WO2001038371A1 - Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001038371A1
WO2001038371A1 PCT/CN2000/000475 CN0000475W WO0138371A1 WO 2001038371 A1 WO2001038371 A1 WO 2001038371A1 CN 0000475 W CN0000475 W CN 0000475W WO 0138371 A1 WO0138371 A1 WO 0138371A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
trna synthetase
sequence
human
Prior art date
Application number
PCT/CN2000/000475
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU15118/01A priority Critical patent/AU1511801A/en
Publication of WO2001038371A1 publication Critical patent/WO2001038371A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y601/00—Ligases forming carbon-oxygen bonds (6.1)
    • C12Y601/01—Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
    • C12Y601/01017—Glutamate-tRNA ligase (6.1.1.17)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human glutamyl tRNA synthetase 58 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the protein information carried by DNA generates mRNA through transcription to complete only part of gene expression.
  • a more complicated part is the translation process, that is, the process of converting nucleic acid language into protein language.
  • the main roles in this process are various aminoacyl-tRNA synthetases, various tRNAs and ribosomes. Due to their combined effect, amino acids can be linked to each other according to the information provided by mRNA to form a polypeptide chain.
  • Aminoacyl tRNA synthetase has three substrates namely amino acid, tRNA, and ATP.
  • aaRS catalyzes the esterification of amino acids to the 3 'end of tRNA.
  • Each aaRS corresponds to one amino acid and several isotropic tRNAs.
  • ATP provides the energy required to activate amino acids.
  • the amino acids are first activated to aminoacyladenylic acid, and then tRNA is used to generate aminoacyl tRNA.
  • the interaction between aaRS and substrate involves issues of identification and binding.
  • aaRS can be divided into two types with ten members each, and glutamyl tRNA synthetase belongs to aaRS type 1 (Eriani et al., 1990).
  • aaRS type 1 usually has the following domains (Cavarelli J et al., 1998):
  • Amino acid recognition region There are only two highly conserved amino acid residues in the aaRS type 1 amino acid binding gap, one is a tyrosine residue at 347 site, and the other is an aspartic acid residue at 191 site.
  • ArgRS Tyr347 is involved in recognizing the ⁇ -nitrogen atom of the amino acid substrate.
  • tyrosine residues perform other functions.
  • Aspl91 is at the C-terminus of the fifth P-fold of the chain. It does not involve substrate binding but has a structural role. It stabilizes the interaction of the fifth P-fold of the chain with the sixth ⁇ -fold of the chain and the surrounding secondary structure.
  • ATP binding site Two specific peptide domains, HIGH and KMSKS, are linked to the ATP binding site.
  • the invariant Gly on HIGH forms a platform at the N-terminus of the sixth alpha helix of the chain in order to bind ATP, two Hiss and Lys are involved in the stabilization of the formation of aminoacylated transition state products.
  • tRNA anchoring platform members of aaRS type 1 have a 13th ⁇ -strand and 14th ⁇ -strand domain, which is located after Rossmann folding. This domain involves tRNA anchoring to glutamyl tRNA synthesis. Enzyme platform.
  • ArgRS N-terminus RNA binding domain Add-1 domain of glutamyl tRNA synthetase and tRNA recognition, and tRNA! ⁇ ⁇ The interaction is the closest. The naked beta-sheet of the Add-1 domain plays an important role in many nucleic acid binding proteins.
  • Anti-codon binding site The anti-codon binding site of glutamyl tRNA synthetase is located on the left-hand side of the C 'end, and the naked P-fold of the Add-1 domain also recognizes the anti-codon arm.
  • aaRS Arg, Asp, Gin, Glu, He, Leu, Lys, Met, and Pro
  • the glutamyl tRNA synthetase catalyzes the glutamic acid isoform tRNA to carry glutamic acid, and completes the initiation, extension and termination of the peptide chain with the participation of ribosomes and related factors.
  • the discovery of the polynucleotide encoding human glutamyl tRNA synthetase, and the human glutamyl tRNA synthetase it encodes provides a way to study the physiological and biochemical processes of cell differentiation and proliferation under normal and pathological conditions
  • the method also provides a new approach for the diagnosis, treatment and disorders of cell differentiation and proliferation, including cancer.
  • the polypeptide of the present invention was inferred and identified as human glutamyl tRNA synthetase 58 (HGluRS58) or human glutamyl tRNA aminotransferase 58 (HGluAT58), and its homologous protein is a type of typhoid pathogen Glutamyl tRNA aminotransferase, protein number is AJ235270.
  • the human glutamyl tRNA synthetase 58 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participants
  • These processes of the human glutamyl tRNA synthetase 58 protein in particular, identify the amino acid sequence of this protein.
  • Isolation of the new human glutamyl tRNA synthetase 58 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human glutamyl tRNA synthetase 58.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human glutamyl tRNA synthetase 58.
  • Another object of the present invention is to provide a method for producing human glutamyl tRNA synthetase 58.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human glutamyl tRNA synthetase 5 8.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human glutamyl tRNA synthetase 5 8.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human glutamyl t RNA synthetase 58.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 100-1686 in SEQ ID NO: 1; and (b) a sequence having positions 1-2 in SEQ ID NO: 1 030-bit sequence.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human glutamyl tRNA synthetase 58 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human glutamyl tRNA synthetase 5 8 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the present invention also relates to a pharmaceutical composition, which comprises a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of polypeptides and / or polynucleotides of the present invention for the treatment of cancer, developmental or immune diseases or other diseases caused by abnormal expression of human glutamyl tRNA synthetase 58. Use of medicine.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human glutamyl tRNA synthetase 58, causes a change in the protein to regulate the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human glutamyl tRNA synthetase 58.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human glutamyl tRNA synthetase 58 when combined with human glutamyl tRM synthetase 58.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human glutamyl tRNA synthetase 58.
  • Regular refers to a change in the function of human glutamyl tRNA synthetase 58 including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human glutamyl tRNA synthetase 58 Qualitative, functional or immune properties.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human glutamyl tRNA synthetase 58 using standard protein purification techniques. Basically pure human glutamyl tRNA synthetase 58 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human glutamyl tRNA synthetase 58 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine Acid and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? , It can specifically bind to the epitope of human glutamyl tRNA synthetase 58.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human glutamyl tRNA synthetase 58 means that human glutamyl tRNA synthetase 58 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human glutamyl tRNA synthetase 58 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human glutamyl tRNA synthetase 58 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human glutamyl tRNA synthetase 58, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, miracidia, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human glutamyl t A synthetase 58. As used in the present invention, the terms "fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the human glutamyl tRNA synthetase 58 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2030 bases, and its open reading frame (100-1686) encodes 528 amino acids.
  • this polypeptide has 41% homology with a glutamyl tRNA aminotransferase of a typhoid pathogen, and it can be inferred that the human glutamyl tRNA synthetase 58 has the valley Similar structure and function of aminoacyl tRNA aminotransferase.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature. Polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); and Non-coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization Use a denaturing agent, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / ° Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Hybridization occurs at 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human glutamyl tRNA synthetase 58.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human glutamyl tRNA synthetase 58 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determining the level of the transcript of human glutamyl tRNA synthetase 58; (4) Through immunological techniques or assay biology Activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human glutamyl tRNA synthetase 58 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using human glutamyl tRNA synthetase 58 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding human glutamyl tRNA synthetase 58 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct synthetic beer containing human glutamyl tRNA encoding 58 DNA sequences and expression vectors with appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, leg synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecul ar Clinging, a Labora tory Manua l, Col Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human glutamyl tRNA synthetase 58 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human glutamyl tRNA synthetase 58 (Sc ience, 1984; 224: 1431). Generally, the following steps are taken: (1) using the polynucleotide (or variant) encoding human human glutamyl tR synthetase 58 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Figure 1 is a comparison diagram of the amino acid sequence homology of the glutamyl tRNA synthetase 58 of the present invention and a glutamyl tRNA aminotransferase of a typhoid pathogen.
  • the upper sequence is human glutamyl tRNA synthetase 58 and the lower sequence is a glutamyl tRNA aminotransferase that is a typhoid pathogen.
  • Identical amino acids are represented by single character amino acids between the two sequences, and similar amino acids are represented by "+".
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human glutamyl tRNA synthetase 58.
  • 58kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Qui k mRNA I so lat ion K it (Qiegene) Isolate poly (A) mRNA from total RNA.
  • 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with an existing public MA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1027C08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the sequence of the human glutamyl tRNA synthetase 58 of the present invention and the protein sequence encoded by the same were performed using the Mas t program (Basicloca l Al ignment search tool) [Al tschul, SF et a l. J. Mol. Biol. 1990 215: 403-10], perform homology search in databases such as Genbank and Swiss sport.
  • the gene most homologous to the human glutamyl tRNA synthetase 58 of the present invention is a known glutamyl tRM aminotransferase, a type of typhoid pathogen, and the protein encoded by the accession number in Genbank is AJ235270.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 41% identity; 61% similarity.
  • Example 3 Cloning of a gene encoding human glutamyl tRNA synthetase 58 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5, — GAATTAAAGATGGCTGCGCGCATG —3, (SEQ ID NO: 3)
  • Pr imer2 5,-TCATTTTATTTTATTTTATTATTTATTT -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer 2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmo i / L KC1, 10 ⁇ l Tris s-Cl, (pH 8. 5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L in a reaction volume of 50 ⁇ 1 dNTP, Opmo primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results indicate PCR The DNA sequence of the product is exactly the same as 1-2030bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human glutamyl tRNA synthetase 58 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25 mM KH 2 P0 4 (pH 7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC_0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human glutamyl tRNA synthetase 58
  • Primer3 5'- CCCCATATGATGCTGGGCCGGAGCCTCCGAGAAG -3, (Seq ID No: 5)
  • Primer4 5,-CATGGATCCTTACTGTTTTAGAGACACAGGGG -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS-1027C08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1027C08 plasmid, primers Primaer-3 and Primer-4, and 1 J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-1027C08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21 (pET-1027C08) was at 37.
  • peptides specific for human glutamyl tRNA synthetase 58 were synthesized using a peptide synthesizer (product of PE): NH 2 -Met-Leu-G 1 y-Arg-Ser-Leu-Arg-G lu-Va 1- Ser-A 1 aA la-Leu-Lys-G ln-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avramea s, eta l. Immunochemi st ry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant. After 15 days, the rabbit was immunized with hemocyanin polypeptide complex and incomplete Freund's adjuvant once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used as the ELI SA to determine the antibody titer in rabbit serum. Total I gG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0 S e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human glutamyl tRNA synthetase 58.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the polypeptide (human glutamyl tRNA synthetase 58) of the present invention is indispensable in the process of protein synthesis, and its existence is of great significance for protein translation.
  • the abnormal expression of the human glutamyl tRNA synthetase 58 of the present invention will cause a disorder of protein biosynthesis, and thus various diseases. These diseases include, but are not limited to:
  • Metabolic and nutritional diseases such as atrophy, hyperlipidemia and hyperlipoproteinemia, obesity, nutritional deficiencies;
  • Inflammation such as allergic reactions, adult respiratory distress syndrome, pulmonary eosinophilia, rheumatoid arthritis, rheumatoid arthritis, cholecystitis, glomerulonephritis, dermatomyositis, polymyositis, Addison's disease
  • tumors such as basal epithelial tumors, squamous epithelial tumors, myxoid tumors, fibromas, lipomas, chondroma, hemangiomas, lymphomas, hematopoietic tumors, neuromas, adenomas;
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human glutamyl tRNA synthetase 58.
  • Agonists enhance human glutamyl tRNA synthetase 58 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human glutamyl tRNA synthetase 58 can be cultured with labeled human glutamyl tRNA synthetase 58 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human glutamyl tRNA synthetase 58 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human glutamyl tRNA synthetase 58 can bind to human glutamyl tRNA synthetase 58 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot function biological functions.
  • human glutamyl tRNA synthetase 58 When screening compounds as antagonists, human glutamyl tRNA synthetase 58 can be added to bioanalytical assays, and compounds can be identified by measuring the effect of the compound on the interaction between human glutamyl tRNA synthetase 58 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human glutamyl tRNA synthetase 58 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human glutamyl tRNA synthetase 58 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human glutamyl tRNA synthetase 58 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human glutamyl tRNA synthetase 58 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human glutamyl tRNA synthetase 58 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat. No. 4946778) can also be used to produce single chain antibodies against human glutamyl tRNA synthetase 58.
  • Antibodies against human glutamyl tRNA synthetase 58 can be used in immunohistochemistry to detect human glutamyl tRNA synthetase 58 in biopsy specimens.
  • Monoclonal antibodies that bind to human glutamyl tRNA synthetase 58 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human glutamyl tRNA synthetase 58 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through disulfide exchange.
  • This hybrid antibody can be used to kill human glutamyl tRNA synthetase 58 Cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human glutamyl tRNA synthetase 58.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human glutamyl tRNA synthetase 58.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human glutamyl tRNA synthetase 58 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human glutamyl tRNA synthetase 58 detected in the test can be used to explain the importance of human glutamyl tRNA synthetase 58 in various diseases and to diagnose the role of human glutamyl tRNA synthetase 58 disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human glutamyl tRNA synthetase 58 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human glutamyl tRNA synthetase 58.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human glutamyl tRNA synthetase 58 to inhibit endogenous human glutamyl tRNA synthetase 58 activity.
  • a mutated human glutamyl tRNA synthetase 58 may be a shortened human glutamyl tRNA synthetase 58 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human glutamyl tRNA synthetase 58.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human glutamyl tRNA synthetase 58 into a cell.
  • a polynucleoside carrying human glutamyl tRNA synthetase 58 Methods for acidic recombinant viral vectors can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human glutamyl tRNA synthetase 58 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human glutamyl tRNA synthetase 58 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human glutamyl tRNA synthetase 58 can be used for the diagnosis of diseases related to human glutamyl tRNA synthetase 58.
  • a polynucleotide encoding human glutamyl tRNA synthetase 58 can be used to detect the expression of human glutamyl tRNA synthetase 58 or abnormal expression of human glutamyl tRNA synthetase 58 in a disease state.
  • a DNA sequence encoding human glutamyl tRNA synthetase 58 can be used to hybridize biopsy specimens to determine the expression of human glutamyl tRNA synthetase 58.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human glutamyl tRNA synthetase 58 specific primers can also be used to detect the transcription products of human glutamyl tRNA synthetase 58 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the human glutamyl tRNA synthetase 58 gene can also be used to diagnose human glutamyl tRNA synthetase 58-related diseases.
  • Human glutamyl tRNA synthetase 58 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human glutamyl tRNA synthetase 58 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • the specificity of each gene on the chromosome needs to be identified Site.
  • an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian ian Inheritance in Man (available online with Johns Hopk ins University Welt ch Med i cal l ibrary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human glutamyl tRNA synthetase 58 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human glutamyl tRNA synthetase 58 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

Cette invention concerne un nouveau polypeptide glutamate ARNt synthétase 58 d'origine humaine - et un polycnucléotide codant pour ce polypeptide ainsi qu'un procédé de fabrication dudit polypeptide par méthodes recombinantes. L'invention concerne également une méthode d'utilisation de ce nouveau polypeptide dans le traitement de diverses pathologies, dont le cancer, l'hémopathie, l'infection par le VIH, les maladies liées à l'immunité et l'inflammation. De plus, l'invention porte sur l'antagoniste de ce polypeptide et sur son utilisation thérapeutique. Enfin, elle concerne l'utilisation du polynucléotide codant pour le glutamate ARNt synthétase 58 d'origine humaine.
PCT/CN2000/000475 1999-11-24 2000-11-20 Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide WO2001038371A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15118/01A AU1511801A (en) 1999-11-24 2000-11-20 A novel polypeptide-human glutamate trna synthetase 58 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99124102.9 1999-11-24
CN 99124102 CN1297999A (zh) 1999-11-24 1999-11-24 一种新的多肽——人谷氨酰转移核糖核酸合成酶58和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001038371A1 true WO2001038371A1 (fr) 2001-05-31

Family

ID=5283195

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000475 WO2001038371A1 (fr) 1999-11-24 2000-11-20 Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297999A (fr)
AU (1) AU1511801A (fr)
WO (1) WO2001038371A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000703A2 (fr) * 2000-06-27 2002-01-03 Bayer Aktiengesellschaft Regulation de l'enzyme de type glutamyl-arnt (gln) amido-transferase humaine
EP2624857A2 (fr) * 2010-10-06 2013-08-14 aTyr Pharma, Inc. Découverte innovante de fragments de protéine de tryptophanyle arnt synthétases associés à des compositions thérapeutiques, diagnostiques et d'anticorps
US8926918B2 (en) 2009-10-09 2015-01-06 Dow Global Technologies Llc Isothermal multitube reactors
US8933280B2 (en) 2009-10-09 2015-01-13 Dow Global Technologies Llc Processes for the production of hydrofluoroolefins

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5135504B2 (ja) * 2004-10-27 2013-02-06 ザ スクリプス リサーチ インスティチュート 非天然アミノ酸のインビボ組込み用直交翻訳成分

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0785261A1 (fr) * 1996-01-19 1997-07-23 Smithkline Beecham Plc Glutamyl-ARNt synthétase de Staphylococcus Aureus
WO1997038718A1 (fr) * 1996-04-18 1997-10-23 Smithkline Beecham Corporation Nouveaux composes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0785261A1 (fr) * 1996-01-19 1997-07-23 Smithkline Beecham Plc Glutamyl-ARNt synthétase de Staphylococcus Aureus
WO1997038718A1 (fr) * 1996-04-18 1997-10-23 Smithkline Beecham Corporation Nouveaux composes

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000703A2 (fr) * 2000-06-27 2002-01-03 Bayer Aktiengesellschaft Regulation de l'enzyme de type glutamyl-arnt (gln) amido-transferase humaine
WO2002000703A3 (fr) * 2000-06-27 2002-06-27 Bayer Ag Regulation de l'enzyme de type glutamyl-arnt (gln) amido-transferase humaine
US8926918B2 (en) 2009-10-09 2015-01-06 Dow Global Technologies Llc Isothermal multitube reactors
US8933280B2 (en) 2009-10-09 2015-01-13 Dow Global Technologies Llc Processes for the production of hydrofluoroolefins
EP2624857A2 (fr) * 2010-10-06 2013-08-14 aTyr Pharma, Inc. Découverte innovante de fragments de protéine de tryptophanyle arnt synthétases associés à des compositions thérapeutiques, diagnostiques et d'anticorps
EP2624857A4 (fr) * 2010-10-06 2014-04-09 Atyr Pharma Inc Découverte innovante de fragments de protéine de tryptophanyle arnt synthétases associés à des compositions thérapeutiques, diagnostiques et d'anticorps
US10563191B2 (en) 2010-10-06 2020-02-18 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of tryptophanyl tRNA synthetases

Also Published As

Publication number Publication date
AU1511801A (en) 2001-06-04
CN1297999A (zh) 2001-06-06

Similar Documents

Publication Publication Date Title
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001031022A1 (fr) Nouveau polypeptide, arginyl arnt synthetase 44, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001032862A1 (fr) Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001031023A1 (fr) Nouveau polypeptide, proteine precurseur humaine 25 de la nucleoproteine ii, et polynucleotide codant pour ce polypeptide
WO2001038390A1 (fr) Nouveau polypeptide - proteine 25 snare humaine et polynucleotide la codant
WO2001038369A1 (fr) Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide
WO2001030822A1 (fr) Nouveau polypeptide, pyrophosphatase humaine 26 dutp, et polynucleotide codant pour ce polypeptide
WO2001031032A1 (fr) Nouveau polypeptide, sous-unite 42 d'ht atpase c humaine vacuolaire, et polynucleotide codant pour ce polypeptide
WO2001029229A1 (fr) Nouveau polypeptide, proteine humaine 20 de liaison de retinoblastome et polynucleotide le codant
WO2001030832A1 (fr) Nouveau polypeptide, proteine a doigt de zinc hkznf-23, et un polynucleotide codant pour ce polypeptide
WO2001030834A1 (fr) Nouveau polypeptide, proteine 33 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030833A1 (fr) Nouveau polypeptide, proteine de regulation d'un nouveau cycle cellulaire 53, et polynucleotide codant pour ce polypeptide
WO2002036619A1 (fr) Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase