WO2001038370A1 - Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide - Google Patents

Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001038370A1
WO2001038370A1 PCT/CN2000/000474 CN0000474W WO0138370A1 WO 2001038370 A1 WO2001038370 A1 WO 2001038370A1 CN 0000474 W CN0000474 W CN 0000474W WO 0138370 A1 WO0138370 A1 WO 0138370A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
sequence
protein subunit
seq
Prior art date
Application number
PCT/CN2000/000474
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU16870/01A priority Critical patent/AU1687001A/en
Publication of WO2001038370A1 publication Critical patent/WO2001038370A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide transcript activating protein subunit 49, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • GABP is a transcriptional activator protein and it is a member of the ETS family. It is composed of two subunits (X and ⁇ .
  • the -X00 subunit of the X subunit has an ETS domain, which can be combined with the promoter's A / CGGAA / TA / GY sequence and activate RNA transcription.
  • the 4 cysteine at C00H are redox regulated sites, and the modification of these sites affects the binding of protein to DNA and the binding of a and ⁇ subunits.
  • the beta subunit contains 4.5 tandem ankyrin repeats. Each repeat unit consists of a pair of antiparallel curling helices and a loop with a type I corner at one end. These structures mainly mediate heterodimerization with the (X) subunit, thereby strengthening the binding of the (A) subunit to D. (2) Adrian H. Batchelor, Arthur E. Piper, Fabienne Charles de la Brousse, Steven L. McKnight , Cynthia Wolberger (1998) science 279: 1037-1041
  • GABP is an activator of the utrophin promoter.
  • Utrophin is a nutrient protein found at the nerve-muscle junction. Therefore, GABP can increase the expression of utrophinD, so as to treat Duchenne muscular dystrophy.
  • GABP is also involved in the activation of the 0TR (oxytocin receptor) gene promoter, and oxytocin mediates labor and ejaculation. Therefore GABP can be used to regulate reproductive function. (4) Hoare S, Copland J A, Wood T G et al (1999) Endocr inology 140 (5) 2268-79
  • GABP is also involved in the transcriptional activation of tumor necrosis factor, which is used for anti-tumor (5) Tomaras GD, Foster DA, Burrer CM et al. J Leukoc Biol 1999 66 (1): 183-93 Another way to treat tumors It interferes with the metabolism of polyamines. Because the growth of eukaryotic cells requires that the multi-SSAT gene product is a rate-limiting enzyme for polyamine metabolism, NRF2, a homologue of GABP, can interact with the PRE of the SSAT gene. The combination of response elements promotes the transcription of the SSAT gene. (6) Yan l in Wang, Le i Xiao, Aruntha th i Th iaga l ingam (1998) J Bio l Chem 273 (51) 34623-34630. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a transcriptional activator protein subunit 49.
  • Another object of the present invention is to provide a method for producing a transcriptional activator protein subunit 49.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the transcription-activating protein subunit 49 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in transcriptional activator subunit 49.
  • a novel isolated transcriptional activator protein subunit 49 is provided.
  • the polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or Its active fragment, or its active derivative, analog.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • a polynucleotide encoding the isolated polypeptides, the polynucleotide comprising a nucleotide sequence, the nucleotide sequence having at least ⁇ 70% ⁇ identity: (a) a polynucleotide encoding the aforementioned transcriptional activator protein subunit 49; (b) a polynucleotide complementary to the polynucleotide (a).
  • the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 293 to 1639 in SEQ II NO: 1; and (b) having a sequence of 1-1912 in SEQ ID NO: 1 Sequence of bits.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated transcriptional activator protein subunit 49 means that transcriptional activator protein subunit 49 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify transcription-activating protein subunits 49 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of Transcription Activator Subunit 49 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a transcription activation protein subunit 49, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of transcriptional activator protein subunit 49.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the transcriptional activating protein subunit 49 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1912 bases in length and its open reading frame (293-1639) encodes 448 amino acids. According to the amino acid sequence homology comparison, it was found that this peptide is 75% The homology can be deduced that the transcriptional activator protein subunit 49 has similar structure and function to the transcriptional activator protein GABP.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDM, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 fl /.
  • SDS, 6 (TC; or (2) adding denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; Or (3) hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is shown in SEQ ID NO: 2 The mature polypeptide has the same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding transcriptional activator protein subunit 49.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the transcription activator protein subunit 49 of the present invention can be performed in various ways. Get.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from CI on tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of transcription-activating protein subunit 49; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the transcriptional activating protein subunit 49 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE_cDNA terminal rapid amplification method
  • the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length cDNA sequence, The sequence needs to be repeated. Sometimes it is necessary to determine the CDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the transcriptional activating protein subunit 49 coding sequence, and a recombinant technology for producing the polypeptide of the present invention method.
  • the polynucleotide sequence encoding the transcriptional activating protein subunit 49 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, eta l.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a transcriptional activator protein subunit 49 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mo l ecu l ar C l on ing, a Labora tory Manua l, co ld Spr ing Harbor Labora tory. New York, 1989 ).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a transcription activator protein subunit 49 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the ⁇ (12 ) method. The steps used are well known in the art. Alternatively, MgC l 2. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Plastid packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant transcriptional activator protein subunit 49 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Figure 1 is a comparison diagram of the amino acid sequence homology of the transcription activator protein subunit 49 and the transcription activator protein GABP of the present invention.
  • the upper sequence is transcription activation protein subunit 49
  • the lower sequence is transcription activation protein GABP.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated transcriptional activating protein subunit 49.
  • 49kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0635G04 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the results showed that the full-length cDNA contained in the 0635G04 clone was 1912bp (as shown in Seq IDN0: 1), and there was a 1346bp open reading frame (0RF) from 293bp to 1639bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-0635G04 was named transcriptional activator protein subunit 49.
  • Example 2 Homologous search of cDNA clones
  • the Bactiv program (Basiclocal Alignment search tool) was used for the sequence of transcription activation protein subunit 49 of the present invention and its encoded protein sequence [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] Perform homology search in Genbank, Swissport and other databases.
  • the gene most homologous to the transcriptional activator protein subunit 49 of the present invention is a known transcriptional activator protein GABP, the accession number of the encoded protein in Genbank is M74516.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with 70% identity; 75% similarity.
  • Example 3 Cloning of a gene encoding transcriptional activator protein subunit 49 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primerl 5 — GCATTTTGTTGCCTCTGTTTCTC — 3, (SEQ ID NO: 3)
  • Primer2 5,-CATGCAGTATTCTTTTACTTCTA- 3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1- 1912bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of Transcription Activator Subunit 49 Gene Expression by Northern Blotting:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid ( ⁇ 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation cc- 32 P dATP with 32 P- DNA probe labeled by the random primer method.
  • the DNA probe used was the PCR-encoded transcription-activating protein subunit 49 coding region sequence (293bp to 1639bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant transcriptional activator protein subunit 49 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers is designed, and the sequences are as follows:
  • Primer3 5'-CCCCATATGATGTCTTTGGTGGACTTGGGAAAG-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTTAAGATGAAACAGTTGCCATGGA-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'end and 3' end of the gene of interest are followed, respectively.
  • the Nde I and BamH I restriction sites correspond to the expression vector plasmid pET- 28 b (+) (Novagen product, Cat. No. 69865.3) Selective endonuclease site.
  • the pBS-0635G04 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 containing 10 pg of P BS-0635G04 plasmid, bow
  • the digestion product and plasmid pET-28 (+) were double-digested with Ncol and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation products were transformed with the calcium chloride method Escherichia coli DH50. After the LB plates containing kanamycin (final concentration 30 g / ml) were cultured overnight, the positive clones were screened by colony PCR and sequenced. The positive clones with the correct sequence were selected (pET-0635G04).
  • the plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen).
  • the host strain BL21 (pET-0635G04) was cultured at 37 ° C to In the logarithmic growth phase, add IPTG to a final concentration of 1 foot ol / L, and continue to cultivate for 5 hours. Centrifuge the bacteria to collect, centrifuge the bacteria, collect the supernatant by centrifugation, and combine with 6 histidine (6His-Tag) Affinity chromatography column His. Bind Quick Cartridge (product of Novagen) The purified target protein transcription-activating protein subunit 49 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 49 kDa ( Figure 2).
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following peptides specific to transcriptional activation protein subunit 49: NH 2 -Met-Ser-Leu-Val-As -Leu-Gly-Lys-Arg-Leu-Leu-Glu- Ala-Ala-Arg- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • polypeptides of the present invention as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat muscular dystrophy, reproductive dysfunction, tumors and the like.
  • GABP is an activator of the utrophin promoter.
  • Utrophin is a nutrient protein present at the neuro-muscular junction. Therefore, GABP can increase the expression of utrophinD, so as to treat Duchenne muscular dystrophy.
  • GABP is also involved in the activation of the OTR (oxytocin receptor) gene promoter, and oxytocin mediates labor and ejaculation. Therefore GABP can be used to regulate reproductive function. (4) Hoare S, Copland J A, Wood T G et al (1999) Endocrinology 140 (5) 2268-79
  • GABP is also involved in the transcriptional activation of tumor necrosis factor, which is used for antitumor (5) TomarasGD, Foster DA, Burrer CM et al. J Leukoc Biol 1999 66 (1): 183-93. Another way to treat tumors is Interfering with the metabolism of polyamines. Because the growth of eukaryotic cells requires multiple SSAT gene products, which are rate-limiting enzymes for polyamine metabolism, NRF2, a homolog of GABP, can be combined with the PRE response element of the SSAT gene to promote the transcription of the SSAT gene. (6) Yanlin Wang, Lei Xiao, Arunthathi Thiagalingam (1998) J Biol Chera 273 (51) 34623-3463
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) transcriptional activator protein 49.
  • Agonists increase transcriptional activating protein subunits 49 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing transcriptional activator protein subunit 49 can be cultured with the labeled transcriptional activator protein subunit 49 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of Transcription Activator Subunit 49 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of transcription activator protein subunit 49 can bind to transcription activator protein subunit 49 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot perform biological functions.
  • transcriptional activator protein subunit 49 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between transcriptional activator protein subunit 49 and its receptor. .
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to transcriptional activating protein subunit 49 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase Got. When screening, 49 molecules of transcriptional activator subunit should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the transcriptional activating protein subunit 49 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by directly injecting transcription-activating protein subunit49 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
  • Techniques for preparing monoclonal antibodies to transcriptional activator protein subunit 49 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851), and existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single-chain antibodies against transcriptional activator protein subunit 49.
  • Antibodies against Transcription Activator Subunit 49 can be used in immunohistochemistry to detect Transcription Activator Subunit 49 in biopsy specimens.
  • Monoclonal antibodies that bind to transcriptional activator protein subunit 49 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • a transcription-activating protein subunit 49 high-affinity monoclonal antibody can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill transcription-activating protein subunit 49 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to transcriptional activator protein subunit 49.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of transcriptional activator protein subunit 49.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of transcriptional activator protein subunit 49.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of Transcription Activator Subunit 49 detected in the test can be used to explain the importance of Transcription Activator Subunit 49 in various diseases and to diagnose diseases where Transcription Activator Subunit 49 plays a role.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding transcriptional activator protein subunit 49 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of transcriptional activator protein subunit 49.
  • Recombinant gene therapy vectors can be designed to express variant transcriptional activator protein subunit 49 to inhibit endogenous transcriptional activator protein subunit 49 activity.
  • a mutated transcriptional activator protein subunit 49 may be a shortened transcriptional activator protein subunit 49 that lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of transcriptional activator subunit 49.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a recombinant viral vector carrying a polynucleotide encoding a transcriptional activator protein subunit 49 can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding transcription activation protein subunit 49 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit transcription activation protein subunit 49 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding transcriptional activator protein subunit 49 can be used to diagnose diseases associated with transcriptional activator protein subunit 49.
  • a polynucleotide encoding transcriptional activator protein subunit 49 can be used to detect the expression of transcriptional activator protein subunit 49 or the abnormal expression of transcriptional activator protein subunit 49 in a disease state.
  • a DNA sequence encoding transcriptional activator protein subunit 49 can be used to hybridize biopsy specimens to determine the expression of transcriptional activator protein subunit 49.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • a DM chip also called a "gene chip”
  • RT-PCR RNA-polymerase chain reaction
  • Transcription activator subunit 49 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type transcription activation protein subunit 49 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendeian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as defects visible at the chromosomal level or detectable by cDNA sequence-based PCR Missing or transposing. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Transcription activator protein subunit 49 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of Transcription Activator Subunit 4.9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne, d'une part une nouvelle sorte de sous-unité 49 de l'activateur de transcription polypeptidique et le polynucléotide codant ce polypeptide, et d'autre part un procédé de production de ce polypeptide par recombinaison. L'invention concerne également l'utilisation de ce polypeptide pour traiter diverses affections telles que la dystrophie musculaire, des dysfonctions génétiques et le cancer. L'invention concerne en outre l'antagoniste du polypeptide et son utilisation thérapeutique. L'invention concerne enfin l'utilisation du polynucléotide codant cette sous-unité 49 de l'activateur de transcription.
PCT/CN2000/000474 1999-11-24 2000-11-20 Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide WO2001038370A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU16870/01A AU1687001A (en) 1999-11-24 2000-11-20 A novel polypeptide-transcriptional activator subunit 49 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99124101 CN1297908A (zh) 1999-11-24 1999-11-24 一种新的多肽——转录激活蛋白亚单位49和编码这种多肽的多核苷酸
CN99124101.0 1999-11-24

Publications (1)

Publication Number Publication Date
WO2001038370A1 true WO2001038370A1 (fr) 2001-05-31

Family

ID=5283194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000474 WO2001038370A1 (fr) 1999-11-24 2000-11-20 Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297908A (fr)
AU (1) AU1687001A (fr)
WO (1) WO2001038370A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENEBANK [online] Database accession no. A53950 *
DELA BROUSSE F.C. ET AL.: "Molecular and genetic characterization of GABP beta", GENES DEV., vol. 8, no. 15, August 1994 (1994-08-01), pages 1853 - 1865 *

Also Published As

Publication number Publication date
AU1687001A (en) 2001-06-04
CN1297908A (zh) 2001-06-06

Similar Documents

Publication Publication Date Title
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001038370A1 (fr) Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001032699A1 (fr) Nouveau polypeptide, nouvelle udp glucose-glycoproteine glucosyltransferase (« biohugtr »), et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030819A1 (fr) Nouveau polypeptide, tropomoduline humaine 39, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030832A1 (fr) Nouveau polypeptide, proteine a doigt de zinc hkznf-23, et un polynucleotide codant pour ce polypeptide
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide
WO2001030826A1 (fr) Nouveau polypeptide, une serine/threonine kinase 29, et polynucleotide codant pour ce polypeptide
WO2001029080A1 (fr) Nouveau polypeptide, une proteine humaine hmg-13, et polynucleotide codant pour ce polypeptide
WO2001030821A1 (fr) Nouveau polypeptide, arn cyclase humaine 41, et polynucleotide codant pour ce polypeptide
WO2001029229A1 (fr) Nouveau polypeptide, proteine humaine 20 de liaison de retinoblastome et polynucleotide le codant
WO2001038369A1 (fr) Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide
WO2001029075A1 (fr) Nouveau polypeptide, proteine 129 activant la proteine g, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001027148A1 (fr) Nouveau polypeptide, facteur homo 56 riche en glutamine(q), et polynucleotide codant pour ce polypeptide
WO2001027285A1 (fr) Nouveau polypeptide, methyltransferase humaine dpb 41 et polynucleotide codant pour ce polypeptide
WO2001032862A1 (fr) Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase