WO2001032673A1 - Sequences codant un marqueur neoplasique humain - Google Patents

Sequences codant un marqueur neoplasique humain Download PDF

Info

Publication number
WO2001032673A1
WO2001032673A1 PCT/US2000/030190 US0030190W WO0132673A1 WO 2001032673 A1 WO2001032673 A1 WO 2001032673A1 US 0030190 W US0030190 W US 0030190W WO 0132673 A1 WO0132673 A1 WO 0132673A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
tnox
seq
cell
host cell
Prior art date
Application number
PCT/US2000/030190
Other languages
English (en)
Other versions
WO2001032673A9 (fr
Inventor
D. James Morre
Dorothy M. Morre
Pin-Ju Chueh
Original Assignee
Purdue Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Purdue Research Foundation filed Critical Purdue Research Foundation
Priority to GB0210912A priority Critical patent/GB2371548B/en
Priority to CA002388612A priority patent/CA2388612A1/fr
Priority to JP2001535374A priority patent/JP2003517299A/ja
Priority to AU14537/01A priority patent/AU1453701A/en
Publication of WO2001032673A1 publication Critical patent/WO2001032673A1/fr
Publication of WO2001032673A9 publication Critical patent/WO2001032673A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the field of this invention is the area of molecular biology, in particular, as related to the molecular biology of neoplastic and diseased cells, as specifically related to a cell surface marker for neoplastic and certain other diseased cell states.
  • An object of the present invention is to provide a recombinant plasma membrane NADH oxidase/thiol interchange protein (termed tNOX herein) and its coding sequence.
  • the full length protein has an amino acid sequence as given in SEQ ID NO:2, and the truncated tNOX protein has the amino acid sequence given in SEQ ID NO:2, amino acids 220-610.
  • the full length sequence has a specifically exemplified coding sequence as given in SEQ ID NO:l, nucleotides 23-1852, and the truncated protein has an amino acid sequence as given at nucleotides 680-1852 of SEQ ID NO:l.
  • coding sequences which are synonymous with those specifically exemplified sequences. Also contemplated within the present invention are sequences which encode a neoplastic cell surface marker and which coding sequences hybridize under stringent conditions to the specifically exemplified full length or partial sequence.
  • the cell surface tNOX is characteristic of neoplastic conditions and certain viral and other infections (e.g., HIV).
  • the recombinant tNOX protein is useful in preparing antigen for use in generation of monoclonal antibodies or antisera for diagnosis of cancer, other neoplastic conditions, and certain infectious disease states.
  • non-naturally occurring recombinant DNA molecules comprising a portion encoding an NADH oxidase/protein disulfide-thiol interchange polypeptide, said portion consisting essentially of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , nucleotides 23 to 1852; SEQ ID NO: 1 , nucleotides 680 to 1852; and a sequence which hybridizes under stringent conditions to one of the foregoing sequences and wherein said hybridizing sequence encodes a neoplastic marker protein of the cell surface having NADH oxidase/protein disulfide-thiol interchange activity.
  • These recombinant DNA molecules can include sequences where the encoded polypeptide consists essentially of an amino acid sequence of SEQ ID NO:2, amino acids 1 to 610 or amino acids 220 to 610.
  • the portion encoding the specified polypeptide can further contain a translation termination codon (TGA, TAA or TAG) immediately downstream of nucleotide 1852 of SEQ ID NO: 1
  • TGA, TAA or TAG translation termination codon
  • the present invention further provides a method for determining neoplasia in a mammal, said method comprising the steps of detecting the presence, in a biological sample from a mammal, of a ribonucleic acid molecule encoding a NADH oxidase/protein disulfide thiol interchange protein associated with neoplastic cells as compared to a ribonucleic acid molecule encoding a NADH oxidase associated with normal cells, wherein the step of detecting is carried out using hybridization under stringent conditions or using a polymerase chain reaction in which a perfect match of primer to template is required, where a hybridization probe or primer consists essentially consists essentially of at least 15 consecutive nucleotides of a nucleotide sequence as given in SEQ ID NO:l and correlating the result obtained with said sample in step (a), where the presence of the ribonucleic acid molecule in the biological sample is indicative of the presence of neoplasia.
  • the method encompasses the use of hybridization probes which consist essentially of a nucleotide sequence as given in SEQ ID NO:l, nucleotides 680-1852, nucleotides 23 to 1852 or a portion thereof where there is a detectable difference in the results obtained with normal cells as compared to neoplastic cells or virus infected cells.
  • the present invention enables the generation of antibody preparations, especially using recombinant tNOX or truncated tNOX or an antigenic peptide derived in sequence from tNOX, which specifically binds to an antibody selected from the group consisting of a protein characterized by an amino acid sequence as given in SEQ ID NO:2, amino acids 1-610, a protein characterized by an amino acid sequence as given in SEQ ID NO:220-610 or a protein characterized by an amino acid sequence as given in SEQ ID NO: 16.
  • These antibody preparations are useful in detecting tNOX in blood or serum from a patient or animal with a neoplastic condition such as cancer, or cells or tissue which are neoplastic or virus infected.
  • tNOX of the present invention in a host cell, for example, a mammalian host cell, results in a faster growth rate of the recombinant host cell and a significant increase in recombinant cell volume.
  • the MAB 12.1 used in the expression screening does not appear to react selectively with an antigen preferentially expressed by OVCAR-3 cells nor do any of the properties of tNOX parallel those of the Kl antigen of OVCAR-3 cells.
  • tNOX tNOX cDNA was subcloned into a pcDNA3.1 expression vector with Hindlll and BamHI restriction sites. Subsequently, COS cells were transfected with tNOX using calcium phosphate transfection and DMSO shock. tNOX overexpression was evaluated on the basis of enzymatic activity and Western blot analysis. Peptide antibody against tNOX recognized expressed proteins with the molecular weights of 34 and 48 kDa. Growth rates determined by image enhanced light microscopy of the tNOX-transfected cells were 2- to 3-fold greater than with vector alone. The larger cell diameter led to a 4- to 5-fold increase in cell volume.
  • transfected COS cells were more susceptible to tNOX inhibitors, such as capsaicin and epigallocatechin gallate (EGCg), with the EC 50 of growth inhibition being shifted by 1 to 2 orders of magnitude to lower drug concentrations.
  • tNOX function is in cell enlargement and is believed important in sustaining the uncontrolled growth of cancer cells.
  • Fig. 1 summarizes the results of restriction mapping the tNOX cDNA clones.
  • Fig. 2 diagrammatically illustrates the intron-exon organization of the gene encoding human tNOX. Closed boxes in the genomic DNA map represent the identified protein- coding exons. The tNOX gene is at the Xq25-26 chromosomal locus. At least nine exons have been identified within the partial genomic information available (Bird, 1999).
  • Fig. 3 is a hydropathy plot prepared using the deduced amino acid sequence of tNOX and the algorithm of Kyte and Doolittle, 1982. One strongly hydrophobic region extending from amino acids 535-558 of SEQ ID NO:2 was identified.
  • Fig. 4 shows the results of Western blot analysis of OVCAR-3 cells using antisera raised in a rabbit which was immunized with recombinant tNOX. Following separation on
  • Fig. 5A-5C show the periodic variation in the rate of oxidation of NADH as a function of time over 100 min, with 5 maxima.
  • Fig. 5 A the enzyme source was a crude preparation from bacterial cells expressing the tNOX cDNA from a HeLa library induced to express the protein by the addition of IPTG.
  • Fig. 5B The crude preparation was as in Fig. 5 A except that the expression of the tNOX cDNA cloned under the regulatory control of the lac promoter was not induced.
  • Fig. 5C The crude preparation was as in Fig. 5A except that the activities were measured as a function of time.
  • the solid curve shows oxidation of NADH as measured in Fir. 5 A.
  • the dotted curve shows the cleavage of a dithiopyridine (DTP) substrate as a measure of protein disulfide-thiol interchange.
  • DTP dithiopyridine
  • Fig. 6 shows overexpression of tNOX in COS cells as determined after sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
  • the first two lanes are the results of Ponceau staining (lane 1 , tNOX cDNA cloned into the pcDNA3.1 expression vector and transfected and expressed in COS cells; lane 2, vector without insert).
  • the remaining lanes are the results of Western blotting with tNOX-specific antibody and detection (lane 3, tNOX cDNA; lane 4, vector without insert).
  • Fig. 7 graphically illustrates that the diameters of transfected COS cells were greater (approximately two times greater than those of untransfected COS cells).
  • Fig. 8 compares periodic changes in rates of cell enlargement (growth) of COS cells transfected with vector without insert (upper curve) and COS cells transfected with vector containing the tNOX cDNA insert (lower curve).
  • the tNOX cDNA-transfected COS cells enlarge at about twice the rate of the control cells.
  • Fig. 9 shows that the COS cells transfected with the tNOX cDNA were more susceptible to capsaicin, which is a known anticancer agent and tNOX inhibitor.
  • Fig. 10 demonstrates that COS cells transfected with the tNOX cDNA were more susceptible to epigallocatechin gallate (EGCg), the principal anticancer constituent of green tea.
  • ECCg epigallocatechin gallate
  • X or Xaa represents an amino acid residue that has not yet been identified but may be any amino acid residue including but not limited to phosphorylated tyrosine, threonine or serine, as well as cysteine or a glycosylated amino acid residue.
  • amino acid residues as used herein are as follows: A, Ala, alanine; V, Val, valine; L, Leu, leucine; I, He, isoleucine; P, Pro, proline; F, Phe, phenylalanine; W, Trp, tryptophan; M, Met, methionine; G, Gly, glycine;
  • S Ser, serine; T, Thr, threonine; C, Cys, cysteine; Y, Tyr, tyrosine; N, Asn, asparagine; Q, Gin, glutamine; D, Asp, aspartic acid; E, Glu, glutamic acid; K, Lys, lysine; R, Arg, arginine; and H, His, histidine.
  • Additional abbreviations used herein include Mes, 2-(N-morpholino)ethanesulfonic acid; DMSO, dimethylsulfoxide; tNOX, cancer-associated and drug- (capsaicin-) responsive cell surface NADH oxidase; ttNOX, truncated tNOX; CNOX, constitutive and drug- unresponsive cell surface NADH oxidase; SDS-PAGE, sodium dodecylsulfate- polyacrylamide gel electrophoresis; capsaicin, 8-methyl-N-vanillyl-6-noneamide; LY181984, N-(4-methylphenylsulfonyl)-N'-(4-chlorophenly)urea; LY181985, N-(4- methylphenylsulfonyl)-N'-(4-phenyl)urea; EGCg, (-)-epigallocatechin gallate.
  • DMSO dimethylsulfoxide
  • Neoplastic conditions include, but are not limited to, cancers, sarcomas, tumors, leukemias, lymphomas, and the like.
  • the cell surface NADH oxidase/protein disulfide-thiol interchange protein of the present invention characterizes neoplastic cells and tissue as well as virus-infected cells (for example, human immunodeficiency virus, feline immunodeficiency virus, etc).
  • the cell surface marker which is characteristic of diseased cells is described in U.S. Patent No. 5,605,810, issued February 25, 1997, which is incorporated by reference herein, and in several scientific publications of which D. James Morre is sole author or a coauthor.
  • This NADH oxidase/thiol interchange protein is found in the plasma membrane of neoplastic cells and cells infected with viruses, especially retroviruses and protozoan parasites. This protein is termed tNOX herein (tumor NADH oxidase).
  • tNOX tumor NADH oxidase
  • tNOX cDNA is comprised of multiple exons (at least nine) in just the N-terminal portion of the full-length precursor (Fig 2).
  • the C-terminal portion of the derived amino acid sequence corresponded to the mature, processed MW of 34 kDa (ca 33.5 kDa from serum) as documented in previous studies (Morre et al., 1995a, 1996a; Chueh et al., 1997; del Castillo Olivares et al., 1998).
  • Several potential functional motifs required of tNOX were contained in this portion of the protein as follows: The sequence E394-E-M-T-E forms a putative quinone binding site with 4 of 5 amino acids conserved (Table 2).
  • the C505-X-X-X-X-C510 motif represents a potential active site for the protein disulfide-thiol interchange activity based on site-directed mutagenesis (Table 3). Also representing a potential active site for protein disulfide-thiol interchange activity from site-directed mutagenesis and from inhibition of activity by antisera to a C-X-X-X-X-C-containing peptide (LAILPACATPATCNPD) is C569-X-X-X-X-X- C575 (amino acids 569-575 of SEQ ID NO:2).
  • the sequence T590-G-V-G-A-S-L (amino acids 590-595 of SEQ ID NO:2) together with E605 forms a putative binding site for the adenine portion of NADH with 5 of 7 amino acids conserved with known mitochondrial adenine-binding proteins (Leblanc et al, 1995).
  • the H546-V-H-E-F-G motif (amino acids 546-
  • N-glycosylation sites were at positions 138, 358, 418 and 525.
  • Potential O-glycosylation sites include a threonine at amino acid 38, a threonine at amino acid 71, a serine at amino acid 35 and a serine at amino acid 240.
  • tNOX is a membrane-associated protein.
  • Three putative signal sequences and cleavage sites near the N-terminus were identified as involved in membrane targeting.
  • the second signal sequence near M220 would yield a 45.6 kDa protein containing all of the above identified functional motifs.
  • the third potential signal sequence near M314 would result in a 34 kDa protein.
  • In vitro translation of the cDNA of truncated tNOX starting at M220 using a rabbit reticulocyte lysate in the presence and absence of dog pancreatic microsomal membranes showed no indication of membrane insertion or apparent change in molecular weight of the in vitro translated product indicative of membrane-dependent processing.
  • the truncated tNOX is encoded in SEQ ID NO:l, nucleotides 680-1852.
  • tNOX is a non-lipid-linked, extrinsic protein of the external plasma membrane surface (Morre, 1995). It is released from membranes by incubation at pH 5 (del Castillo et al.,
  • APK1 antigen cDNA sequence was obtained originally by expression cloning using a Kl antibody produced from the ovarian carcinoma cell line (OVCAR-3) as immunogen.
  • a portion of the cDNA of tNOX appears to be the same as that isolated by Chang and Pastan except that their sequence contained one extra T at nucleotide 929 and one less G at nucleotide 1092 (at the nucleotide 83 and 247 of their sequence). These differences generated an incorrect reading frame. The two errors were confirmed by Sugano et al. (2000).
  • the monoclonal antibody used for cDNA screening did not react with the Kl antigen expressed by OVCAR-3 cells nor do any of the properties of tNOX parallel those of the Kl antigen.
  • the non-identity of tNOX and Kl antigen is consistent with a subsequent identification of the CAK1 protein as the protein reactive with the Kl antibody (Chang et al., 1992; Chang and Pastan, 1994).
  • CAK1 protein is expressed primarily in cell lines of mesothelial origin (Chang et al., 1992) and is anchored in the membrane by a glycosidic phosphatdyl-inositol (GPI) anchor.
  • GPI glycosidic phosphatdyl-inositol
  • tNOX The expression of the tNOX cDNA in E. coli resulted in several forms of tNOX including a truncated 46 kDa beginning at M220 (ttNOX), 46 kDa histidine-tagged ttNOX and 34 kDa truncated tNOX beginning at G327.
  • ttNOX truncated 46 kDa beginning at M220
  • ttNOX 46 kDa histidine-tagged ttNOX
  • 34 kDa truncated tNOX beginning at G327.
  • tNOX proteins were identified by reaction with the tNOX-specific monoclonal antibody (Fig 5).
  • the apparent molecular weight of the ttNOX of 48 kDa on SDS-PAG ⁇ was consistent with the calculated molecular weight from the deduced amino acid sequence of 46 kDa.
  • the molecular weight of the truncated tNOX beginning at G327 was 42 kDa on SDS-PAG ⁇ .
  • Direct amino acid sequencing has revealed that the expressed protein purified from bacterial extract matched the deduced amino acid sequence.
  • the induced bacterial extract exhibited a NADH oxidase activity with a 23 min period (arrows in Fig. 6A). Both the induced bacterial extracts when measured in the presence of 1 or 100 ⁇ M capsaicin (open circles in Fig. 6A and Fig. 7) or the uninduced extracts (Fig. 6B) had no periodic activity.
  • the addition of 1 ⁇ M antitumor sulfonylurea LY181984 also completely inhibited the activity.
  • Illustrated in Fig. 7 is a second unique feature of the cell surface tNOX activity whereby the maximum rates of the two activities associated with the cloned and expressed protein, the hydroquinone (NADH) oxidase activity and the protein disulfide-thiol interchange (dithiodipyridine cleavage), alternate.
  • NADH hydroquinone
  • DTDP cleavage increases, so that DTDP cleavage is at a maximum when NADH oxidation is at a minimum. Both had approximately the same period length of 23 min.
  • Peptide antisera against the tNOX C-terminus recognized expressed a truncated protein species (produced in recombinant COS-1 cells) with a molecular weight 48 kDa on SDS-PAGE (Fig 8). Also present were two peptides of lower M r . Growth rates determined by image enhanced light microscopy of the ttNOX-transfected cells were about 2-fold greater than with vector alone (Fig 9). The increased growth rate also was reflected in increased cell size. At confluency, the mean cell diameter of tNOX-transfected COS cells was about 30 ⁇ m whereas the average cell diameter of COS cells transfected with vector alone was about 20 ⁇ m (Fig. 10).
  • tNOX inhibitors included capsaicin, (-)-epigallocatechin gallate (EGCg), adriamycin, and the active antitumor sulfonylurea, LY181984 (N-(4-methylphenylsulfonyl)-
  • tNOX protein and the 34 kD NOX protein isolated from sera represent the same protein derives, in part, from the collective properties that define the two proteins. These include two different enzymatic activities, hydroquinone (NADH) oxidation and protein disulfide-thiol interchange (Figs. 6 and 7), together with an alternation of these two activities to generate a period length of 22 min (Figs. 6 and 7, Table 3). Additionally, the activities of both proteins respond to the same series of quinone site inhibitors and antitumor drugs in situ as well as in solution (Tables3 and 4). It is the latter property that defines tNOX and distinguishes tNOX from other NOX proteins lacking drug responsiveness.
  • a further characteristic of NOX proteins is that the two activities, NADH oxidation and protein disulfide-thiol interchange, alternate every 12 min to generate a regular pattern of oscillations with a temperature compensated and entrainable period length of ca 24 min (Fig.
  • NADH oxidation and protein disulfide-thiol interchange was increased to 36 min.
  • the period length was 39 min.
  • NOX proteins are unique in that they exhibit two different activities, hydroquinone oxidation and protein disulfide-thiol interchange. The two activities alternate (Morre, 1998; Sun et al., 2000) to generate the ca 24 min period.
  • tNOX the cancer-specific form designated tNOX.
  • tNOX differs from the constitutive CNOX form present in both cancer and non-cancer tissues in its sensitivity to several anticancer drugs and to thiol reagents.
  • the response of tNOX activity to the quinone site inhibitor capsaicin was used to guide purification of the processed tNOX protein from sera of cancer patients, as the basis for the monoclonal antibody selection and eventually to confirm the identity of the cloned cDNA based on complete capsaicin-inhibition of the activity of the bacterially expressed protein (Fig. 6).
  • the sequence was one previously attributed to a cytosolic protein, the APK1 antigen (Chang and Pastan, 1994).
  • the APK1 antigen was considered to be the antigen recognized by a monoclonal antibody designated Kl that was produced by hybridoma cells from mice immunized with ovarian carcinoma (OVCAR-3) cells.
  • CAK1 The protein reactive with the Kl antibody was originally identified as CAK1 (Chang et al., 1992).
  • CAK1 is a membrane-bound protein with a molecular weight of 40 kDa, whereas the expressed APK1 gene product generated a soluble cytosolic protein (Chang and Pastan, 1994).
  • CAKl is expressed in ovarian cancers and mesotheliomas as well as in normal mesothelial cells. It appears to be a differentiation antigen that is expressed on cancers derived from mesothelium, such as epithelioid type mesotheliomas and ovarian cancers. It is a protein very distinct from tNOX.
  • the monoclonal antibody Kl Using the monoclonal antibody Kl, they eventually isolated a 2,138-bp cDNA that encoded CAKl (Chang and Pastan, 1996).
  • the cDNA had an 1,884- bp open reading frame encoding a 69 kDa protein.
  • the 69 kDa precursor was processed to the 40 kDa form and the protein was named mesothelin because it was characteristic of mesothelial cells.
  • the cDNA When the cDNA was transfected into COS and NIH3T3 cells, the antigen was found on the cell surface and could be released by treatment with phosphatidylinositol- specific phospholipase C.
  • tNOX is not anchored at the plasma membrane by a GPI linkage nor is it released by treatment with a phosphatidylinositol-specific phospholipase C.
  • Mesothelin (CAKl) while associated with the cell membrane via a glycosyl- phosphatidylinositol tail, is not shed into the sera of cancer patients nor does it appear in conditioned medium supporting the growth of cultured cells (Chang and Pastan, 1994).
  • CAKl Mesothelin
  • tNOX has been isolated both from culture media by the growth of HeLa cells (Wilkinson et al, 1996) and from sera of cancer patients (Chueh et al., 1997). Furthermore, no protein sequence homology was found between CAKl and tNOX.
  • the NOX protein binds the antitumor sulfonylurea LY181984 (Morre et al., 1995c) and activity is inhibited or stimulated depending on the redox environment of the protein (Morre et al., 1998b).
  • Reduced coenzyme Q is readily oxidized by the protein (Kishi et al., 1999) and other substances such as capsaicin and adriamycin which inhibit the activity are considered to occupy quinone sites.
  • Ubiquinone protects against the binding and activity inhibition by the sulfonylurea LY181984.
  • the presence in the tNOX sequence of a motif indicative of quinone binding as well as binding of sulfonylureas and other molecules known to occupy quinone sites was sought.
  • a site with a methionine-histidine pair has been suggested to be the quinone binding site of pyruvate oxidase (Grabau and Cronan, 1986) by analogy with several quinone binding proteins of the photosystem II complex of chloroplasts. All known urea and sulfonylyrea herbicide inhibitors of photosystem II are directed to such sites (Duke, 1990). Based on these considerations, a preliminary consensus sequence for the amino acids surrounding the charged residues critical to sulfonylurea and quinone-binding site was determined to be A-M- H-G (SEQ ID NO:4) or a closely related sequence (Table 2). Apparently arginine can substitute for the critical histidine.
  • the putative quinone-binding site of the Dl protein of a cyanobacterium contains the sequence E-T-M-R-E (SEQ ID NO:5).
  • E-T-M-R-E SEQ ID NO:5
  • a sequence similar to E-T-M-R-E sequence is present in the NADH ubiquinone dehydrogenase of chloroplasts.
  • Serum albumins also bind sulfonylureas and their putative sulfonylurea binding sites are included in Table I as well.
  • the restoration of activity to scrambled yeast RNase was similar to that catalyzed by protein disulfide isomerases of the endoplasmic reticulum (Freedman, 1989) but was clearly due to an activity of a different protein.
  • a C-X-X-C motif is present as well in thioredoxin reductase and related proteins where it appears to catalyze the transfer of electrons in conjunction with bound flavin (Russel and Model, 1988; Ohnishi et al., 1995).
  • tNOX does not appear to contain bound flavin nor is its activity dependent upon addition of flavin (FAD or FMN).
  • FAD or FMN flavin
  • the redox active disulfide of thioredoxin reductase from the malaria parasite Plasmodiumfalciparum was in a motif C88-X-X-X-X-C93 (Gilberger et al., 1997) similar to those found in tNOX. This motif together with a downstream His509 was shown to be a putative proton donor/acceptor. A second C535-X-X-X-X-C540 motif in the same protein was crucially involved in substrate coordination and/or electron transfer (Gilberger et al., 1998). As suggested by the site directed mutagenesis results for tNOX, four of the eight cysteines present in truncated tNOX may be functionally paired.
  • tNOX lacks the two C-X-X-X-X-C motifs characteristic of flavoproteins, the sequence C505-A-S-R-L-C510 (amino acids 505-510 of SEQ ID NO:2) or the sequence C569-T-S-D-V-E-C575 (amino acids
  • SEQ ID NO:2 569-575 of SEQ ID NO:2 might represent potential protein disulfide-thiol interchange motifs.
  • the tNOX protein catalyzes the transfer of electrons and protons to molecular oxygen. Oxygen uptake by plasma membranes prepared from HeLa cells is inhibited by the antitumor sulfonylurea L 181984 with approximately the same dose response (see Morre et al., 1998a) as other aspects of tNOX activity (see also Morre et al.,
  • tNOX and NOX proteins in general bind oxygen The minimum requirement for an oxygen site would appear to be a metal together with appropriate covalent interactions such as hydrogen bonding (MacBeth et al., 2000). There are no indications that they might form a cluster with a typical motif for a [4Fe-4S] cluster binding site (C-X-X-C-X-X-C) and a remote cysteine followed by a proline.
  • tNOX does contain a conserved copper site, which could provide the basis for oxygen binding.
  • truncated tNOX in E. coli and COS cells has confirmed that the cloned cDNA indeed exhibits fully the characteristics of the tNOX protein. All forms of tNOX (including the truncated and processed forms) were recognized by the tNOX-specific monoclonal antibody used in expression cloning. In addition, the expressed protein exhibited both enzymatic activities associated with NOX proteins (Figs. 6 and 7). Overexpression of the tNOX proteins in COS cells stably transfected with the tNOX cDNA imparted tNOX- specific characteristics to the COS cells.
  • the tNOX cDNA-transfected cells exhibited a 1.5 to 2-fold increase in cell size compared to control cells (3- to 5-fold increase in cell volume) and one to two log orders increase in sensitivity to tNOX-inhibitory drugs including capsaicin, (-)-epigallocatechin gallate (EGCg), adriamycin and the antitumor sulfonylureas (Table III).
  • EGCg is the principal catechin responsible for the effects of green tea and green tea extracts on cancer prevention and on growth of cancer cells in culture (Chang, 2000).
  • EGCg inhibits the activity of tNOX but is largely without effect on the constitutive CNOX (Morre et al., 2000).
  • the findings discussed herein confirm the molecular cloning and expression of the tNOX protein.
  • the availability of the cDNA and the expressed protein will greatly facilitate future studies of the potential contribution of tNOX to unregulated growth and loss of differentiated characteristics linked to cancer.
  • the restriction mapping revealed that the five independent clones were identical except for the different lengths of DNA inserts. Since clone 1 contained the longest DNA insert, it was chosen for complete DNA sequencing. The rest of the four clones were sent for one round of automated sequencing. DNA sequences of all five clones were examined in the GenBank to seek identity or relatedness with other known genes. A computer-assisted search revealed that all five clones were similar to a DNA sequence designated as APK1 antigen [Chang and Pastan (1994) supra]. When all five of our clones were compared with the nucleotide sequence of APK1 antigen, two possible differences were observed in positions 83 and 246 of the APK1 antigen sequence.
  • the nucleotide sequence encoding human tNOX, recombinant human tNOX protein and recombinant cells which express recombinant human tNOX can be used in the production of recombinant tNOX for use in pancancer diagnostic protocols and as a target for (screening) new anticancer drugs.
  • nonexemplified plasma membrane NADH oxidase of neoplastic mammalian cells, virus- or parasite-infected mammalian cells or capsaicin-responsive plant plasma membrane NADH oxidase proteins can have some amino acid sequence divergence from the specifically exemplified amino acid sequence.
  • Such naturally occurring variants can be identified, e.g., by hybridization to the exemplified coding sequence (or a portion thereof capable of specific hybridization to human tNOX sequences) under conditions appropriate to detect at least about 70% nucleotide sequence homology, preferably about 80%, more preferably about 90%) or 95-100%) sequence homology.
  • the encoded tNOX has at least about 90% amino acid sequence identity to the exemplified tNOX amino acid sequence.
  • nucleic acid molecules comprising nucleotide sequences encode tNOX proteins and which hybridize under stringent conditions to a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:l or a sequence corresponding to nucleotides 23 to 1852 thereof.
  • DNA molecules with at least 85%o nucleotide sequence identity to a specifically exemplified tNOX coding sequence sequence of the present invention are identified by hybridization under stringent conditions using a probe as set forth herein.
  • Stringent conditions involve hybridization at a temperature between 65 and 68C in aqueous solution (5 x SSC, 5 x Denhardt's solution, 1%> sodium dodecyl sulfate) or at about 42C in 50% formamide solution, with washes in 0.2 x SSC, 0.1%) sodium dodecyl sulfate at room temperature, for example.
  • aqueous solution 5 x SSC, 5 x Denhardt's solution, 1%> sodium dodecyl sulfate
  • washes in 0.2 x SSC, 0.1%) sodium dodecyl sulfate at room temperature for example.
  • percent homology or percent sequence identity of two nucleic acid molecules is determined using the algorithm of Karlin and Altschul (1990) Proc. Natl Acad. Sci. USA 87, 2264-2268, modified as described in Karlin and Altschul (1993)
  • amino acid substitutions can be made in protein sequences without affecting the function of the protein. Generally, conservative amino acids are tolerated without affecting protein function. Similar amino acids can be those that are similar in size and/or charge properties; for example, aspartate and glutamate and isoleucine and valine are both pairs of similar amino acids. Similarity between amino acid pairs has been assessed in the art in a number of ways. For example, Dayhoff et al. [(1978) In: Atlas of Protein Sequence and Structure, Volume 5, Supplement 3, Chapter 22, pp. 345-352], which is incorporated by reference herein, provides frequency tables for amino acid substitutions which can be employed as a measure of amino acid similarity.
  • Dayhoff et al.'s frequency tables are based on comparisons of amino acid sequences for proteins having the same function from a variety of evolutionarily different sources.
  • the art provides methods for determining tNOX activity, including its characteristic response to certain inhibitors (capsaicin, adriamycin, quassinoids, etc).
  • a polynucleotide or fragment thereof is substantially homologous (or substantially similar) to another polynucleotide if, when optimally aligned (with appropriate nucleotide insertions or deletions) with another polynucleotide, there is nucleotide sequence identity for approximately 60% of the nucleotide bases, usually approximately 70%>, more usually about 80%, preferably about 90%>, and more preferably about 95%> to 100%> of the nucleotide bases.
  • substantial homology exists when a polynucleotide or fragment thereof will hybridize to another polynucleotide under selective hybridization conditions.
  • Selectivity of hybridization exists under hybridization conditions which allow one to distinguish the target polynucleotide of interest from other polynucleotides.
  • selective hybridization will occur when there is approximately 55% similarity over a stretch of about 14 nucleotides, preferably approximately 65%, more preferably approximately 75%, and most preferably approximately 90%. See Kanehisa [(1984) Nucl. Acids Res. 12:203- 213].
  • the length of homology comparison, as described, may be over longer stretches, and in certain embodiments will often be over a stretch of about 17 to 20 nucleotides, and preferably about 36 or more nucleotides.
  • the hybridization of polynucleotides is affected by such conditions as salt concentration, temperature or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing polynucleotides, as will be readily appreciated by those skilled in the art. However, the combination of parameters is much more important than the measure of any single parameter [Wetmur and Davidson (1968) J Mol Biol. 31 : 349-370].
  • An isolated or substantially pure polynucleotide is a polynucleotide which is substantially separated from other polynucleotide sequences which naturally accompany a native tNOX protein coding sequence:
  • the term embraces a polynucleotide sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates, chemically synthesized analogues and analogues biologically synthesized by heterologous systems.
  • a polynucleotide is said to encode a polypeptide if, in its native state or when manipulated by methods known to those skilled in the art, it can be transcribed and/or translated to produce the polypeptide of a fragment thereof.
  • the antisense strand of such a polynucleotide is also said to encode the sequence.
  • the assay methods described hereinbelow allow the confirmation that an active tNOX protein with intact response patterns to inhibitors of authentic tNOX is produced upon expression of the coding sequence disclosed herein in a recombinant host cell.
  • a nucleotide sequence is operably linked when it is placed into a functional relationship with another nucleotide sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression.
  • operably linked means that the sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • certain genetic elements such as enhancers, may be operably linked even at a distance, i.e., even if not contiguous.
  • non-naturally occurring or recombinant nucleic acid molecule refers to a polynucleotide which is made by the combination of two otherwise separated segments of a sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
  • Polynucleotide probes include an isolated polynucleotide attached to a label or reporter molecule and may be used to identify and isolate other tNOX protein coding sequences. Probes comprising synthetic oligonucleotides or other polynucleotides may be derived from naturally occurring or recombinant single- or double-stranded nucleic acids or be chemically synthesized. They may be used in polymerase chain reactions as well as in hybridizations. Polynucleotide probes may be labeled by any of the methods known in the art, e.g., random hexamer labeling, nick translation, or the Klenow fill-in reaction.
  • Oligonucleotides or polynucleotide primers useful in PCR are readily understood and accessible to the skilled artisan using the sequence information provided herein taken with what is well known to the art.
  • Large amounts of the polynucleotides may be produced by replication in a suitable host cell.
  • Natural or synthetic DNA fragments coding for a tNOX protein incorporated into recombinant polynucleotide constructs typically DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell, desirably a yeast cell, and preferably a Saccharomyces cerevisiae cell are provided by the present invention.
  • the construct will be suitable for replication in a unicellular host, such as yeast or bacteria, but a multicellular eukaryotic host may also be appropriate, with or without integration within the genome of the host cells.
  • a multicellular eukaryotic host may also be appropriate, with or without integration within the genome of the host cells.
  • prokaryotic hosts include strains of Escherichia coli, although other prokaryotes, such as Bacillus subtilis or Pseudomonas may also be used.
  • Yeasts suitable for the present invention include species of Saccharomyces and Pichia, e.g.,
  • Mammalian (e.g., CHO or COS cells) or other eukaryotic host cells include filamentous fungi, plant, insect, amphibian and avian species. Such factors as ease of manipulation, ability to appropriately glycosylate expressed proteins, degree and control of protein expression, ease of purification of expressed proteins away from cellular contaminants, or other factors may determine the choice of the host cell.
  • Nectors suitable for use in the foregoing host cells are well known to the art and are widely available in research laboratories as well as through commerce.
  • the polynucleotides may also be produced by chemical synthesis, e.g., by the phosphoramidite method described by Beaucage and Caruthers [(1981) 7etr ⁇ . letts. 22:1859-1862] or the triester method according to Matteuci et al. [(1981) J. Am. Chem. Soc.
  • a double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using D ⁇ A t ⁇ OX protein with an appropriate primer sequence.
  • D ⁇ A constructs prepared for introduction into a prokaryotic or eukaryotic host cell typically comprise a replication system (i.e. vector) recognized by the host, including the intended D ⁇ A fragment encoding the desired polypeptide, and preferably also include transcription and translational initiation regulatory sequences operably linked to the t ⁇ OX protein-encoding segment.
  • Expression systems may include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences.
  • Signal peptides may also be included where appropriate from secreted polypeptides of the same or related species, which allow the protein to cross and/or lodge in cell membranes or be secreted from the cell.
  • Expression and cloning vectors desirably contain a selectable marker, that is, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector.
  • a selectable marker that is, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector.
  • a marker gene may be carried on another polynucleotide sequence co- introduced into the host cell, it is most often contained on the cloning vector. Only those host cells into which the marker gene has been introduced will survive and/or grow under selective conditions.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate, etc.; (b) complement auxotrophic deficiencies; or (c) supply critical nutrients not available from complex media.
  • the choice of the proper selectable marker will depend on the host cell; appropriate markers for different hosts are known in the art.
  • the coding sequence and the deduced amino acid sequence for the tNOX are provided in Table 1. See also SEQ ID NO:l and SEQ ID NO:2.
  • a combination of restriction endonuclease cutting and site-directed mutagenesis via PCR using an oligonucleotide containing a desired restriction site for cloning (one not present in coding sequence), a ribosome binding site, a translation initiation codon (ATG) and the codons for the first amino acids of tNOX can be employed to engineer tNOX for recombinant expression.
  • Site-directed mutagenesis strategy is described, for example, in Boone et al. [(1990) Proc. Natl. Acad. Sci. USA 87:2800-2804], with modifications for use with PCR as readily understood by the skilled artisan.
  • compositions and immunogenic preparations comprising substantially purified recombinant tNOX virus or an immunogenic peptide having an amino acid sequence derived therefrom and a suitable carrier therefor are provided by the present invention.
  • a suitable carrier protein e.g., bovine serum albumin or keyhole limpet hemocyanin
  • Immunogenic compositions are those which result in specific antibody production when injected into a human or an animal.
  • the vaccine preparations comprise an immunogenic amount of the exemplified tNOX or an immunogenic fragment(s) thereof.
  • Such vaccines may comprise tNOX, alone or in combination with another protein or other immunogen.
  • immunogenic amount is meant an amount capable of eliciting the production of antibodies directed against the exemplified tNOX in an individual or animal to which the vaccine has been administered.
  • Immunogenic carriers can be used to enhance the immunogenicity of the tNOX or peptides derived in sequence therefrom.
  • Such carriers include but are not limited to proteins and polysaccharides, liposomes, and bacterial cells and membranes. Protein carriers may be joined to the tNOX protein or peptides derived therefrom to form fusion proteins by recombinant or synthetic means or by chemical coupling. Useful carriers and means of coupling such carriers to polypeptide antigens are known in the art.
  • Preferred fusion proteins which are effective for stimulating an immune response, especially when administered orally (e.g., in food or water) include those fusion proteins with a cholera toxin fragment, or so-called LTB fusion. These methods are described in Dougan et al. [(1990) Biochem. Soc. Trans. 18:746-748] and Elson et al. [(1984) J. Immunol. 132:2736- 2741].
  • the immunogenic compositions and/or vaccines may be formulated by any of the means known in the art. They are typically prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also, for example, be emulsified, or the protein(s)/peptide(s) encapsulated in liposomes.
  • the active immunogenic ingredients are often mixed with excipients or carriers which are pharmaceutically acceptable and compatible with the active ingredient.
  • Suitable excipients include but are not limited to water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • concentration of the immunogenic polypeptide in injectable formulations is usually in the range of 0.2 to 5 mg/ml.
  • the vaccines may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine.
  • adjuvants which may be effective include but are not limited to: aluminum hydroxide; N-acetyl-muramyl-L-threonyl- D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP); N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(l'-2'- dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A, referred to as MTP-PE); and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion.
  • thr-MDP N
  • the effectiveness of an adjuvant may be determined by measuring the amount of antibodies directed against the immunogen resulting from administration of the immunogen in vaccines which are also comprised of the various adjuvants. Such additional formulations and modes of administration as are known in the art may also be used.
  • tNOX as exemplified herein and/or epitopic fragments or peptides of sequences derived therefrom or from other tNOX proteins having primary structure similar (more than 90% identity) to the exemplified tNOX protein may be formulated into vaccines as neutral or salt forms.
  • Pharmaceutically acceptable salts include but are not limited to the acid addition salts (formed with free amino groups of the peptide) which are formed with inorganic acids, e.g., hydrochloric acid or phosphoric acids; and organic acids, e.g., acetic, oxalic, tartaric, or maleic acid.
  • Salts formed with the free carboxyl groups may also be derived from inorganic bases, e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides, and organic bases, e.g., isopropylamine, trimethylamine, 2-ethylamino-ethanol, histidine, and procaine.
  • inorganic bases e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides
  • organic bases e.g., isopropylamine, trimethylamine, 2-ethylamino-ethanol, histidine, and procaine.
  • Multiantigenic peptides having amino acid sequences derived from the exemplified tNOX for use in immunogenic compositions are synthesized as described in Briand et al.
  • the immunogenic compositions or vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective.
  • the quantity to be administered which is generally in the range of about 100 to 1,000 ⁇ g of protein per dose, more generally in the range of about 5 to 500 ⁇ g of protein per dose, depends on the subject to be treated, the capacity of the individual's immune system to synthesize antibodies, and the degree of protection desired. Precise amounts of the active ingredient required to be administered may depend on the judgment of the veterinarian, physician or doctor of dental medicine and may be peculiar to each individual, but such a determination is within the skill of such a practitioner.
  • immunogenic compositions can be administered orally via food or water preparations comprising an effective amount of the protein(s) and or peptide(s), and these immunogenic compositions may be formulated in liposomes as known to the art.
  • the vaccine or other immunogenic composition may be given in a single dose or multiple dose schedule.
  • a multiple dose schedule is one in which a primary course of vaccination may include 1 to 10 or more separate doses, followed by other doses administered at subsequent time intervals as required to maintain and or reinforce the immune response, e.g., at 1 to 4 months for a second dose, and if needed, a subsequent dose(s) after several months.
  • Antibodies specific for the plasma membrane tNOX and the shed forms in the urine and serum of cancer patients and animals with neoplastic disorders are useful, for example, as probes for screening DNA expression libraries or for detecting or diagnosing a neoplastic disorder in a sample from a human or animal.
  • the antibodies or second antibodies which are specific for the antibody which recognizes tNOX
  • Suitable labels include but are not limited to radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. United States Patents describing the use of such labels include.but are not limited to,Nos. 3,817,837;
  • Antibodies useful in diagnostic and screening assays can be prepared using a peptide antigen whose sequence is derived from all or a part of SEQ ID NO:2, for example, SEQ ID NO: 16, the full length protein or a protein corresponding to amino acids 220-610. All references cited herein are hereby incorporated by reference in their entirety to the extent that they are not inconsistent with the present disclosure.
  • E. coli strains XL 1 -blue and SOLR, a Uni-Zap XR HeLa cell cDNA library, helper phage and expression vector pETl 1 were purchased from Stratagene (La Jolla, Ca). Luria- Bertani broth (LB broth) media and agar were supplied by DIFCO (Detroit, MI).
  • DNA markers, restriction endonucleases and the plasmid DNA purification kit were purchased from Promega (Madison, WI).
  • the mammalian expression system including expression vector pcDNA3.1 was purchased from Invitrogen (Carlsbad, CA). Unless indicated otherwise, all chemicals were purchased from Sigma Chemical Co. (St. Louis, MO).
  • the antigen utilized for the generation of the monoclonal antibody was isolated and characterized from pooled sera of cancer patients (Chueh et al., 1997).
  • the fraction containing a ca 34 kDa protein with capsaicin-inhibited tNOX activity was concentrated with a Centricon (Amicon, MA) followed by washing with PBS three times to remove excess salts.
  • the monoclonal antibody and hybridomas were generated in the Monoclonal Antibody Facility of the Purdue Cancer Center following standard protocols (Schook, 1987).
  • Two BALB/c mice were immunized with tNOX protein mixed with complete Freund's adjuvant and boosted three times at 3-week intervals.
  • Hybridomas were screened both by enzymatic activity assay and Western blot analysis.
  • Antisera-generating clones with the following characteristics were selected: ability to block completely drug responsive NOX activity of cancer cells and sera of cancer patients, to immunoprecipitate the protein with capsaicin- inhibited NADH oxidase activity from the surface of cancer cells and of sera pooled from cancer patients, having no effect on the NADH oxidase activity of sera from healthy volunteers and reactive with a 34 kDa cell surface protein of HeLa cells and sera of cancer patients.
  • the HeLa Uni-Zap cDNA library was first screened as described [Sambrook et al. (1989) supra] at approximately 50,000 plaque-forming units per 150 mm plate using monoclonal ascites (1:100 dilution) and peroxidase-conjugated goat anti-mouse IgG (1 :50,000 dilution). Five positive plaques were isolated from a total of about 8 x 10 5 total plaques screened and the bacteriophages were purified to homogeneity by at least three rounds of screening and selection.
  • the tNOX insert was sequenced using T3' and T7 primers, the complete nucleotide sequence of cDNA clone 1 was obtained using the gene walking technique and 10 17 bp synthetic primers (DNA Sequencing Service, Tufts University, Boston, MA). Searches within the NCBI/GenBank database were with nucleotide sequence and deduced amino acid sequence information for the longest open reading frame uncovered.
  • a 1.2% agarose gel was prepared by adding 0.9 g of agarose into 75 ml of TBE buffer (10 .8 g Tris, 5.5 g boric acid and 0.93 g brought to 1 liter with distilled deionized water) and heated until all agarose was completely dissolved. TBE buffer was filtered before use. Ethidium bromide was added to the gel solution at a final concentration of 0.5 ⁇ g/ml solution before the gel solution was cast. Immediately, the mixture was poured onto the cast and a comb was placed in the proper position. The gel was cast at least for 30 minutes before electrophoresis. The comb was removed and the gel was placed into the electrophoresis system and TBE buffer was added until the gel was covered by buffer. Markers and DNA samples were mixed with loading buffer and pipetted into separate wells. The electrophoresis was performed at 90 V for approximately 1.5 hours.
  • Example 5 Sequencing Analysis and Restriction Mapping.
  • Several restriction endonucleases (EcoRI, Xhol, BamHI, Xbal, Kpnl and Sail) were utilized to determine restriction sites. The digestion was performed according to the protocol provided by Promega (Madison, WI). Eleven ⁇ l of H 2 O, 2 ⁇ l of lOx reaction buffer, 2 ⁇ l of 1 ⁇ g/ ⁇ l of BSA, 4 ⁇ l of DNA and l ⁇ l of the respective restriction endonuclease were mixed by pipetting into an eppendorf tube and centrifuging for several seconds. The mixture was incubated at the optimum temperature for three to four hours dependent on the enzyme.
  • agarose electrophoresis was performed after each digestion.
  • the DNA sequence was first analyzed by automated sequencing using T3 and T7 primers. The complete nucleotide sequence was determined on both DNA strands.
  • the gene walking was performed by using 10 17-bp synthetic primers. The nucleotide sequences of all five clones and the deduced amino-acid sequence of clone 1 were analyzed for homology using BLAST and Pedro program against GenBank.
  • Example 6 Expression of tNOX and histidine-tagged tNOX proteins in bacteria tNOX cDNA from clone 1 was expressed in E. coli either as a truncated form (ttNOX) (beginning at M220), as a fusion protein with six histidine residues (ttNOX-his) fused to the amino terminus of ttNOX, or as a processed tNOX (beginning at G327).
  • ttNOX truncated form
  • ttNOX-his six histidine residues fused to the amino terminus of ttNOX
  • G327 processed tNOX
  • the forward primer was designed to incorporate six histidine residues to the amino terminus of tNOX protein.
  • the amplification performed was with an initiation step of 94C for 90 sec, followed by 90 sec of denaturation at 94C, 90 sec of annealing at 55C, and 90 sec of extension at 72C for 29 cycles.
  • E. coli [BL21 (DE3)] were transfected and grown in LB medium containing ampicillin (100 ⁇ g/ml) for 16 hr at 25C and harvested. DNA sequences of the ligation products were confirmed by DNA sequencing. Expressions of all forms of tNOX were confirmed by SDS-PAGE with silver staining and immunoblotting. Immunoblot analysis was with anti-tNOX monoclonal antibody. Detection used alkaline phosphate conjugated anti- mouse antibody.
  • ttNOX cDNA was first amplified by PCR using primers 5'- TGGGAGTGTAAACAGCGTATG-3' (forward; SEQ ID NO: 12) and 5'- TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID NO: 13).
  • the PCR product was then amplified using primers 5'-AAACTTAAGCTTTGGGAGTGT-3' (forward, SEQ ID NO:14) and 5'-TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID NO:15) to construct a Hindlll site at 5 'end of the nontemplate strand.
  • the product was double digested using Hindlll and BamHI enzymes.
  • the digested products were separated on an agarose gel and extracted using a DNA Extraction Kit (Qiagen, Valencia, CA).
  • the DNA was then ligated into a pcDNA3.1 vector that contains a cytomegalovirus enhancer-promoter for high levels of expression.
  • the ligation product was used to transform XL-1 blue competent cells using heat pulse technique (Sambrook et al., 1989, supra). The positive clones were identified by PCR. The resulting plasmid was then used to transfect COS cells.
  • COS-1 cells African monkey kidney cell line
  • Thirty-six ⁇ l of 2 M CaCl 2 and 30 ⁇ g of pcDNA3.1 or pcDNA3.1-tNOX in 300 ⁇ l sterile H2O were slowly added dropwise into 300 ⁇ l of 2 X Hepes Buffered Saline (HBS) at room temperature for 30 min.
  • the transfection mixtures then were added dropwise to the media to the cells and incubated overnight at 37C.
  • tNOX expression was evaluated on the basis of enzymatic activity and Western blot analysis.
  • antibiotic G418 sulfate was used (Invitrogen, Carlsbad, CA).
  • 0.5mg/ml of G418 sulfate was added into the media twice a week and the cultures were maintained until colonies 2 to 3 mm in diameter were formed. A total of three colonies were selected and trypsinized individually and then transferred into wells of a 24- well plate and then into a 35 mm petri dish. Cells were harvested at 80% confluency. Transfections were confirmed by immunoblotting.
  • recombinant tNOX protein from the recombinant E. coli extract were precipitated with 20%> ammonium sulfate, electrophoresed on 12% SDS- PAGE and transferred to poly(vinylidene difluoride) membranes. Proteins were stained with Coomassie blue, and protein bands were excised and then sequenced by automated Edman degradation (Applied Biosystems, Procise 492) by the Laboratory for Macromolecular Structure, Purdue University.
  • Peptide antisera to the tNOX terminus containing the putative adenine binding site KQEMTGVGASLEKRW (SEQ ID NO: 16) were generated in rabbits using standard technology by Covance Research Products Inc. (Dever, PA). The antisera were diluted 1 :300 before use.
  • Example 10 Generation of polyclonal antisera
  • the tNOX protein bands were excised and chopped into fine pieces.
  • the protein then was mixed with 0.5 ml complete Freund's adjuvant and injected into two rabbits. Three boosts of antigen in incomplete Freund's adjuvant were given in three weeks interval.
  • the antisera were diluted 1 : 300 before use.
  • RNA was prepared from HeLa (or other cells) using the guanidinium method described by Ausubel et al. (1992), Current Protocols in Molecular Biology, Wiley Interscience, New York, NY. Denatured RNA was transferred to nitrocellulose membranes for hybridization and autoradiography essentially as described in Sambrook et al. [(1989) supra].
  • mRNA is isolated from biological samples, biopsy material, tumor tissue or the like and resolved using gel electrophoresis. Suitable conditions include 1.2% agarose and 2.2 moles/liter formaldehyde. mRNA sizes are estimated by comparison to marker molecules, such as the 0.28 to 6.58 kb markers available commercially, for example, from Promega, Madison, WI.Lanes containing marker molecules are stained with ethidium bromide and photographed with UV illumination. Transfer of RNA molecules from the gel to nitrocellulose filters is accomplished as described by Maniatis et al. (1982) supra. Blots are prehybridized at 42C for 2 h with 50% formamide, 5 x SSPE, 2 x Denhardt's solution, and
  • SDS sodium dodecyl sulfate
  • Denatured radiolabeled or other labeled probe nucleic acid is added directly to the prehybridization fluid and the incubation is continuous for an additional 16-24 h.
  • the blots are then washed for 20 min at room temperature in 1 x SSC, 0.1% SDS, followed by three washes of 20 min each at 68C in 0.2 X SSC, 0.1% SDS.
  • the labeled probe is then visualized according to the label used. Where the label is radioactive, autoradiography can be used.
  • Samples for use in nucleic acid-based diagnostic methods include 15-25 ml peripheral blood specimens
  • the tissue or biopsy sample is frozen in liquid nitrogen immediately after collection.
  • Ground tissue or cells from blood are dissolved in guanidinium thiocyanate, left for 15 min at 50C and then centrifuged at 3000 rpm at 5 min.
  • the supernatant is layered over cesium chloride and centrifuged.
  • the RNA pellet is dissolved in diethylpyrocarbonate. About 2 mg RNA are used for cDNA synthesis using commercially available reagents according to the supplier's instructions (e.g.,
  • PCR can be carried out using commercially available reagents and primers specific for the tNOX mRNA.
  • the integrity of RNA samples is confirmed using an irrelevant gene product, for Example glyceraldehyde phosphate 3 dehydrogenase, the sequence of which is well known.
  • oligonucleotides were designed to replace amino acid residues potentially involved in tNOX activity by site-directed mutagenesis according to Braman et al. (1996). Cysteine codons corresponding to C505, C510, C558, C569, C575, and C602, were replaced by alanine codons.
  • the coding sequence was independently modified to replace a methionine of the putative drug binding site with an alanine (M396A).
  • the tNOX coding sequence was independently modified to replace a glycine in the potential adenine binding site with a valine (G592V).
  • Oligonucleotides were as follows: C505A: 5'- GAAAAGGAAAGCGCCGCTTCTAGGCTGTGTGCC-3' (forward, SEQ ID NO: 17), 5'- GGCACACAGTCCCTAGAAGCGGCGCTTTCCTTTTC-3' (reverse, SEQ ID NO: 18); C510A: 5 '-GCTTCTAGGCTGGCCGCCTCAAACCAGGATAGCG-3 ' (forward, SEQ ID NO: 17
  • CACTCCACATCGCTGGTGGCGATCTTATTATCAAGACG -3' (reverse, SEQ ID NO:24); C575A: 5'-CCAGCGATGTGGAGGCCCTCATGGGTAGACTCC-3' (forward, SEQ ID NO:25), 5'-GGAGTCTACCCATGAGGGCCTCCACATCGCTGG-3' (reverse, SEQ ID NO:26); C602A: 5'- GAAAAGAAGATGGAAATTCGCTGGCTTCGAGGGCTTGAAG-3' (forward, SEQ ID NO:27), 5'-CTTCAAGCCCTCGAAGCCAGCGAATTTCCATCTCTTTTC-3'(reverse, SEQ ID NO:28); M396A: 5'-
  • CAGGAAATGACTGGAGTTGTGGCCAGCCTGGAAAAGAG-3' forward, SEQ ID NO:31
  • 5'-CTCTTTTCCAGGCTGGCCACAACTCCAGTCATTTCCTG-3' reverse, SEQ ID NO:32.
  • thermostable Pfu DNA polymerase For the site-directed mutagenesis, the high fidelity thermostable Pfu DNA polymerase, low cycle number, and primers designed only to copy the parental strand in a linear fashion were used to minimize unwanted second site mutations.
  • Double-stranded, super-coiled expression plasmid pETl ltNOX 40 ng
  • mutagenic sense and antisense primers 100 ng
  • the cycling parameters were 95C for 30 sec, 55C for 1 min, and 68C for 12.8 min for a total of 16 cycles.
  • the linear amplification product was treated with endonuclease Dpnl (10 units/ ⁇ l) for 1 h to eliminate the parental template. Subsequently, an aliquot of 4 ⁇ l of this reaction mixture containing the double-nicked mutated plasmid was used for the transformation of supercompetent E. coli XL-1 Blue cells (Stratagene). All mutants were analyzed by DNA sequencing to confirm that the correct replacements were achieved
  • NADH oxidase A multifunctional ectoprotein of the eukarotic cell surface.
  • the possible adenine (NADH) binding sequence, T589GVGASL, is indicated by a dashed line.
  • EGCg epigallocatechin gallate

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Physics & Mathematics (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une séquence nucléotidique codant une protéine NADH d'échanges disulfide-thiol oxydase/protéine de surface cellulaire (tNOX) qui caractérise les cellules néoplasiques et infectées par des virus. Elle concerne aussi des molécules d'ADN recombinantes comprenant une partie de séquence codant une tNOX pleine longueur ou tronquée, une cellule hôte recombinante exprimant une tNOX pleine longueur ou tronquée et des procédés diagnostiques qui utilisent des séquences nucléotidiques de la tNOX spécifique aux cellules néoplasiques ou des anticorps spécifiques de la protéine rNOX.
PCT/US2000/030190 1999-11-01 2000-11-01 Sequences codant un marqueur neoplasique humain WO2001032673A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
GB0210912A GB2371548B (en) 1999-11-01 2000-11-01 Sequences encoding NADH oxidase/protein disulphide-thiol interchange polypeptides and their use in diagnosing neoplasia
CA002388612A CA2388612A1 (fr) 1999-11-01 2000-11-01 Sequences codant un marqueur neoplasique humain
JP2001535374A JP2003517299A (ja) 1999-11-01 2000-11-01 ヒト新生物形成マーカーをコードする配列
AU14537/01A AU1453701A (en) 1999-11-01 2000-11-01 Sequences encoding human neoplastic marker

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16264499P 1999-11-01 1999-11-01
US60/162,644 1999-11-01

Publications (2)

Publication Number Publication Date
WO2001032673A1 true WO2001032673A1 (fr) 2001-05-10
WO2001032673A9 WO2001032673A9 (fr) 2002-07-04

Family

ID=22586517

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/030190 WO2001032673A1 (fr) 1999-11-01 2000-11-01 Sequences codant un marqueur neoplasique humain

Country Status (5)

Country Link
JP (1) JP2003517299A (fr)
AU (1) AU1453701A (fr)
CA (1) CA2388612A1 (fr)
GB (1) GB2371548B (fr)
WO (1) WO2001032673A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7053188B2 (en) 2002-02-22 2006-05-30 Purdue Research Foundation Monoclonal antibodies specific for neoplasia-specific NADH:disulfide reductase
EP1739168A2 (fr) * 2005-06-27 2007-01-03 Purdue Research Foundation Variantes d'épissage et méthodes spécifiques à la néoplasie
GB2441860A (en) * 2006-09-01 2008-03-19 Nox Technologies Inc Neoplasia specific tNOX isoforms

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9612243B1 (en) * 2016-05-31 2017-04-04 Mor-Nuco Enterprises, Inc. Methods and compositions for targeted two-dimensional western blot analysis for early cancer detection and cancer diagnosis up to ten years in advance of clinical symptoms of malignant disease

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5605810A (en) * 1994-04-05 1997-02-25 Purdue Research Foundation NADH oxidase assay for neoplasia determination
WO1999004265A2 (fr) * 1997-07-17 1999-01-28 Ludwig Institute For Cancer Research Acides nucleiques et polypeptides associes au cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE, BETHESDA, MD; 1 May 2000 (2000-05-01), CHUEH ET AL.: "The cloning and expression of tNOX, a unique tumor-associated and plasma membrane-associated hydroquinone (NADH) oxidase with protein disulfide-thiol interchange activity", XP002943028, accession no. STN *
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE, BETHESDA, MD; 28 January 1999 (1999-01-28), CHEN ET AL.: "New Isolated cancer associated nucleic acids and polypeptides - isolated using sera from cancer patients, used to develop products for the diagnosis, monitoring or treatment of cancers", XP002943029, accession no. STN *
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE, BETHESDA, MD; 29 December 1999 (1999-12-29), CHUEH ET AL.: "The cloning and expression of tNOX, a unique tumor-associated and plasma membrane-associated hydroquinone (NADH) oxidase with protein disulfide-thiol interchange activity", XP002943027, accession no. STN *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7053188B2 (en) 2002-02-22 2006-05-30 Purdue Research Foundation Monoclonal antibodies specific for neoplasia-specific NADH:disulfide reductase
EP1739168A2 (fr) * 2005-06-27 2007-01-03 Purdue Research Foundation Variantes d'épissage et méthodes spécifiques à la néoplasie
EP1739168A3 (fr) * 2005-06-27 2007-03-07 Purdue Research Foundation Variantes d'épissage et méthodes spécifiques à la néoplasie
GB2441860A (en) * 2006-09-01 2008-03-19 Nox Technologies Inc Neoplasia specific tNOX isoforms
GB2441860B (en) * 2006-09-01 2011-06-29 Nox Technologies Inc Detecting Neoplasia-specific tNOX isoforms

Also Published As

Publication number Publication date
GB2371548A (en) 2002-07-31
GB2371548B (en) 2004-11-24
AU1453701A (en) 2001-05-14
WO2001032673A9 (fr) 2002-07-04
CA2388612A1 (fr) 2001-05-10
JP2003517299A (ja) 2003-05-27
GB0210912D0 (en) 2002-06-19

Similar Documents

Publication Publication Date Title
EP1876241A2 (fr) Compositions et procédés pour le traitement et le diagnostic du cancer du sein
JP4270523B2 (ja) 乳癌の処置および診断のための組成物および方法
US7541181B2 (en) Vector carrying a polynucleotide which encodes a GSD polypeptide from Mycobacterium paratuberculosis
KR20090079938A (ko) 텔로머라제 역전사효소 융합 단백질, 이를 암호화하는 뉴클레오타이드, 및 이들의 용도
CA2197569A1 (fr) Sequences de nucleotides et d'aminoacides des genes de l'enveloppe (1) et du noyau du virus de l'hepatite
WO1997025431A1 (fr) Compositions et procedes de traitement et de diagnostic du cancer
US20030207340A1 (en) Sequences encoding human neoplastic marker
US6261806B1 (en) Molecular sequence of swine retrovirus and methods of use
WO2001032673A1 (fr) Sequences codant un marqueur neoplasique humain
WO1995022604A1 (fr) Enzyme d'edition d'arn et procedes d'utilisation
JP2003523188A (ja) Ａｉｄｓ先祖ウイルスおよびワクチン
JP2007500518A (ja) 祖先ウィルスおよびワクチン
US20020111467A1 (en) Compositions and methods for the treatment and diagnosis of breast cancer
AU1445895A (en) Mycobacteria virulence factors and a method for their identification
KR20020026418A (ko) 유방암을 치료 및 진단하기 위한 조성물 및 방법
WO2005077105A2 (fr) Réduction de la réplication de vih-1 par l'apobec 3g
CA2375650A1 (fr) Genes d'ehrlichia canis et vaccins
JPWO2002031163A1 (ja) 新規なａｄａｍｔｓファミリーポリペプチドおよびそれをコードする遺伝子
Chan et al. Identification, expression and antigenic analysis of recombinant hemagglutinin proteins of canine distemper virus
CN108828228A (zh) 预测或诊断无精症或少精症的nanos2标志物及其应用
KR20150041637A (ko) B형 간염 바이러스 표면 유전자 넌센스 돌연변이의 검출 방법
FR2758144A1 (fr) Polynucleotide codant pour un polypeptide de 27 kd de mycobacteries appartenant au complexe de mycobacterium tuberculosis, application au diagnostic et a la prevention de la tuberculose
JP2004208695A (ja) レンチウィルス関連疾病から動物を保護するための組成物及び方法、並びに新規ネコ免疫不全ウィルス
KR20230048760A (ko) 신종 마늘 바이러스의 진단을 위한 프라이머 세트 및 진단 방법
MXPA03009306A (es) Antigenos para aumentar una respuesta inmune contra patogenos rickettsieae y ehrlichieae.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 535374

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2388612

Country of ref document: CA

ENP Entry into the national phase

Ref country code: GB

Ref document number: 200210912

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/10-10/10, DRAWINGS, REPLACED BY NEW PAGES 1/10-10/10; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase