WO2001038520A1 - Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001038520A1
WO2001038520A1 PCT/CN2000/000437 CN0000437W WO0138520A1 WO 2001038520 A1 WO2001038520 A1 WO 2001038520A1 CN 0000437 W CN0000437 W CN 0000437W WO 0138520 A1 WO0138520 A1 WO 0138520A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
phospholipid bilayer
exercise
human phospholipid
Prior art date
Application number
PCT/CN2000/000437
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU15083/01A priority Critical patent/AU1508301A/en
Publication of WO2001038520A1 publication Critical patent/WO2001038520A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human phospholipid bilayer exercise-related protein 36, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • the mutations that occur will lead to a loss of phospholipid motility.
  • the phospholipid bilayer movement-related protein promotes phosphatidylserine and other recombinant protein liposomes. As the concentration of Ca2 + in the cytoplasm increases, it promotes the movement of phosphatidylserine from the interior of the plasma membrane to the cell surface. The study of this kind of movement mechanism (Zhao J, et al, J Biol Chera.
  • Bilayer motion caused by phospholipid bilayer motion-related proteins is an important factor that causes plasma coagulation and phage cells to clear injured cells and programmed death cells.
  • Patients with Scott syndrome exhibit a congenital bleeding disorder, that is, their blood cell coagulation activity is defective, and the factor potentially related to the phospholipid bilayer exercise-related protein has turn off.
  • the polypeptide of the present invention was inferred and identified as human phospholipid bilayer exercise-related protein 36 (PS 36). Its homologous protein is mouse phospholipid bilayer exercise-related protein. Its protein number is AF098642. .
  • the human phospholipid bilayer exercise-related protein 36 protein plays an important role in regulating important functions of the body, such as cell division and embryonic pupal development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of Many human phospholipid bilayer movement related protein 36 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human phospholipid bilayer motor-related protein 36 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human phospholipid bilayer exercise-related protein 36.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human phospholipid bilayer exercise-associated protein 36.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide-human phospholipid bilayer motor-related protein 36 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human phospholipid bilayer exercise-related protein 36.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • -(b) a polynucleotide that is identical to the polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 222-12 1 1 in SEQ ID NO: 1; and (b) a sequence of 1 in SEQ ID NO: 1 -32 13-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human phospholipid bilayer motor-related protein 36 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human phospholipid bilayer exercise-associated protein 36 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human phospholipid bilayer exercise-related protein 36.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine with leucine, and non-conservative changes, such as tryptophan Acid replaces glycine.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human phospholipid bilayer exercise-associated protein 36, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human phospholipid bilayer exercise-related protein 36.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human phospholipid bilayer exercise-related protein 36 when combined with human phospholipid bilayer exercise-related protein 36.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human phospholipid bilayer exercise-related protein 36.
  • Regular refers to a change in the function of human phospholipid bilayer movement-related protein 36, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human phospholipid bilayer movement-related protein 36. Or changes in immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human phospholipid bilayer exercise-related proteins 36 using standard protein purification techniques.
  • Basic The pure human phospholipid bilayer movement-related protein 36 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human phospholipid bilayer movement-related protein 36 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a sequence of partially complementary sequences that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Cluster method divides each group of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. J., (1990) Methods in emzumology 183: 625-645),
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human phospholipid bilayer exercise-related protein 36.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human phospholipid bilayer motion-related protein 36 refers to human phospholipid bilayer motion-related protein 36 that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human phospholipid bilayer movement-associated protein 36 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human phospholipid bilayer exercise-related protein 36 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human phospholipid bilayer exercise-related protein 36, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the present invention also includes fragments, derivatives, and analogs of human phospholipid bilayer exercise-related protein 36.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human phospholipid bilayer exercise-associated protein 36 of the present invention: a polypeptide of the present invention
  • the fragment, derivative, or analog may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may be It may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (III) such a type, Wherein the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It packs The total length of the polynucleotide sequence is 3213 bases, and its open reading frame (2222-1211) encodes 329 amino acids. Based on the amino acid sequence homology comparison, it was found that this polypeptide has 47% homology with mouse phospholipid bilayer movement-related protein. It can be concluded that the human phospholipid bilayer movement-related protein 36 is related to mouse phospholipid bilayer movement. Similar structure and function of proteins.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate multicores encoding human phospholipid bilayer exercise-associated protein 36 Glycylic acid.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human phospholipid bilayer exercise-related protein 36 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mMA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human phospholipid bilayer exercise-related protein 36; 4) Detecting the protein product of gene expression through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the human phospholipid bilayer exercise-related protein 36 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention. Especially when it is difficult to obtain the full-length cDNA from the library, you can use the RACE method (RACE-rapid amplification of cDNA ends) for PCR.
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human phospholipid bilayer exercise-associated protein 36 coding sequence, and recombinant technology to produce the present invention. Polypeptide method.
  • a polynucleotide sequence encoding a human phospholipid bilayer exercise-related protein 36 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes and translational regulatory elements
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human phospholipid bilayer exercise-related protein 36 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, and many SV40 enhancers on the late side of the origin of replication. Tumor enhancer and adenovirus enhancer.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human phospholipid bilayer exercise-related protein 36 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • callus cells insect cells
  • insect cells such as fly S2 or S f 9
  • animal cells such as CH0, COS or Bowes s melanoma Cells etc.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human phospholipid bilayer exercise-associated protein 36 (Science, 1 984; 224: 1 4 31). Generally, The following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide can be coated in the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, it can be separated and purified by various separation methods using its physical, chemical and other properties.
  • Recombinant protein These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High performance liquid chromatography (HP
  • Fig. 1 is a comparison diagram of the amino acid sequence homology of the human phospholipid bilayer movement related protein 36 and the mouse phospholipid bilayer movement related protein of the present invention.
  • the upper sequence is human phospholipid bilayer movement-related protein 36
  • the lower sequence is mouse phospholipid bilayer movement-related protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human phospholipid bilayer motion-related protein 36.
  • 36kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Example 1 Cloning of human phospholipid bilayer exercise-related protein 36
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0484 g 04, was a new DM.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results show that the full-length cDNA contained in the 0484g04 clone is 3213bp (as shown in Seq IDN0: 1), and there is an open reading frame (0RF) of 990b P from 222bp to 1211bp, which encodes a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0484g04 and named the encoded protein as human phospholipid bilayer exercise-related protein 36.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human phospholipid bilayer exercise-associated protein 36 of the present invention and the protein sequence encoded by the same were used by the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403- 10].
  • the gene with the highest homology to the human phospholipid bilayer movement-related protein 36 of the present invention is a known mouse phospholipid bilayer movement-related protein, and its encoded protein is accession number AF098642 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 47% identity; 61% similarity.
  • Example 3 Cloning of a gene encoding human phospholipid bilayer exercise-related protein 36 by RT-PCR
  • DNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 5,-GGGGGAAGGAGGGTCCAGGCGTGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- GAGAATTTGTTTTTTAATCAATCC -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (C 1 om ech).
  • the reaction was performed for 25 cycles on a PE 9600 DNA thermal cycler (Perkin-E 1 mer) under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate (P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) _5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human phospholipid bilayer exercise-related protein 36
  • Primer 3 5'- CATGCTAGCATGTCAGGTGTGGTACCCACAGCCC _3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTATCTTGAACGTTGTGGTGGAGATC -3' (Seq ID No: 6)
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-2Sb (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0484 g 04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0484g04 plasmid, primers Primer-3 and Primer- 4 points; j is lOpmol, Advantage polymerase Mix
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 rain, a total of 25 cycles. Nhe I and BamH I were used to double-digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered, and T4 was used. Ligase ligation. The ligated product was transformed with colibacillus DH5C by the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human phospholipid bilayer exercise-related protein 36 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Immunize the patient with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin polypeptide complex and incomplete Freund's adjuvant to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive vaccination serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human phospholipid bilayer exercise-related protein 36.
  • the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the probes from the hybridization are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention Polynucleotide SEQ ID NO: 1 Identical or complementary oligonucleotide fragments.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. Selection of probes Industrial applicability
  • polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases.
  • they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the polypeptide of the present invention (human phospholipid bilayer movement-associated protein 36) is an important factor that causes cell membrane movement.
  • the polypeptide of the present invention contains 12 residues related to the binding of calcium ions in the cytoplasm to form an EF-hand-loop structure As the [Ca2 +] level in the cytoplasm increases, the bilayer movement is accelerated.
  • the polypeptide of the present invention can be used for the study of blood cell coagulation activity, and the movement of the phospholipid bilayer of the plasma membrane determines the coagulation of blood cells.
  • the polypeptide of the present invention can be used for research and treatment of Scott syndrome.
  • the disease is a rare hereditary coagulation disorder.
  • the interaction between calcium ions on the surface of red blood cell membranes and phospholipid bilayer exercise-related proteins has changed. Patients' platelets and other blood cells cannot coagulate normally. Post-translation exception handling.
  • the polypeptide of the present invention can be used for the treatment of thrombus, disseminated intravascular coagulation (DIC), and traveling thrombotic vasculitis (Trausseau syndrome) due to increased blood coagulation. Utilizing the polypeptide of the present invention can treat some diseases caused by cell and tissue damage.
  • Cell edema (2) Intracellular material deposition and other pathologically induced steatosis, arteriosclerosis, acute rheumatism, nodular periarteritis, mesenchymal tumors; (3) pathological pigmentation, pathological calcification.
  • the polypeptides of the invention are also involved in regulating the secretion of the prostate. It can be used as an adjuvant treatment for anterior 1 J gland diseases such as hyperplasia of prostate and carcinoma of prostate.
  • the polypeptide of the present invention is also closely related to the removal of injured cells and programmed death cells by phage cells, and accelerates the elimination process through the reticuloendothelial tissue system.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human phospholipid bilayer exercise-associated protein 36.
  • Agonists enhance human phospholipid bilayer exercise-related proteins 36 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human phospholipid bilayer movement-associated protein 36 and a labeled human phospholipid bilayer movement-associated protein 36 can be cultured in the presence of a drug, and then the drug can be measured to increase or block this Ability to function.
  • Antagonists of human phospholipid bilayer motion-related protein 36 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human phospholipid bilayer movement-related protein 36 can bind to human phospholipid bilayer movement-related protein 36 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human phospholipid bilayer movement-related protein 36 can be added to the bioanalytical assay by measuring the effect of the compound on the interaction between human phospholipid bilayer movement-related protein 36 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to human phospholipid bilayer exercise-related protein 36 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 36 molecules of human phospholipid bilayer movement-associated protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human phospholipid bilayer exercise-related protein 36 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human phospholipid bilayer exercise-related protein 36 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human phospholipid bilayer exercise-related protein 36 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, and human B-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Human constant region and non W human-derived variable region-bound chimeric antibodies can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human phospholipid bilayer exercise-related protein 36.
  • Antibodies against human phospholipid bilayer movement-related protein 36 can be used in immunohistochemistry to detect human phospholipid bilayer movement-related protein 36 in biopsy specimens.
  • Monoclonal antibodies that bind to human phospholipid bilayer exercise-related protein 36 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human phospholipid bilayer exercise-related protein 36 For example, human phospholipid bilayer exercise-related protein 36.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human phospholipid bilayer exercise-related protein 36 Positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human phospholipid bilayer exercise-related protein 36.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human phospholipid bilayer exercise-related protein 36.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human phospholipid bilayer exercise-related protein 36.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human phospholipid bilayer movement-related protein 36 detected in the test can be used to explain the importance of human phospholipid bilayer movement-related protein 36 in various diseases and to diagnose human phospholipid bilayer movement-related protein 36 A working disease.
  • polypeptide of the invention can also be used for peptide mapping analysis.
  • the peptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding human phospholipid bilayer exercise-related protein 36 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human phospholipid bilayer exercise-related protein 36.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human phospholipid bilayer movement-associated protein 36 to inhibit endogenous human phospholipid bilayer movement-associated protein 36 activity.
  • a mutated human phospholipid bilayer motion-associated protein 30 may be a shortened human phospholipid bilayer motion-associated protein 36 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signal transduction. active.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human phospholipid bilayer exercise-associated protein 36: virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex Rash virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human phospholipid bilayer movement-related protein 36 into cells.
  • virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex Rash virus, parvovirus, etc.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human phospholipid bilayer exercise-related protein 36 can be found in the existing literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding human phospholipid bilayer exercise-related protein 36 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit 36 mRM of human phospholipid bilayer movement-related proteins are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis for oligonucleotide synthesis.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human phospholipid bilayer exercise-related protein 36 can be used for the diagnosis of diseases related to human phospholipid bilayer exercise-related protein 36.
  • the polynucleotide encoding human phospholipid bilayer movement-related protein 36 can be used to detect the expression of human phospholipid bilayer movement-related protein 36 or the abnormal expression of human phospholipid bilayer movement-related protein 36 in a disease state.
  • a DNA sequence encoding human phospholipid bilayer motility-related protein 36 can be used to hybridize biopsy specimens to determine the expression status of human phospholipid bilayer motility-related protein 36.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
  • RNA-polymerase chain reaction RT-PCR
  • Human phospholipid bilayer movement-associated protein 36 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human phospholipid bilayer movement-associated protein 36 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor t hern blotting and Wes tern blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35b P ) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human phospholipid bilayer exercise-related protein 36 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human phospholipid bilayer exercise-related protein 36 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 36 liée au mouvement de la bicouche de phospholipide, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine humaine 36 liée au mouvement de la bicouche de phospholipide.
PCT/CN2000/000437 1999-11-24 2000-11-20 Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide WO2001038520A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15083/01A AU1508301A (en) 1999-11-24 2000-11-20 A novel polypeptide, a human phospholipid bilayer movement-relative protein 36 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99124092 CN1297900A (zh) 1999-11-24 1999-11-24 一种新的多肽——人磷脂双分子层运动相关蛋白36和编码这种多肽的多核苷酸
CN99124092.8 1999-11-24

Publications (1)

Publication Number Publication Date
WO2001038520A1 true WO2001038520A1 (fr) 2001-05-31

Family

ID=5283185

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000437 WO2001038520A1 (fr) 1999-11-24 2000-11-20 Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297900A (fr)
AU (1) AU1508301A (fr)
WO (1) WO2001038520A1 (fr)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BIOCHEM. BIOPHYS. RES. COMMUN., vol. 249, no. 2, August 1998 (1998-08-01), pages 449 - 455 *
BIOCHEMISTRY, vol. 37, no. 8, 24 February 1998 (1998-02-24), pages 2356 - 2360 *
DATABASE DDBJ [online] 2 September 1998 (1998-09-02), Database accession no. AB006746 *
DATABASE DDBJ [online] 6 December 1997 (1997-12-06), Database accession no. D78354 *
DATABASE DDBJ [online] 6 December 1997 (1997-12-06), Database accession no. D78355 *
J. BIOL. CHEM., vol. 272, no. 29, 18 July 1997 (1997-07-18), pages 18240 - 18244 *

Also Published As

Publication number Publication date
CN1297900A (zh) 2001-06-06
AU1508301A (en) 2001-06-04

Similar Documents

Publication Publication Date Title
WO2001038523A1 (fr) Nouveau polypeptide, gene humain 14 lie a la surdite, et polynucleotide codant pour ce polypeptide
WO2001038377A1 (fr) Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001038520A1 (fr) Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001064720A1 (fr) Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001070964A1 (fr) Nouveau polypeptide, proteine humaine de transport de glucose 18, et polynucleotide codant pour ce polypeptide
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001064727A1 (fr) Nouveau polypeptide, adenosinate cyclase soluble 25 de souris, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001038386A1 (fr) Nouveau polypeptide, facteur humain d'epissage sr 52, et polynucleotide codant pour ce polypeptide
WO2002036619A1 (fr) Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide
WO2001038381A1 (fr) Nouveau polypeptide phosphodiesterase 17 humaine inhibee par gmpc et polynucleotide le codant
WO2001038363A1 (fr) Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001046236A1 (fr) Nouveau polypeptide, protamine 45 humaine, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642