WO2001038363A1 - Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide - Google Patents

Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001038363A1
WO2001038363A1 PCT/CN2000/000438 CN0000438W WO0138363A1 WO 2001038363 A1 WO2001038363 A1 WO 2001038363A1 CN 0000438 W CN0000438 W CN 0000438W WO 0138363 A1 WO0138363 A1 WO 0138363A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human membrane
protein
sequence
Prior art date
Application number
PCT/CN2000/000438
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU15084/01A priority Critical patent/AU1508401A/en
Publication of WO2001038363A1 publication Critical patent/WO2001038363A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human membrane-bound protein 37, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • the C2 structure has no significant catalytic activity. Its interaction with the membrane can cause modulation of other membrane-bound proteins such as phospholipases. It also has a "divalent" activity, that is, it can interconnect two membrane structures to form a complex, and the two membrane structures can be fused together under the action of another stimulus signal.
  • Copi nes protein includes two C2 structures, It is quite conservative and found in plants, animals and ciliates, indicating that it plays an important role in eukaryotic cells.
  • Cop ines protein will self-aggregate in the presence of calcium ions, and can also be rich in Phosphatidylserine binds to vesicles. This phenomenon is specific to calcium ions.
  • Cop ines protein also has the "divalent" property of the C2 structure, which can bind two membrane structures together. Cop ines protein may also be transported with cell membrane material The Cop ines protein found in the brain regulates the plasticity of synapses in the central nervous system based on the concentration of calcium ions in the cytoplasm.
  • Copines protein will cause the disorder of the material transport on the membrane surface, make the nutrition supply of cells abnormal, and hinder the discharge of metabolic waste cells, which will cause malnutrition, tissue necrosis, and local edema.
  • the protein will be abnormally expressed in secretory cells. It can also cause hormones and other secreted substances not to be secreted to the outside of the cell in time and cause various endocrine disorders.
  • the abnormal expression of this protein can disrupt the function of nerve synapses and sense nerve impulses, causing a series of.
  • abnormal Cop ines protein expression in the central nervous system can destroy the plasticity of synapses, leading to memory loss.
  • the present invention has 99% homology with the Copines I protein found in humans.
  • the gene of the present invention is considered to be a gene encoding a protein similar to Cop ines I and has similar biological functions.
  • the present invention is named human membrane binding protein 37.
  • the human membrane-bound protein 37 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more involved in these processes.
  • Human membrane-bound protein 37 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human membrane-bound protein 37 protein-encoding gene also provides a basis for research to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human membrane-bound protein 37.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human membrane-bound protein 37.
  • Another object of the present invention is to provide a method for producing human membrane-bound protein 37.
  • Another object of the present invention is to provide an antibody against the polypeptide-human membrane-bound protein 37 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-human membrane-binding protein 37 of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human membrane binding protein 37.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 399-1709; and (b) a sequence of positions 1-2584 of SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human membrane binding protein 37 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human membrane-bound protein 37 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human membrane binding protein 37.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when bound to human membrane-bound protein 37, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human membrane binding protein 37.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human membrane binding protein 37 when bound to human membrane binding protein 37.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human membrane binding protein 37.
  • Regular refers to a change in the function of human membrane-bound protein 37, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human membrane-bound protein 37.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human membrane binding protein 37 using standard protein purification techniques.
  • Substantially pure human membrane-bound protein 37 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the human membrane-bound protein 37 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALI GN program
  • the program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Cluster method arranges each group of sequences by checking the distance between all pairs.
  • the clusters are then allocated in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human membrane binding protein 37.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • Polynucleoside in its natural state Acids and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances in their natural state.
  • isolated human membrane binding protein 37 means that human membrane binding protein 37 is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human membrane binding protein 37 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human membrane-bound protein 37 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human membrane-bound protein 37, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of human membrane binding protein 37.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human membrane-bound protein 37 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted An amino acid may or may not be encoded by a genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ) such One, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2584 bases in length and its open reading frame (699-1709) encodes 336 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 99% homology with the cop ines I protein. It can be concluded that the human membrane-bound protein 37 has a similar structure and function to the cop ines I protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
  • the same or degenerate variants refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ⁇ Hybridization with a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human membrane binding protein 37.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human membrane-bound protein 37 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • cDNA libraries are also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human membrane-bound protein 37 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human membrane-bound protein 37 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human membrane binding protein 37 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the human membrane-bound protein 37 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Ros enberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression expressed in mammalian cells Vectors (Lee and Na thans, JBio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human membrane-bound protein 37 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, leg synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecu l ar C l on ing, a Labora tory Manua l, co ld Harbor Harbora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human membrane-bound protein 37 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human membrane-bound protein 37 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of amino acid sequence homology of the human membrane-bound protein 37 and cop ines I protein of the present invention.
  • the upper sequence is human membrane-bound protein 37, and the lower sequence is cop ines I protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human membrane-bound protein 37.
  • FIG. 37kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • the sequence of the human membrane-bound protein 37 of the present invention and the protein sequence encoded by the protein are analyzed by the Blas t program.
  • CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Pr imerZ 5,-CTTCACTGGTCTTTATTGAATGAG-3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ⁇ l of Kol1, KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume , 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2584bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human membrane-bound protein 37 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • Primer3 5'- CCCCATATGATGAGGCTGACTATAAGGCTGCTC -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTCAGGTAGTGTAGGGAGTCAGGTAG -3, (Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0938E02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: pBS-0938E02 in a total volume of 50 ⁇ 1 Plasmid 10pg, 51 7 Primer-3 ⁇ Primer-4 ⁇ ! J ⁇ OpmoK Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0938E02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0938E02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1mmol / L, and continued. Incubate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). Purified the target protein human membrane-bound protein 37.
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Protein ⁇ -Sepharose was used to isolate total IgG from antibody-positive serum.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody specifically binds to human membrane-bound protein 37.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Copines proteins are involved in cell membrane material transport. Copines protein found in brain based on cytoplasm The concentration of calcium ions regulates the plasticity of the central nervous system synapses. As a result, malnutrition, tissue necrosis, local edema, endocrine disorders, diseases of the nervous and motor systems, and memory loss;
  • the polypeptide of the present invention or a fragment thereof can be used to treat or prevent malnutrition, tissue necrosis, and local edema caused by abnormal supply of cellular nutrients and obstacles to the elimination of metabolic waste.
  • polypeptides or fragments thereof of the present invention can also be used to treat or prevent various endocrine diseases, including but not limited to: diabetes insipidus, pituitary syndrome, hypohypoxia in adults, pituitary dwarfism, hypothyroidism, diabetes Embolism
  • polypeptides or fragments thereof of the present invention can also be used to treat or prevent various motor and neurological diseases caused by abnormal synaptic functions, including but not limited to: Alzheimer's disease, Parkinson's disease, chorea, depression, Amnesia, epilepsy, migraine, dementia, multiple sclerosis, myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, tonic muscular dystrophy, myasthenia, bradykinesia, dystonia, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human membrane binding protein 37.
  • Agonists enhance biological functions such as human membrane-bound protein 37 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human membrane binding protein 37 can be cultured together with labeled human membrane binding protein 37 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human membrane binding protein 37 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human membrane binding protein 37 can bind to human membrane binding protein 37 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human membrane-bound protein 37 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human membrane-bound protein 37 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human membrane binding protein 37 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human membrane-bound protein 37 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human membrane-bound protein 37 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries Paragraph.
  • Polyclonal antibodies can be produced by directly injecting human membrane-bound protein 37 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human membrane-bound protein 37 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
  • Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human membrane-bound protein 37.
  • Anti-human membrane-bound protein 37 antibodies can be used in immunohistochemical techniques to detect human membrane-bound protein 37 in biopsy specimens.
  • Monoclonal antibodies that bind to human membrane-bound protein 37 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human membrane-bound protein 37 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human membrane binding protein 37 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human membrane binding protein 37.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human membrane binding protein 37.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human membrane-bound protein 37 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of human membrane binding protein 37 detected in the test can be used to explain the importance of human membrane binding protein 37 in various diseases and to diagnose diseases in which human membrane binding protein 37 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human membrane binding protein 37 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human membrane-bound protein 37.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human membrane binding protein 37 to inhibit endogenous human membrane binding protein 37 activity.
  • a mutated human membrane-bound protein 37 may be a shortened human membrane-bound protein 37 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore recombinant gene therapy vectors can be used Treatment of diseases caused by abnormal expression or activity of human membrane-bound protein 37.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human membrane-bound protein 37 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human membrane-bound protein 37 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding human membrane-bound protein 37 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human membrane binding protein 37 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human membrane binding protein 37 can be used for the diagnosis of diseases related to human membrane binding protein 37.
  • the polynucleotide encoding human membrane-bound protein 37 can be used to detect the expression of human membrane-bound protein 37 or the abnormal expression of human membrane-bound protein 37 in a disease state.
  • the DNA sequence encoding human membrane-bound protein 37 can be used to hybridize biopsy specimens to determine the expression of human membrane-bound protein 37.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human membrane-bound protein 37-specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human membrane-bound protein 37 transcripts.
  • Detection of mutations in the human membrane-bound protein 37 gene can also be used to diagnose human membrane-bound protein 37-related diseases.
  • Human membrane-bound protein 37 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human membrane-bound protein 37 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can be crossed with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific c-hard library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • containers there can be medicines manufactured, used or sold by Instructions given by the government regulatory agency for the product or biological product, which reflects the permission of the government regulatory agency for production, use, or sale to be administered to the human body.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human membrane binding protein 37 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of human membrane-bound protein 37 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne, d'une part une nouvelle sorte de protéine 37 à liaison membranaire humaine polypeptidique et le polynucléotide codant ce polypeptide, et d'autre part un procédé de production de ce polypeptide par recombinaison. L'invention concerne également l'utilisation de ce polypeptide pour traiter diverses affections telles que le cancer, l'hémopathie, l'infection par le VIH, les affections immunitaires et l'inflammation. L'invention concerne en outre l'antagoniste du polypeptide et son utilisation thérapeutique. L'invention concerne enfin l'utilisation du polynucléotide codant cette protéine membranaire humaine 37.
PCT/CN2000/000438 1999-11-24 2000-11-20 Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide WO2001038363A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15084/01A AU1508401A (en) 1999-11-24 2000-11-20 A novel polypeptide-human membrane-binding protein 37 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99124093 CN1297901A (zh) 1999-11-24 1999-11-24 一种新的多肽——人膜结合蛋白37和编码这种多肽的多核苷酸
CN99124093.6 1999-11-24

Publications (1)

Publication Number Publication Date
WO2001038363A1 true WO2001038363A1 (fr) 2001-05-31

Family

ID=5283186

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000438 WO2001038363A1 (fr) 1999-11-24 2000-11-20 Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297901A (fr)
AU (1) AU1508401A (fr)
WO (1) WO2001038363A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CREUTZ C.E. ET AL.: "The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from paramecium to humans", J. BIOL. CHEM., vol. 273, no. 3, 1998, pages 1393 - 1402 *

Also Published As

Publication number Publication date
CN1297901A (zh) 2001-06-06
AU1508401A (en) 2001-06-04

Similar Documents

Publication Publication Date Title
WO2001038377A1 (fr) Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001038363A1 (fr) Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001032862A1 (fr) Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide
WO2001038369A1 (fr) Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide
WO2001038383A1 (fr) Nouvelle hydrolase 28 a terminaison carboxy d'ubiquitine humaine a base d'un polypeptide et polynucleotide codant cette hydrolase
WO2001029075A1 (fr) Nouveau polypeptide, proteine 129 activant la proteine g, et polynucleotide codant pour ce polypeptide
WO2001031032A1 (fr) Nouveau polypeptide, sous-unite 42 d'ht atpase c humaine vacuolaire, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001038370A1 (fr) Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide
WO2001038388A1 (fr) Nouveau polypeptide - transacylase 31 a chaine ramifiee de type humain - et polynucleotide codant ce polypeptide
WO2002036619A1 (fr) Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide
WO2001038520A1 (fr) Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide
WO2001030832A1 (fr) Nouveau polypeptide, proteine a doigt de zinc hkznf-23, et un polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)