WO2001034208A1 - Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo - Google Patents

Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo Download PDF

Info

Publication number
WO2001034208A1
WO2001034208A1 PCT/US2000/030345 US0030345W WO0134208A1 WO 2001034208 A1 WO2001034208 A1 WO 2001034208A1 US 0030345 W US0030345 W US 0030345W WO 0134208 A1 WO0134208 A1 WO 0134208A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
growth factor
angiogenic
peptide
protein
Prior art date
Application number
PCT/US2000/030345
Other languages
English (en)
Inventor
H. Kirk Hammond
Frank J. Giordano
Wolfgang H. Dillmann
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EA200200533A priority Critical patent/EA008538B1/ru
Priority to JP2001536204A priority patent/JP2003513942A/ja
Priority to AU14604/01A priority patent/AU784392B2/en
Priority to IL14945100A priority patent/IL149451A0/xx
Priority to EP00976894A priority patent/EP1225921A1/fr
Priority to CA002389524A priority patent/CA2389524A1/fr
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Priority to KR1020027005855A priority patent/KR20020049031A/ko
Priority to US09/847,936 priority patent/US20030148968A1/en
Publication of WO2001034208A1 publication Critical patent/WO2001034208A1/fr
Priority to HK03100751.6A priority patent/HK1048593A1/zh
Priority to US11/236,221 priority patent/US20060286072A1/en
Priority to US12/045,658 priority patent/US20090082293A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/50—Fibroblast growth factors [FGF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors (Somatomedins), e.g. IGF-1, IGF-2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/025—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a parvovirus

Definitions

  • the present invention relates to methods and compositions for treating cardiovascular disease, by in vivo gene therapy. More specifically, the present invention relates to techniques and polynucleotide constructs for treating heart disease and/or for treating peripheral vascular disease by in vivo delivery of angiogenic transgenes.
  • BACKGROUND OF THE INVENTION It has been reported by the American Heart Association (1995 Statistical Supplement), that about 60 million adults in the United States suffer from cardiovascular disease. Cardiovascular diseases are responsible for almost a million deaths annually in the United States representing over 40% of all deaths.
  • Myocardial ischemia is an aspect of heart dysfunction that occurs when the heart muscle (the myocardium) does not receive adequate blood supply and is thus deprived of necessary levels of oxygen and nutrients.
  • Myocardial ischemia may result in a variety of heart diseases including, for example, angina, heart attack and/or congestive heart failure.
  • the most common cause of myocardial ischemia is atherosclerosis (also referred to as coronary artery disease or "CAD”), which causes blockages in the coronary arteries, blood vessels that provide blood flow to the heart muscle.
  • CAD coronary artery disease
  • Present treatments for myocardial ischemia include pharmacological therapies, coronary artery bypass surgery and percutaneous revascularization using techniques such as balloon angioplasty.
  • Standard pharmacological therapy is predicated on strategies that involve either increasing blood supply to the heart muscle or decreasing the demand of the heart muscle for oxygen and nutrients.
  • increased blood supply to the myocardium can be achieved by agents such as calcium channel blockers or nitroglycerin. These agents are thought to increase the diameter of diseased arteries by causing relaxation of the smooth muscle in the arterial walls.
  • Decreased demand of the heart muscle for oxygen and nutrients can be accomplished either by agents that decrease the hemodynamic load on the heart, such as arterial vasodilators, or those that decrease the contractile response of the heart to a given hemodynamic load, such as beta-adrenergic receptor antagonists.
  • Surgical treatment of ischemic heart disease is generally based on the bypass of diseased arterial segments with strategically placed bypass grafts (usually saphenous vein or internal mammary artery grafts).
  • Percutaneous revascularization is generally based on the use of catheters to reduce the narrowing in diseased coronary arteries. All of these strategies are used to decrease the number of, or to eradicate, ischemic episodes, but all have various limitations, some of which are discussed below.
  • Many patients with heart disease including many of those whose severe myocardial ischemia resulted in a heart attack, are diagnosed as having congestive heart failure.
  • Congestive heart failure is defined as abnormal heart function resulting in inadequate cardiac output to meet metabolic needs (Braunwald, E. (ed), In: Heart Disease, W.B.
  • CHF congestive heart failure
  • CHF chronic myelolism
  • Symptoms of CHF include breathlessness, fatigue, weakness, leg swelling and exercise intolerance.
  • patients with heart failure tend to have elevations in heart and respiratory rates, rales (an indication of fluid in the lungs), edema, jugular venous distension, and, in general, enlarged hearts.
  • the most common cause of CHF is atherosclerosis which, as discussed above, causes blockages in the coronary arteries that supply blood to the heart muscle.
  • congestive heart failure is most commonly associated with coronary artery disease that is so severe in scope or abruptness that it results in the development of chronic or acute heart failure.
  • extensive and/or abrupt occlusion of one or more coronary arteries precludes adequate blood flow to the myocardium, resulting in severe ischemia and, in some cases, myocardial infarction or death of heart muscle.
  • the consequent myocardial necrosis tends to be followed by progressive chronic heart failure or an acute low output state - both of which are associated with high mortality.
  • Most patients with congestive heart failure tend to develop enlarged, poorly contracting hearts, a condition referred to as "dilated cardiomyopathy" (or DCM, as used herein).
  • DCM is a condition of the heart typically diagnosed by the finding of a dilated, hypocontractile left and/or right ventricle. Again, in the majority of cases, the congestive heart failure associated with a dilated heart is the result of coronary artery disease, often so severe that it has caused one or more myocardial infarcts. In a significant minority of cases, however, DCM can occur in the absence of characteristics of coronary artery disease (e.g., atherosclerosis). In a number of cases in which the dilated cardiomyopathy is not associated with CAD, the cause of DCM is known or suspected.
  • Examples include familial cardiomyopathy (such as that associated with progressive muscular dystrophy, myotonic muscular dystrophy, Freidrich's ataxia, and hereditary dilated cardiomyopathy), infections resulting in myocardial inflammation (such as infections by various viruses, bacteria and other parasites), noninfectious inflammations (such as those due to autoimmune diseases, peripartum cardiomyopathy, hypersensitivity reactions or transplantation rejections), metabolic disturbances causing myocarditis (including nutritional, endocrinologic and electrolyte abnormalities) and exposure to toxic agents causing myocarditis (including alcohol, as well as certain chemotherapeutic drugs and catecholamines).
  • familial cardiomyopathy such as that associated with progressive muscular dystrophy, myotonic muscular dystrophy, Freidrich's ataxia, and hereditary dilated cardiomyopathy
  • infections resulting in myocardial inflammation such as infections by various viruses, bacteria and other parasites
  • noninfectious inflammations such as those due to autoimmune diseases,
  • Idiopathic dilated cardiomyopathy or "IDCM”
  • DCM idiopathic dilated cardiomyopathy
  • CHF cardiac arrhythmias
  • Traditional revascularization is not an option for treatment of non-CAD DCM, because occlusive coronary disease is not the primary problem.
  • the damage is typically not readily reversible.
  • the cardiomyopathy is generally irreversible and results in death in over 60% of afflicted patients.
  • the cause itself is unknown. As a result, there are no generally applied treatments for DCM.
  • ventricular remodeling while initially adaptive, often leads further impairment of ventricular function. Dilation of the whole heart occurs in about 50% of patients who have such infarcts, and remodeling usually develops within a few months after a myocardial infarction although it can occur as early as 1-2 weeks after the infarct. Poor left ventricular function is the best single predictor of adverse outcome following myocardial infarction. Thus, preventing ventricular remodeling after myocardial infarction would be beneficial.
  • One approach to try to prevent ventricular remodeling is to treat patients who have suffered a myocardial infarction with angiotensin converting enzyme ("ACE") inhibitors (see, e.g., McDonald, K.M., Trans. Assoc. Am.
  • ACE angiotensin converting enzyme
  • CHF cerebral revascularization procedures
  • Pharmacological therapies for CHF have been directed toward increasing the force of contraction of the heart (by using inotropic agents such as digitalis and beta-adrenergic receptor agonists), reducing fluid accumulation in the lungs and elsewhere (by using diuretics), and reducing the work of the heart (by using agents that decrease systemic vascular resistance such as angiotensin converting enzyme inhibitors).
  • Beta-adrenergic receptor antagonists have also been tested. While such pharmacological agents can improve symptoms, and potentially prolong life, the prognosis in most cases remains dismal.
  • Some patients with heart failure due to associated coronary artery disease can benefit, at least temporarily, by revascularization procedures such as coronary artery bypass surgery and angioplasty.
  • revascularization procedures such as coronary artery bypass surgery and angioplasty.
  • Such procedures are of potential benefit when the heart muscle is not dead but maybe dysfunctional because of inadequate blood flow. If normal coronary blood flow is restored, previously dysfunctional myocardium may contract more normally, and heart function may improve.
  • the patient has an inadequate microvascular bed (e.g., as may be found in more severe CHF patients)
  • revascularization will rarely restore cardiac function to normal or near-normal levels, even though mild improvements are sometimes noted.
  • the incidence of failed bypass grafts and restenosis following angioplasty poses further risks to patients treated by such methods.
  • Heart transplantation can be a suitable option for CHF patients who have no other confounding diseases and are relatively young, but this is an option for only a small number of such patients, and only at great expense. In sum, it can be seen that CHF has a very poor prognosis and responds poorly to current therapies.
  • CHF patients Further complicating the physiological conditions associated with CHF are various natural adaptations that tend to occur in patients with dysfunctional hearts. Although these natural responses can initially improve heart function, they often result in other problems that can exacerbate the disease, confound treatment, and have adverse effects on survival.
  • Atherosclerosis present in a peripheral vessel may cause ischemia in the tissue supplied by the affected vessel.
  • This problem known as peripheral arterial occlusive disease (PAOD)
  • PAOD peripheral arterial occlusive disease
  • this condition or at least some of its symptoms may be treated by using drugs, such as aspirin or other agents that reduce blood viscosity, or by surgical intervention, such as arterial grafting, surgical removal of fatty plaque deposits or by endovascular treatments, such as angioplasty. While symptoms may be improved, the effectiveness of such treatments is typically inadequate, for reasons similar to those referred to above.
  • Angiogenesis refers generally to the development and differentiation of blood vessels.
  • a number of proteins, typically referred to as “angiogenic proteins,” are known to promote angiogenesis.
  • angiogenic proteins include members of the fibroblast growth factor (FGF) family, the vascular endothelial growth factor (VEGF) family, the platelet-derived growth factor (PDGF) family, the insulin-like growth factor (IGF) family, and others (as described in more detail below and in the art).
  • FGF fibroblast growth factor
  • VEGF vascular endothelial growth factor
  • PDGF platelet-derived growth factor
  • IGF insulin-like growth factor
  • the FGF and VEGF family members have been recognized as regulators of angiogenesis during growth and development. Their role in promoting angiogenesis in adult animals has recently been examined (as discussed below).
  • aFGF acidic FGF
  • the attempted in vivo methods generally suffered from one or more of the following deficiencies: inadequate transduction efficiency and transgene expression; marked immune response to the vectors used, including inflammation and tissue necrosis; and importantly, a relative inability to target transduction and transgene expression to the organ of interest (e.g., gene transfer targeted to the heart resulted in the transgene also being delivered to non-cardiac sites such as liver, kidneys, lungs, brain and testes of the test animals).
  • the insertion of a transgene into a rapidly dividing cell population will result in substantially reduced duration of transgene expression.
  • Examples of such cells include endothelial cells, which make up the inner layer of all blood vessels, and fibroblasts, which are dispersed throughout the heart. Targeting the transgene so that only the desired cells will receive and express the transgene, and so that the transgene will not be systemically distributed, are also critically important considerations. If this is not accomplished, systemic expression of the transgene and problems attendant thereto will result. For example, inflammatory infiltrates have been documented after adenovirus-mediated gene transfer in liver (Yang et al. Proc. Natl. Acad. Sci. U.S.A., 91 : 4407, 1994). Additionally, inflammatory infiltrates were documented in the heart after direct intramyocardial injection through a needle inserted into the myocardial wall (French et al., Circulation, 90(5): 2414- 2424, 1994).
  • a method for treating certain forms of congestive heart failure associated with beta-adrenergic signaling has recently been demonstrated by Hammond et al. in PCT publication WO 98/10085, published 12 March 1998. That method involves the delivery of genes encoding elements of the beta-adrenergic signaling pathway to the heart of a patient with heart disease associated with a reduction in beta-adrenergic signaling.
  • the present invention relates to methods and compositions for treating cardiovascular disease comprising delivering a transgene encoding an angiogenic protein or peptide to affected tissue by introducing a vector comprising the transgene into said tissue wherein the transgene is expressed and disease symptoms ameliorated.
  • contractile function and/or blood flow in the heart can be increased by introduction of a transgene-containing vector into at least one coronary artery of a patient, wherein the transgene is delivered to the myocardium and therein expressed.
  • Methods are also provided for use in peripheral vascular diseases such as peripheral arterial occlusive disease (PAOD). As described and illustrated herein, these methods are thus useful for treating heart disease, peripheral vascular disease and similar disorders.
  • PAOD peripheral arterial occlusive disease
  • the present invention provides a method for increasing blood flow in an ischemic tissue of a patient, comprising delivering an angiogenic protein or peptide to an ischemic region of said tissue by introducing a vector comprising the transgene to the tissue, whereby the transgene is expressed in the tissue, and blood flow in the tissue is increased.
  • the vector comprising a transgene encoding an angiogenic protein or peptide, is introduced into ischemic skeletal muscle, wherein the angiogenic protein or peptide is expressed and causes an increase in blood flow and a decrease in ischemia in the tissue.
  • the vector is introduced into a blood vessel supplying blood to the ischemic tissue (e.g.
  • the vectors employed in the invention can be a plasmid or preferably a viral vector, for example a replication-deficient adenovirus.
  • a viral vector for example a replication-deficient adenovirus.
  • the present invention provides a method for increasing contractile function in the heart of a patient, comprising delivering a transgene encoding an angiogenic protein or peptide to the myocardium of the patient by introducing a vector comprising the transgene to the myocardium (preferably by delivery to one or more coronary arteries), wherein the transgene is delivered to the myocardium and expressed, and contractile function in the heart is increased.
  • the transgene may be introduced by, for example, intracoronary injection into one or more coronary arteries or saphenous vein or internal mammary artery grafts supplying blood to the myocardium.
  • the transgene preferably encodes at least one angiogenic protein or peptide.
  • the vectors employed in the invention can be a plasmid or preferably a viral vector, including, by way of illustration, a replication-deficient adenovirus.
  • a viral vector including, by way of illustration, a replication-deficient adenovirus.
  • FIG. 1 graphically presents percent wall thickening during pacing in a porcine model of congestive heart failure. Percent wall thickening was assessed sequentially in the interventricular septum and lateral wall before pacing (day 0) and every 7 days as heart failure progressed (as described in Example 1). Symbols represent mean values; error bars denote one standard deviation (1 SD).
  • Figures 2A and 2B graphically present subendocardial blood flow during pacing in a porcine model of congestive heart failure, as described in Example 1.
  • subendocardial (endo) blood flow was assessed sequentially in the interventricular septum and lateral wall under the conditions listed along the x axis.
  • Day refers to the day of sustained pacing that measurements were obtained (0, initiation of pacing; 14, 14 days; 21-28, 21 to 28 days).
  • PACE refers to whether blood flow determinations were obtained with pacemaker activated (+) or inactivated (0).
  • Figure 3A graphically presents meridional end-systolic wall stress as assessed sequentially in the interventricular septum and lateral wall before pacing (day 0) and every 7 days as heart failure progressed (described in Example 1).
  • Two-way ANOVA (repeated measures) showed that systolic wall stress was affected by duration of pacing (EO.0001). However, the pattern of systolic wall stress was similar in both regions. Measurements were made with pacemakers inactivated.
  • Figure 3B graphically presents coronary vascular resistance during pacing in a porcine model of congestive heart failure, as described in Example 1. An index of coronary vascular resistance was assessed sequentially in the interventricular septum and lateral wall under the conditions listed along the x axis. Symbols and conditions are the same as in Fig 2.
  • Figure 4 shows a schematic of the construction of an exemplary replication- defective recombinant adenovirus vector useful for gene transfer, as described in the Examples below.
  • Figure 5 is a schematic figure which shows rescue recombination construction of a transgene-encoding adenovirus.
  • Figures 6 A and 6B graphically present the regional contractile function of the treated animals, as described in Example 5.
  • Figure 6 A shows results of animals examined 2 weeks post gene transfer and
  • Figure 6B shows results 12 weeks post gene transfer.
  • Figures 7A, 7B and 7C show diagrams corresponding to myocardial contrast echocardiographs. White areas denote contrast enhancement (more blood flow) and dark areas denote decreased blood flow.
  • Figure 7A illustrates acute LCx occlusion in a normal pig.
  • Figure 7B illustrates the difference in contrast enhancement between IVS and LCx bed 14 days after gene transfer with lacZ, indicating different blood flows in two regions during atrial pacing (200 bpm).
  • Figure 7C contrast enhancement appears equivalent in
  • FIG. 8 shows the peak contrast ratio (a correlate of blood flow) expressed as the ratio of the peak video intensity in the ischemic region (LCx bed) divided by the peak video intensity in the interventricular septum (INS), measured from the video images using a computer-based video analysis program during atrial pacing (200 bpm) before and 14 ⁇ 1 days after gene transfer with lacZ (control gene) and with FGF-5, and in 5 animals, 12 weeks after FGF-5 gene transfer (described in Example 5).
  • INS interventricular septum
  • FIG. 9 shows vessel number as quantitated by microscopic analysis in the ischemic and nonischemic regions after gene transfer with FGF-5 and with lacZ (described in Example 5). There was increased capillary number surrounding each fiber in the ischemic and nonischemic regions of animals that received FGF-5 gene transfer (p ⁇ 0.038) compared to animals that received the lacZ gene.
  • Figures 10A, 10B and 10C are from gels documenting D ⁇ A, mR ⁇ A and protein expression after gene transfer of an angiogenic transgene to the myocardium according to the present invention (as described in Example 5).
  • Figure 10D is from a gel following PCR amplification demonstrating the absence of any detectable gene transfer to the retina, liver or skeletal muscle of treated animals (as described in Example 5).
  • Figure 11 shows a comparison of wall thickening achieved with in vivo gene transfer using different angiogenic gene constructs, FGF-4, FGF-5 and FGF-2LI +/- sp (i.e. FGF-2LI plus or minus secretion signal peptide), as described in examples 6 and 7.
  • Figure 12 shows that improved function in the ischemic region after FGF-4 gene transfer (as indicated by wall thickening) was associated with improved regional perfusion.
  • Figure 13 shows a comparison of perfusion (blood flow) resulting from injection of
  • Figure 14 shows a comparison of wall thickening as a result of gene transfer with FGF-2 plus (FGF-2LI+sp) or minus secretion signal peptide (FGF-2LI-sp), as described in Example 7.
  • Heart disease refers to acute and/or chronic cardiac dysfunctions. Heart disease is often associated with a decrease in cardiac contractile function and may be associated with an observable decrease in blood flow to the myocardium (e.g., as a result of coronary artery disease). Manifestations of heart disease include myocardial ischemia, which may result in angina, heart attack and/or congestive heart failure.
  • Myocardial ischemia is a condition in which the heart muscle does not receive adequate levels of oxygen and nutrients, which is typically due to inadequate blood supply to the myocardium (e.g., as a result of coronary artery disease).
  • Heart failure is clinically defined as a condition in which the heart does not provide adequate blood flow to the body to meet metabolic demands. Symptoms include breathlessness, fatigue, weakness, leg swelling, and exercise intolerance. On physical examination, patients with heart failure tend to have elevations in heart and respiratory rates, rales (an indication of fluid in the lungs), edema, jugular venous distension, and, in many cases, enlarged hearts. Patients with severe heart failure suffer a high mortality; typically 50% of the patients die within two years of developing the condition. In some cases, heart failure is associated with severe coronary artery disease ("CAD"), typically resulting in myocardial infarction and either progressive chronic heart failure or an acute low output state, as described herein and in the art. In other cases, heart failure is associated with dilated cardiomyopathy without associated severe coronary artery disease.
  • CAD severe coronary artery disease
  • Peripheral vascular disease refers to acute or chronic dysfunction of the peripheral (i.e., non-cardiac) vasculature and/or the tissues supplied thereby.
  • peripheral vascular disease typically results from an inadequate blood flow to the tissues supplied by the vasculature, which lack of blood may result, for example, in ischemia or, in severe cases, in tissue cell death.
  • aspects of peripheral vascular disease include, without limitation, peripheral arterial occlusive disease (PAOD) and peripheral muscle ischemia.
  • PAOD peripheral arterial occlusive disease
  • symptoms of peripheral vascular disease are manifested in the extremities of the patient, especially the legs.
  • the terms "having therapeutic effect” and “successful treatment” carry essentially the same meaning.
  • a patient suffering from heart disease is successfully "treated” for the condition if the patient shows observable and/or measurable reduction in or absence of one or more of the symptoms of heart disease after receiving an angiogenic factor transgene according to the methods of the present invention. Reduction of these signs or symptoms may also be felt by the patient.
  • indicators of successful treatment of heart disease conditions include the patient showing or feeling a reduction in any one of the symptoms of angina pectoris, fatigue, weakness, breathlessness, leg swelling, rales, heart or respiratory rates, edema or jugular venous distension.
  • the patient may also show greater exercise tolerance, have a smaller heart with improved ventricular and cardiac function, and in general, require fewer hospital visits related to the heart condition.
  • the improvement in cardiovascular function may be adequate to meet the metabolic needs of the patient and the patient may not exhibit symptoms under mild exertion or at rest. Many of these signs and symptoms are readily observable by eye and/or measurable by routine procedures familiar to a physician.
  • Indicators of improved cardiovascular function include increased blood flow and/or contractile function in the treated tissues. As described below, blood flow in a patient can be measured by thallium imaging (as described by Braunwald in Heart Disease, 4 th ed., pp. 276-311 (Saunders,
  • LV ejection fraction
  • Blood flow and contractile function can likewise be measured in peripheral tissues treated according to the present invention.
  • angiogenic protein or peptide refers to any protein or peptide capable of promoting angiogenesis or angiogenic activity, i.e. blood vessel development.
  • a "polynucleotide” refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule, and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modified polynucleotides such as methylated and/or capped polynucleotides.
  • Recombinant means that the polynucleotide is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
  • a “gene” or “transgene” refers to a polynucleotide or portion of a polynucleotide comprising a sequence that encodes a protein. For most situations, it is desirable for the gene to also comprise a promoter operably linked to the coding sequence in order to effectively promote transcription. Enhancers, repressors and other regulatory sequences may also be included in order to modulate activity of the gene, as is well known in the art.
  • polypeptide As used interchangeably to refer to polymers of amino acids of any length. These terms also include proteins that are post- translationally modified through reactions that include glycosylation, acetylation and phosphorylation.
  • heterologous component refers to a component that is introduced into or produced within a different entity from that in which it is naturally located.
  • a polynucleotide derived from one organism and introduced by genetic engineering techniques into a different organism is a heterologous polynucleotide which, if expressed, can encode a heterologous polypeptide.
  • a promoter or enhancer that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous promoter or enhancer.
  • promoter refers to a polynucleotide sequence that controls transcription of a gene or coding sequence to which it is operably linked.
  • a large number of promoters, including constitutive, inducible and repressible promoters, from a variety of different sources, are well known in the art (and identified in databases such as GenBank) and are available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources).
  • an “enhancer,” as used herein, refers to a polynucleotide sequence that enhances transcription of a gene or coding sequence to which it is operably linked.
  • enhancers from a variety of different sources are well known in the art (and identified in databases such as GenBank) and available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources).
  • a number of polynucleotides comprising promoter sequences (such as the commonly-used CMV promoter) also comprise enhancer sequences.
  • operably linked refers to a juxtaposition of two or more components, wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a promoter is operably linked to a gene or coding sequence if the promoter controls transcription of the gene or coding sequence.
  • an operably linked promoter is generally located upstream of the coding sequence, it is not necessarily contiguous with it.
  • An enhancer is operably linked to a coding sequence if the enhancer increases transcription of the coding sequence. Operably linked enhancers can be located upstream, within or downstream of coding sequences.
  • a polyadenylation sequence is operably linked to a coding sequence if it is located at the downstream end of the coding sequence such that transcription proceeds through the coding sequence into the polyadenylation sequence.
  • a "replicon” refers to a polynucleotide comprising an origin of replication which allows for replication of the polynucleotide in an appropriate host cell. Examples include chromosomes of a target cell into which a heterologous nucleic acid might be integrated (e.g., nuclear and mitochondrial chromosomes), as well as extrachromosomal replicons (such as replicating plasmids and episomes).
  • Gene delivery are terms referring to the introduction of an exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, irrespective of the method used for the introduction.
  • exogenous polynucleotide sometimes referred to as a "transgene”
  • Such methods include a variety of well-known techniques such as vector-mediated gene transfer (by, e.g., viral infection transfection, or various other protein-based or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of "naked” polynucleotides (such as electroporation, "gene gun” delivery and various other techniques used for the introduction of polynucleotides).
  • the introduced polynucleotide may be stable or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon
  • plasmid e.g., a plasmid
  • nuclear or mitochondrial chromosome e.g., a nuclear or mitochondrial chromosome.
  • vectors are known to be capable of mediating transfer of genes to mammalian cells, as is known in the art and described herein.
  • In vivo gene delivery, gene transfer, gene therapy and the like as used herein, are terms referring to the introduction of a vector comprising an exogenous polynucleotide directly into the body of an organism, such as a human or non-human mammal, whereby the exogenous polynucleotide is introduced into a cell of such organism in vivo.
  • a "vector” (sometimes referred to as a gene delivery or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo.
  • the polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy.
  • “Vasculature” or “vascular” are terms referring to the system of vessels carrying blood (as well as lymph fluids) throughout the mammalian body.
  • Blood vessel refers to any of the vessels of the mammalian vascular system, including arteries, arterioles, capillaries, venules, veins, sinuses, and vasa vasorum.
  • vectors comprising angiogenic transgenes are introduced directly into vascular conduits supplying blood to the myocardium.
  • vascular conduits include the coronary arteries as well as vessels such as saphenous veins or internal mammary artery grafts.
  • Angiogenesis refers to a blood vessel through which blood passes away from the heart. Coronary arteries supply the tissues of the heart itself, while other arteries supply the remaining organs of the body.
  • the general structure of an artery consists of a lumen surrounded by a multi-layered arterial wall.
  • An “individual” or a “patient” refers to a mammal, preferably a large mammal, most preferably a human.
  • Treatment refers to administering, to an individual patient, agents that are capable of eliciting a prophylactic, curative or other beneficial effect on the individual.
  • Gene therapy refers to administering, to an individual patient, vectors comprising a therapeutic gene or genes.
  • a “therapeutic polynucleotide” or “therapeutic gene” refers to a nucleotide sequence that is capable, when transferred to an individual, of eliciting a prophylactic, curative or other beneficial effect in the individual.
  • the present invention relates to methods and compositions for treating cardiovascular diseases including myocardial ischemia, heart failure and peripheral vascular disease.
  • a vector construct containing a gene encoding an angiogenic protein or peptide is targeted to the heart of a patient whereby the exogenous angiogenic protein is expressed in the myocardium, thus ameliorating cardiac dysfunction by improving blood flow and/or improving cardiac contractile function.
  • Improved heart function ultimately leads to the reduction or disappearance of one or more symptoms of heart disease or heart failure and prolonged life beyond the expected mortality.
  • a vector construct comprising a transgene encoding at least one angiogenic protein or peptide is targeted to the affected tissue, for example ischemic skeletal muscle, whereby synthesis of the exogenous angiogenic protein ameliorates and/or cures symptoms of the peripheral vascular disease, for example by increasing blood flow to the affected (e.g., ischemic) region of the tissue and/or, in muscle, by improving contractile function of the affected muscle.
  • the affected tissue for example ischemic skeletal muscle
  • the present invention provides a method for treating heart disease in a patient having myocardial ischemia, comprising delivering a transgene- inserted vector to the myocardium of the patient by intracoronary injection, preferably by injecting the vector directly into one or both coronary arteries (or grafts), whereby the transgene is expressed and blood flow and/or contractile function are improved.
  • angiogenesis can be promoted in the affected region of the myocardium.
  • transgenes such as those encoding beta-adrenergic signaling proteins or other cardiac- or muscle-enhancing proteins, can also be used, as described below, in conjunction with the use of an angiogenic transgene.
  • the vectors employed in the invention can be a plasmid or preferably a viral vector, for example a replication-deficient adenovirus or adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the present invention can also be used to treat a patient suffering from congestive heart failure, by delivering a transgene-inserted vector to the heart of said patient, the vector comprising a transgene encoding an angiogenic protein or peptide, whereby the transgene is expressed in the myocardium resulting in increased blood flow and function in the heart.
  • a transgene-inserted vector comprising a transgene encoding an angiogenic protein or peptide, whereby the transgene is expressed in the myocardium resulting in increased blood flow and function in the heart.
  • the vector is preferably introduced into a blood vessel supplying blood to the myocardium of the heart, so as to deliver the vector to the myocardium.
  • the vector is introduced into the lumen of a coronary artery, a saphenous vein graft, or an internal mammary artery graft; most preferably, the vector is introduced into the lumen of both a left and right coronary artery.
  • the intracoronary injection is preferably made, as a single injection, relatively deeply within each of the selected artery(s), (e.g., preferably at least about 1 cm into the lumens of the vessel(s)).
  • the techniques of the present invention are also useful to prevent or alleviate deleterious ventricular remodeling in a patient who has suffered (or may suffer) a myocardial infarction.
  • a vector comprising a transgene encoding an angiogenic protein or peptide, preferably operably linked to a promoter for expression of the gene, is delivered to the heart of the patient, where the transgene is expressed and the deleterious ventricular remodeling alleviated.
  • one or more transgenes encoding an angiogenic protein or peptide factor that can enhance blood flow and/or contractile function can be used. Any protein or peptide that exhibits angiogenic activity, measurable by the methods described herein and in the art, can be potentially employed in connection with the present invention. A number of such angiogenic proteins are known in the art and new forms are routinely identified. Suitable angiogenic proteins or peptides are exemplified by members of the family of fibroblast growth factors (FGF), vascular endothelial growth factors (VEGF), platelet-derived growth factors (PDGF), insulin-like growth factors (IGF), and others.
  • FGF fibroblast growth factors
  • VEGF vascular endothelial growth factors
  • PDGF platelet-derived growth factors
  • IGF insulin-like growth factors
  • FGF-1 aFGF
  • FGF-2 bFGF
  • FGF-4 also known as "hst/KS3"
  • FGF-5 FGF-6
  • VEGF has been shown to be expressed by cardiac myocytes in response to ischemia in vitro and in vivo; it is a regulator of angiogenesis under physiological conditions as well as during the adaptive response to pathological states (Banai et al. Circulation 89:2183-2189, 1994).
  • the VEGF family includes, but is not limited to, members of the VEGF-A sub-family (e.g.
  • VEGF-121 VEGF-145, VEGF-165, VEGF-189 and VEGF-206
  • members of the VEGF-B sub-family e.g. VEGF- 167 and VEGF- 186) and the VEGF-C sub-family.
  • PDGF includes, e.g., PDGF A and PDGF B
  • IGF includes, for example, IGF-1.
  • Other angiogenic proteins or peptides are known in the art and new ones are regularly identified. The nucleotide sequences of genes encoding these and other proteins, and the corresponding amino acid sequences are likewise known in the art (see, e.g., the GENBANK sequence database).
  • Angiogenic proteins and peptides include peptide precursors that are post- translationally processed into active peptides and "derivatives" and “functional equivalents” of angiogenic proteins or peptides.
  • Derivatives of an angiogenic protein or peptide are peptides having similar amino acid sequence and retaining, to some extent, one or more activities of the related angiogenic protein or peptide.
  • useful derivatives generally have substantial sequence similarity (at the amino acid level) in regions or domains of the protein associated with the angiogenic activity.
  • functional equivalent is meant a protein or peptide that has an activity that can substitute for one or more activities of a particular angiogenic protein or peptide.
  • Preferred functional equivalents retain all of the activities of a particular angiogenic protein or peptide; however, the functional equivalent may have an activity that, when measured quantitatively, is stronger or weaker than the wild-type peptide or protein.
  • FGF family see, e.g., Burgess, Ann. N.Y. Acad. Sci. 638: 89-97,
  • angiogenic proteins can promote angiogenesis by enhancing the expression, stability or functionality of other angiogenic proteins.
  • angiogenic proteins or peptides include, e.g., regulatory factors that are induced in response to hypoxia (e.g. the hypoxia-inducible factors such as Hif-1, Hif-2 and the like; see, e.g., Wang et al., Proc. Natl. Acad. Sci. USA 90(9): 4304-8, 1993;
  • angiogenic proteins include certain insulin-like growth factors (e.g., IGF-1) and angiopoietins (Angs), which have been reported to promote and/or stimulate expression and/or activity of other angiogenic proteins such as VEGF (see e.g.
  • angiogenic polypeptides include natural and synthetic regulatory peptides (angiogenic polypeptide regulators) that act as promoters of endogenous angiogenic genes.
  • angiogenic polypeptide regulators can be derived from inducers of endogenous angiogenic genes. Hif, as described above, is one illustrative example of such an angiogenic gene which has been reported to promote angiogenesis by inducing expression of other angiogenic genes.
  • Synthetic angiogenic polypeptide regulators can be designed, for example, by preparing multi-finger zinc-binding proteins that specifically bind to sequences upstream of the coding regions of endogenous angiogenic genes and which can be used to induce the expression of such endogenous genes.
  • Studies of numerous genes has led to the development of "rules" for the design of such zinc-finger DNA binding proteins (see, e.g., Rhodes and Klug, Scientific American, February 1993, pp 56-65; Choo and Klug, Proc. Natl. Acad. Sci. USA, 91(23): 11163-7, 1994; Rebar and Pabo, Science, 263(5147): 671-3, 1994; Choo et al., J. Mol.
  • the angiogenic protein-encoding transgene is operably linked to a promoter that directs transcription and expression of the gene in a mammalian cell, such as a cell in the heart or in the skeletal muscle.
  • a promoter that directs transcription and expression of the gene in a mammalian cell, such as a cell in the heart or in the skeletal muscle.
  • a CMV promoter is a CMV promoter.
  • the promoter is a tissue-specific promoter, such as a cardiac-specific promoter (e.g., a cardiomyocyte- specific promoter).
  • the gene encoding the angiogenic factor is also operably linked to a polyadenylation signal.
  • preferred angiogenic proteins or peptides include those which are naturally secreted or have been modified to permit secretion, such as by operably linking to a signal peptide.
  • a gene encoding a secreted angiogenic protein, such as, FGF-4, FGF-5, or FGF-6 is prefened since these proteins contain functional secretory signal sequences and are readily secreted from cells.
  • Many if not most human VEGF proteins include but not limited to VEGF-121 and VEGF- 165) also are readily secreted and diffusible after secretion.
  • angiogenic proteins when expressed, can readily access the cardiac interstitium and induce angiogenesis.
  • Blood vessels that develop in angiogenesis include capillaries which are the smallest caliber blood vessels having a diameter of about 8 microns, and larger caliber blood vessels that have a diameter of at least about 10 microns.
  • Angiogenic activity can be determined by measuring blood flow, increase in function of the treated tissue or the presence of blood vessels, using procedures known in the art or described herein. For example, capillary number or density can be quantitated in an animal visually or by microscopic analysis of the tissue site (see Example 5).
  • angiogenic proteins such as aFGF (FGF-1) and bFGF (FGF-2) that lack a native secretory signal sequence
  • fusion proteins having secretory signal sequences can be recombinantly produced using standard recombinant DNA methodology familiar to one of skill in the art. It is believed that both aFGF and bFGF are naturally secreted to some degree; however, inclusion of an additional secretion signal sequence can be used to enhance secretion of the protein.
  • the secretory signal sequence would typically be positioned at the N-terminus of the desired protein but can be placed at any position suitable to allow secretion of the angiogenic factor.
  • a polynucleotide containing a suitable signal sequence can be fused 5' to the first codon of the selected angiogenic protein gene.
  • Suitable secretory signal sequences include signal sequences of the FGF-4, FGF-5, FGF-6 genes or a signal sequence of a different secreted protein such as
  • IL-1-beta Example 7 below exemplifies one type of modification of an angiogenic protein to contain a signal sequence from another protein, the modification achieved by replacement of residues in the angiogenic protein with residues that direct secretion of the secreted second protein.
  • a signal sequence derived from a protein that is normally secreted from cardiac myocytes can be used.
  • Angiogenic genes can also provide additional functions that can improve, for example cardiac cell function.
  • FGFs can provide cardiac enhancing and/or "ischemic protectant effects" that may be independent of their capability to promote angiogenesis.
  • angiogenic genes can be used to enhance cardiac function by mechanisms that are additional to or in place of the promotion of angiogenesis per se.
  • IGFs which can promote angiogenesis
  • muscle cell function see e.g. Musaro et al. Nature 400: 581-585, 1999; as well as exhibit anti-apoptotic effects (see e.g. Lee et al. Endocrinology 140: 4831-4840, 1999).
  • Other proteins which enhance muscle cell function can also be employed in accordance with the methods of the present invention.
  • genes encoding one or more angiogenic proteins or peptides can be used in conjunction with the present invention.
  • a gene or genes encoding a combination of angiogenic proteins or peptides can be delivered using one or more vectors according to the methods described herein.
  • the families of angiogenic genes described herein and in the art comprise numerous examples of such genes.
  • the genes may be derived from different families of angiogenic factors (such as a combination selected from two or more different members of the group consisting of FGFs, VEGFs, PDGFs and IGFs).
  • a vector comprising an FGF gene and a VEGF gene may be used.
  • FGF-4 fragment 140 see e.g., the FGF-4 gene and variants thereof described by Basilico et al., in U.S. Patent No. 5,459,250, issued 17 October 1995, and related cases
  • VEGF-145 mutein 2 see, e.g., the VEGF-145 gene and variants thereof described by
  • Vectors comprising angiogenic genes or combinations of angiogenic genes can also include one or more other genes that can be used to further enhance tissue blood flow and/or contractile function.
  • genes encoding beta-ASPs as described, by Hammond et al., in co-pending applications WO 98/10085, published 12 March 1998) can be employed in combination with one or more genes encoding angiogenic proteins or peptides.
  • Other cardiac or muscle cell enhancing proteins can similarly be incorporated into the compositions and methods of the present invention.
  • Combinations of genes that can be employed in accordance with the present invention can be provided within a single vector (e.g., as separate genes, each under the control of a promoter, or as a single transcriptional or translational fusion gene). Combinations of genes can also be provided as a combination of vectors (which may be derived from the same or different vectors, such as a combination of adenovirus vectors, or an adenovirus vector and an AAV vector); which can be introduced to a patient coincidentally or in series.
  • Ad Adenovirus
  • AAV Adeno-associated virus
  • Ad vector may thus be introduced coincident with or prior to introduction of an AAV vector according to the present invention.
  • choice of vector is also influenced by the desired longevity of transgene expression.
  • angiogenic genes may be introduced using an adenovirus (or other vector that does not normally integrate into host DNA) which might be used prior to or in combination with the introduction of an AAV vector carrying a transgene for which longer-term expression is desired (e.g., a beta- ASP transgene).
  • transgenes and/or vectors will be apparent to those of skill in the art based on the teachings and illustrations of the present invention.
  • genes encoding angiogenic proteins of human origin are preferred although angiogenic proteins of other mammalian origin that exhibit cross- species activity i.e. having angiogenic activity in humans, can also be used.
  • the gene of interest is transferred to the heart or to the peripheral vasculature in vivo, and directs production of the encoded protein.
  • the gene of interest is transferred to the heart or to the peripheral vasculature in vivo, and directs production of the encoded protein.
  • Preferably such production is constitutive (although inducible expression systems can also be employed).
  • Vectors useful in the present invention include viral vectors, lipid-based vectors (e.g., liposomes) and other vectors that are capable of delivering DNA to non-dividing cells in vivo.
  • viral vectors particularly replication-defective viral vectors including, for example, replication-defective adenovirus vectors and adeno- associated virus vectors.
  • replication-defective adenovirus vectors are presently most preferred.
  • Adenovirus efficiently infects non-dividing cells and is therefore useful for expressing recombinant genes in the myocardium because of the nonreplicative nature of cardiac myocytes.
  • vectors suitable for in vivo gene therapy can readily be employed to deliver angiogenic protein transgenes for use in the present invention.
  • Such other vectors include other viral vectors (such as AAV), non-viral protein-based delivery platforms, as well as lipid-based vectors (such as liposomes, micelles, lipid-containing emulsions and others that have been described in the art).
  • AAV vectors are preferably replication-defective in humans, such as for example, having the rep and cap genes removed (which sequence must therefore be supplied in trans to replicate and package AAV vectors, typically in a packaging cell line) and the inserted transgene (including, for example, a promoter operably linked thereto) is preferably flanked by AAV inverted terminal repeats (ITRs).
  • Recombinant viral vectors comprise one or more heterologous genes or sequences.
  • the heterologous genes or sequences are typically introduced by replacing one or more portions of the viral genome.
  • viruses may become replication-deficient, as a result of the deletions, thereby requiring the deleted function(s) to be provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying genes necessary for replication and/or encapsidation) (see, e.g., the references and illustrations below).
  • modified AAV vectors in which transgenes are inserted in place of viral rep and/or cap genes are likewise well known in the art.
  • modified viral vectors in which a polynucleotide to be delivered is carried on the outside of the viral particle have also been described (see, e.g., Curiel, DT, et al. PNAS 88:8850-8854, 1991). References describing a these and other gene delivery vectors are known in the art, a number of which are cited herein.
  • vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells.
  • Such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector by the cell; components that influence processing and/or localization of the vector and its nucleic acid within the cell after uptake (such as agents mediating intracellular processing and/or nuclear localization); and components that influence expression of the polynucleotide.
  • Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector.
  • Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities.
  • a detectable marker gene allows cells carrying the gene to be specifically detected (e.g., distinguished from cells which do not carry the marker gene).
  • One example of such a detectable marker gene is the lacZ gene, encoding beta-galactosidase, which allows cells transduced with a vector carrying the lacZ gene to be detected by staining, as described below.
  • Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated.
  • marker genes have been described, including bifunctional (i.e. positive/negative) markers (see, e.g., Lupton, S., WO 92/08796, published 29 May 1992; and Lupton, S., WO 94/28143, published 8 December 1994).
  • Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts.
  • a large variety of such vectors are known in the art and are generally available (see, e.g., the various references cited above).
  • references describing adenovirus vectors and other viral vectors which could be used in the methods of the present invention include the following: Horwitz, M.S., Adenoviridae and Their Replication, in Fields, B., et al.. (eds.) Virology, Vol. 2, Raven
  • adenovirus plasmids are also available from commercial sources, including, e.g., Microbix
  • retro virus-derived systems have also been developed to be used in in vivo gene delivery.
  • the lenti virus genus of retro viruses for example, human immunodeficiency virus, feline immunodeficiency virus and the like
  • retro viruses can be modified so that they are able to transduce cells that are typically non-dividing (see, e.g., Poeschla et al., PNAS 96:11395- 11399, 1996; Naldini et al., PNAS 96:11382-11388, 1996; Naldini et al., Science 272:263- 267, 1996; Srinivasakumar et al., J. Virol. 71: 5841-5848, 1997; Zufferey et al., Nat.
  • HlV-based lentiviral vector systems have received some degree of focus in this regard, other lentiviral systems have recently been developed, such as feline immunodeficiency virus-based lentivirus vector systems, that offer potential advantages over the HlV-based systems (see e.g. Poeschla et al., Nat. Med.
  • non-viral vectors that may be employed as a gene delivery means are likewise known and continue to be developed.
  • non- viral protein-based delivery platforms such as macromolecular complexes comprising a DNA binding protein and a carrier or moiety capable of mediating gene delivery
  • lipid- based vectors such as liposomes, micelles, lipid-containing emulsions and others
  • References describing non-viral vectors which could be used in the methods of the present invention include the following: Ledley, FD, Human Gene Therapy 6: 11 29-1144, 1995; Miller, N., et al., FASEB Journal 9: 190-199, 1995; Chonn, A., et al., OUT. Opin. in Biotech.
  • a vector such as a viral vector
  • a vasoactive agent for example histamine or a histamine agonist, or a vascular endothelial growth factor (VEGF) protein, as described herein and further illustrated in co-pending PCT application WO 99/40945, published 19 Aug. 1999.
  • VEGF vascular endothelial growth factor
  • vasoactive agent that can be employed to enhance the efficiency of gene delivery is a nitric oxide donor such as sodium nitroprusside. Most preferably the vasoactive agent is infused into the blood vessel or tissue coincidently with and/or within several minutes prior to introduction of the vector.
  • Vasoactive agent refers to a natural or synthetic substance that induces increased vascular permeability and/or enhances transfer of macromolecules such as gene delivery vectors from blood vessels, e.g. across capillary endothelia.
  • vasoactive agents can enhance delivery of these vectors to the targeted sites and thus effectively enhance overall expression of the transgene in the target tissue.
  • histamine as a vasoactive agent and such was found to substantially enhance delivery of a vector to an infused site such as the myocardium.
  • Histamine derivatives and agonists, such as those that interact with histamine H receptors, which can be employed include, for example, 2- methylhistamine, 2-pyridylethylamine, betahistine, and 2 thiazolylethylamine.
  • histamine agonists are described, for example, in Garrison JC, Goodman and Gilman's The Pharmacological Basis of Therapeutics (8th Ed: Gilman AG, Rail TW, Nies AS, Taylor P, eds) Pergamon Press, 1990, pp 575-582 and in other pharmacological treatises.
  • vascular endothelial growth factors VEGFs
  • VEGF agonists as described herein and in the cited references
  • the VEGF is preferably infused into a blood vessel supplying the target site over several minutes prior to infusion of vector.
  • Nitric oxide donors such as sodium nitroprusside (SNP) can also be employed as vasoactive agents.
  • the nitric oxide donor e.g., SNP
  • the target tissue or blood vessel supplying a target tissue
  • Administration can also be continued during infusion of the vector composition.
  • Adenoviral Vector that is Helper-Independent and Replication- Deficient in Humans
  • the gene of interest is transferred to the heart or to the peripheral vasculature, in vivo, and directs production of the encoded protein.
  • a helper-independent replication- deficient system based on human adenovirus 5 (Ad5).
  • Ad5 human adenovirus 5
  • Non-replicative recombinant adenoviral vectors are particularly useful in transfecting coronary endothelium and cardiac myocytes resulting in highly efficient transfection after intracoronary injection.
  • Adenovirus vectors can also be used to transfect tissue supplied by the peripheral vasculature, e.g., by intra-arterial or direct injection.
  • the helper-independent replication-defective human adenovirus 5 system can be used to effectively transfect a large percentage of myocardial cells in vivo by a single intracoronary injection.
  • Such a delivery technique can be used to effectively target vectors to the myocardium of a large mammal heart. Additional means of targeting vectors to particular cells or tissue types are described below and in the art.
  • the recombinant adenovirus vectors used are based on the human adenovirus 5 (as described by McGrory WJ et al., Virology
  • adenovirus genome 163:614-617, 1988 which are missing essential early genes from the adenovirus genome (usually El A/El B), and are therefore unable to replicate unless grown in permissive cell lines that provide the missing gene products in trans.
  • a transgene of interest can be cloned and expressed in tissue/cells infected with the replication-defective adenovirus.
  • adenovirus-based gene transfer does not result in stable integration into the target cell genome.
  • adenovirus vectors can be propagated in high titer and transfect non-replicating cells; and, although the transgene is not passed to daughter cells, this is suitable for gene transfer to adult cardiac myocytes, which do not actively divide.
  • Retrovirus vectors provide stable gene transfer, and high titers are now obtainable via retrovirus pseudotyping (Burns, et al.,
  • the increased blood flow correlated with an increase in the number of capillaries in the heart (see Example 5). Wall thickening also increased within two weeks after gene transfer and persisted for at least 12 weeks. Thus, the angiogenic factor gene does not have to be present in the infected cell for more than a few weeks to produce a therapeutic effect. Once the blood vessels have developed, continued expression of the exogenous angiogenic protein may not be required to maintain the new vascular structure and increased blood flow.
  • An advantage associated with non-dividing cells such as myocytes is that the viral vector is not readily "diluted out" by host cell division.
  • Human 293 cells (Accession No. ATCC CRL1573; Rockville, MD), which are human embryonic kidney cells transformed with adenovirus El A/El B genes, typify useful permissive cell lines for the production of such replication-defective vectors.
  • Other cell lines which allow replication-defective adenovirus vectors to propagate therein can also be used, such as HeLa cells.
  • Adenoviral vectors used in the present invention can be constructed by the rescue recombination technique described in Graham, Virology 163:614-617, 1988. Briefly, the transgene of interest is cloned into a shuttle vector that contains a promoter, polylinker and partial flanking adenoviral sequences from which E1A/E1B genes have been deleted.
  • plasmid pACl (Virology 163:614-617, 1988) (or an analog) which encodes portions of the left end of the human adenovirus 5 genome (Virology 163:614- 617, 1988) minus the early protein encoding E1A and El B sequences that are essential for viral replication, and plasmid ACCMVPLPA (Gomez-Foix et al., J. Biol. Chem. 267:
  • plasmid pACl or ACCMVPLA facilitates the cloning process.
  • the shuttle vector is then co-transfected with a plasmid which contains the entire human adenoviral 5 genome with a length too large to be encapsulated, into 293 cells. Co-transfection can be conducted by calcium phosphate precipitation or lipofection (Zhang et al., Biotechniques 15:868-872, 1993).
  • Plasmid JM17 encodes the entire human adenovirus 5 genome plus portions of the vector pBR322 including the gene for ampicillin resistance (4.3 kb). Although JM17 encodes all of the adenoviral proteins necessary to make mature viral particles, it is too large to be encapsulated (40 kb versus 36 kb for wild type).
  • rescue recombination between the transgene containing the shuttle vector such as plasmid pACl and the plasmid having the entire adenoviral 5 genome such as plasmid pJM17 provides a recombinant genome that is deficient in the EIA EIB sequences, and that contains the transgene of interest but secondarily loses the additional sequence such as the pBR322 sequences during recombination, thereby being small enough to be encapsulated (see Figure 1).
  • Limiting expression of the angiogenic transgene to the heart, or to particular cell types within the heart (e.g. cardiac myocytes) or to other target tissues, such as those in the peripheral vasculature, can provide certain advantages as discussed below.
  • the present invention contemplates the use of targeting not only by delivery of the transgene into the coronary artery or other tissue-specific conduit, for example, but also by use of targeted vector constructs having features that tend to target gene delivery and/or gene expression to particular host cells or host cell types (e.g. cardiac or other myocytes).
  • targeted vector constructs would thus include targeted delivery vectors and/or targeted vectors, as described in more detail below and in the published art.
  • Restricting delivery and/or expression can be beneficial as a means of further focusing the potential effects of gene therapy.
  • the potential usefulness of further restricting delivery/expression depends in large part on the type of vector being used and the method and place of introduction of such vector.
  • delivery of viral vectors via intracoronary injection to the myocardium has been observed to provide, in itself, highly targeted gene delivery (see the Examples below).
  • cardiac myocytes are expected to exhibit relatively long transgene expression since the cells do not generally replicate.
  • expression in rapidly dividing cells such as endothelial cells would tend to be decreased by cell division and turnover.
  • other means of limiting delivery and/or expression can also be employed, in addition to or in place of the illustrated delivery methods, as described herein.
  • Targeted delivery vectors include, for example, vectors (such as viruses, non- viral protein-based vectors and lipid-based vectors) having surface components (such as a member of a ligand-receptor pair, the other half of which is found on a host cell to be targeted) or other features that mediate preferential binding and/or gene delivery to particular host cells or host cell types.
  • vectors such as viruses, non- viral protein-based vectors and lipid-based vectors
  • surface components such as a member of a ligand-receptor pair, the other half of which is found on a host cell to be targeted
  • other features that mediate preferential binding and/or gene delivery to particular host cells or host cell types.
  • a number of vectors of both viral and non-viral origin have inherent properties facilitating such preferential binding and/or have been modified to effect preferential targeting (see, e.g., Douglas et al., Nat. Biotech. 14:1574-1578, 1996; Kasahara, N. e
  • Targeted vectors include vectors (such as viruses, non-viral protein-based vectors and lipid-based vectors) in which delivery results in transgene expression that is relatively limited to particular host cells or host cell types.
  • angiogenic transgenes to be delivered according to the present invention can be operably linked to heterologous tissue-specific promoters thereby restricting expression to cells in that particular tissue.
  • tissue-specific transcriptional control sequences derived from a gene encoding a cardiomyocyte-specific myosin light chain (MLC) or myosin heavy chain (MHC) promoter can be fused to a transgene such as an FGF gene within a vector such as the adenovirus constructs described above. Expression of the transgene can therefore be relatively restricted to cardiac myocytes.
  • MLC cardiomyocyte-specific myosin light chain
  • MHC myosin heavy chain
  • the MLC promoter can comprise as few as about 250 bp, it easily fits within even size-restricted delivery vectors such as the adenovirus-5 packaging system exemplified herein.
  • the myosin heavy chain promoter known to be a vigorous promoter of transcription, provides another alternative cardiac-specific promoter, comprising less than about 300 bp. While other promoters, such as the troponin-C promoter do not provide tissue specificity, they are small and highly efficacious.
  • An unexpected finding of the present invention is that the recombinant adenovirus is taken up very efficiently in the first vascular bed that it encounters. Indeed, in the animal model of Example 4, the efficiency of the uptake of the virus in the heart after intracoronary injection, was 98%, i.e., 98% of the virus was removed in the first pass of the virus through the myocardial vascular bed. Furthermore, serum taken from the animals during the injection was incapable of growing viral plaques (Graham, Virology, 163:614- 617, 1988) until diluted 200-fold, suggesting the presence of a serum factor (or binding protein) that inhibits viral propagation. These two factors (efficient first pass attachment of virus and the possibility of a serum binding protein) may act together to limit gene expression to the first vascular bed encountered by the virus.
  • PCR polymerase chain reaction
  • Recombinant viral vectors such as adenoviral vectors
  • the resulting recombinant adenoviral viral vectors can be propagated in human 293 cells (which provide El A and E1B functions in trans) to titers in the preferred range of about 10 10 -10 12 viral particles/ml.
  • Propagation and purification techniques have been described for a variety of viral vectors that can be used in conjunction with the present invention.
  • Adenoviral vectors are exemplified herein but other viral vectors such as AAV can also be employed.
  • cells can be infected at 80% confluence and harvested 48 hours later.
  • the cellular debris is pelleted by centrifugation and the virus purified by CsCl gradient ultracentrifugation (double CsCl gradient ultracentrifugation is preferred).
  • the viral stocks Prior to in vivo injection, the viral stocks can be desalted
  • the desalted viral stock can also be filtered through a 0.3 micron filter if desired.
  • PBS phosphate buffered saline
  • the resulting viral stock typically has a final viral titer that is at least about 10 10 -10 12 viral particles/ml.
  • the recombinant adenovirus is highly purified and is substantially free of wild-type (potentially replicative) virus.
  • propagation and purification can be conducted to exclude contaminants and wild-type virus by, for example, identifying successful recombinant virus with PCR using appropriate primers, conducting two rounds of plaque purification, and double CsCl gradient ultracentrifugation.
  • a vector can be in the form of an injectable preparation containing a pharmaceutically acceptable carrier/diluent such as phosphate buffered saline, for example.
  • a pharmaceutically acceptable carrier/diluent such as phosphate buffered saline, for example.
  • Other pharmaceutical carriers, formulations and dosages are described below.
  • the presently preferred means of in vivo delivery for heart disease is by injection of the vector into a blood vessel or other conduit directly supplying the myocardium or tissue, preferably by injection into one or both coronary arteries or other tissue-specific arteries (or by a bolus injection into peripheral tissue).
  • a blood vessel or other conduit directly supplying the myocardium or tissue
  • coronary arteries or other tissue-specific arteries or by a bolus injection into peripheral tissue.
  • catheter is preferably achieved by catheter introduced substantially (typically at least about 1 cm) within the lumen of one or both coronary arteries or one or more saphenous veins or internal mammary artery grafts or other conduits delivering blood to the myocardium.
  • the injection is made in both left and right coronary arteries to provide general distribution to all areas of the heart (e.g., LAD, LCx and Right).
  • an adenoviral vector preparation in accordance herewith, optionally in combination with a vasoactive agent to enhance gene delivery as described herein, it is possible to perform effective adenovirus-mediated angiogenic gene transfer for the treatment of cardiovascular disease, for example clinical myocardial ischemia, or peripheral vascular disease without any undesirable effects.
  • the vectors are delivered in an amount sufficient for the transgene to be expressed and to provide a therapeutic benefit.
  • the final titer of the virus in the injectable preparation is preferably in the range of about 10 7 -10 13 viral particles which allows for effective gene transfer.
  • An adenovirus vector stock preferably free of wild-type virus can be injected deeply into the lumen of one or both coronary arteries (or grafts), preferably into both right and left coronary arteries (or grafts), and preferably in an amount of about 10 9 - 10 n viral particles as determined by optical densitometry.
  • the vector is delivered in a single injection into each conduit (e.g. into each coronary artery).
  • vasoactive agent preferably histamine or a histamine agonist or a vascular endothelial growth factor (VEGF) protein or a nitric oxide donor (e.g. sodium nitroprusside)
  • VEGF vascular endothelial growth factor
  • a nitric oxide donor e.g. sodium nitroprusside
  • the vector composition By injecting the vector composition directly into the lumen of the coronary artery by coronary catheters, it is possible to target the gene rather effectively, and to minimize loss of the recombinant vectors to the proximal aorta during injection.
  • This type of injection enables local transfection of a desired number of cells, especially cardiac myocytes, in the affected myocardium with angiogenic protein- or peptide-encoding genes, thereby maximizing therapeutic efficacy of gene transfer, and minimizing undesirable angiogenesis at extracardiac sites.
  • the vector can be introduced into one or more arteries supplying such tissue, or as a bolus injection into the tissue.
  • Vector constructs that are specifically targeted to the myocardium such as vectors incorporating myocardial-specific binding or uptake components, and/or which incorporate angiogenic protein transgenes that are under the control of myocardial-specific transcriptional regulatory sequences (e.g., cardiomyocyte-specific promoters) can be used in place of or, preferably, in conjunction with such directed injection techniques as a means of further restricting expression to the myocardium, (e.g. the ventricular myocytes).
  • myocardium e.g. the ventricular myocytes
  • it is preferable to inject the vector directly into a blood vessel supplying the myocardium as described above although the additional techniques for restricting the extracardiac delivery or otherwise reducing the potential for an immune response can also be employed.
  • Vectors targeted to tissues supplied by the peripheral vasculature such as vectors targeted to skeletal muscle or promoters specifically expressed in skeletal muscle, can likewise be employed.
  • transgene expression did not occur in hepatocytes and viral RNA could not be found in the urine at any time after intracoronary injection.
  • no evidence of extracardiac gene expression in the eye, liver, or skeletal muscle could be detected by PCR two weeks after intracoronary delivery of transgenes in this manner.
  • catheters and delivery routes can be used to achieve intracoronary delivery, as is known in the art (see, e.g., the references cited above, including: Topol, EJ (ed.), The Textbook of Interventional Cardiology, 2nd Ed. ( W.B. Saunders Co.
  • Direct intracoronary (or graft vessel) injection can be performed using standard percutaneous catheter based methods under fluoroscopic guidance. Any variety of coronary catheter, or a Stack perfusion catheter, for example, can be used in the present invention.
  • a variety of general purpose catheters, as well as modified catheters, suitable for use in the present invention are available from commercial suppliers such as Advanced Cardiovascular Systems (ACS), Target Therapeutics, Boston Scientific and Cordis. Also, where delivery to the myocardium is achieved by injection directly into a coronary artery
  • a catheter can be conveniently introduced into a femoral artery and threaded retrograde through the iliac artery and abdominal aorta and into a coronary artery.
  • a catheter can be first introduced into a brachial or carotid artery and threaded retrograde to a coronary artery.
  • the capillary bed of the myocardium can also be reached by retrograde perfusion, e.g., from a catheter placed in the coronary sinus.
  • Such a catheter may also employ a proximal balloon to prevent or reduce anterograde flow as a means of facilitating retrograde perfusion.
  • catheters can be introduced into arteries supplying such tissues (e.g., femoral arteries in the case of the leg) or may be introduced, by example, as a bolus injection or infusion into the affected tissue.
  • kits for use in accordance with the present invention.
  • kits may also incorporate one or more vasoactive agents to enhance gene delivery, and may further include instructions describing their use in accordance with any of the methods described herein.
  • the pig is a particularly suitable model for studying heart diseases of humans because of its relevance to human physiology.
  • the pig heart closely resembles the human heart in the following ways.
  • the pig has a native coronary circulation very similar to that of humans, including the relative lack of native coronary collateral vessels.
  • the size of the pig heart is similar to that of the human heart.
  • the pig is a large animal model, therefore allowing more accurate extrapolation of various parameters such as effective vector dosages, toxicity, etc.
  • the hearts of animals such as dogs and members of the murine family have a lot of endogenous collateral vessels.
  • the size of the dog heart is twice that of the human heart.
  • An animal model described herein in Example 5 is exemplary of myocardial ischemia. (Since, myocardial ischemia can also result in and/or occur in connection with congestive heart failure, this particular model is further relevant to that situation.)
  • This model it was demonstrated that vector-mediated delivery of a gene encoding an angiogenic protein alleviated myocardial ischemia and enhanced blood flow in the ischemic region. Collateral vessel development was likewise increased.
  • ischemic region Myocardial function and blood flow are normal at rest in the region previously perfused by the occluded artery (referred to as the ischemic region), but blood flow reserve is insufficient to prevent ischemia when myocardial oxygen demands increase, due to limited endogenous collateral vessel development.
  • the LCx bed is subject to episodic ischemia, analogous to clinical angina pectoris.
  • Collateral vessel development and flow- function relationships are stable within 21 days of ameroid placement, and remain stable for four months (Roth, et al.. Circulation. 82:1778, 1990; Roth, et al., Am. J. Phvsiol.. 235:H1279, 1987; White, et al., Circ. Res..
  • the model has a bed with stable but inadequate collateral vessels, and is subject to periodic ischemia.
  • Another distinct advantage of the model is that there is a normally perfused and functioning region (the LAD bed) adjacent to an abnormally perfused and dysfunctioning region (the LCx bed), thereby offering a control bed within each animal.
  • Myocardial contrast echocardiography was used to estimate regional myocardial perfusion.
  • the contrast material is composed of microaggregates of galactose and increases the echogenicity (whiteness) of the image.
  • the microaggregates distribute into the coronary arteries and myocardial walls in a manner that is proportional to blood flow (Skyba, et al., Circulation, 90:1513-1521, 1994). It has been shown that peak intensity of contrast is closely correlated with myocardial blood flow as measured by microspheres (Skyba, et al., Circulation, 90: 1513-1521, 1994).
  • a hydraulic cuff occluder was placed around the proximal LCx adjacent to the ameroid.
  • the hearts were perfusion-fixed (glutaraldehyde, physiological pressures, in situ) in order to quantitate capillary growth by microscopy.
  • PCR was used to detect angiogenic protein DNA and mRNA in myocardium from animals that had received gene transfer.
  • myocardial samples from lacZ-transduced animals showed substantial beta-galactosidase activity on histological inspection.
  • using a polyclonal antibody to an angiogenic protein angiogenic protein expression in cells and myocardium from animals that had received gene transfer was demonstrated. With respect to demonstrating improved blood flow, various techniques are known to those of skill in the art.
  • myocardial blood flow can be determined by the radioactive microsphere technique as described in Roth, DM, et al., Am. J. Phvsiol. 253:H1279-H1288, 1987 or Roth, DM, et al., Circulation 82:1778-1789, 1990.
  • Myocardial blood flow can also be quantitated, e.g., by thallium imaging, which involves perfusing the heart with the radionuclide thallium as described by Braunwald in Heart Disease, 4 th ed., pp. 276-311 (Saunders, Philadelphia, 1992).
  • the cells in the heart have an avidity for thallium. Uptake of thallium is positively correlated with blood flow.
  • reduced uptake indicates reduced blood flow as occurs in ischemic conditions in which there is a perfusion deficit.
  • angiogenic activity can be readily evaluated by contrast echocardiography such as described in Examples 1 and 5 and in Sahn, DJ, et al., Circulation. 58:1072-1083, 1978.
  • Improved myocardial function can be determined by measuring wall thickening such as by transthoracic echocardiography.
  • the strategy for therapeutic studies included the timing of transgene delivery, the means and route of administration of the transgene, and choice of the angiogenic gene.
  • gene transfer was performed after stable but insufficient collateral vessels had developed.
  • Previous studies using the ameroid model had involved delivery of angiogenic peptides during the closure of the ameroid, prior to the development of ischemia and collateral vessels.
  • that approach was not employed for several reasons. First, such studies are not suitable for closely duplicating the conditions that would be present in the treatment of clinical myocardial ischemia in which gene transfer would be given in the setting of ongoing myocardial ischemia; previous studies are analogous to providing the peptide in anticipation of ischemia, and are therefore less relevant.
  • control animals that received the same vector (e.g., a recombinant adenovirus), but with a reporter gene, provide a control for these studies.
  • the pig has a native coronary circulation very similar of that of humans, including the relative lack of native coronary collateral vessels.
  • the pig model also provided an excellent means to follow regional blood flow and function before and after gene delivery.
  • the use of control animals that received the same recombinant adenovirus construct but with a reporter gene provided a control for these studies. Based on the foregoing, and previous published studies, those skilled in the art will appreciate that the results described below in pigs are expected to be predictive of results in humans.
  • peripheral vascular disease delivery of angiogenic genes into the peripheral vasculature using gene therapy vectors of the present invention can be examined using, for example, a hind limb ligation model of peripheral ischemia. See, e.g., the femoral artery ligation model described by R.L. Terjung and colleagues (see, for example, Yang, et al., Circ. Res., 79(l):62-9, 1996).
  • the delivery of angiogenic genes according to the present invention to the peripheral vasculature and/or associated muscle can be used to overcome effects of peripheral vascular disease.
  • Example 1 Another animal model, described herein in Example 1 , induces dilated cardiomyopathy such as that observed in clinical congestive heart failure.
  • dilated cardiomyopathy such as that observed in clinical congestive heart failure.
  • continuous rapid ventricular pacing over a period of 3 to 4 weeks induces heart failure which shows similarities with many features of clinical heart failure, including left ventricular dilation with impaired systolic function analogous to regional functional abnormalities seen in heart failure (including those associated with severe coronary artery disease and with non-CAD DCM, such as IDCM).
  • Other animal models of congestive heart failure include the induction of chronic ventricular dysfunction via intracoronary delivery of microspheres (see e.g. Lavine et al., J Am Coll. Cardiol. 18: 1794-1803 (1991); Blaustein et al., Am. J. Cardio.
  • these models can be used to determine whether delivery of a vector construct coding for an angiogenic peptide or protein is effective to alleviate the cardiac dysfunctions associated with these conditions. These models are particularly useful in providing some of the parameters by which to assess the effectiveness of in vivo gene therapy for the treatment of congestive heart failure and ventricular remodeling.
  • the vectors of the present invention allow for highly efficient gene transfer in vivo without significant necrosis or inflammation. Based on these results, some of which are described in detail in the
  • vasoactive agent such as histamine, a histamine agonist, a nitric oxide donor, or a VEGF protein
  • a vasoactive agent such as histamine, a histamine agonist, a nitric oxide donor, or a VEGF protein
  • the vectors and methods of the present invention can be employed to treat dilated cardiomyopathy (DCM), a type of heart failure that is typically diagnosed by the finding of a dilated, hypocontractile left and/or right ventricle.
  • DCM can occur in the absence of other characteristic forms of cardiac disease such as coronary occlusion or a history of myocardial infarction.
  • DCM is associated with poor ventricular function and symptoms of heart failure. In these patients, chamber dilation and wall thinning generally results in a high left ventricular wall tension. Many patients exhibit symptoms even under mild exertion or at rest, and are thus characterized as exhibiting severe, i.e.
  • Type-Ill or “Type-IV”, heart failure, respectively (see, e.g., NYHA classification of heart failure).
  • many patients with coronary artery disease may progress to exhibiting dilated cardiomyopathy, often as a result of one or more heart attacks (myocardial infarctions).
  • a further application of the present invention is to prevent, or at least lessen deleterious left ventricular remodeling (a.k.a., deleterious remodeling, for short), which refers to chamber dilation after myocardial infarction that can progress to severe heart failure. Even if ventricular remodeling has already initiated, it is still desirable to promote an increase in blood flow, as this can still be effective to offset ventricular dysfunction.
  • angiogenesis can be useful, since the development of a microvascular bed can also be effective to offset ventricular dysfunction. Further, such angiogenic proteins or peptides can also have other enhancing effects. In a patient who has suffered a myocardial infarction, deleterious ventricular remodeling is prevented if the patient lacks chamber dilation and if symptoms of heart failure do not develop.
  • Deleterious ventricular remodeling is alleviated if there is any observable or measurable reduction in an existing symptom of the heart failure.
  • the patient may show less breathlessness and improved exercise tolerance.
  • Methods of assessing improvement in heart function and reduction of symptoms are essentially analogous to those described above for DCM.
  • Prevention or alleviation of deleterious ventricular remodeling as a result of improved collateral blood flow and ventricular function and/or other mechanisms is expected to be achieved within weeks after in vivo angiogenic gene transfer in the patient using methods as described herein.
  • the present method of in vivo transfer of a transgene encoding an angiogenic protein is used to demonstrate that gene transfer of a recombinant adenovirus expressing an angiogenic protein or peptide is effective in substantially reducing myocardial ischemia.
  • the present method of in vivo transfer of a transgene encoding an angiogenic protein is used to treat conditions associated with congestive heart failure. As the data below shows, expression of an exogenously-provided angiogenic transgene results in increased blood flow and/or function in the heart (or other target tissue). This increased blood flow and/or function will lessen one or more symptoms of the cardiovascular disease affecting the target tissues.
  • a number of different vectors can be employed to deliver the angiogenic protein transgenes in vivo according to the methods of the present invention.
  • replication-deficient recombinant adenovirus vectors exemplified herein achieved highly efficient gene transfer in vivo without cytopathic effect or inflammation in the areas of gene expression.
  • gene transfer of an angiogenic protein encoding a transgene can be conducted at any time, but preferably is performed relatively soon after the onset of severe angina.
  • gene transfer of an angiogenic protein encoding transgene can be conducted, for example, when development of heart failure is likely or heart failure has been diagnosed.
  • gene transfer can be performed any time after the patient has suffered an infarct, preferably within 30 days and even more preferably within 7-20 days after an infarct.
  • beta-adrenergic signaling proteins (beta-ASPs) (including beta- adrenergic receptors (beta-ARs), G-protein receptor kinase inhibitors (GRK inhibitors) and adenylylcyclases (ACs)) can also be employed to enhance cardiac function as described and illustrated in detail in U.S. patent application Serial No. 08/924,757, filed 05 September 1997 (based on U.S. 60/048,933 filed 16 June 1997 and U.S. 08/708,661 filed
  • compositions or products of the invention may conveniently be provided in the form of formulations suitable for administration to a patient, into the blood stream (e.g. by intra-arterial injection or as a bolus infusion into tissue such as the skeletal muscle).
  • a suitable administration format may best be determined by a medical practitioner.
  • Suitable pharmaceutically acceptable carriers and their formulation are described in standard formulations treatises, e.g., Remington's Pharmaceuticals Sciences by E.W. Martin.
  • Vectors of the present invention should preferably be formulated in solution at neutral pH, for example, about pH 6.5 to about pH 8.5, more preferably from about pH 7 to 8, with an excipient to bring the solution to about isotonicity, for example, 4.5% mannitol or 0.9% sodium chloride, pH buffered with art- known buffer solutions, such as sodium phosphate, that are generally regarded as safe, together with an accepted preservative such as metacresol 0.1 % to 0.75%, more preferably from 0.15% to 0.4% metacresol.
  • the desired isotonicity may be accomplished using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, polyols (such as mannitol and sorbitol), or other inorganic or organic solutes.
  • sodium chloride is preferred particularly for buffers containing sodium ions.
  • solutions of the above compositions also can be prepared to enhance shelf life and stability.
  • the therapeutically useful compositions of the invention are prepared by mixing the ingredients following generally accepted procedures. For example, the selected components may be mixed to produce a concentrated mixture which may then be adjusted to the final concentration and viscosity by the addition of water and/or a buffer to control pH or an additional solute to control tonicity.
  • compositions will be provided in dosage form containing an amount of a vector of the invention which will be effective in one or multiple doses in order to provide a therapeutic effect.
  • an effective amount of therapeutic agent will vary with many factors including the age and weight of the patient, the patient's physical condition, and the level of angiogenesis and/or other effect to be obtained, and other factors.
  • the effective dose of the viral vectors of this invention will typically be in the range of about 10 7 - 10 13 viral particles, preferably about 10 9 - 10 11 viral particles.
  • the exact dose to be administered is determined by the attending clinician, but is preferably in 5 ml or less of physiologically buffered solution (such as phosphate buffered saline), more preferably in 1-3 ml.
  • the prefened mode of administration is by injection into one or more localized sites (e.g., one or both coronary arteries, in the case of heart diseases) using a suitable catheter or other in vivo delivery device.
  • one or more localized sites e.g., one or both coronary arteries, in the case of heart diseases.
  • the power generator (Spectrax 5985; Medtronic, Inc.) was inserted into a subcutaneous pocket in the abdomen.
  • Four animals were instrumented with a flow probe (Transonic, Inc.) around the main pulmonary artery.
  • the pericardium was loosely approximated and the chest closed.
  • Hemodynamic data were obtained from conscious, unsedated animals after the pacemaker had been inactivated for at least 1 hour and animals were in a basal state. All data were obtained in each animal at 7-day intervals. Pressures were obtained from the left atrium, pulmonary artery, and aorta. Left ventricular dP/dt was obtained from the high- fidelity left ventricular pressure. Pulmonary artery flow was recorded. Aortic and pulmonary blood samples were obtained for calculation of arteriovenous oxygen content difference. 1-C. Echocardiographic Studies
  • Echocardiography is a method of measuring regional myocardial blood flow which involves injection of a contrast material into the individual or animal.
  • Contrast material microaggregates of galactose
  • the microaggregates distribute into the coronary arteries and myocardial walls in a manner that is proportional to blood flow (Skyba, et al., Circulation, 90: 1513- 1521 , 1994).
  • the peak intensity of contrast enhancement is correlated with myocardial blood flow as measured by microspheres (Skyba, et al., Circulation. 90:1513- 1521, 1994).
  • Two-dimensional and M-mode images were obtained with a Hewlett Packard Sonos 1500 imaging system. Images were obtained from a right parasternal approach at the mid-papillary muscle level and recorded on VHS tape. Measurements were made according to criteria of the American Society of Echocardiography (Sahn, DJ, et al., Circulation. 58:1072-1083, 1978). Because of the midline orientation of the porcine interventricular septum (TVS) and use of the right parasternal view, short-axis M-mode measures were made through the IVS and the anatomic lateral wall.
  • TVS porcine interventricular septum
  • end-diastolic dimension EDD
  • ESD end-systolic dimension
  • wall thickness wall thickness
  • Myocardial blood flow was determined by the radioactive microsphere technique as described in detail in previously (Roth, DM, et al., Am. J. Phvsiol. 253:H1279-H1288, 1987; Roth, DM, et al., Circulation 82:1778-1789, 1990).
  • Transmural samples from the left ventricular lateral wall and IVS were divided into endocardial, midwall, and epicardial thirds, and blood flow to each third and transmural flow were determined. Transmural sections were taken from regions in which echocardiographic measures had been made so that blood flow and functional measurements corresponded within each bed.
  • Myocardial blood flow per beat was calculated by dividing myocardial blood flow by the heart rate (recorded during microsphere injection) (Indolfi, C, et al., Circulation 80:933- 993, 1989).
  • Mean left atrial and mean arterial pressures were recorded during microsphere injection so that an estimate of coronary vascular resistance could be calculated; coronary vascular resistance index equals mean arterial pressure minus mean left atrial pressure divided by transmural coronary blood flow.
  • ATP and ADP were measured in transmural samples of the IVS and lateral wall in four animals with heart failure (paced 28 days) and four control animals. The samples from the animals with heart failure were obtained with the pacemakers off (60 minutes) on the day the animals were killed. Samples were obtained identically in all animals. ATP and ADP were measured in a Waters high-performance liquid chromatograph as previously described (Pilz, R.B., et al, J. Biol. Chem. 259:2927-2935, 1984).
  • Data are expressed as mean ⁇ standard deviation (SD). Specific measurements obtained in the control (prepaced) state and at 1-week intervals during pacing were compared by repeated measures ANOVA (Crunch4, Crunch Software Corp.). In some comparisons (lateral wall versus IVS, for example), two-way ANOVA was used. Post hoc comparisons were performed with the "Tukey method" as described in the art. Nine animals survived 21 days of pacing; six of these survived 28 days of pacing. Data from animals surviving 28 days were statistically indistinguishable from those who survived only 21 days. ANOVA was conducted, therefore, on nine animals at four time points: control (prepacing), 7 days, 14 days, and 21 to 28 days. The null hypothesis was rejected when P ⁇ .05 (two-tailed).
  • EDTh end-diastolic wall thickness
  • WTh % wall thickening
  • Control animals showed normal ATP/ ADP ratios, similar to those reported in pig heart collected by drill biopsies followed by immediate submersion in liquid nitrogen,
  • EXAMPLE 2 PREPARATION OF ILLUSTRATIVE GENE DELIVERY CONSTRUCTS 2-A. Preparation of Illustrative Adenoviral Constructs
  • a helper independent replication deficient human adenovirus-5 system was used.
  • the genes encoding ⁇ -galactosidase and FGF-5 were used using full length cDNAs.
  • the system used to generate recombinant adenoviruses imposed a packing limit of about 5kb for transgene inserts.
  • Each of the ⁇ -gal and FGF-5 genes operably linked to the CMV promoter and with the SV40 polyadenylation sequences were less than 4 kb, well within the packaging constraints.
  • the full length cDNA for human FGF-5 was released from plasmid pLTR122E (Zhan et al., Mol. Cell. Biol., 8:3487, 1988) as a 1.1 kb ECOR1 fragment which includes 981 bp of the open reading frame of the gene and cloned into the polylinker of shuttle vector plasmid ACCMVpLpA.
  • the nucleotide and amino acid sequence of FGF-5 is disclosed in Figure 1 of Zhan et al, Mol. Cell. Biol.. 8:3487, 1988.
  • pACCMVpLpA is described in Gomez-Foix et al. J. Biol. Chem.. 267:25129-25134, 1992.
  • pACCMVpLpA contains the 5' end of the adenovirus serotype 5 genome (map units 0 to 17) where the El region has been substituted with the human cytomegalovirus enhancer-promoter (CMV promoter) followed by the multiple cloning site (polylinker) from pUC 19 (plasmid well known in the art), followed by the SV40 polyadenylation signal.
  • CMV promoter human cytomegalovirus enhancer-promoter
  • polylinker multiple cloning site
  • the lacZ-encoding control adenovirus is based on a E1A /E1B deletion from map unit 1 to 9.8.
  • the FGF-5- encoding adenovirus (Ad.FGF-5) is based on a E1A /E1B deletion from map unit 1.3 to 9.3.
  • Both of these vectors eliminate the entire El A coding sequences and most of the E1B coding sequences. Both of the vectors have the transgene inserts cloned in an inverted orientation relative to the adenovirus sequences. Therefore, in the unlikely event of read- through transcription, the adenovirus transcript would be antisense and would not express viral proteins.
  • the FGF-5 gene-containing plasmid was co-transfected (using calcium phosphate precipitation) into 293 cells with plasmid JM17 (pJM17) which contains the entire human adenovirus 5 genome with an additional 4.3 kb insert, making pJMl 7 too large to be encapsidated into mature adenovirus virions.
  • the cells were then overlaid with nutrient agarose. Infectious viral particles containing the angiogenic gene were generated by homologous rescue recombination in the 293 cells and were isolated as single plaques 10- 12 days later.
  • adenoviral vectors contain the transgene but are devoid of El A/El B sequences and are therefore replication-deficient.
  • Adenovirus vector carrying the FGF-5 gene is also referred to herein as Ad.FGF-5.
  • Viral stocks were propagated in 293 cells to titers in the range of 10 10 to 10 12 per milliliter (ml) as determined by optical densitometry. Human 293 cells were infected at 80% confluence and culture supernatant was harvested at 36-48 hours.
  • the cellular debris was pelleted by standard centrifugation and the virus further purified by two cesium chloride (CsCl) gradient ultracentrifugations (discontinuous 1.33/1.45 CsCl gradient; CsCl prepared in 5 mM Tris, 1 mM EDTA (pH 7.8); 90,000 x g (2 hr), 105,000 x g (18 hr)).
  • CsCl cesium chloride
  • the viral stocks Prior to in vivo injection, the viral stocks were desalted by gel filtration through Sepharose columns (e.g. G25 Sephadex equilibrated with PBS).
  • ⁇ viral concentrations were about 10 n viral particles per milliliter (ml), as determined by optical densitometry.
  • Viral stocks can be conveniently stored in cells in media at minus 70 degrees C.
  • purified virus is preferably resuspended in saline.
  • the adenoviral vector preparation was highly purified and substantially free of wild-type (potentially replicative) virus (i.e., preferably containing less than about one (1) replication competent adenovirus (RCA) particle per
  • adenoviral infection and inflammatory infiltration in the heart were minimized.
  • adenoviral vector constructs are provided below and, in combination with the other teachings provided herein, other adenoviral vector constructs suitable for use in the present invention, including constructs based on modified adenoviral vectors, can be employed.
  • adeno-associated viral (AAV) vectors have been generated for in vivo delivery according to the methods of the present invention as described above.
  • AAV adeno-associated viral
  • another angiogenic gene that can be used in the context of the present invention, we have prepared constructs comprising an IGF gene as described above, in both adenoviral (Ad) and AAV vector constructs.
  • the exemplary constructs contain the IGF-1 gene under the control of a heterologous promoter (the CMV promoter was used for purposes of illustration), and are designated as rAd/IGF or rAAV/IGF.
  • constructs comprising a marker gene e.g., enhanced green fluorescent protein (EGFP)
  • EGFP enhanced green fluorescent protein
  • the rAd/IGF or rAAV/IGF constructs can also be constructed to include a marker gene (such as, EGFP).
  • Constructs comprising EGFP are commercially available (for example, from Clontech, Palo Alto, California).
  • the IGF-1 gene (available from the ATCC) is subcloned into an adenovirus shuttle vector, such as pAdshuttle-CMV, pAd5CI, and/or pAdtrack-CMV.
  • an adenovirus shuttle vector such as pAdshuttle-CMV, pAd5CI, and/or pAdtrack-CMV.
  • the resulting IGF-1 shuttle plasmid undergoes a recombination process with a helper plasmid, pJM17, in either bacteria or 293 cells depending on the shuttle vector used.
  • the resulting rAd/IGF virus is verified for the expression of IGF-1 protein by RT-PCR and/or western blotting.
  • exemplary rAd/IGF constructs using the shuttle vector and pJM17 helper plasmid in 293 cells essentially as described and illustrated above for the generation of adenoviral vectors comprising the FGF-5 angiogenic gene.
  • Adenoviral vectors comprising EGFP were prepared as controls using analogous techniques.
  • AAV vectors can be generated using a variety of different techniques, as described in the art, we used a basic double transfection procedure, essentially as described by Samulski et al., J. Virol. 63: 3822-3828, 1989.
  • the IGF-1 gene was subcloned into an rAAV plasmid DNA (such that the IGF gene would be flanked by the AAV inverted terminal repeats or ITRs) and this rAAV plasmid was then co-transfected into 293 cells with an AAV helper plasmid (to provide the AAV rep and cap genes in trans).
  • AAV production was subsequently initiated by infecting with a helper adenovirus (we used an El -deleted adenovirus known as dl312).
  • Viral lysates are generally heat treated to inactivate adenovirus and treated with DNase and Pronase following standard techniques (see, e.g., Samulski et al., supra).
  • DNase resistant particles DNase resistant particles (DRP); and are tested for absence of cytopathic effect.
  • IGF-1 in the rAd/IGF and rAAV/IGF was verified by western blot analysis. They were further tested for the production of functional IGF-1 protein using a proliferation assay on cultured MCF-7 cells. Briefly, HEK (human embryonic kidney carcinoma) 293 cells are transduced with rAd/IGF or rAAV/IGF on Day 1 and cultured in serum-free medium. After a 48 hour incubation, the serum free medium is harvested and put onto MCF-7 cells that have been cultured in serum-free medium. The proliferation of MCF-7 cells is monitored for the next 72 hours with a standard proliferation assay method (e.g.
  • MTT assay essentially as described by Mosmann (see e.g. Mosmann, J. Immunol. Meth. 16: 55-63, 1983).
  • Results from this MTT assay indicated that both the rAd IGF and rAAV/IGF vector constructs were capable of delivering the IGF-1 transgene to the human target cells (HEK 293) and that the medium of such targeted cells was then capable of inducing proliferation of the MCF-7 cells in a manner analogous to purified IGF-1 protein.
  • IGF vector constructs can be performed using myocytes, in which the effects of IGF on muscle cell size and/or function can be observed.
  • myocytes in which the effects of IGF on muscle cell size and/or function can be observed.
  • IGF-1 can be delivered by adenovirus or AAV vectors to induce hypertrophy and cellular DNA synthesis in NCM.
  • MOI multiplicity of infection
  • the cardiomyocytes are stained with crystal violet or neutral red.
  • the cells are imaged under a microscope, and the size of individual cells, including area, length, and width, can be measured automatically (e.g.
  • Vectors comprising angiogenic transgenes can be delivered to a heart by intracoronary delivery as described and illustrated herein.
  • intracoronary delivery As an initial test of candidate vectors, prior to delivery in a large animal model such as pig, we have also employed a rat model in which we use indirect intracoronary delivery of vector to the myocardium. In that model, delivery is achieved by introduction of a solution comprising the vector (e.g.
  • phosphate buffered saline PBS
  • HEPES buffered saline phosphate buffered saline
  • Flow from the chamber of the ventricle thus carries the material to be delivered into the coronary arteries since alternative pathways are temporarily blocked.
  • We have employed a cross-clamping procedure to constrict the pulmonary artery and aorta see, e.g., Hajjar, et al., Proc. Natl. Acad. Sci. USA, 95: 5251-5256, 1998).
  • vasoactive agent we have also employed pretreatment with a vasoactive agent, as described above and in the corresponding co-pending application referred to above, in order to enhance gene transfer via intracoronary delivery.
  • a vasoactive agent we typically use either histamine or sodium nitroprusside (SNP) as a vasoactive agent. These can be employed at ranges of about 1 to 75 milligrams/ml. Typically, we use about 25 mg/ml of histamine infused prior to delivery of vector. In the case of SNP, we typically use about 50 mg/ml of the vasoactive agent with infusion beginning up to several minutes prior to introduction of the vector and continuing until vector has been completely injected.
  • SNP sodium nitroprusside
  • EXAMPLE 3 GENE TRANSFER IN RAT CARDIOMYOCYTES 3-A Ad. ⁇ -gal Gene Transfer and Expression
  • rat cardiomyocytes were prepared by Langendorf perfusion with a collagenase containing perfusate according to standard methods. Rod shaped cells were cultured on laminin coated plates and at 24 hours, were infected with the ⁇ -galactosidase- encoding adenovirus obtained in the above Example 2, at a multiplicity of infection of 1:1. After a further 36 hour period, the cells were fixed with glutaraldehyde and incubated with X-gal. Consistently 70-90%) of adult myocytes expressed the ⁇ -galactosidase transgene after infection with the recombinant adenovirus. At a multiplicity of infection of 1-2:1 there was no cytotoxicity observed.
  • IGF-1 expression in rat neonatal cardiac myocytes 2 x 10e6 cells were plated on 10 cm cell culture dishes and infected with 1 x lOelO DNase resistant particles of rAAV/IGF-1 or rAAV/EGFP. Cells were cultured without serum in minimal media and normal oxygen levels at 37 degrees Celsius. Recombinant IGF-1 protein (50 ng/ml) or phenylephrine (50 uM) were added to the culture as positive controls. Cells were visually assessed 48 hours after treatment. Cells treated with rAAV-IGF-1 displayed significant hypertrophy (comparable to that obtained using phenylephrine), based on morphological appearance, as compared to untreated cells.
  • IGF-1 protein appeared to induce only slight hypertrophy as compared to rAAV/IGF-1.
  • a stereological program Image Pro Plus 5 (Media Cybernetics, Carlsbad, California), was utilized. Briefly, the Image Pro Plus 5 program allows individual cells to be traced and measurements obtained. Cells were outlined within the program and area counts per cell were calculated. Approximately 50-100 cells were counted per condition and graphed in the statistical program Prizm. It was found that phenylephrine-treated cells and rAAV/IGF-1 -infected cells demonstrated significant hypertrophy compared to untreated cells.
  • the level of IGF-1 secretion into the media following rAAV/IGF-1 expression was determined using an ELISA assay for IGF-1 protein. Briefly, protein expression was found in the media of rAAV/IGF-1 -infected cultures, collected at 48 hours, at levels of approximately 0.1-1.0 ng/ml, representing a significant increase over IGF-1 levels in control populations (untreated or infected with rAAV/EGFP).
  • EXAMPLE 4 IN VIVO GENE TRANSFER INTO PORCINE MYOCARDIUM 4-A. Ad. ⁇ -gal Gene Transfer and Expression
  • the ⁇ -galactosidase-encoding adenoviral vector obtained in Example 2 was propagated in permissive 293 cells and purified by CsCl gradient ultracentrifugation with a final viral titer of 1.5 x 10 10 viral particles, based on the procedures of Example 2.
  • a 26 gauge butterfly needle was inserted into the mid left anterior descending (LAD) coronary artery and the vector
  • An EGFP-encoding adeno-associated viral vector was produced, propagated and purified as described above in Example 2.
  • Four farm pigs ( ⁇ 30 kg each) were anesthetized, ventilated and underwent a midline neck cutdown.
  • the carotid artery was isolated and a 5 French Introducer sheath inserted.
  • a 5 French multipurpose angiocatheter was placed in the left circumflex artery (LCX) with the tip of the catheter positioned about 1 cm within the coronary artery lumen.
  • the syringe to be used for gene injection was first flushed with PBS and then the gene solution was drawn into the syringe.
  • a total volume of 1.5 ml of gene solution was injected into each pig at an infusion rate of 1 ml/30 seconds.
  • the angiocatheter and introducer sheath were then removed and the neck incision closed. The animals were allowed to recover from anesthesia and placed in their holding cage until completion of the study.
  • pigs were sacrificed and tissues collected.
  • Hearts were excised and placed in iced saline.
  • Coronary arteries were cold perfused and the tissue collected and flash frozen in liquid nitrogen.
  • Other tissues were likewise collected as quickly as possible and flash frozen in liquid nitrogen.
  • Both fluorescence microscopy and RT-PCR of tissue sections demonstrated successful delivery and expression of the EGFP gene by rAAV vector using this direct intracoronary injection method of delivery in closed- chest pigs.
  • results from RT-PCR confirmed the gene was successfully delivered to and expressed in the bed supplied by the injected artery (i.e., the LCX bed) as compared to the left anterior descending coronary artery (LAD) bed:
  • EXAMPLE 5 PORCINE MODEL OF ANGIOGENESIS-MEDIATED GENE THERAPY (USING AN FGF-5 TRANSGENE)
  • Control animals received a recombinant adenovirus expressing lacZ ( ⁇ -gal) to exclude the possibility that the adenovirus itself, independent of FGF-5, was stimulating new blood vessel formation. This also controlled for possible continued collateral vessel development unrelated to gene transfer.
  • adenovirus expressing lacZ ⁇ -gal
  • Two weeks after gene transfer, stress-induced cardiac dysfunction and regional blood flow were again measured.
  • Pigs receiving lacZ showed a similar degree of pacing-induced dysfunction in the ischemic region before and two weeks after gene transfer.
  • the animals showed increase in wall thickening and improved blood flow in the ischemic region during pacing.
  • the results demonstrated that gene transfer of an angiogenic transgene (FGF-5) was effective to ameliorate regional myocardial contractile dysfunction by improving regional blood flow through newly- formed blood vessels.
  • FGF-5 angiogenic transgene
  • the ameroid material is hygroscopic and slowly swells, leading gradually to complete closure of the artery 10 days after placement, with minimal infarction ( ⁇ 1%> of the left ventricle) because of the development of collateral blood vessels.
  • Myocardial function arid blood flow are normal at rest in the region previously perfused by the occluded artery (the ischemic region), but blood flow is insufficient to prevent ischemia when myocardial oxygen demands increase.
  • Collateral vessel development is complete within 21 days of ameroid placement and remains unchanged for at least 4 months (Roth et al., Am. J. Phvsiol. 253: H1279-H1288, 1987).
  • a hydraulic cuff was also placed around the artery, adjacent but distal to the ameroid.
  • a helper-independent replication-deficient human adenovirus-5 system was prepared as described in Example 2 above.
  • mice were anesthetized, and a 5F arterial sheath placed into the carotid artery.
  • a 5F multipurpose (A2) coronary catheter was inserted through the sheath and into the coronary arteries. Closure of the ameroid was confirmed in all animals by contrast injection into the left main coronary artery. The catheter tip was then placed deeply within the arterial lumen so that minimal material would be lost to the proximal aorta during injection.
  • Four milliliters containing 2 X 10 1 x viral particles of recombinant adenovirus was delivered by slowly injecting 2.0 ml into both the left and right coronary arteries.
  • Contrast material increases the echogenicity (whiteness) of the image after left atrial injection.
  • the microaggregates distribute into the coronary arteries and myocardial walls in a manner that is proportional to blood flow.
  • the peak intensity of contrast enhancement is correlated with myocardial blood flow as measured by microspheres (Skyba et al., Circulation 58: 1072-1083, 1978).
  • Thirty-eight ( ⁇ 2) days after ameroid placement, well after ameroid closure, but before gene transfer contrast echocardiographic studies were performed during atrial pacing (200 bpm). Studies were repeated 14 + 1 days after gene transfer, and, in five animals, 12 weeks after gene transfer with FGF-5. Peak contrast intensity was measured from the video images with a computer-based video analysis program (Color Vue ⁇ , Nova Microsonics, Indianapolis, Indiana), that provided an objective measure of video intensity.
  • the brachiocephalic artery was cannulated and other great vessels ligated.
  • heparin 10,000 IU
  • papaverine 60 mg
  • potassium chloride to induce diastolic cardiac arrest
  • the aorta was cross-clamped and the coronary vasculature perfused.
  • Glutaraldehyde solution 6.25%, 0.1 M cacodylate buffer
  • the number of capillaries around each fiber and fiber cross-sectional area in each of eight fields in each subsample were measured with an image analyzer (Videometric 150, American Inno vision) at XI 400.
  • the number of capillaries around a total of 325 ⁇ 18 fibers was measured.
  • Capillary density (number per fiber cross-sectional area) was estimated by point counting 15 ⁇ 1 fields per subsample.
  • PCR polymerase chain reaction
  • a sense primer to the CMV promoter (GCAGAGCTCGTTTAGTGAAC; SEO ID. NO. 1) and an antisense to the internal FGF-5 sequence (GAAAATGGGTAGAGATATGCT; SEQ ID NO. 2) amplified the expected 500-bp fragment.
  • a sense primer to the beginning of the FGF-5 sequence (ATGAGCTTGTCCTTCCTCCTC; SEQ ID NO. 3) and an antisense primer to the internal FGF-5 sequence (i.e., SEQ ID NO. 2)
  • RT-PCR amplified the expected 400-bp fragment.
  • Primers directed against the adenovirus DNA E2 region were used to detect wild-type or recombinant viral DNA in tissues (TCGTTTCTCAGCAGCTGTTG; SEQ ID NO. 4) and
  • CATCTGAACTCAAAGCGTGG SEQ ID NO. 5
  • the expected 900-bp fragment was amplified from the recombinant virus.
  • PCR detection sensitivity was 1 viral sequence per 5 million cells.
  • a polyclonal antibody directed against FGF-5 was used in immunoblots of protein from the medium of cultured rat cardiac fibroblasts 48 h after the gene transfer of FGF-5 or lacZ.
  • FGF-5 protein was found in conditioned media after gene transfer of FGF-5, but not after gene transfer o ⁇ lacZ.
  • Pulmonary arterial blood was withdrawn continuously during intracoronary injection of recombinant adenovirus in three animals. Serum from each sample was used in a standard plaque assay. Undiluted serum (0.5 ml) was added to subconfluent H293 cells; 10 days later, no plaques had formed. However, when 0.5 ml serum was diluted 200- to 8000-fold with DMEM (2% FBS), viral plaques formed by day 9. A single vascular bed (myocardial) separates the coronary and pulmonary arteries. If no virus attaches in this bed after injection into the coronary artery, then the pulmonary artery concentration of virus should reflect the dilution of coronary sinus blood by systemic venous blood over the time of the injection.
  • DMEM 2% FBS
  • Hematoxylin eosin and Masson's trichrome stains were used to detect inflammatory cell infiltrates, cell necrosis and fibrosis.
  • Mouse ascites, porcine anti-CD4 and anti-CD8 monoclonal antibodies (1.0 mg/ml; VMRD, Inc., Pullman, Washington) were used to detect CD4 and CD8 markers on T lymphocytes in frozen sections (6 ⁇ m) of spleen (positive control) and heart.
  • FGF-5 TRANSGENE Three measurements were used to assess whether gene transfer of FGF-5 was effective in treating myocardial ischemia: regional contractile function and perfusion (assessed before and after gene transfer) and capillary number. All measurements were conducted without knowledge of which gene the animals had received (FGF-5 versus lacZ). Regional contractile function and blood flow. Thirty-eight days after ameroid placement, animals showed impaired wall thickening during atrial electrical stimulation (pacing). Pigs receiving lacZ showed a similar degree of pacing-induced dysfunction in the ischemic region before and two weeks after gene transfer.
  • Angiogenesis Uninfected ameroid-constricted animals (no gene transfer performed) had identical physiological responses to animals receiving lacZ-encoding adenovirus, indicating that the lacZ vector did not adversely affect native angiogenesis.
  • PCR Polymerase chain reaction
  • RT-PCR reverse transcriptase coupled with PCR
  • left ventricular samples were examined to document transgene inco ⁇ oration and expression. Briefly, 3 days after intracoronary gene transfer of lacZ, myocardium was treated with X-gal, and then counterstained with Eosin XI 20. Examination using standard histological techniques revealed that the majority of myocytes showed ⁇ -galactosidase activity (blue stain). Activity was also seen 14 ⁇ 1 days after gene transfer in all animals that had received lacZ gene transfer. Higher magnification demonstrated cross striations in cells containing ⁇ -galactosidase activity, confirming gene expression in myocytes.
  • PCR analysis using a sense primer directed against the CMV promoter and an antisense primer directed against an internal FGF-5 sequence was performed to confirm the presence of recombinant adenovirus DNA encoding FGF-5 in the ischemic (LCx) and nonischemic (LAD) regions of three animals that received FGF-5 gene transfer.
  • the results, shown in Figure 10A confirmed the presence of the expected 500-bp fragments.
  • FGF-5 mRNA expression was then examined 14 days after gene transfer.
  • Figure 10B the RT-PCR-amplified 400-bp fragment was present in both regions from two animals, whereas control animals showed no signal.
  • a polyclonal antibody directed against FGF-5 was used in immunoblots of protein from the medium of cultured rat cardiac fibroblasts 48 hours after gene transfer of FGF-5 or lacZ. As shown in Figure
  • FGF-5 protein was found after gene transfer of FGF-5 (F), but not after gene transfer o ⁇ lacZ ( ⁇ ), demonstrating protein expression and extracellular secretion after FGF-5 gene transfer.
  • PCR using a set of primers directed against adenovirus DNA (E2 region), was performed to determine whether adenovirus DNA was present in retina, liver, or skeletal muscle of two animals that received intracoronary injection of adenovirus
  • the expected 900-bp amplified fragment was only found in a control lane (+) containing recombinant adenovirus (as a positive control), and not in the lanes derived from the retina (r), liver (1), or skeletal muscle (m) of the treated animals.
  • Successful gene transfer was documented in both the ischemic and nonischemic regions. Immunoblotting showed FGF-5 protein in myocardium from animals that received FGF-5 gene transfer. In additional experiments using cultured fibroblasts, we documented that gene transfer of FGF-5 conferred the ability of these cells to synthesize and secrete FGF-5 extracellularly.
  • FGF-4 angiogenic protein-encoding gene
  • the protocol for FGF-4 gene therapy was essentially as described in Example 5 above for FGF-5.
  • the human FGF-4 gene was isolated from a cDNA library which was constructed from mRNA of Kaposi's Sarcoma DNA transformed-NIH3T3 cells.
  • the FGF-4 cDNA is about 1.2 kb in length and encodes a polypeptide of 206 amino acids including a 30 amino acid signal peptide at the N-terminal (Dell Bovi et al. Cell 50:729-737, 1987; Bellosta et al. J. Cell Biol. 121 :705-713, 1993).
  • FGF-4 adenovirus vector pACCMVpLpASR (pACSR for simplicity).
  • the 5' start site was at 243 basepairs and the 3' end at 863 basepairs.
  • Recombinant adenovirus encoding FGF-4 (also referred to herein as Ad.FGF-4) was made as described in Example 2 for making the FGF-5 adenovirus.
  • Expression of FGF-4 in cardiac tissue (and a lack of expression in other tissues including the liver, skeletal muscle and eye) was confirmed by Western-blot analysis using anti-FGF-4 antibody for detection. The mitogenic effect of FGF-4 on proliferation of endothelial cells in vitro was also tested.
  • Transgene Delivery As with FGF-5, gene transfer was performed after endogenous angiogenesis was quiescent and inducible myocardial ischemia, analogous to angina pectoris in patients, was present.
  • animals were anesthetized, and a 5F arterial sheath placed into the carotid artery.
  • a 5F multipu ⁇ ose coronary catheter was inserted through the sheath and into the coronary arteries. Closure of the ameroid was confirmed in all animals by contrast injection into the left main coronary artery. The catheter tip was then placed 1 cm within the arterial lumen so that minimal material would be lost to the proximal aorta during injection.
  • Five ml containing 1.5xl0 12 viral particles of recombinant adenovirus expressing FGF-4 were delivered by slowly injecting 3.0 ml into the left and 2.0 ml into the right coronary arteries.
  • Transmural myocardial biopsies from three consecutive animals that received Ad.FGF-4 have been examined. The animals were killed 2 weeks after gene transfer. There was no evidence of inflammatory cell infiltrates, necrosis, or increased fibrosis in these sections compared to control ameroid animals that received no adenovirus. This was true in both the LAD and LCx beds. These slides were reviewed by a pathologist who made a blind-sample assessment and commented that there was no evidence for myocarditis in any section.
  • EXAMPLE 7 GENE-MEDIATED ANGIOGENESIS USING AN FGF-2 MUTEIN
  • This experimental example demonstrated successful gene therapy using a third angiogenic protein-encoding gene, FGF-2.
  • This experiment also demonstrates how an angiogenic protein can be modified to increase secretion and potentially improve efficacy of angiogenic gene therapy in enhancing blood flow and cardiac function within the heart.
  • the protocol used for human FGF-2 gene therapy was virtually identical to that employed for FGF-5 and FGF-4 above.
  • Acidic FGF (aFGF, FGF-1) and basic FGF (FGF-2) lack a native secretory signal sequence; although some protein secretion may occur.
  • An alternate secretary pathway not involving the Golgi apparatus, has been described for acidic FGF.
  • Two FGF-2 constructs (FGF-2LI +sp and FGF-2LI -sp) were made, one with a sequence encoding a signal peptide (FGF-2LI +sp) for the classic protein secretary pathway and one without the signal peptide encoding sequence (FGF-2LI -sp) to test for improved efficacy of FGF-2 having an added signal peptide over the same protein without the added signal peptide.
  • FGF-2 has a five-residue loop structure which extends from amino acid residue 118 to residue 122. This loop structure was replaced by cassette directed mutagenesis, with the corresponding five-residue loop from interleukin-l ⁇ to produce FGF-2LI loop replacement mutants. Briefly, the gene encoding human Glu 3,5 FGF-2 (Seddon et al. Ann. N.Y. Acad. Sci. 638:98-108, 1991) was cloned into T7 expression vector pET-3a (M13), a derivative of pET-3a (Rosenberg et al. Gene 56:125- 135, 1987), between restriction sites Ndel and BamYXX .
  • the unique restriction endonuclease sites, Bst X and SplX, were introduced into the gene in such a way as to produce no change in the encoded amino acids (i.e. silent mutations) at positions that flank the codons encoding the segment Serl 17-T ⁇ l23 of FGF-2. Structured alignment 1 of the ⁇ 9- ⁇ l0 loops in FGF-1, FGF-2, and IL-l ⁇ .
  • FGF-2 SNNYNTYRSRKY..TSWYVALKRTG (SEQ ID NO. 7)
  • FGF-1 and FGF-2 are from amino acid residue 1 deduced from the cDNA sequence encoding the 155-residue form (as described in Seddon et al. Ann. N. Y. Acad. Sci. 638:98-108, 1991), and that for IL-l ⁇ is from residue 1 of the mature 153-residue polypeptide (id.).
  • DNA fragment was ligated, using T 4 DNA ligase, to a double-stranded DNA obtained by annealing two synthetic oligonucleotides: 5"-CGAACGATTG GAATCTAATA ACTACAATAC GTACCGGTCT GCGCAGTTTC CTAACTGGTA TGTGGCACTT AAGC-3' (SEQ ID NO. 9) and 5' GTACGCTTAA GTGCCACATA CCAGTTAGGA AACTGCGCAG ACCGGTACGT ATTGTAGTTA TTAGATTCCA ATCGTT-3' (SEQ ID NO. 9) and 5' GTACGCTTAA GTGCCACATA CCAGTTAGGA AACTGCGCAG ACCGGTACGT ATTGTAGTTA TTAGATTCCA ATCGTT-3' (SEQ ID NO. 9) and 5' GTACGCTTAA GTGCCACATA CCAGTTAGGA AACTGCGCAG ACCGGTACGT ATTGTAGTTA TTAGATTCCA ATCGTT-3' (S
  • FGF-2LI Escherichia coli
  • Afl2 restriction site underlined above.
  • FGF-2LI with and without signal peptide were constructed by using a polymerase chain reaction (PCR)-based method.
  • PCR polymerase chain reaction
  • pACCMVpLpASR(+) pACSR for simplicity
  • Recombinant virus and injectable vector were prepared essentially as described in Example 2.
  • Gene transfer was performed as described in Example 5 (using 8 animals for FGF-2LI sp+ and 6 animals for FGF-2LI sp-, with the lacZ vector serving as a control, all with 10 1 ' to 10 12 viral particles).
  • FIG. 13 shows results using intracoronary gene transfer of recombinant adenovirus expressing lacZ, FGF-5, FGF-2LI +sp, FGF-2LI -sp, and FGF-4 for comparison.
  • the black bar on the right side in Figure 13 shows the normal flow ratio using this method.
  • FGF-2LI +sp normalized peak contrast flow ratio in these animals.
  • Percent wall thickening was also improved two weeks after intracoronary delivery of a recombinant adenovirus expressing FGF-2LI +sp.
  • Figure 11 shows results using intracoronary gene transfer of recombinant adenovirus expressing lacZ, FGF-5, FGF-2LI +sp, FGF-2LI -sp, and FGF-4 for comparison.
  • the black bar on the right side in Figure 11 shows the normal percent wall thickening before pacing-induced stress.
  • FGF-2LI +sp improved regional function to a degree that was statistically indistinguishable from FGF-5.
  • Figure 13 shows there was some improvement noted after gene transfer with FGF-2LI -sp, the improvement with the signal peptide containing transgene was superior (Figure 13).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Hospice & Palliative Care (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés permettant de traiter des patients souffrant de maladies cardiovasculaires, et plus particulièrement, de maladies cardiaques et de maladies vasculaires périphériques. Les procédés préférés de la présente invention concernent l'administration in vivo de gènes, le codage de peptides ou de protéines angiogéniques dans le myocarde ou les tissus ischémiques périphériques. Ces procédés consistent à introduire un vecteur contenant ce gène dans un vaisseau sanguin alimentant le coeur ou dans un tissu ischémique périphérique.
PCT/US2000/030345 1995-02-28 2000-11-03 Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo WO2001034208A1 (fr)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2001536204A JP2003513942A (ja) 1999-11-05 2000-11-03 インビボ遺伝子送達による心血管疾患を処理するための技術および組成物
AU14604/01A AU784392B2 (en) 1999-11-05 2000-11-03 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
IL14945100A IL149451A0 (en) 1999-11-05 2000-11-03 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
EP00976894A EP1225921A1 (fr) 1999-11-05 2000-11-03 Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo
CA002389524A CA2389524A1 (fr) 1999-11-05 2000-11-03 Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo
EA200200533A EA008538B1 (ru) 1999-11-05 2000-11-03 Способы и композиции для лечения сердечно-сосудистого заболевания доставкой генов in vivo
KR1020027005855A KR20020049031A (ko) 1999-11-05 2000-11-03 생체내 유전자 송달에 의하여 심혈관 질환을 치료하기위한 기술 및 조성물
US09/847,936 US20030148968A1 (en) 1995-02-28 2001-05-03 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
HK03100751.6A HK1048593A1 (zh) 1999-11-05 2003-01-29 用於通過體內基因輸送治療心血管疾病的技術和組合物
US11/236,221 US20060286072A1 (en) 1995-02-28 2005-09-26 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
US12/045,658 US20090082293A1 (en) 1995-02-28 2008-03-10 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US43515699A 1999-11-05 1999-11-05
US09/435,156 1999-11-05
US60908000A 2000-06-30 2000-06-30
US09/609,080 2000-06-30

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US60908000A Continuation-In-Part 1995-02-28 2000-06-30

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US09/847,936 Continuation-In-Part US20030148968A1 (en) 1995-02-28 2001-05-03 Techniques and compositions for treating cardiovascular disease by in vivo gene delivery

Publications (1)

Publication Number Publication Date
WO2001034208A1 true WO2001034208A1 (fr) 2001-05-17

Family

ID=27030448

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/030345 WO2001034208A1 (fr) 1995-02-28 2000-11-03 Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo

Country Status (10)

Country Link
EP (1) EP1225921A1 (fr)
JP (1) JP2003513942A (fr)
KR (1) KR20020049031A (fr)
CN (1) CN1433325A (fr)
AU (1) AU784392B2 (fr)
CA (1) CA2389524A1 (fr)
EA (1) EA008538B1 (fr)
HK (1) HK1048593A1 (fr)
NZ (1) NZ546670A (fr)
WO (1) WO2001034208A1 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1310266A1 (fr) * 2001-11-13 2003-05-14 St. Jude Medical, Inc. Dispositifs médicaux stimulant la production des facteurs de croissance
WO2004012775A2 (fr) * 2002-08-05 2004-02-12 Zaklady Farmaceutyczne Polpharma S.A. Boite d'expression, vecteur de plasmide a deux cistrons, produit pharmaceutique et leur utilisation en therapie genique angiogenique
AU784392B2 (en) * 1999-11-05 2006-03-23 Regents Of The University Of California, The Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
US7745174B2 (en) 2002-03-20 2010-06-29 Viromed Co., Ltd. Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
WO2010078624A1 (fr) * 2009-01-07 2010-07-15 Vegenics Limited Matériaux et méthodes pour le traitement de l’hypertension
US8389492B2 (en) 2008-04-09 2013-03-05 Viromed Co., Ltd. Lyophilized DNA formulations for enhanced expression of plasmid DNA
EP2814513A4 (fr) * 2012-02-14 2016-01-13 Univ California Administration systémique et expression régulée des gènes à action paracrine pour les maladies cardiovasculaires et autres états
US10155099B2 (en) 2009-09-21 2018-12-18 Cook Regentec Llc Method for infusing stem cells
WO2019222455A1 (fr) * 2018-05-16 2019-11-21 University Of Massachusetts Administration à base de perfusion de vecteurs de vaa recombinés pour l'expression de protéines sécrétées
US10532193B2 (en) 2012-06-05 2020-01-14 Muffin Incorporated Catheter systems and methods useful for cell therapy
US10639351B2 (en) 2013-10-22 2020-05-05 Helixmith Co., Ltd. Method for treating amyotrophic lateral sclerosis with a polynucleotide encoding two or more isoforms of hepatocyte growth factor
US11554179B2 (en) 2018-07-19 2023-01-17 Helixmith Co., Ltd Lyophilized pharmaceutical compositions for naked DNA gene therapy

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5623740B2 (ja) * 2006-07-25 2014-11-12 セラドン・コーポレーション 遺伝子治療用アデノ随伴ウイルスベクターの長期順行性の心外膜冠動脈注入
EP2197900B9 (fr) * 2007-08-24 2013-01-09 Julius-Maximilians-Universität Würzburg Récepteurs peptidiques cyclisés double mutants inhibiteurs d'anticorps anti-récepteurs bêta 1-adrénergiques
KR101006106B1 (ko) * 2009-06-04 2011-01-07 김현태 전·자기장 차단 전열선

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996026742A1 (fr) * 1995-02-28 1996-09-06 The Regents Of The University Of California Therapie angiogenique par transfert de genes
WO1998032859A1 (fr) * 1997-01-29 1998-07-30 Cornell Research Foundation, Inc. Administration a des sites multiples d'un vecteur d'adenovirus en vue de provoquer une angiogenese
US5792453A (en) * 1995-02-28 1998-08-11 The Regents Of The University Of California Gene transfer-mediated angiogenesis therapy
WO1998050079A2 (fr) * 1997-05-06 1998-11-12 The Regents Of The University Of California Techniques et compositions destinees au traitement d'une insuffisance cardiaque et du remodelage ventriculaire par apport in vivo de transgenes angiogeniques
WO1999040945A2 (fr) * 1998-02-11 1999-08-19 The Regents Of The University Of California Traitement de l'angiogenese par transfert de genes et techniques d'apport intravasculaire de genes
WO2000038518A1 (fr) * 1998-12-28 2000-07-06 Arch Development Corporation Transfert efficace et stable in vivo de genes dans des cardiomyocytes a l'aide de vecteurs viraux adeno-associes de recombinaison

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1225921A1 (fr) * 1999-11-05 2002-07-31 The Regents of the University of California Techniques et compositions permettant de traiter les maladies cardiovasculaires par l'administration de genes in vivo

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996026742A1 (fr) * 1995-02-28 1996-09-06 The Regents Of The University Of California Therapie angiogenique par transfert de genes
US5792453A (en) * 1995-02-28 1998-08-11 The Regents Of The University Of California Gene transfer-mediated angiogenesis therapy
WO1998032859A1 (fr) * 1997-01-29 1998-07-30 Cornell Research Foundation, Inc. Administration a des sites multiples d'un vecteur d'adenovirus en vue de provoquer une angiogenese
WO1998050079A2 (fr) * 1997-05-06 1998-11-12 The Regents Of The University Of California Techniques et compositions destinees au traitement d'une insuffisance cardiaque et du remodelage ventriculaire par apport in vivo de transgenes angiogeniques
WO1999040945A2 (fr) * 1998-02-11 1999-08-19 The Regents Of The University Of California Traitement de l'angiogenese par transfert de genes et techniques d'apport intravasculaire de genes
WO2000038518A1 (fr) * 1998-12-28 2000-07-06 Arch Development Corporation Transfert efficace et stable in vivo de genes dans des cardiomyocytes a l'aide de vecteurs viraux adeno-associes de recombinaison

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
GIORDANO F J ET AL: "INTRACORONARY GENE TRANSFER OF FIBROBLAST GROWTH FACTOR-5 INCREASES BLOOD FLOW AND CONTRACTILE FUNCTION IN AN ISCHEMIC REGION OF THE HEART", NATURE MEDICINE,US,NATURE PUBLISHING, CO, vol. 2, no. 5, 1 May 1996 (1996-05-01), pages 534 - 539, XP000619527, ISSN: 1078-8956 *
ISNER J M ET AL: "CLINICAL EVIDENCE OF ANGLOGENESIS AFTER ARTERIAL GENE TRANSFER OF PHVEGF165 IN PATIENT WITH ISCHAEMIC LIMB", LANCET THE,GB,LANCET LIMITED. LONDON, vol. 348, 10 August 1996 (1996-08-10), pages 370 - 374, XP002059360, ISSN: 0140-6736 *
LEWIS B S ET AL: "ANGIOGENESIS BY GENE THERAPY: A NEW HORIZON FOR MYOCARDIAL REVASCULARIZATION?", CARDIOVASCULAR RESEARCH,XX,XX, vol. 35, no. 3, 1997, pages 490 - 497, XP000916748, ISSN: 0008-6363 *
MACK C A ET AL: "SALVAGE ANGIOGENESIS INDUCED BY ADENOVIRUS-MEDIATED GENE TRANSFER OF VASCULAR ENDOTHELIAL GROWTH FACTOR PROTECTS AGAINST ISCHEMIC VASCULAR OCCLUSION", JOURNAL OF VASCULAR SURGERY,C.V. MOSBY CO., ST. LOUIS, MO,US, vol. 27, no. 4, April 1998 (1998-04-01), pages 699 - 709, XP000949375, ISSN: 0741-5214 *
RAJANAYAGAM S ET AL: "DELIVERY OF VEGF TO ISCHEMIC TISSUE USING ADENOVIRAL-MODIFIED AUTOLOGOUS ENDOTHELIAL CELLS", CIRCULATION,US,AMERICAN HEART ASSOCIATION, DALLAS, TX, vol. 94, no. 8, 15 October 1996 (1996-10-15), pages 646, XP002064912, ISSN: 0009-7322 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU784392B2 (en) * 1999-11-05 2006-03-23 Regents Of The University Of California, The Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
EP1310266A1 (fr) * 2001-11-13 2003-05-14 St. Jude Medical, Inc. Dispositifs médicaux stimulant la production des facteurs de croissance
US7812146B2 (en) 2002-03-20 2010-10-12 Viromed Co., Ltd. Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
US7745174B2 (en) 2002-03-20 2010-06-29 Viromed Co., Ltd. Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
US7838505B2 (en) 2002-03-20 2010-11-23 Viromed Co., Ltd. Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
US8338385B2 (en) 2002-03-20 2012-12-25 Viromed Co., Ltd. Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
USRE48404E1 (en) 2002-03-20 2021-01-26 Helixmith Co., Ltd Hybrid hepatocyte growth factor gene having high expression efficiency of two heterotypes of hepatocyte growth factor
WO2004012775A3 (fr) * 2002-08-05 2004-05-27 Zaklady Farm Polpharma Sa Boite d'expression, vecteur de plasmide a deux cistrons, produit pharmaceutique et leur utilisation en therapie genique angiogenique
WO2004012775A2 (fr) * 2002-08-05 2004-02-12 Zaklady Farmaceutyczne Polpharma S.A. Boite d'expression, vecteur de plasmide a deux cistrons, produit pharmaceutique et leur utilisation en therapie genique angiogenique
US8389492B2 (en) 2008-04-09 2013-03-05 Viromed Co., Ltd. Lyophilized DNA formulations for enhanced expression of plasmid DNA
WO2010078624A1 (fr) * 2009-01-07 2010-07-15 Vegenics Limited Matériaux et méthodes pour le traitement de l’hypertension
US10155099B2 (en) 2009-09-21 2018-12-18 Cook Regentec Llc Method for infusing stem cells
US10806891B2 (en) 2009-09-21 2020-10-20 Cook Regentec Llc Method for infusing stem cells
EP2814513A4 (fr) * 2012-02-14 2016-01-13 Univ California Administration systémique et expression régulée des gènes à action paracrine pour les maladies cardiovasculaires et autres états
EP3311830A1 (fr) * 2012-02-14 2018-04-25 The Regents of The University of California Administration systémique et expression régulée des gènes à action paracrine pour les maladies cardiovasculaires et autres états
US10202618B2 (en) 2012-02-14 2019-02-12 The Regents Of The University Of California Method of treating type I diabetes using an AAV vector encoding uracortin 2
AU2013221615B2 (en) * 2012-02-14 2018-02-22 The Regents Of The University Of California Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions
RU2642605C2 (ru) * 2012-02-14 2018-01-25 Те Риджентс Оф Те Юниверсити Оф Калифорния Системная доставка и регулируемая экспрессия паракринных генов для лечения сердечно-сосудистых и иных заболеваний
US10918738B2 (en) 2012-02-14 2021-02-16 The Regents Of The University Of California Method of treating type I diabetes using an AAV vector encoding uracortin 2
US10532193B2 (en) 2012-06-05 2020-01-14 Muffin Incorporated Catheter systems and methods useful for cell therapy
US10639351B2 (en) 2013-10-22 2020-05-05 Helixmith Co., Ltd. Method for treating amyotrophic lateral sclerosis with a polynucleotide encoding two or more isoforms of hepatocyte growth factor
WO2019222455A1 (fr) * 2018-05-16 2019-11-21 University Of Massachusetts Administration à base de perfusion de vecteurs de vaa recombinés pour l'expression de protéines sécrétées
US11554179B2 (en) 2018-07-19 2023-01-17 Helixmith Co., Ltd Lyophilized pharmaceutical compositions for naked DNA gene therapy

Also Published As

Publication number Publication date
CA2389524A1 (fr) 2001-05-17
JP2003513942A (ja) 2003-04-15
EA200200533A1 (ru) 2002-12-26
EA008538B1 (ru) 2007-06-29
AU784392B2 (en) 2006-03-23
AU1460401A (en) 2001-06-06
KR20020049031A (ko) 2002-06-24
CN1433325A (zh) 2003-07-30
HK1048593A1 (zh) 2003-04-11
EP1225921A1 (fr) 2002-07-31
NZ546670A (en) 2009-02-28

Similar Documents

Publication Publication Date Title
US20090082293A1 (en) Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
AU706908B2 (en) Gene-transfer-mediated angiogenesis therapy
US6174871B1 (en) Gene therapies for enhancing cardiac function
AU784392B2 (en) Techniques and compositions for treating cardiovascular disease by in vivo gene delivery
CA2289600C (fr) Techniques et compositions destinees au traitement d'une insuffisance cardiaque et du remodelage ventriculaire par apport in vivo de transgenes angiogeniques
WO1999062940A9 (fr) Procedes de modification du phenotype de la cellule cardiaque
EP1695719A1 (fr) Combinaision d'une acide nucléaire et d'un agent vasoactif pour l'amélioration de transfert de gènes
AU2002216751A1 (en) Dual recombinant gene therapy compositions and methods of use
US20130096500A1 (en) Nucleic acid based cardiovascular therapeutics
AU2006200170B2 (en) Combination of a nucleic acid and a vasoactive agent for enhanced gene delivery
AU706050C (en) Gene transfer-mediated angiogenesis therapy
US20160296674A1 (en) Nucleic acid based cardiovascular therapeutics
AU2006235836A1 (en) Gene transfer-mediated angiogenesis therapy
AU4754199A (en) Gene transfer-mediated angiogenesis therapy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2389524

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 149451

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020027005855

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2001 536204

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 518793

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2000976894

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 14604/01

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 008164819

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 200200533

Country of ref document: EA

WWP Wipo information: published in national office

Ref document number: 1020027005855

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2000976894

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642