WO2001038389A1 - Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine - Google Patents

Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine Download PDF

Info

Publication number
WO2001038389A1
WO2001038389A1 PCT/CN2000/000471 CN0000471W WO0138389A1 WO 2001038389 A1 WO2001038389 A1 WO 2001038389A1 CN 0000471 W CN0000471 W CN 0000471W WO 0138389 A1 WO0138389 A1 WO 0138389A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
ribosomal protein
human ribosomal
sequence
Prior art date
Application number
PCT/CN2000/000471
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU15115/01A priority Critical patent/AU1511501A/en
Publication of WO2001038389A1 publication Critical patent/WO2001038389A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human ribosomal protein L14.22, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Ribosomes are organelles that synthesize proteins. The main components are proteins and ribosomal ribosomal proteins. They are very conservative and play an important role in the translation of ribosomes. For example: They play an important role in folding rRNA into a functional three-dimensional structure. In the ribosome's spatial conformation, a series of changes occur, and some ribosomal proteins may "fine-tune" the conformation of the ribosome. At the binding site of the ribosome, it may even play a catalytic role. Work together. Other studies have also found that certain ribosomal proteins are also regulators of cell proliferation and apoptosis. [Fannie W. Chen et a 1, International Reviews of Immunology 1998]
  • the L14 protein is one of the most conserved ribosomal proteins and plays an important role in the ribosome nucleic acid-protein complex. Studies have shown that in the large ribosomal subunit, the L14 protein occupies the central position of peptidyltransferase and GTPase.
  • the L14 protein contains a barrel structure consisting of five strands, and the C-terminal ring structure includes two small spiral structures, as well as a band structure protruding from the barrel structure.
  • RNA binds to both parts of L14.
  • An RNA-binding site recognizes the distal end of ribosomal RNA when the ribosomal particles are assembled. The second RNA-binding site is occupied during subsequent RNA compaction.
  • the hydrophobic portion of the L14 surface may be a site for protein-protein interactions, such as with the L19 protein. [Christopher Davis et al, Structure Vol 4, No. 1, 15 Jan 1996]
  • ribosomal proteins Deletion or inappropriate chemical modification of ribosomal proteins, or mutations in ribosomal protein genes, will affect the function of ribosomes and reduce the activity of peptide synthesis, leading to various serious consequences, such as the inability to maintain cell membrane structures and cells.
  • the present invention and the L14 protein found in Drosophila have a protein level of 27 »/. Therefore, it is considered that the gene of the present invention is a gene encoding a protein similar to L14 protein and has similar biological functions.
  • the present invention is named human ribosomal protein L23.
  • the human ribosomal protein L14.22 protein regulates cell division and embryonic development. It plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so the art has always needed to identify more human ribosomal protein L 14.22 proteins involved in these processes, especially the amino acids of this protein. sequence.
  • the isolation of the new human ribosomal protein L 14.22 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ribosomal protein L14.22.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human ribosomal protein L14.22.
  • Another object of the present invention is to provide a method for producing human ribosomal protein L 14.22.
  • Another object of the present invention is to provide an antibody against the polypeptide-human ribosomal protein L 14.22 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human ribosomal protein L 14.22.
  • Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human ribosomal protein L14.22.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 413-1024 in SEQ ID NO: 1; and (b) a sequence having 1-2002 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ribosomal protein L 14.22 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human ribosomal protein L14. 22 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal protein L 14.22.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ribosomal protein L14.22, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribosomal protein L14.22.
  • Antagonist refers to a molecule that, when combined with human ribosomal protein L14.22, can block or regulate the biological or immunological activity of human ribosomal protein L14.22.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human ribosomal protein L14.22.
  • Regular refers to a change in the function of human ribosomal protein L14.22, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human ribosomal protein L14.22 change.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ribosomal protein L14.22 using standard protein purification techniques. Pure human ribosomal protein L14.22 can generate a single main band on non-reducing polyacrylamide gel. The purity of human ribosomal protein L14.22 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the C lus ter method works by checking the The distance arranges each group of sequences into clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jo tun He in Percentage of identity (He in J., (1990) Me thod s in emzumo l ogy 183: 625-645),
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human ribosomal protein L 14.22.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector. It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides coexist in a natural state Separated in other materials, it is isolated and purified.
  • isolated human ribosomal protein L14. 22 means human ribosomal protein L14. 22 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ribosomal protein L 14.22 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human ribosomal protein L14. 22 The purity of the peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human ribosomal protein L14. 22, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human ribosomal protein L14.22.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ribosomal protein L14.22 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2002 bases, and its open reading frame (41 3-1024) encodes 203 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 27% homology with the L 14 protein, and it can be deduced that the human ribosomal protein L14. 22 has a similar structure and function to the L 14 protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide ⁇ 'J: the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) ) And non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human ribosomal protein L14.22.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ribosomal protein L14. 22 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • cDNA libraries are also a common method (Sambrook, et al .. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of the human ribosomal protein L14.22 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any one of the polynucleotides of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human ribosomal protein L14.22 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human ribosomal protein L14.22 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
  • a polynucleotide sequence encoding human ribosomal protein L14.22 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal protein L14.22 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. Ew York, 1 89) c DNA sequences can be efficiently linked to An appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers and adenovirus enhancers on the late stage of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reduction for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reduction for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ribosomal protein L14.22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ribosomal protein L14.22 (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of human ribosomal protein L14.22 and L14 protein of the present invention.
  • the upper sequence is the human ribosomal protein L14.22, and the lower sequence is the L14 protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human ribosomal protein L14.22. 22kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method.
  • the sequence of the human ribosomal protein L14.22 of the present invention and the protein sequence encoded by the same were applied using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403- 10], perform a homology search in databases such as Genbank, Swissport, and the gene with the highest homology to the human ribosomal protein L14.22 of the present invention is a known L14 protein whose accession number encoded in Genbank is Y10018. The protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 27% and a similarity of 52%.
  • Example 3 Cloning of a gene encoding human ribosomal protein L14.22 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification: Primer 1: 5,-GACGGTTAACTTTGACCCAAAGAC -3, (SEQ ID NO: 3) Primer2: 5'- GCTTTCAAGCAGTCTTTACTTGGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1.10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmoi primer in a reaction volume of 50 ⁇ 1, 1U of Taq DNA polymerase (C 1 on te ch).
  • the reaction was performed for 25 cycles on a PE 9600 DNA thermal cycler (Perkin-Elmer) under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Ir itrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2002bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human ribosomal protein L14.22 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pM.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.23 ⁇ 4 agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2 ⁇ 2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation cc- 32 P dATP with 32 P- DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human ribosomal protein L14.22 coding region sequence (413bp to 1024bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide_25mM KH 2 P0 4 (pH 7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, filter was placed in 1> ⁇ SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human ribosomal protein L14.22
  • Primer3 5'- CCCCATATGATGTACCTGTTTCCCAGGCAACTAC -3 '(Seq ID No: 5)
  • Primer4 5,-CATGGATCCTCAGCGCCTTGTCCCAAGGTAGTTG-3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen Company product, Cat. No. 69865.3).
  • PCR was performed using the pBS-0507E08 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of P BS-0507E08 plasmid, primers Primer-3 and Primer- 4 points, and 'J is lOpmol Advantage polymerase Mix
  • Cycle parameters 94 C 20s, 60 ° C 30s, 68 ° C 2 min, total cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into Ca. bacillus DH5cc by the calcium chloride method.
  • peptides specific to human ribosomal protein L14.22 were synthesized using a peptide synthesizer (product of PE company): NH 2 -Met-Tyr-Leu-Phe-Pro-Arg-Gln-Leu-Leu-Ile-Arg-His -Phe-Trp-Thr-COOH (SEQ ID NO: 7)
  • the peptide was coupled with hemocyanin and bovine serum albumin to form a complex.
  • the method see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Immunologists were treated with 4 mg of the hemocyanin peptide complex and complete Freund's adjuvant. In rabbits, 15 days later, the immune system was boosted with hemocyanin peptide complex and incomplete Freund's adjuvant. The titer plate coated with 15 g / ml bovine serum albumin peptide complex was used for ELISA to determine the antibody drip in rabbit serum Isolate total IgG from antibody-positive rabbit sera with protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and the anti-peptide antibody was isolated from the total IgG by affinity chromatography. Proved by immunoprecipitation The purified antibody specifically binds to human ribosomal protein L14.22.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Ribosome proteins play an important role in the process of ribosomal translation. Deletion or inappropriate chemical modification of ribosomal proteins, or mutations in ribosomal protein genes, will affect the function of ribosomes and reduce the activity of peptide synthesis. It leads to various serious consequences, such as unsustainable cell membrane structure, abnormal cell metabolism, cell growth arrest, and even death, etc., which causes various diseases, such as developmental disorders, metabolic diseases, immune diseases, cell death, and so on.
  • the polypeptide or fragment thereof of the present invention can be used to treat or prevent diseases caused by developmental disorders, including but not limited to: spina bifida, anencephaly, congenital hydrocephalus, aqueduct malformation , Cartilage hypoplasia dwarfism, pseudochondral hypoplasia, gonad hypoplasia, etc .;
  • polypeptide or fragment thereof of the present invention can also be used to treat or prevent diseases caused by metabolic disorders, including but not limited to: phenylketonuria, albinism, trimethylamineuria, hypersarcosinemia, etc .;
  • polypeptides or fragments thereof of the present invention can also be used to treat or prevent various immunodeficiency diseases, including but not limited to: HIV, rheumatoid arthritis, chronic active hepatitis, systemic lupus erythematosus, scleroderma, immune platelets Reduced purpura, autoimmune interstitial nephritis, autoimmune heart disease, etc.
  • immunodeficiency diseases including but not limited to: HIV, rheumatoid arthritis, chronic active hepatitis, systemic lupus erythematosus, scleroderma, immune platelets Reduced purpura, autoimmune interstitial nephritis, autoimmune heart disease, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal protein L14.22.
  • Agonists enhance human ribosomal protein L14. 22 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ribosomal protein L14. 22 can be cultured with labeled human ribosomal protein L 14.22 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of human ribosomal protein L 14.22 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribosomal protein L 14.22 can bind to human ribosomal protein L 14.22 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • human ribosomal protein L 14.22 When screening compounds as antagonists, human ribosomal protein L 14.22 can be added to bioanalytical assays, and compounds can be identified by measuring the effect of the compound on the interaction between human ribosomal protein L 14.22 and its receptor Whether it is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human ribosomal protein L 14.22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to the solid phase. When screening, human ribosomal protein L 14. 22 molecules were labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human ribosomal protein L 14.22 epitope. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ribosomal protein L14.22 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to human ribosomal protein L14.22 include, but are not limited to, hybridoma technology (Kohier and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human ribosomal protein L14.22.
  • Antibodies against human ribosomal protein L14.22 can be used in immunohistochemistry to detect human ribosomal protein L14.22 in biopsy specimens.
  • Monoclonal antibodies that bind to human ribosomal protein L14.22 can also be labeled with radioisotopes, and their location and distribution can be tracked in vivo. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ribosomal protein L14.22 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ribosomal protein L14.22 positive cell.
  • the antibody of the present invention can be used to treat or prevent diseases related to human ribosomal protein L14.22 .: Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ribosomal protein L14.22.
  • the invention also relates to diagnostic test methods for the quantitative and localized detection of human ribosomal protein L14.22 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human ribosomal protein L14.22 detected in the test can be used to explain the importance of human ribosomal protein L14.22 in various diseases and to diagnose diseases in which human ribosomal protein L14.22 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human ribosomal protein L14.22 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal protein L14.22.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ribosomal protein L14.22 to inhibit endogenous human ribosomal protein L14.22 activity.
  • a variant human ribosomal protein L 14.22 may be a shortened human ribosomal protein L14.22, which lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ribosomal protein L 14.22.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ribosomal protein L14.22 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ribosomal protein L14. 22 can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human ribosomal protein L 14.22 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ribosomal protein L14.22 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ribosomal protein L14.22 can be used for the diagnosis of diseases related to human ribosomal protein L14.22.
  • the polynucleotide encoding human ribosomal protein L14. 22 can be used to detect the expression of human ribosomal protein L14. 22 or the abnormal expression of human ribosomal protein L 14.22 in a disease state.
  • the DNA sequence encoding human ribosomal protein L14. 22 can be used to hybridize biopsy specimens to determine the expression of human ribosomal protein L14. 22.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mi cr oa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues Genetic diagnosis.
  • Human ribosomal protein L 14.22 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human ribosomal protein L 14.22 transcripts.
  • Detection of mutations in the human ribosomal protein L14. 22 gene can also be used to diagnose human ribosomal protein L 14.22-related diseases.
  • Human ribosomal protein L 14.22 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosomal protein L14.22 DNA sequence. Available already Some techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization detect mutations. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ribosomal protein L 14.22 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ribosomal protein L14.22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Pro Leu lie Ser Asp Ala Gly Leu Arg Trp Arg Leu Thr As Leu
  • Leu Gly lie Gly Gin Leu Thr Ala Gin Glu Val Lys Ser Ala Cys Tyr Leu Arg Gly Leu Asn Ser Thr His lie Gly Glu Asp Arg Cys Arg Thr Trp Leu Gly Glu Trp Leu Gin lie Ser Cys Ser Leu Glu Ala Glu Leu Ser Leu Leu Leu His Asn Val Val Leu Leu Thr Asn Tyr Leu Gly Thr Arg Arg

Abstract

Cette invention se rapporte à une nouvelle protéine ribosomique humaine L14.22 à base d'un polypeptide, au polynucléotide codant cette protéine et à un procédé de production de ce polypeptide par technique de recombinaison d'ADN. Cette invention concerne également un procédé d'utilisation de ce polypeptide pour traiter diverses affections, telles que les néoplasmes malins, les hémopathies, les infections à VIH et les maladies immunologiques et diverses inflammations, notamment. Cette invention se rapporte également à un agoniste de ce polypeptide et à son usage thérapeutique, ainsi qu'à l'utilisation du polynucléotide codant cette nouvelle protéine ribosomique humaine L14.22.
PCT/CN2000/000471 1999-11-24 2000-11-20 Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine WO2001038389A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15115/01A AU1511501A (en) 1999-11-24 2000-11-20 A new polypeptide-ribosomal protein l14.22 and the polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99124098A CN1297905A (zh) 1999-11-24 1999-11-24 一种新的多肽——人核糖体蛋白l14.22和编码这种多肽的多核苷酸
CN99124098.7 1999-11-24

Publications (1)

Publication Number Publication Date
WO2001038389A1 true WO2001038389A1 (fr) 2001-05-31

Family

ID=5283191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000471 WO2001038389A1 (fr) 1999-11-24 2000-11-20 Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine

Country Status (3)

Country Link
CN (1) CN1297905A (fr)
AU (1) AU1511501A (fr)
WO (1) WO2001038389A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6797471B2 (en) * 2000-08-04 2004-09-28 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANSARI-LARI M.A. ET AL.: "A gene-rich cluster between the CD4 and triosephosphate isomerase genes at human chromosome 12p13", GENOME RES., vol. 6, no. 4, 1996, pages 314 - 326 *
TRIPODIS N. ET AL.: "Physical map of human 6p21.2-6p21.3: region flanking the centromeric end of the major histocompatibility complex", GENOME RES., vol. 8, no. 6, 1998, pages 631 - 643 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6797471B2 (en) * 2000-08-04 2004-09-28 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers
US7741034B2 (en) 2000-08-04 2010-06-22 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers
US8093001B2 (en) 2000-08-04 2012-01-10 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers

Also Published As

Publication number Publication date
CN1297905A (zh) 2001-06-06
AU1511501A (en) 2001-06-04

Similar Documents

Publication Publication Date Title
WO2001038377A1 (fr) Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001032862A1 (fr) Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide
WO2001046409A1 (fr) Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide
WO2001079280A1 (fr) Nouveau polypeptide, proteine humaine 16 associee au represseur catabolique du carbone, et polynucleotide codant pour ce polypeptide
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide
WO2001038376A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 46, et polynucleotide codant pour ce polypeptide
WO2001030819A1 (fr) Nouveau polypeptide, tropomoduline humaine 39, et polynucleotide codant pour ce polypeptide
WO2001030834A1 (fr) Nouveau polypeptide, proteine 33 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030833A1 (fr) Nouveau polypeptide, proteine de regulation d'un nouveau cycle cellulaire 53, et polynucleotide codant pour ce polypeptide
WO2002036619A1 (fr) Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide
WO2001029229A1 (fr) Nouveau polypeptide, proteine humaine 20 de liaison de retinoblastome et polynucleotide le codant
WO2001031032A1 (fr) Nouveau polypeptide, sous-unite 42 d'ht atpase c humaine vacuolaire, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase