WO2001004298A1 - Nouvelle substance physiologiquement active, procede de production et utilisation - Google Patents

Nouvelle substance physiologiquement active, procede de production et utilisation Download PDF

Info

Publication number
WO2001004298A1
WO2001004298A1 PCT/JP2000/004484 JP0004484W WO0104298A1 WO 2001004298 A1 WO2001004298 A1 WO 2001004298A1 JP 0004484 W JP0004484 W JP 0004484W WO 0104298 A1 WO0104298 A1 WO 0104298A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
precursor protein
dna
peptide
Prior art date
Application number
PCT/JP2000/004484
Other languages
English (en)
Japanese (ja)
Inventor
Tsukasa Sugo
Mika Kurihara
Chieko Kitada
Masaaki Mori
Original Assignee
Takeda Chemical Industries, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Chemical Industries, Ltd. filed Critical Takeda Chemical Industries, Ltd.
Priority to AU58484/00A priority Critical patent/AU5848400A/en
Publication of WO2001004298A1 publication Critical patent/WO2001004298A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/02—Non-specific cardiovascular stimulants, e.g. drugs for syncope, antihypotensives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/57509—Corticotropin releasing factor [CRF] (Urotensin)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4703—Regulators; Modulating activity

Definitions

  • the present invention relates to a novel polypeptide against SNR (sensory epithelium neuropeptide-1 ike receptor), which is a G protein-coupled receptor protein, and a DNA encoding the same.
  • SNR sensor epithelium neuropeptide-1 ike receptor
  • G proteins conjugated guanine nucleotide-binding proteins
  • G protein-coupled receptor Yuichi maintains homeostasis in the living body, reproduction, individual development, metabolism, growth, the nervous system, the circulatory system, and the immune system.
  • Important functions such as regulation of digestive system, metabolic system, and sensory perception are important for living organisms.
  • the regulation of biological functions involves the receptor proteins for various hormones and neurotransmitters, and plays an important role in regulating their functions. And neurotransmitters) and whether there is a receptor for it is often unknown.
  • PCR Polymerase Chain Reaction
  • an agonist for this receptor from among a group of artificially synthesized compounds, and used it as a probe to verify the expression of the receptor in the receptor cDNA-introduced cells, and then used the same intracellular signaling system as the agonist.
  • cDNA encoding the receptor G protein-coupled receptor G-104 was introduced into CHO cells and the specific expression in the receptor-expressing cells was confirmed.
  • GRL104 receptor G protein-coupled receptor G-104
  • this novel bioactive peptide had high homology with known leucokinin, and GRL104 also had reactivity with known leucokinin.
  • almost no ligand can be estimated from the orphan G protein-coupled receptor protein.
  • the similarity to a known G protein-coupled receptor protein protein family is low, the ligand Little information was available and it was difficult to estimate the ligand.
  • S ENR S ENR
  • GPR14 Marchese, A., Genomics, 29, 335-344, 1995
  • Marchese, A. et al. Is the same receptor as SENR.
  • the ligand for S ENR a G protein-coupled receptor expressed in the central nervous system, circulatory system, reproductive system, immune system, digestive system, urinary system, sensory organs, etc., is useful as a pharmaceutical. It is thought that there is, but its structure and function have not been clarified so far. Disclosure of the invention
  • the present inventors used cells expressing cDNA encoding SENR by an appropriate means, and measured the specific cell stimulation (signal transduction) activity as an index.
  • the present inventors have found that it is possible to screen for a compound that alters the binding between the ligand as the activator and the above-mentioned SENR.
  • a substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34
  • SEQ ID NO: 15 amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34
  • the precursor protein according to the above (4) which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26;
  • a pharmaceutical comprising the precursor protein or an amino acid or a salt thereof according to the above.
  • SENR characterized by using the polypeptide according to (1) or the precursor protein according to (4) or an amide or ester thereof or a salt thereof, and the polypeptide according to (1). Or a method for screening a compound or a salt thereof that alters the binding property to the precursor protein or an amide or an ester or a salt thereof according to the above (4),
  • S ENR for the polypeptide in the present invention specifically, not only the above-mentioned known S ENR or a salt thereof, but also the like,
  • S ENR or a salt thereof comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 29 or SEQ ID NO: 30, or
  • FIG. 1 shows the entire nucleotide sequence of rat urotensin 1 ike peptide precursor protein cDNA isolated from rat spinal cord cDNA and the entire amino acid sequence of rat urotensin like peptide precursor protein translated therefrom.
  • FIG. 2 shows the entire nucleotide sequence of mouse urotensin like peptide precursor protein cDNA isolated from mouse spinal cord cDNA and the entire amino acid sequence of mouse urotensin like peptide precursor protein translated therefrom.
  • Figure 3 shows the Araki Don acid metabolite release activity against synthetic rat hurot ens inli ke pep ti de- 2 of CH0 / RSE T R cell lines.
  • substantially the same means that the activity of the protein, for example, the binding activity between the ligand and the receptor (SENRR), the physiological characteristics, and the like are substantially the same.
  • Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the polypeptide, in which case the substitution, deletion, addition or insertion of the polypeptide is made.
  • the peptide will be substantially identical to one without such substitutions, deletions, additions or insertions.
  • Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs.
  • Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, norin, proline, phenylalanine, tryptophan, methionine and the like.
  • Polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like.
  • positively charged (basic) amino acids include arginine, lysine, and histidine.
  • Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • the polypeptide of the present invention is a ligand for SENR. Specifically, the polypeptide has the same amino acid sequence as SEQ ID NO: 14 or has a glutamine residue or a pyroglutamic acid residue at the N-terminus. And polypeptides containing an amino acid sequence substantially identical to the amino acid sequence represented by 4, amides thereof, esters thereof and salts thereof (hereinafter, may be abbreviated as the polypeptide of the present invention).
  • polypeptide of the present invention is described in more detail below.
  • polypeptide of the present invention examples include human tissues from warm-blooded animals (eg, guinea pigs, rats, mice, bush, higgies, horses, monkeys, etc.) (for example, Such as pituitary gland, kidney, brain, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract, blood vessel, heart, etc. Having the same amino acid sequence as SEQ ID NO: 14 or having a glutamine residue or pyroglutamic acid residue at the N-terminus and having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 14 Any polypeptide may be used.
  • polypeptide of the present invention in addition to the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 and the like, and having a glutamine residue or a pyroglutamic acid residue at the N-terminus, SEQ ID NO: 14
  • a polypeptide having substantially the same activity as the polypeptide containing the represented amino acid sequence eg, SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or a polypeptide containing the amino acid sequence represented by SEQ ID NO: 34.
  • Substantially the same activity includes, for example, receptor binding activity, signal transduction activity and the like.
  • “Substantially the same quality" means that the receptor binding activity and the like are the same in nature. Therefore, quantitative factors such as the strength of the receptor binding activity and the molecular weight of the polypeptide may be different.
  • the amino acid sequence contains the amino acid sequence from the 8th (Al a) to the 17th (lie) from the N-terminus of the amino acid sequence, and 3 a polypeptide consisting of 14 to 17 amino acid residues.
  • amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34 Preferred examples include polypeptides.
  • the polypeptide has a N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide labeling.
  • 1 The amino acid sequence represented by SEQ ID NO: 14; 2 The amino acid sequence represented by SEQ ID NO: 15; 3 The amino acid sequence represented by SEQ ID NO: 27; 4 The amino acid sequence represented by SEQ ID NO: 31
  • the polypeptide containing the amino acid sequence, 5 the amino acid sequence represented by SEQ ID NO: 32, 6 the amino acid sequence represented by SEQ ID NO: 33, 7 the amino acid sequence represented by SEQ ID NO: 34, is a C-terminal there usually a carboxyl group (-C00H) or carboxylate (- C00-) a but, C-terminal, is not good even amide (-C0N T H 2) or ester (-C00R).
  • R of the ester such as methyl, Echiru, n- propyl, C I 6 alkyl group such as isopropyl or 11 one-butyl, cyclopentyl, C 3 _ s cycloalkyl group such as key sill cycloheteroalkyl, phenyl, shed one naphthyl C 2 ⁇ aryl group such as benzyl, phenethyl, phenylene Lou ( ⁇ such as benzhydryl - 2 Al kill, or alpha-C 7 _ 1 4 7 aralkyl group such as flying one Nafuchiru C Interview _ 2 alkyl, such as naphthylmethyl And a pivaloyloxymethyl group commonly used as an ester for oral use.
  • ⁇ such as benzhydryl - 2 Al kill, or alpha-C 7 _ 1 4 7 aralkyl group such as flying one Nafuchiru C Interview _ 2 alkyl, such as naphthy
  • a salt with a physiologically acceptable base eg, alkali metal or the like
  • an acid organic acid or inorganic acid
  • Addition salts are preferred.
  • Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) , Tartaric acid, cunic acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid).
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid
  • Tartaric acid cunic acid, malic acid, oxalic acid
  • benzoic acid me
  • the polypeptide of the present invention can be produced by a method for purifying a polypeptide from a tissue or a cell of a human warm-blooded animal, or can be produced according to a polypeptide synthesis method described later. It can also be produced by culturing a transformant containing a DNA encoding a polypeptide described below. Organization Alternatively, after homogenizing the cells, extraction is performed with an acid, an organic solvent, or the like, and the extracted solution is subjected to chromatography such as salting out, dialysis, gel filtration, reverse phase chromatography, ion exchange chromatography, affinity chromatography, etc. Purification and isolation can be achieved by combining the above.
  • the polypeptide of the present invention can be produced according to a polypeptide synthesis method known per se, or by cleaving a polypeptide containing the polypeptide of the present invention with an appropriate peptidase.
  • a method for synthesizing a peptide for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the objective peptide is produced by condensing a partial peptide or amino acid capable of constituting the polypeptide of the present invention with the remaining portion, and when the product has a protecting group, removing the protecting group to produce the desired peptide. can do.
  • Known methods for condensation and elimination of the protecting group include, for example, the methods described in the following 1 to 5.
  • the polypeptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization.
  • the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when the polypeptide is obtained as a salt, it is converted to a free form by a known method. be able to.
  • a commercially available resin for peptide synthesis suitable for amide formation can be used.
  • resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, Benzoxy benzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl) Hydroxymethyl) phenoxy resin; 4- (2 ′, 4′-dimethoxyphenyl—Fmoc aminoethylyl) phenoxy resin; Using such a resin, amino acids having a suitably protected amino group and side chain functional group are condensed on the resin in accordance with the sequence of the target peptide in accordance with various known condensation methods.
  • the peptide is cleaved from the resin, and at the same time, various protecting groups are removed. If necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the desired polypeptide.
  • the protected amino acid may be added directly to the resin along with a racemization inhibitor (eg, HOB and HOOBt) or may be pre-protected as a symmetrical acid anhydride or H0B1 ester or HOOBt ester.
  • the activated amino acids can be added to the resin after activation.
  • the solvent used for the condensation of the protected amino acid with the activated resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction.
  • acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, and N-methylpyrrolidone
  • halogenated hydrocarbons such as methylene chloride and chloroform
  • alcohols such as trifluoroethanol
  • Sulfoxides such as dimethyl sulfoxide
  • tertiary amines such as pyridine
  • ethers such as dioxane and tetrahydrofuran
  • nitriles such as acetonitrile and propionitrile
  • esters such as methyl acetate and ethyl acetate; or an appropriate mixture thereof.
  • the reaction temperature is appropriately selected from the range known to be usable for the disulfide bond formation reaction, and is usually selected from the range of about 120 ° C to 50 ° C.
  • the activated amino acid derivative is usually used in a 1.5 to 4-fold excess.
  • Ninhydrite As a result of the test using the reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. If sufficient condensation is not obtained even after repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so that the subsequent reaction is not affected.
  • Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tert-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, CutZ, Br-Z, and adamantyl. Examples thereof include xycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, and Fmoc.
  • the protecting group for the carboxyl group is, for example, R as described above. .
  • alkyl groups C 3 _ s cycloalkyl group, C 7 _ 1 4 Ararukiru group, 2-Adamanchiru, 4-nitro-base Nji le, 4-methoxybenzyl, 4-black port benzyl, Fuenashiru group and downy Nji Ruokishi Carbonyl hydrazide, evening butoxycarbonyl hydrazide, trityl hydrazide and the like.
  • the hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification.
  • Suitable groups for this esterification include, for example, lower alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbon such as benzyloxycarbonyl group and ethoxycarbonyl group.
  • groups suitable for etherification include a benzyl group, a tetrahydrobiranyl group, and a butyl group.
  • the protecting group of the phenolic hydroxyl group of tyrosine include Bz l, C l 2 -Bz K 2- two Torobenjiru, Br-Z, and the like evening over tert-butyl.
  • imidazole protecting group of histidine examples include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DT, benzyloxymethyl, Buiii, Bo Tr K Fmoc and the like.
  • Activated carboxyl groups of the raw materials include, for example, the corresponding acid anhydrides, azides, and active esters [alcohols (eg, phenol phenol, 2,4,5-trichloromouth phenol, 2,4- Dinitrophenol, Alcohol, paranitrophenol, H0NB, N-hydroxysuccinimide, N-hydroxyfurimide, HOBt) and the like.
  • the activated amino group of the raw material includes, for example, the corresponding phosphoric amide.
  • Methods for removing (eliminating) the protecting group include catalytic reduction in the presence of a catalyst such as Pd black or Pd carbon in a stream of hydrogen, as well as anhydrous hydrogen fluoride, methanesulfonic acid, and trifluorosulfonic acid.
  • Examples include acid treatment with an acid, trifluoroacetic acid or a mixture thereof, treatment with a base using diisopropylethylamine, triethylamine, piperidine, piperazine, or the like, and reduction with sodium in liquid ammonia.
  • the elimination reaction by the above acid treatment is generally carried out at a temperature of 120 ° C to 40 ° C.
  • the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment
  • the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butanedithiol, etc.
  • it is also removed by alkaline treatment with dilute sodium hydroxide, dilute ammonia and the like.
  • the protection of the functional group which should not be involved in the reaction of the raw material and the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.
  • an amide form of a polypeptide first, after amidating the ⁇ -hydroxyl group of the carboxyl terminal amino acid, the peptide chain is extended to a desired chain length on the amino group side, and ⁇ A peptide is prepared by removing only the protecting group of the terminal amino amino group and a peptide (or amino acid) is obtained by removing only the protecting group of the C-terminal carboxyl group, and these peptides are mixed in the above-mentioned mixed solvent. To condense. Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. This crude polypeptide is purified using various known purification methods, and the main polypeptide is freeze-dried to obtain the desired polypeptide. Can be obtained.
  • the ⁇ -carboxy group of the carboxy-terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then the ester of the desired polypeptide is prepared in the same manner as the amide of the polypeptide. You can get your body.
  • the polypeptide of the present invention may be the same as the amino acid sequence represented by the above-mentioned SEQ ID NO: 14 or an amino acid sequence having a glutamine residue or a pyroglutamic acid residue at the ⁇ -terminal and represented by SEQ ID NO: 14 Contains substantially the same amino acid sequence, and has the same action as the polypeptide, for example, a central nervous function controlling action, a circulatory function controlling action, a heart function controlling action, a kidney function controlling action, a urinary function controlling action or a sensory organ Any polypeptide may be used as long as it has a function of regulating functions.
  • the polypeptide of the present invention can be further used as an antigen for preparing an antibody against the polypeptide.
  • a partial peptide such as a ⁇ -terminal peptide, a C-terminal peptide, or a peptide at the center of the polypeptide of the present invention is used. You.
  • a peptide containing each domain individually may be used, but a peptide containing a plurality of domains at the same time may be used.
  • the partial peptide in this specification also has an amide (—C0NH 2 ) or ester at the C-terminus.
  • ester group examples are the same as in the case of the polypeptide described above.
  • the partial peptide has a lipoxyl group or lipoxylate other than at the C-terminus, those in which those groups are amidated or esterified are also included in the partial peptide of the present invention.
  • the ester at this time for example, the above-mentioned C-terminal ester and the like are used.
  • partial peptide of the present invention include, for example, 2 to 16 amino acids including the fifth (His) and sixth (Gly) from the N-terminal of the amino acid sequence represented by SEQ ID NO: 14. And a base comprising an amino acid sequence containing an amino acid.
  • the polypeptide of the present invention or its partial peptide may be a fusion protein with a protein whose function or property is well known.
  • the same salts as the above-mentioned salts of the polypeptide are used.
  • the partial peptide of the polypeptide of the present invention or its amide, ester or salt thereof is produced according to the same synthetic method as in the above-mentioned polypeptide, or by cleaving the polypeptide of the present invention with an appropriate peptidase. be able to.
  • the DNA encoding the polypeptide of the present invention may be the same as the amino acid sequence represented by SEQ ID NO: 14 or an amino acid having a glutamine residue or a pyrrodal acid residue at the N-terminus and represented by SEQ ID NO: 14 Any DNA may be used as long as it contains DNA encoding a polypeptide containing an amino acid sequence substantially identical to the sequence (hereinafter, may be abbreviated as the DNA of the present invention). Further, it may be any of genomic DNA, genomic DNA library, the aforementioned tissue-cell derived cDNA, the aforementioned tissue / cell derived cDNA library, and synthetic DNA.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using an RNA fraction prepared from the above-mentioned tissues and cells.
  • examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 include, for example, DNA containing the DNA having the base sequence represented by SEQ ID NO: 16
  • Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 15 include, for example, a DNA having the base sequence represented by SEQ ID NO: 17
  • Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 27 include, for example, the base sequence represented by SEQ ID NO: 28 Such as DNA having the amino acid sequence represented by SEQ ID NO: 31.
  • Examples of the DNA containing the DNA encoding the DNA include DNA containing the nucleotide sequence represented by SEQ ID NO: 35, and the like.
  • the DNA containing the amino acid sequence represented by SEQ ID NO: 32 is included.
  • Examples of a DNA containing a DNA encoding the polypeptide of the present invention include a DNA containing a DNA having a base sequence represented by SEQ ID NO: 36, and an amino acid represented by SEQ ID NO: 33.
  • Examples of the DNA containing the DNA encoding the polypeptide containing the sequence include DNA containing the DNA having the base sequence represented by SEQ ID NO: 37, and the like.
  • Examples of the DNA containing the DNA encoding the polypeptide containing the amino acid sequence represented by 34 include DNA containing the DNA having the base sequence represented by SEQ ID NO: 38, and the like.
  • Examples of DNA having a glutamine residue or a pyroglutamic acid residue at the N-terminal and containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 include, for example, (1) from the 5 'end 3 bases are CAA and have about 80% or more, preferably about 90% or more, more preferably about 95% or more, and more preferably about 98% or more homology with the base sequence represented by SEQ ID NO: 16. Examples include DNA containing a DNA having a base sequence and (2) DNA having 9 to 30 bases added to the 5 'end.
  • DNA having a glutamine residue or a pyroglutamic acid residue at the N-terminus and containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 14 include, for example, 1) SEQ ID NO: 16; SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or 1 or 2 or more (preferably 1 to 30) in the nucleotide sequence represented by SEQ ID NO: 38 Sequence, more preferably about 1 to 10, more preferably several (one or two) bases deleted, (2) SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 28 , SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38 One or more or more (preferably about 1 to 30, more preferably 1 to 10) About, more preferably several (one or two) bases Nucleotide sequences, 3 SEQ ID NO: 1 6, SEQ ID NO: 17, SEQ ID NO: 28, SEQ ID NO: 35
  • a base sequence substituted with one or more (preferably about 1 to 30, more preferably about 1 to 10, and more preferably several (1 or 2)) other bases, or DN This also includes DNAs containing DNAs having base sequences obtained by combining them.
  • amino acid sequence represented by SEQ ID NO: 14 which is identical to the amino acid sequence represented by SEQ ID NO: 14 under stringent conditions or has a glutamine residue or pyrodaltamic acid residue at the N-terminus
  • a mammal-derived DNA that hybridizes with a DNA-containing sequence capable of binding to a receptor protein containing an amino acid sequence substantially identical to the sequence; (2) a sequence due to degeneracy of the genetic code; Receptor protein having the same amino acid sequence as the amino acid sequence represented by No.
  • the DNA that hybridizes with the sequence of the DNA containing the coding DNA includes, for example, CAA consisting of 3 bases from the 5 'end and about 70% of the base sequence represented by SEQ ID NO: 16. Or more, preferably about 80% or more, more preferably about 90% or more, most preferably More preferably, DNA containing a nucleotide sequence having about 95% or more homology is used.
  • the DNA fragment containing the partial nucleotide sequence of DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 14 and the like of the present invention is also preferably used as a DNA detection probe.
  • DNA encoding the polypeptide of the present invention can also be produced by the following genetic engineering techniques.
  • the DNA library and the like can be cloned by a PCR method known per se using a synthetic DNA primer having a partial nucleotide sequence of the polypeptide of the present invention. From the target DNA, or the DNA incorporated into an appropriate vector, for example, labeled using a DNA fragment or a synthetic DNA having a partial or entire region of the polypeptide of the present invention. It can be sorted by hybridization. Hybridization is performed according to, for example, the method described in Molecular Cloning C 2nd ed .; J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When using a commercially available library, perform the procedure described in the attached instruction manual.
  • the cloned DNA encoding the polypeptide of the present invention can be used as it is depending on the purpose, or can be used after digestion with a restriction enzyme or addition of a linker if desired.
  • the DNA may have ATG as a translation initiation codon at the 5 'end, and TAA, TGA or TAG as a translation termination codon at the 3' end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter.
  • the expression vector of the polypeptide of the present invention can be prepared by, for example, (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (mouth) converting the DNA fragment into an appropriate expression vector. It can be produced by ligating downstream of one of the promoters.
  • vectors examples include Escherichia coli-derived plasmids (eg, pBR322, pBR325, pUC12, pUC13) and Bacillus subtilis-derived plasmids (eg, pUB11). 0, pTP5, pC194), yeast-derived plasmids (eg, pSHl9, pSH15), bacteriophages such as ⁇ phage, and animal viruses such as retrovirus, vaccinia virus, and baculovirus. .
  • Escherichia coli-derived plasmids eg, pBR322, pBR325, pUC12, pUC13
  • Bacillus subtilis-derived plasmids eg, pUB11
  • yeast-derived plasmids eg, pSHl9, pSH15
  • bacteriophages such as ⁇ phage
  • animal viruses such as retrovirus, vaccinia virus, and baculovirus
  • the promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.
  • the expression vector optionally contains an enhancer, a splicing signal, a poly-A addition signal, a selection marker, and an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori).
  • SV40 ori an SV40 replication origin
  • the selection marker include a dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], an ampicillin resistance gene (hereinafter sometimes abbreviated as Ampr), Neomycin resistance gene (hereinafter sometimes abbreviated as Neo, G418 resistance) and the like.
  • a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. If the host is Escherichia, the phoA-signal sequence and the immediate A / signal sequence, etc. However, if the host is yeast, the mating factor a (MF ⁇ ) signal sequence, invertase signal sequence, etc. If the host is an animal cell, for example, insulin signal sequence, Hi-interferon A signal sequence, an antibody molecule 'signal sequence and the like can be used.
  • a bacterium belonging to the genus Escherichia for example, a bacterium belonging to the genus Escherichia, a bacterium belonging to the genus Bacillus, a yeast, an insect or an insect cell, an animal cell and the like are used.
  • Examples of the genus Escherichia include Escherichia coli K12. DH1 [Prosings 'ob' The National Academy Obb-Schencies ob Ob The USA. Sci. USA), 60, 160 (1968)], JM 103 [Nucleic Acids Research, Vol. 9, 309 (1981)], JA 221 [ Journal of Molecular Biology (Journal of Molecular Biology)], 120, 5 17 (1 978)], HB 101 (Journal of Molecular Biology) Molecule's biology, 41, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like are used.
  • Bacillus bacteria examples include, for example, Bacillus subtilis MI 114 (Gene, Vol. 24, 255 (1983)), 207—21 [Journal ⁇ ob 'Biochemistry (Journal ⁇ Biochemistry), 95, 87 (1 984)).
  • yeast for example, Saccharomyces cerevisiae AH22AH22R-, NA87-11A, DKD-5D, 20B-12 are used.
  • insects for example, silkworm larvae are used [Maeda et al.
  • insect cells for example, when the virus is Ac NPV, a cell line derived from night larvae of moth larvae (Spodoptera frugiperda cell; Sf cell), Trichoplusia ni (7) MG1 cell derived from the midgut, Trichoplusia ni egg High Five TM cells of origin, Mamestra A cell derived from brassicae or a cell derived from Estigmena acrea is used.
  • Sf cells include, for example, Sf9 cells (ATCC CRL1711), S ⁇ 21 cells [Vaughn, JL et al., In vitro, Vol. 13, 21-3-21] Page 7 (1977)].
  • animal cells examples include monkey COS-7 cells, Vero cells, Chinese Hams Yuichi cell CH 0, DHFR gene-deficient Chinese Hams Yuichi cell CH ⁇ (dhfi "—CHO cell), mouse L cell, mouse 3 T 3 cells, mouse myeoma cells, human 293 cells, human FL cells, 293 cells, C127 cells, BALB 3T3 cells, S ⁇ -2— cells, etc. are used.
  • Transformation of insect cells or insects is performed, for example, according to the method described in Bio / Technology. 6, 47-55 (1988).
  • Transformation of animal cells is performed, for example, according to the method described in Virology, 52, 456 (1973).
  • Methods for introducing an expression vector into cells include, for example, the lipofection method [Feigner, PL et al. Proceedings of "National Academy of Sciences", “Prof. the National Academy of Sciences of the United States of America), 84, 74 13 6 4 6 7 page (1 9 7 3 years)], electroporation [i ⁇ T uemann, E. et al . Enbo 'journal (EMBO J.), 1 vol., 8 4 1 one 84 page 5 (1 982 years)].
  • the above-described method for selecting cells by clonal selection of cells in which the expression vector introduced into the animal cells is integrated into the chromosome is used. is there. Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the polypeptide of the present invention can be obtained by repeatedly performing clone selection on the animal cells obtained using the selection marker as described above.
  • the polypeptide of the present invention or a partial peptide thereof can be encoded together with the dhfr gene by culturing the cells at a gradually increased MTX concentration and selecting a resistant strain.
  • the resulting DNA can be amplified intracellularly to obtain even higher expression animal cell lines.
  • the polypeptide of the present invention can be produced by culturing the above transformant under conditions capable of expressing DNA encoding the polypeptide of the present invention and producing and accumulating the polypeptide of the present invention.
  • a liquid medium is suitable as a medium used for culturing, and a carbon source necessary for the growth of the transformant is contained therein.
  • Nitrogen sources include glucose, dextrin, soluble starch, and sucrose.
  • nitrogen sources include ammonium salts, nitrates, corn chip liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like.
  • the inorganic or organic substance include, for example, calcium chloride, sodium dihydrogen phosphate, and magnesium chloride.
  • yeast vitamins, growth promoting factors and the like may be added.
  • the pH of the medium is preferably about 5 to 8.
  • a medium for culturing the genus Rhichia for example, an M9 medium containing glucose and casamino acid (Miller, Journal 'Ob'Experiment in Mole 1,000 Yra-Jetetics ( Journal of Experiments in Molecular Genetics), 431-43, Cold Spring Harbor Laboratory, New York 1972].
  • a drug such as 3 / 3-indolylacrylic acid can be added to make the promoter work efficiently.
  • the cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.
  • cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours, and if necessary, aeration and stirring may be added.
  • Burkholder's minimal medium (Bostian, KL et al., "Procedures of the National Academy of Sciences” is used. S.A. (Pro Natl. Acad. Sci. USA), 77, 450 (1980)] or an SD medium containing 0.5% casamino acid [BiUer, GA “Pro-Natl. Acad. Sci. USA", 81, 53, 30 (19), "Processings of the National Academy of Sciences of the United States”
  • the pH of the medium is preferably adjusted to about 5 to 8. Cultivation is usually performed at about 20 ° C to 35 ° C for about 24 to 72 hours, and if necessary. Add aeration and agitation.
  • the culture medium When culturing a transformant whose host is an insect cell, the culture medium was immobilized in Grace's Insect Medium (Grace.raceC., Nature, 195, 788 (1962)). For example, those to which additives such as serum and the like are appropriately added are used. Preferably, ⁇ of the medium is adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and agitation are added as necessary.
  • the culture medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122 vol., 501 (19) 5 2)].
  • DMEM medium Vology, Vol. 8, 3 96 (1 959)], RPM I 1640 medium [The Journal of the American Medical Association, Vol. 199, 5 19 (1 967)], 199 medium [Proceding of the Society for the Biological Medicine, 73, 1 (1950)] .
  • the pH is about 6-8.
  • Culture is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours, and if necessary, aeration and / or agitation are added.
  • CHO (dhfr ) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal serum containing almost no thymidine.
  • polypeptide of the present invention can be separated and purified from the above culture by, for example, the following method.
  • the cells or cells are collected by a known method after culturing, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme and Z or After the cells or cells are destroyed by freeze-thawing or the like, a method of obtaining a crude polypeptide extract by centrifugation or filtration may be used as appropriate.
  • the buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, sometimes abbreviated as TM hereinafter).
  • the bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected.
  • Purification of the polypeptide of the present invention contained in the culture supernatant or extract obtained in this manner can be carried out by appropriately combining known separation and purification methods.
  • These known separation and purification methods mainly include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis.
  • Method using difference in molecular weight Method using charge difference such as ion exchange chromatography, Method using specific affinity such as affinity chromatography, Hydrophobicity such as reverse phase high performance liquid chromatography Using the difference between A method utilizing the difference between isoelectric points, such as to focusing, is used.
  • the thus-obtained polypeptide of the present invention when obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide of the present invention is obtained in a salt, it is a known method Alternatively, it can be converted into a free form or another salt by a method analogous thereto.
  • the polypeptide of the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification.
  • an appropriate protein modifying enzyme for example, trypsin, chymotrypsin, arginyl endopeptidase, proteinase, glycosidase and the like are used.
  • the presence of the polypeptide of the present invention thus produced can be measured by enzyme immunoassay using a specific antibody or the like.
  • the DNA encoding the polypeptide of the present invention or the polypeptide of the present invention includes (1) searching for the physiological action of the polypeptide of the present invention, (2) preparing a synthetic oligonucleotide probe or a primer for PCR, and (3) a ligand for SENR.
  • ⁇ Acquisition of DNA encoding the precursor protein ⁇
  • Development of a receptor binding assay system using a recombinant receptor protein expression system and screening of drug candidate compounds ⁇ Acquisition of antibodies and antisera, 6 DNA , Development of diagnostic drugs using RNA, antibodies or antisera, ⁇ central nervous function regulators, circulatory function regulators, heart function regulators, kidney function regulators, urinary function regulators, sensory organ function regulators, etc. It can be used for drug development and gene therapy.
  • a SENR agonist or antagonist specific to a warm-blooded animal such as a human can be screened by a receptor-binding assay system using a recombinant SENR expression system described below. Evening gonists can be used as preventive and therapeutic agents for various diseases.
  • the polypeptide of the present invention or the DNA encoding the same are those recognized as ligands by SENR expressed in the central nervous system, circulatory system, heart, kidney, urinary system or sensory system. Therefore, it is useful as a safe and low toxic drug.
  • the polypeptide of the present invention or a DN encoding the same A is involved in central nervous function regulation, circulatory function regulation, heart function regulation, kidney function regulation, urinary function regulation or sensory organ regulation, such as senile dementia and cerebrovascular dementia.
  • diseases such as heart failure, acute myocardial infarction, urinary frequency, urinary incontinence, hearing loss, olfactory abnormalities, and visual abnormalities.
  • the polypeptide of the present invention or DNA encoding the same is used as the above-mentioned medicament, it can be carried out in a conventional manner.
  • parenteral use in the form of injections such as suspensions.
  • the compound or a salt thereof may be combined with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc. in a unit dosage form required for generally accepted pharmaceutical practice. It can be manufactured by mixing. The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.
  • the DNA of the present invention is used, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. Can be implemented.
  • an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like
  • Useful bulking agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry are used.
  • the unit dosage form is a capsule, the above type of material can further contain a liquid carrier such as an oil or fat.
  • Sterile compositions for injection include active substances in vehicles such as water for injection, sesame oil, coconut oil It can be formulated according to the usual formulation practice such as dissolving or suspending naturally produced vegetable oils such as.
  • aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.).
  • Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80, HCO-50) may be used in combination.
  • the oily liquid include sesame oil and soybean oil, which may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.
  • buffers eg, phosphate buffer, sodium acetate buffer
  • analgesic IJ eg, benzalkonium chloride, proforce hydrochloride, etc.
  • stabilizers eg, human serum albumin, polyethylene glycol, etc.
  • preservatives eg, benzyl alcohol, phenol, etc.
  • antioxidants eg, antioxidants and the like.
  • the prepared injection solution is usually filled in a suitable ampoule.
  • the preparations obtained in this way are safe and have low toxicity, so they can be used, for example, in humans and mammals (for example, mice, rats, guinea pigs, egrets, higgs, bush dogs, dogs, cats, dogs, monkeys, etc.). Can be administered.
  • the dosage of the polypeptide of the present invention or the DNA encoding the same varies depending on the condition and the like.
  • oral administration generally, for an adult (assuming a body weight of 60 kg), it is about 0.1 per day.
  • 100 mg preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg.
  • parenteral administration the single dose varies depending on the subject of administration, target organ, symptoms, administration method, etc.
  • adult heart failure patients (with a body weight of 60 kg) Is administered by intravenous injection at a dose of about 0.01 to 30 mg / day, preferably about 0.1 to 2 mg / day, more preferably about 0.1 to 1 mg / day. Is convenient.
  • the dose can be administered in terms of 60 kg.
  • the precursor protein of the polypeptide of the present invention is described below. This will be described in more detail.
  • Examples of the precursor protein of the polypeptide of the present invention, its amide, its ester or its salt include, for example, the N-terminus of the aforementioned protein of the present invention or ( And) a tamper having one or more, preferably about 1 to 200, more preferably about 1 to 120, and more preferably about 50 to 120 amino acids bonded to the C-terminus. Quality.
  • a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 is used as the precursor protein of the present invention.
  • a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 is represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 31 or
  • SEQ ID NO: 14 As an example of a precursor of the polypeptide containing the amino acid sequence represented by SEQ ID NO: 32, a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 26
  • SEQ ID NO: 33 or SEQ ID NO: 34 are given.
  • the precursor protein of the present invention can be used in any tissue of human warm-blooded animals (for example, guinea pigs, rats, mice, bush, higgies, horses, monkeys, etc.) A protein derived from kidney, liver, gonad, thyroid gland, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc.) or a cell, etc.
  • SEQ ID NO: 13 or SEQ ID NO: Any protein may be used as long as it has the same or substantially the same amino acid sequence as the amino acid sequence represented by 26.
  • substantially equivalent activities include, for example, receptor-binding activity, signal transduction activity, and the like.
  • the term “substantially the same” means that the receptor binding activity and the like are the same in properties. Therefore, strength factors such as the strength of the receptor binding activity and quantitative factors such as the molecular weight of the protein may be different.
  • the precursor protein of the present invention includes, for example, No.
  • amino acid sequence represented by SEQ ID NO: 26 (preferably about 1 to 30, preferably about 1 to 10, more preferably about 1 to 10) Or 2)) amino acid sequence in which the amino acid has been deleted, (2) 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 30) in the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 , About 1-10 pieces, more preferred Or an amino acid sequence to which several (one or two) amino acids have been added, and 3 one or more (preferably one or more) in the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26.
  • amino acid sequence having about 30 to about 30, preferably about 1 to 10, and more preferably several (one or two) amino acids; 4 SEQ ID NO: 13 or SEQ ID NO: 2 One or more (preferably about 1 to 30, preferably about 1 to 10, more preferably several (1 or 2)) amino acids in the amino acid sequence represented by 6 And amino acids having amino acid sequences obtained by combining the amino acid sequences with amino acids substituted with ⁇ ⁇ ⁇ ⁇ ′.
  • the precursor protein has an N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide notation.
  • the precursor protein of the present invention containing the amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26, etc. is usually a protein having a carboxyl group (-C00H) or carboxy group at the C-terminus. rate (- C00-) in a force C-terminal amino-de (- C0NH 2) or an ester (-C00R).
  • R of the ester for example methylation, Echiru, n - C ⁇ such as butyl - - propyl, isopropyl or n e al Kill group, cyclopentyl, cyclohexylene, such as cyclohexyl (: 3 8 cycloalkyl group, Hue alkenyl, Facial C 6, such as single-naphthyl - 1 2 Ariru group, benzyl, phenethyl, phenylene Lou C Tsu alkyl such benz hydryl, Moshikuwahi such as single naphthylmethyl
  • Ararukiru groups such as ⁇ - Nafuchiru C physicians 2 alkyl, such as pivaloyl Ruo carboxymethyl group which is generally used as an oral es ether and the like.
  • Examples of the salt of the precursor protein of the present invention include the same salts as those exemplified above as the salt of the polypeptide of the present invention.
  • the precursor protein of the present invention can be produced by a method for purifying tissues or cells of human warm-blooded animals, or can be produced according to the protein synthesis method described later. Alternatively, it can be produced by culturing a transformant containing DNA encoding a protein described below.
  • tissue or cells of human warm-blooded animals When producing from tissues or cells of human warm-blooded animals, the tissues or cells of human warm-blooded animals are homogenized, and then extracted with an acid or an organic solvent. The extract is subjected to salting out, dialysis, and gel filtration. It can be purified and isolated by combining chromatography such as reverse phase chromatography, ion exchange chromatography, affinity chromatography and the like.
  • the precursor protein of the present invention can be produced according to a known method for synthesizing a protein, or by cleaving a protein containing the protein of the present invention with an appropriate peptidase. .
  • a method for synthesizing the peptide the same method as described above is used.
  • a commercially available resin for peptide synthesis suitable for amide formation can be used.
  • a resin for example, the above-mentioned resin for peptide synthesis or the like is used.
  • amino acids having a suitably protected amino group and side chain functional group are condensed on the resin in accordance with the sequence of the target peptide according to various condensation methods known per se.
  • the peptide is cleaved from the resin and, at the same time, various protecting groups are removed.
  • an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the desired precursor protein of the present invention. get.
  • the precursor protein of the present invention contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26, and comprises the polypeptide of the present invention.
  • the same effects as, for example, central nervous function regulation, circulatory function regulation, heart function regulation, kidney function regulation, urinary function
  • the precursor protein itself may have a regulatory action or a sensory organ function regulating action.
  • the precursor protein of the present invention can be further used as an antigen for preparing an antibody against the precursor protein.
  • As the protein as such an antigen in addition to the above-described precursor protein of the present invention, partial peptides such as the N-terminal peptide, C-terminal peptide, and central peptide of the precursor protein of the present invention are used.
  • a peptide containing each domain individually may be used, but a peptide containing a plurality of domains at the same time may be used.
  • the salt of the partial peptide of the precursor protein of the present invention the same salts as the above-mentioned salts of polypeptide of the present invention are used.
  • the partial peptide of the precursor protein of the present invention or its amide, ester or salt thereof can be prepared by the same synthetic method as in the case of the above-mentioned precursor protein, or by converting the precursor protein of the present invention into an appropriate peptidase. It can be manufactured by cutting at
  • the DNA encoding the precursor protein of the present invention includes a DNA encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26. Any DNA may be used as long as it is a DNA.
  • any of genomic DNA, genomic DNA library, the above-described tissue / cell-derived cDNA, the above-described tissue / cell-derived cDNA library, and synthetic DNA may be used.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as R-PCR method) using an RNA fraction prepared from the above-mentioned tissue * cells.
  • R-PCR method Reverse Transcriptase Polymerase Chain Reaction
  • examples of the DNA containing a DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 include, for example, SEQ ID NO: 12 Or a DNA containing a DNA having the base sequence represented by SEQ ID NO: 25, and the like. About 50% or more, preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 50% or more of the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25. Examples include DNAs containing DNAs having a nucleotide sequence having a homology of about 90% or more, most preferably about 95% or more.
  • DNA containing DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 include, for example, 1) SEQ ID NO: 1 or 2 or more in the base sequence represented by SEQ ID NO: 25 (preferably about 1 to 30, preferably about 1 to 10, more preferably several (1 or 2 )) The base sequence in which the base is deleted, 2 One or two or more (preferably about 1 to 30, preferably about 1 to 30, in the base sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25) A nucleotide sequence to which about 1 to 10 nucleotides have been added, and more preferably several (one or two) nucleotides; 3 one or more nucleotides in the nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 25 2 or more (preferably about 1 to 30, preferably about 1 to 10 And more preferably one or two or more (preferably one or two or more (preferably one or two or more) of the nucleot
  • a DN encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 under stringent conditions A DNA derived from a mammal that hybridizes with the sequence of the DNA containing A, (2) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 due to degeneracy of the genetic code.
  • DNA that encodes a protein that has an identical amino acid sequence, and that encodes a protein that does not hybridize with the sequence of the DNA that contains the DNA and a sequence that does not hybridize with the sequence defined in (1) but has the same amino acid sequence Are used. Hybridization is performed by a method known per se or a method based thereon.
  • DNA fragment containing the partial base sequence of DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 26 of the present invention is DNA It is also preferably used as a detection probe.
  • DNA encoding the precursor protein of the present invention can also be produced by a genetic engineering technique in the same manner as the above-described polypeptide of the present invention.
  • the DNA encoding the precursor protein of the present invention or the precursor protein of the present invention includes (1) a search for a physiological action of the precursor protein (or the polypeptide of the present invention); (2) a synthetic oligonucleotide probe.
  • preparing a primer for PCR 3 obtaining a DNA encoding the polypeptide of the present invention, ⁇ ⁇ developing a receptor binding system using a recombinant receptor protein expression system and screening for candidate drug compounds 5 5 Acquisition of antibodies and antisera, 6 Development of diagnostic agents using DNA, RNA, antibodies or antisera, central nervous function regulators, circulatory function regulators, heart function regulators, renal function regulators, urology It can be used for the development of drugs such as function regulators and sensory organ function regulators, and gene therapy.
  • a S ENR agonist or antagonist specific to a warm-blooded animal such as human can be screened by a receptor binding assay using a recombinant S ENR expression system described below.
  • an angel gonist can be used as a preventive or therapeutic agent for various diseases.
  • the precursor protein of the present invention or the DNA encoding the same are those recognized as ligands by SENR expressed in the central nervous system, circulatory system, heart, kidney, urinary system or sensory organ system, etc. Therefore, it is useful as a safe and low toxic drug.
  • the precursor protein of the present invention or the DNA encoding the same are involved in central nervous system function control, circulatory function control, heart function control, kidney function control, urinary function control, sensory organ control, etc.
  • dementia due to senile dementia, cerebrovascular dementia, dysgenesis due to phylogenic transformation eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.
  • high (low) blood pressure renal disease (Eg, chronic renal failure, nephritis, etc.)
  • heart disease eg, heart failure, acute myocardial infarction, etc.
  • pollakiuria urinary incontinence, hearing loss, olfactory abnormalities, visual abnormalities, etc. it can.
  • the precursor protein of the present invention or DNA encoding the same is used as the above-mentioned medicament, it can be carried out in a conventional manner.
  • sterility with tablets or capsules, elixirs, microcapsules, etc. coated with sugar coating or enteric coating as needed, or with water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections, such as solutions or suspensions.
  • the compound or a salt thereof may be used together with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, and the like in a unit dosage form required for generally accepted drug practice. It can be manufactured by mixing. The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.
  • additives that can be mixed with tablets, capsules, and the like, the same additives as those described above can be used.
  • Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.).
  • Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80 (TM), HC) -50) may be used in combination.
  • Oily liquids include sesame oil, soybean oil, etc. May be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.
  • buffers eg, phosphate buffer, sodium acetate buffer
  • analgesic IJ eg, benzalkonium chloride, proforce hydrochloride, etc.
  • stabilizers eg, human serum albumin, polyethylene glycol, etc.
  • preservatives eg, benzyl alcohol, phenol, etc.
  • antioxidants eg, antioxidants and the like.
  • the prepared injection solution is usually filled in a suitable ampoule.
  • the preparations obtained in this way are safe and low toxic, so they can be used, for example, in human mammals (eg, mice, rats, guinea pigs, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.). Can be administered.
  • human mammals eg, mice, rats, guinea pigs, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.
  • the dosage of the precursor protein of the present invention or the DNA encoding the same may vary depending on the symptoms and the like.
  • oral administration in general, for an adult (assuming a body weight of 60 kg), about 0. 1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg.
  • parenteral administration the single dose varies depending on the administration target, target organ, symptoms, administration method, etc.
  • administration to adult patients with heart failure with a body weight of 60 kg
  • it is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg per day by intravenous injection.
  • the dose can be administered in terms of 60 kg.
  • polypeptide of the present invention its precursor protein, DNAs and antibodies encoding the polypeptide or precursor protein will be specifically described below.
  • the DNA encoding the polypeptide of the present invention can be used to prevent or treat the DNA or S ENR deficiency. It can also be used as an agent.
  • the polypeptide of the present invention since the polypeptide of the present invention, its precursor protein or S ENR is reduced, the physiological actions of ligands (modulation of central nervous function) , Circulatory function control, heart function control, kidney function control, urinary function control or sensory organ function control) in some patients.
  • ligands modulation of central nervous function
  • Circulatory function control By administering and expressing the DNA encoding the body protein to the patient, or (mouth) after inserting and expressing the DNA encoding the polypeptide of the present invention or its precursor protein in brain cells or the like, By increasing the amount of polypeptide or its precursor protein in brain cells of the patient by transplanting the cells into the patient, etc., the effect of the polypeptide or its precursor protein is fully exerted be able to . Therefore, the DNA encoding the polypeptide of the present invention or its precursor protein can be used as a safe and low-toxicity agent for preventing or treating a deficiency of the polypeptide or its precursor protein.
  • the DNA is used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like.
  • an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like.
  • the polypeptide or its precursor protein of the present invention has SENR or a salt thereof, which has a binding property to a partial peptide of the receptor protein or a salt thereof.
  • concentration of the SENR partial peptide or a salt thereof can be quantified with high sensitivity.
  • This quantification method can be used, for example, in combination with a competition method. That is, by contacting the sample with the polypeptide of the present invention or its precursor protein, the concentration of SENR or a salt thereof, or a partial peptide of SENR or a salt thereof in the sample can be measured.
  • a polypeptide or a salt thereof is obtained.
  • Compounds eg, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc.
  • that alter the binding between the precursor protein and SENR or their salts can be screened.
  • Such compounds have cell stimulatory activity via S ENR (eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production
  • S ENR eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production
  • S ENR eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production
  • a compound having an activity of promoting or suppressing cell membrane potential fluctuations, phosphorylation of intracellular proteins, activation of c-os, and reduction of ⁇ ie, SENR agonist
  • Compounds ie, S ENR antenna gonist. “Altering the binding to a
  • the present invention relates to (i) a case where the polypeptide of the present invention or its precursor protein is brought into contact with S ENR or a salt thereof or a partial peptide or a salt thereof, and ( ⁇ ) The present invention is characterized in that a comparison is made with the case where the polypeptide of the present invention or its precursor protein and a test compound are brought into contact with S ENR or a salt thereof or the partial peptide of the SENR or a salt thereof. It is intended to provide a method for screening a compound or a salt thereof that alters the binding property between the polypeptide or its precursor protein and the above-mentioned SENR.
  • the polypeptide or the precursor thereof of the present invention is brought into contact with the SENR or the partial peptide of the S ENR, and (ii) the S ENR or Part of the S ENR
  • the polypeptide of the present invention or its precursor protein and a test compound are brought into contact with the SENR, for example, the amount of binding of the ligand to the SENR or a partial peptide of the SENR, the cell stimulating activity, etc. are measured and compared. .
  • the labeled polypeptide of the present invention or its precursor protein is contacted with the above-mentioned S ENR or its salt or the partial peptide of S ENR or its salt, and the labeled polypeptide of the present invention or its precursor is
  • the body protein and the test compound are contacted with SENR or a salt thereof or a partial peptide of SENR or a salt thereof
  • a method for screening a compound or a salt thereof that alters the binding between the polypeptide of the present invention or its precursor protein and SENR wherein the amount of binding to the salt is measured and compared.
  • SENR-mediated cell stimulating activity eg, arachidonic acid release, acetylcholine release, intracellular Ca2 + release, intracellular CAMP generation, intracellular cGMP generation, inositol
  • SENR-mediated cell stimulating activity eg, arachidonic acid release, acetylcholine release, intracellular Ca2 + release, intracellular CAMP generation, intracellular cGMP generation, inositol
  • SE SENR expressed on the cell membrane by culturing a transformant containing DNA encoding SENR with a compound that activates SENR eg, the polypeptide of the present invention or its precursor protein. And when the compound that activates SENR and the test compound are brought into contact with SENR expressed on the cell membrane by culturing a transformant containing DNA encoding SENR.
  • S ENR-mediated cell stimulating activity eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorus Or the activity of promoting or suppressing oxidation, activation of c-fos, and lowering of pH, etc.
  • the SENR used in the screening method of the present invention may be any as long as it contains the above-described SENR or a partial peptide of SENR. Minutes are preferred. However, since it is extremely difficult to obtain human-derived organs, S ENR expressed in large amounts using recombinants is suitable for screening. To manufacture the S ENR, the above-described method is used.
  • the cell When a cell containing SENR is used, the cell may be immobilized with dataraldehyde, formalin, or the like.
  • the immobilization method can be performed according to a method known per se.
  • SENR-containing cells refer to host cells expressing SENR.
  • the host cells include the aforementioned Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like.
  • the membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se.
  • Cells can be disrupted by crushing the cells with a Po 11 er—E 1 veh jem-type homogenizer, crushing with a Warinda blender Polytron (Kinematica), crushing with ultrasonic waves, or pressing with a French press. While crushing by ejecting cells from a thin nozzle.
  • centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used.
  • the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically about 1 to 10 minutes), and the supernatant is further centrifuged at a higher speed (15000 rpm to 30000 rpm). Centrifuge for 30 minutes to 2 hours, and use the resulting precipitate as the membrane fraction.
  • the membrane fraction is rich in the expressed SENR and membrane components such as cell-derived phospholipids and membrane proteins.
  • the amount of S ENR in the cell or membrane fraction containing the S ENR is preferably 10 3 to 10 s molecules per cell, and more preferably 10 5 to 10 7 molecules per cell.
  • the higher the expression level the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system but also to measure a large number of samples in the same lot. Become.
  • the appropriate SENR fraction and the labeled present invention are used.
  • Polypeptide or its precursor protein is used.
  • the SENR fraction may be a natural SENR fraction, or A recombinant S ENR fraction having the same activity as the above is desirable.
  • the equivalent activity indicates equivalent ligand binding activity and the like.
  • the labeled ligand a labeled ligand, a labeled ligand analog compound, or the like is used.
  • ligands labeled with [ 3 H], [ 125 I], [ 14 C], [ 35 S] and the like can be used.
  • cells or membrane fractions of cells containing SENR are first suitable for screening.
  • a buffer Any buffer may be used as long as the buffer does not inhibit the binding between the ligand and the receptor, such as a phosphate buffer having ⁇ 4 to 10 (preferably ⁇ 6 to 8) or a tris-hydrochloride buffer.
  • a phosphate buffer having ⁇ 4 to 10 preferably ⁇ 6 to 8
  • a tris-hydrochloride buffer such as a phosphate buffer having ⁇ 4 to 10 (preferably ⁇ 6 to 8) or a tris-hydrochloride buffer.
  • Surfactants such as 0 TM (Kao Atlas), digitonin, and dexcholate can also be added to the buffer.
  • protease inhibitors such as PMS F, louptin, E-64 (manufactured by Peptide Research Institute), and pepstatin can be added for the purpose of suppressing the degradation of the receptor of the present invention and the polypeptide of the present invention by a protease. .
  • a fixed amount (500 0 c pm ⁇ 500000 cm) of the labeled polypeptide of the present invention was added, 10- 1 Q ⁇ 1 0- 7 M simultaneously The test compound is allowed to coexist.
  • a reaction tube containing a large excess of an unlabeled polypeptide of the present invention is also prepared to determine the non-specific binding amount (NSB).
  • the reaction is carried out at 0 ° C to 50 ° C (preferably at 4 ° C to 37 ° C for 20 minutes to 24 hours, preferably 30 minutes to 3 hours.
  • the radioactivity remaining on the glass fiber filter paper is measured with a liquid scintillation counter or a counter, and the count obtained by subtracting the non-specific binding amount (NSB) from the count when there is no antagonist (B.)
  • B.-NSB When (B.-NSB) is set to 100%, a test compound having a specific binding amount (B-NSB) of, for example, 50% or less can be selected as a candidate substance capable of competitive inhibition.
  • a cell stimulating activity via SENR for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • a cell stimulating activity via SENR for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • intracellular cGMP for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • intracellular cGMP for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • intracellular cGMP for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • intracellular cGMP for example, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP
  • intracellular cGMP for example, arachidonic acid release,
  • cells containing S ENR are cultured in a multiwell plate or the like. Before performing screening, replace the cells with a fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, etc., incubate for a certain period of time, and then extract cells or remove supernatant. Collect and quantify the product produced according to each method.
  • a substance for example, arachidonic acid
  • an inhibitor for the degrading enzyme may be added to perform the assay.
  • screening for cAMP production inhibitory activity can be detected as a production inhibitory effect on cells whose basal production has been increased by forskolin or the like. Requires cells that have expressed the appropriate S ENR.
  • the cells expressing the SENR of the present invention are preferably the above-mentioned recombinant SENR-expressing cell lines.
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.
  • the kit for screening a compound or a salt thereof that alters the binding property between the polypeptide or its precursor protein and S ENR of the present invention comprises S ENR or a salt thereof, a partial peptide of S ENR or a salt thereof, and S ENR. Or the membrane fraction of cells containing SENR, and the polypeptide of the present invention or its precursor protein.
  • screening kit of the present invention examples include the following. 1. Screening reagent 1Measurement buffer and washing buffer
  • the solution may be sterilized by filtration through a 0.45 / m pore size filter and stored at 4 ° C, or may be prepared as needed.
  • CHO cells expressing S ENR were subcultured on a 12-well plate with 5 ⁇ 10 5 Z-holes, and cultured for 2 days at 37 ° 5% C ⁇ 2 and 95% air.
  • the polypeptide of the present invention or a precursor protein thereof is dissolved in PBS containing 0.1% serum albumin (manufactured by Sigma) so as to be ImM, and stored at ⁇ 20 ° C.
  • the compound or its salt obtained by using the screening method or the screening kit of the present invention alters the binding between the polypeptide of the present invention or its precursor protein and SENR (inhibits or promotes the binding).
  • S ENR agonist a compound having a cell stimulating activity via S ENR or a salt thereof
  • S ENR agonist a compound having no such stimulating activity
  • the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, and the like. These compounds may be novel compounds or known compounds.
  • a compound that changes the binding property (particularly, inhibits the binding) of the polypeptide of the present invention or its precursor protein to S ENR by performing the binding 'at least one of the screening methods described in (1) to (3) above. After obtaining, it is determined whether the compound has the above-mentioned SENR-mediated cell stimulating activity.
  • the compound having a cell stimulating activity or a salt thereof is a S ENR agonist, and the compound having no such activity or a salt thereof is a S ENR antagonist.
  • test compound is brought into contact with a cell containing SENR, and the cell stimulating activity via the SENR is measured.
  • the compound having a cell stimulating activity or a salt thereof is a S ENR agonist.
  • a compound that activates S ENR for example, the polypeptide of the present invention, its precursor protein, or S ENR agonist
  • a cell that contains S ENR Measures SENR-mediated cell stimulating activity when a test compound is brought into contact with cells containing SENR And compare.
  • a compound or a salt thereof capable of decreasing the cell stimulating activity of a compound that activates SENR is an SENR antagonist.
  • the SENR agonist has an activity similar to the physiological activity of the polypeptide of the present invention or its precursor protein on SENR, it is safe and has low toxicity similarly to the polypeptide of the present invention or its precursor protein. It is useful as a new drug.
  • SENR agonist can suppress the physiological activity of the polypeptide of the present invention against SENR, and is therefore useful as a safe and low-toxic drug for suppressing the receptor activity.
  • SENR agonists include, for example, senile dementia, cerebrovascular dementia, degenerative and metamorphic diseases of phylogenic variants (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.), high (low) blood pressure. , Renal diseases (eg, chronic renal failure, nephritis, etc.), heart diseases (eg, heart failure, acute myocardial infarction, etc.), frequent urination, urinary incontinence, hearing loss, olfactory abnormalities, visual abnormalities, etc. Can be used.
  • senile dementia cerebrovascular dementia
  • degenerative and metamorphic diseases of phylogenic variants eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.
  • Renal diseases eg, chronic renal failure, nephritis, etc.
  • heart diseases eg, heart failure, acute myocardial infarction, etc.
  • salts with inorganic bases examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids.
  • Suitable examples of the salt with an inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt.
  • salt with an organic base examples include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, jenoanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine.
  • Preferred examples of salts with inorganic acids include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid And the like.
  • Suitable examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid And salts with acids and the like.
  • Preferred examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, and olutinine.
  • Preferred examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. .
  • Antibodies for example, polyclonal antibodies, monoclonal antibodies or antisera against the polypeptide of the present invention or its precursor protein can be obtained by using the polypeptide of the present invention or its precursor protein or its partial peptide as an antigen, and It can be produced according to a method for producing an antibody or antiserum.
  • a polyclonal antibody can be produced according to the method described below.
  • the polyclonal antibody against the polypeptide of the present invention or its precursor protein can be produced according to a method known per se or a method analogous thereto.
  • a complex of an immunizing antigen (antigen such as a polypeptide) and a carrier protein is formed, and a warm-blooded animal (for example,
  • Immunity to mammals eg, egrets, sheep, sheep, goats, rats, mice, guinea pigs, lions, lions, horses
  • birds eg, chicks, birds, wildlife, ducks, geese, geese
  • the antibody-containing substance against the polypeptide of the present invention is collected from the immunized animal, and the antibody is separated and purified.
  • the type of carrier protein and the mixing ratio between the carrier and the hapten may be determined as long as antibodies can be efficiently produced against the hapten immunized by crosslinking with the carrier.
  • Crosslinking may be carried out at any ratio.For example, ⁇ serum albumin, ⁇ psiloglobulin, keyhole ⁇ linpet ⁇ hemocyanin, etc.
  • a method of coupling at a ratio of about 1 to 5 is used.
  • various condensing agents can be used, but daltaraldehyde, carposimide, maleimide active ester, thiol group, Condensation products in which active ester reagents containing a dithiopyridyl group are used against itself Oh Rui to the site that can produce the antibody carriers, it is administered with a diluent.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.
  • the polyclonal antibody is preferably collected from blood, ascites, and the like, of the mammal immunized by the above method.
  • the antibody titer against the polypeptide of the present invention or its precursor protein in the antiserum can be measured in the same manner as the measurement of the antibody titer of the hybridoma culture supernatant described later.
  • the antibody can be separated and purified according to the same method for separating and purifying immunoglobulin as described later for the monoclonal antibody.
  • a monoclonal antibody can be produced according to the method described below. [Preparation of monoclonal antibody]
  • the polypeptide of the present invention or a precursor protein thereof may be a warm-blooded animal (for example, a mammal warm-blooded animal (eg, a heron, a sheep, a goat, a rat, a mouse, a guinea pig, a horse, a horse, a bush), a bird ( Eg, chickens, birds, birds, birds, ducks, geese, quail) etc.) Administered with excipients.
  • Complete Freund's adjuvant / incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 26 weeks, for a total of about 210 times.
  • monoclonal antibody-producing cells When preparing monoclonal antibody-producing cells, select an individual with an antibody titer from the above-mentioned warm-blooded animal, such as a mouse, immunized with the antigen, and collect spleen or lymph nodes 25 days after the final immunization. By fusing the antibody-producing cells contained in the above with myeloma cells, a monoclonal antibody-producing hybrid can be prepared.
  • the antibody titer in the antiserum is measured, for example, by reacting the labeled polypeptide of the present invention, its precursor protein or a partial peptide thereof described below with the antiserum, and then measuring the labeling agent bound to the antibody. This is done by measuring the activity.
  • the fusion operation can be performed according to a known method, for example, the method of Koehler and Milstein [Nature, 256 495 (1975) 3].
  • the fusion promoter include polyethylene glycol (PEG) and Sendai virus. PEG is preferably used.
  • myeloma cells examples include NS-1P3U1SP2Z0AP-1 and the like, and P3U1 is preferably used.
  • the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells to be used is about 1: 120: 1, and PEG (preferably PEG 1 000 PEG 6000) is added at a concentration of about 80%.
  • PEG preferably PEG 1 000 PEG 6000
  • the polypeptide antigen of the present invention or the precursor protein antigen thereof can be directly or in a carrier.
  • the hybridoma culture supernatant is added to the solid phase (eg, microplate) to which both have been adsorbed, and then an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (cytolysis U. Mouse immunoglobulin antibody is used) or protein A is added, and a monoclonal antibody against the polypeptide of the present invention or its precursor protein bound to a solid phase is detected.
  • Anti-immunoglobulin antibody or protein A is adsorbed.
  • a method of adding a polypeptide of the present invention labeled with a radioactive substance, an enzyme, or the like, and detecting a monoclonal antibody against the polypeptide of the present invention or its precursor protein bound to a solid phase can be used.
  • the selection of the monoclonal antibody against the polypeptide of the present invention or its precursor protein can be carried out according to a method known per se or a method analogous thereto. It is usually performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine).
  • HAT hyperxanthine, aminopterin, thymidine
  • any medium may be used as long as it can grow a hybridoma.
  • RPMI 1640 medium containing 1-20%, preferably 10-20% fetal calf serum, GIT medium containing 1-10% fetal calf serum (Wako Pure Chemical Industries, Ltd.)
  • serum-free medium for hybridoma culture SFM-101, Nissui Pharmaceutical Co., Ltd.
  • the culture temperature is usually 20 to 40, preferably about 37 ° C.
  • the cultivation time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks.
  • Culture is usually performed under 5% carbon dioxide gas.
  • the antibody titer of the hybridoma culture supernatant can be measured in the same manner as in the measurement of the antibody titer to the polypeptide of the present invention in the antiserum.
  • Separation and purification of the monoclonal antibody against the polypeptide or its precursor protein of the present invention can be carried out in the same manner as in the separation and purification of normal polyclonal antibodies, by the method of separating and purifying immunoglobulin (e.g., salting out method, alcohol precipitation method, Isoelectric point precipitation, electrophoresis, adsorption / desorption with ion exchangers (eg DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or active adsorbents such as protein A or protein G Specific purification method in which only the antibody is collected and the bond is dissociated to obtain the antibody].
  • immunoglobulin e.g., salting out method, alcohol precipitation method, Isoelectric point precipitation, electrophoresis, adsorption / desorption with ion exchangers (eg DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or active adsorbents such as protein A
  • Antibodies against the polypeptide of the present invention or its precursor protein produced according to the methods (a) and (b) above can specifically recognize the polypeptide of the present invention or its precursor protein, respectively. Since it can be used, it can be used for quantification of the polypeptide of the present invention or its precursor protein in a test solution, particularly for quantification by a sandwich immunoassay. That is, the present invention provides, for example,
  • An antibody that reacts with the polypeptide of the present invention or its precursor protein is allowed to react competitively with a test solution and a labeled polypeptide or its precursor protein of the present invention, and labeled with the antibody.
  • a method for quantifying the polypeptide of the present invention or its precursor protein in a test solution comprising measuring the ratio of the polypeptide of the present invention or its precursor protein,
  • a test method comprising simultaneously or continuously reacting a test wave with an antibody insolubilized on a carrier and a labeled antibody, and then measuring the activity of a labeling agent on the insolubilized carrier.
  • one of the antibodies is an antibody that recognizes the N-terminal of the polypeptide of the present invention or its precursor protein, and the other antibody is the present antibody.
  • the present invention provides a method for quantifying the polypeptide of the present invention or its precursor protein in a test solution, which is an antibody that reacts with the C-terminal of the polypeptide of the present invention or its precursor protein.
  • the polypeptide of the present invention or its precursor protein can be measured using a monoclonal antibody that recognizes the polypeptide of the present invention or its precursor protein, and can also be detected by tissue staining or the like. For these purposes
  • the antibody molecule itself may be used, or F (ab ') 2 , Fab', or Fab fraction of the antibody molecule may be used.
  • the measuring method using the antibody of the present invention is not particularly limited, and the amount of the antibody, the antigen, or the antibody-antigen complex corresponding to the amount of the antigen (eg, the amount of the polypeptide) in the liquid to be measured is determined chemically or Any measurement method may be used as long as it is detected by a physical means and is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, a competitive method, an immunometric method, and a sandwich method are preferably used, but a sandwich method described later is particularly preferable in terms of sensitivity and specificity.
  • Examples of the labeling agent used in the measurement method using the labeling substance include a radioisotope, an enzyme, a fluorescent substance, and a luminescent substance.
  • Examples of radioisotopes include
  • enzyme large preferably stable and specific activity, e.g. beta - galactopyranoside Bok oxidase, beta One Darco Fern, alkaline phosphatase, peroxidase, malate dehydrogenase, etc .; fluorescent substances such as fluorescamine and fluorescein isothiocyanate; and luminescent substances such as luminol, luminol derivatives, luciferin And lucigenin, respectively.
  • a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.
  • the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass.
  • a test solution is reacted with an insolubilized anti-polypeptide antibody (primary reaction), and further reacted with a labeled anti-polypeptide antibody (secondary reaction).
  • primary reaction an insolubilized anti-polypeptide antibody
  • secondary reaction a labeled anti-polypeptide antibody
  • the primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times.
  • the labeling agent and the method of insolubilization can be in accordance with those described above.
  • the antibody used for the solid phase antibody or the labeling antibody is not necessarily required to be one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may.
  • the anti-polypeptide or its precursor protein antibody used in the primary reaction and the secondary reaction is the polypeptide of the present invention.
  • Antibodies with different binding sites for the peptide or its precursor protein are preferably used. That is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention or its precursor protein, the antibody used in the primary reaction and the secondary reaction
  • the antibody used is preferably an antibody that recognizes other than the C-terminal part, for example, the N-terminal part.
  • An antibody against the polypeptide of the present invention or its precursor protein may be assayed using a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nematic method. It can be used for flowmetry.
  • a competition method the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, and then the unreacted labeled antigen is separated from (F) and the labeled antigen (B) bound to the antibody. Then, the amount of B or F is measured to determine the amount of antigen in the test solution.
  • a soluble antibody is used as the antibody
  • BZF separation is performed using polyethylene glycol
  • a liquid phase method using a second antibody against the antibody or a solid phase antibody is used as the first antibody.
  • a solid phase method using a soluble first antibody and an immobilized antibody as the second antibody is used.
  • the antigen in the test solution and the immobilized antigen are subjected to a competitive reaction with a certain amount of the labeled antibody, and then the solid phase and the liquid phase are separated.
  • the antigen is allowed to react with an excessive amount of the labeled antibody, then the immobilized antigen is added, and the unreacted labeled antibody is bound to the solid phase, and then the solid phase and the liquid phase are separated.
  • the amount of label in either phase is measured to quantify the amount of antigen in the test solution.
  • the amount of insoluble sediment generated as a result of the antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test liquid is small and only a small amount of sediment is obtained, laser nephrometry utilizing scattering by a laser is preferably used.
  • the polypeptide of the present invention or its precursor protein can be quantified with high sensitivity by using an antibody against the polypeptide of the present invention or its precursor protein.
  • a disease involving the polypeptide of the present invention or its precursor protein can be diagnosed.
  • Diseases involving the polypeptide of the present invention or the precursor protein thereof include, for example, senile dementia, cerebrovascular dementia, regressive metamorphic disease of phylogenic transformation (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease) Disease), dementia, high (low) blood pressure, kidney disease (eg, chronic renal failure, nephritis, etc.), heart disease (eg, heart failure, acute myocardial infarction, etc.), frequent urination, urinary incontinence, hearing loss, smell Diseases such as abnormalities and visual abnormalities.
  • senile dementia cerebrovascular dementia
  • regressive metamorphic disease of phylogenic transformation eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease
  • dementia high (low) blood pressure
  • kidney disease eg, chronic renal failure, nephriti
  • test solution can be prepared from a mammal to be tested (eg, human, egret, sheep, goat, rat, mouse, guinea pig, porcupine, porcine, bush) by a method known per se.
  • a mammal to be tested eg, human, egret, sheep, goat, rat, mouse, guinea pig, porcupine, porcine, bush
  • test liquid include blood, lymph, urine, and the like.
  • bases, amino acids, and the like are indicated by abbreviations based on tags or common abbreviations in the art according to the IUPAC-IUB Commission on Biochemical Nomenclature, examples of which are described below.
  • amino acids may have optical isomers, L-form is indicated unless otherwise specified.
  • H is or H histidine
  • HOB t 1-hydroxybenztriazole
  • DCC N, N'-dicyclohexylcarposimide
  • Trt Trityl
  • sequence numbers in the sequence listing in the present specification indicate the following sequences.
  • the synthetic DNA used to obtain the partial sequence of the cDNA encoding the rat urotensin II like peptide precursor protein is shown.
  • the synthetic DNA used to obtain the partial sequence of the cDNA encoding the rat urotensin II 1 ikepeptide precursor protein is shown.
  • Fig. 3 shows a synthetic DNA used for RACE-PCR for obtaining a 5 'partial sequence of a cDNA encoding rat urotensin II 1 ike peptide precursor protein.
  • FIG. 1 shows the nucleotide sequence of the 5 ′ partial sequence of cDNA encoding rat urotensin II like peptide precursor protein.
  • [SEQ ID NO: 7] Shows the synthetic DNA used for RACE-PCR to obtain the 3 'partial sequence of cDNA encoding rat urotensin II like pepU de precursor protein.
  • the synthetic thigh used as a radiolabeled probe for obtaining the 3 ′ partial sequence of cDNA encoding rat urotensin II like pep de precursor protein is shown. [SEQ ID NO: 9]
  • the synthetic DNA used to obtain the full-length sequence of the cDNA encoding the rat urotensin II 1 ike peptide precursor protein is shown.
  • the synthetic DNA used to obtain the full-length sequence of the cDNA encoding the rat urotensin II like peptide precursor protein is shown.
  • SEQ ID NO: 15 rat urotensin II like peptide-2
  • the synthetic DNA used to obtain the 5 ′ partial sequence of the cDNA encoding the mouse urotensin II like peptide precursor protein is shown.
  • FIG. 1 shows the 5′-side partition sequence of cDN : A encoding mouse urotensin II 1 ike pepiide precursor protein.
  • Fig. 3 shows a synthetic DNA used to obtain a partial sequence and a full-length sequence of a cDNA encoding a mouse urotensin II like peptide precursor protein.
  • FIG. 3 shows the 3′-side distribution sequence of cDNA encoding mouse urotensin II like peptide precursor protein.
  • the synthetic DNA used to obtain the full-length sequence of the cDNA encoding the mouse urotensin II 1 ike pepUde precursor protein is shown.
  • SEQ ID NO: 27 shows the DNA sequence of mouse urotensin II 1 ike peptide.
  • [SEQ ID NO: 30] 1 shows the amino acid sequence of human SENR protein.
  • the amino acid sequence of the mature peptide of rat urotensin II like peptide deduced from the amino acid sequence of the precursor protein is shown.
  • FIG. 2 shows the amino acid sequence of the mature peptide of rat urotensin II like peptide deduced from the amino acid sequence of the precursor protein.
  • FIG. 2 shows the amino acid sequence of the mature peptide of mouse urotensin II like peptide deduced from the amino acid sequence of the precursor protein.
  • FIG. 2 shows the amino acid sequence of the mature peptide of mouse urotensin II like peptide deduced from the amino acid sequence of the precursor protein.
  • SEQ ID NO: 31 mature peptide of rat urotensin II 1 ike pepUde
  • SEQ ID NO: 34 mature urotensin II 1 ike peptide mature peptide
  • the transformant Escherichia coli XLlO-Gold / pcrl I-rUII like obtained in Example 3 described below is 1-3-1, Tsukuba East, Ibaraki, Japan since June 2, 2001.
  • RNA human brain-derived poly (A) + RNA (Clontech) as type III, perform a reverse transcription reaction using a random primer.
  • A human brain-derived poly
  • RNA reverse transcription
  • amplification by PCR is performed using the synthetic DNA primers of SEQ ID NOS: 23 and 24.
  • the synthetic DNA primer is constructed so that the gene in the region translated into the receptor protein is amplified.
  • a nucleotide sequence recognized by the restriction enzyme SalI is added to the 5 ′ side of the gene.
  • Recognition sequences of the respective restriction enzymes are added to the 5 'and 3' sides such that the base sequence recognized by the restriction enzyme Spe I is added to the 3 'side.
  • the cycle for amplification was performed using a thermal cycler (PerkinElmer), heating at 94 ° C for 60 seconds, followed by a cycle of 94 ° C for 30 seconds, 59 ° C for 30 seconds, and 74 ° C for 60 seconds. Is repeated 35 times. Confirmation of the amplification product is performed by 0.8; agarose gel electrophoresis and then staining with ethidium umide.
  • Reference Example 2 Subcloning of PCR product into plasmid vector and insertion Confirmation of amplified cDNA sequence by decoding base sequence of cDNA
  • the reaction product after PCR performed in Reference Example 1 was separated using a low melting point agarose gel of 0.8 mm; the band was cut out with a force razor, and then fragmented, extracted with phenol, and extracted with phenol.
  • the DNA is recovered by phenol-form extraction with ethanol and ethanol precipitation.
  • the recovered DNA is subcloned into the plasmid vector pCR-Scrii A immediate SK (+) according to the prescription of PCR-Script TM A immediate SK (+) cloning kit (Stratagene).
  • the reaction for determining the nucleotide sequence is performed using the DyeDeoxy Terminator Cycle Sequence Kit (PerkinElmer) and decoding is performed using a fluorescent automatic sequencer.
  • SENR human GPR14
  • Plasmids are prepared using the Plasmid Midi Kit (Qiagen) from the ⁇ coli clones transformed with the plasmid and cut with the restriction enzymes Sail and SpeI to cut out the insert portion.
  • the insert DNA is cut out of the agarose gel with a force razor after electroswimming, and then recovered by fragmentation, phenol extraction, phenol / chloroform extraction, and ethanol precipitation.
  • Vector plasmid pAKKO-1 ⁇ for animal cell expression obtained by digesting this insert DNA with Sal I and Spe I (Hi painting a, S. et al. Biochim. Biophys. Acta, Vol.
  • ligation was performed using T4 ligase (Takara Shuzo), and plasmid for protein expression was ligated.
  • pAKKO-hSENR T4 ligase
  • plasmid DM of pAKKO-SENR is prepared using Plasmid Midi Kit (Qiagen). This is introduced into CHO dhfr-cells using Cel! Phect Transfection Kit (Amersham Pharmacia Biotech) according to the attached protocol. 10 mg of DNA is made into a coprecipitation suspension with phosphoric acid and added to a 10 cm dish inoculated with 5 ⁇ 10 5 or 1 ⁇ 10 6 CHO dhfr ”cells 24 hours ago.
  • a reverse transcription reaction was performed using a random primer.
  • the reverse transcription reaction used the reagents of the evening RNA PCR ver. 2 kit.
  • this reverse transcription product was used as type I, and amplification was performed by PCR using the synthetic DNA primers of SEQ ID NOS: 1 and 2.
  • the synthetic DA primer was designed to amplify the gene in the region translated into the receptor protein. At that time, a nucleotide sequence recognized by the restriction enzyme Sai I was added to the 5 'side of the gene.
  • the composition of the reaction mixture was 5 m of cDNA ⁇ type, 1 M each of synthetic DNA primers, 0.2 mM dTPs, 1 mM MgCl 2 , K0D (King of DNA) DNA polymerase 11 and the buffer supplied with the enzyme, and the total reaction volume was set to 50 ll.
  • the cycle for amplification is the thermal cycler. After heating at 94 ° C for 60 seconds, a cycle of 94 ° C for 30 seconds, 59 ° C for 30 seconds, and 74 ° C for 60 seconds was repeated 35 times.
  • the reaction product after the PCR performed in Reference Example 4 was separated using a 0.8% low-melting point agarose gel, and the band was cut out with a force razor, followed by fragmentation, phenol extraction, and phenol-cloth form extraction.
  • the DNA was recovered by ethanol precipitation.
  • the recovered DNA was subcloned into the plasmid vector pCR-Script Amp SK (+) according to the procedure of the PCR-Script TM Amp SK cloning kit (Stratagene).
  • Escherichia coli Escherichia coli
  • M109 competent eel 1 Takara Shuzo
  • clones having cDNA inserts were selected in LB agar medium containing ampicillin and) (-gal, Only the white clones were separated using a sterilized toothpick to obtain a transformant E. coli] M109 / SE1VR
  • Individual clones were cultured in LB medium containing ampicillin, and QIA prep8 mini prep ( Plasmid DNA was prepared using Qiagen Corporation. A portion of the prepared DNA was digested with restriction enzymes Sal I and Spe I to confirm the size of the inserted receptor cDNA fragment.
  • Plasmid was prepared from the ⁇ ⁇ clone transformed with the plasmid using Plasmid Midi Kit (Qiagen), and the restriction enzyme Sal I And Spe I to cut out the insert. After electrophoresis, the insert DNA was cut out from the agarose gel with a force razor, and then recovered by performing fragmentation, phenol extraction, phenol / chloroform extraction, and ethanol precipitation.
  • pAKKO-111H Hinuma, S. et al. Biochim. Biophys. Acta, Vol. 1219, pp. 251-259 (] 994).
  • pAKKO-SENR was constructed by ligation using T4 ligase (Takara Shuzo).
  • Plasmid idi Kit Qiagen
  • 10 DNAs were co-precipitated with calcium phosphate and added to a 10 cm Petri dish seeded with 5 ⁇ 10 5 or 1 ⁇ 10 6 CHO dhfr-cells 24 hours before.
  • RNA Reverse transcription was performed at 50 ° C using the 3'-RACE adapter primer (GGCCACGCGTCGACTAGTAC (T) 1T : Gibco BRL) as a primer according to the manual, and the single-stranded rat spinal cord cDNA was prepared.
  • SEQ ID NO: 1 and SEQ ID NO: 1 prepared based on the nucleotide sequence at positions 265-287 and 352-375 from ATG, which is the initiation codon of the nucleotide sequence encoding the human urotensin II precursor protein (GenBank accession No. AF104118) Using the primer (2) (synthesized by Japan Bioservice), the single-stranded cDNA obtained in Example 1 from the rat spinal cord was subjected to a PCR reaction using the single-stranded cDNA as type III.
  • the composition of the reaction solution was 2.5 M MgCl 2 , dTP 0.2 mM, AmpliTaq Gold (PerkinElmer) 1/200 vome, 10-fold concentrated AmpliTaq Gold Buffer 1 /
  • the volume was 10 volumes and the volume was 25 ⁇ l.
  • PCR conditions are: 95 ° C for 9 minutes, 3 cycles of 94 ° C • 20 seconds, 60 ° C ⁇ 15 seconds, 80 ° C ⁇ 20 seconds, 94 ° C ⁇ 20 seconds, 58 ° C 15 seconds, 80 ° C 20 seconds 5 cycles, 94 ° C 20 seconds, 55 ° C 15 seconds, 80 ° C 7 cycles 20 seconds, 94 ° C '20 seconds, A cycle of 53 ° C for 15 seconds and 80 ° C for 20 seconds was repeated 30 times.
  • the PCR reaction solution was subjected to 3.5-ml sieve electrophoresis using GTG Agarose (Takara Shuzo), and DNA was extracted with a GeneClean Spin kit (Bio 101) from a band of about 110 bp detected by staining with ethidium umide. This was subcloned into a plasmid vector pcrli using T0P0 TAcloningkit (Invitrogen) and introduced into E. coli XL10-Gold (Stratagene). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen).
  • the reaction for determining the nucleotide sequence was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer), and was decoded using a fluorescent automatic sequencer. As a result, the nucleotide sequence shown in SEQ ID NO: 3 was obtained. This sequence had homology to the nucleotide sequence of the human urotensin II precursor protein gene, suggesting that it encodes a peptide precursor protein similar to urotensin 11. However, it was different from the partial sequence of the rat urotensin II (rat SENR ligand) precursor protein gene determined from the rat chromosome sequence (described in W000 / 32627).
  • this sequence is not a precursor protein of rat urotensin II, but encodes another precursor protein of a peptide similar to rat urotensin II. It was concluded that this was a partial sequence of the cDNA. This papna similar to rat urotensin II was named rat urotens in II 1 ike peptide.
  • Example 3 Determination of cDM sequence encoding rat urotensin II like peptide precursor protein by RACE (rapid amplification of cDNA ends) method
  • the composition of the reaction solution was as follows: Primer concentration: SEQ ID NO: 4, 0.4 M, API: 0.2 M, 2.5 mM MgCl 2 , dNTP 0.2 mM, AmliTaq Gold (Perkin Elmer) 1/100 volume, 10-fold concentration AmpliTaq Gold Buffer 1/10 volume, liquid volume was 25 1.
  • the PCR conditions were: 95 ° C for 9 minutes, 3 cycles of 94 ° C for 20 seconds, 70 ° C for 1 minute, 94 ° C for 20 seconds, 68 ° C for 1 minute. Five cycles of 94 ° C for 20 seconds and 66 ° C for 1 minute were repeated 25 times.
  • This reaction solution 1a1 was made into type III, and PCR was performed again using the primer of SEQ ID NO: 5 (synthesized by Nippon Bioservices) and the adapter primer AP2 included in the kit.
  • the composition of the reaction mixture was as follows: Primer concentration: SEQ ID NO: 5: 0.4 M, AP2: 0.2 M, 2.5 mM MgCl 2 , dNTP 0.2 mM, AmpliTaq Gold (Perkin Elmer) 1/100 volume, 10-fold concentrated AmpliTaq Gold Buffer 1/10 volume, liquid volume was 25 n 1.
  • the PCR conditions were as follows: after incubating at 95 ° C for 9 minutes, a cycle of 94 ° C for 20 seconds and 64 ° C for 30 seconds was repeated 35 times, and then incubated at 72 ° C for 7 minutes.
  • the PCR reaction solution was subjected to electrophoresis using 3.5% usieve GTG Agarose (Takara Shuzo), and DNA was extracted from the band near 420 bp detected by staining with ethidium mouth mouth using the GeneClean Spin kit (Bio 101). Subcloning was performed using a T0P0 TA cloning kit (Invitrogen). Plasmid DNA was purified from the resulting transformant using QIA prepS mini prep kit (Qiagen).
  • the reaction for base sequence determination is performed using the DyeDeoxy Terminator Cycle Sequence kit (Hikin Elma) and using a fluorescent automatic sequencer. Upon decoding, the sequence shown in SEQ ID NO: 6 was obtained. This sequence contained the 5'-terminal sequence including the initiation codon of the cDNA encoding the rat urotensin II like peptide precursor protein.
  • PCR conditions are: 1 minute incubation at 94 ° C, 30 cycles of 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes, and 30 minutes at 72 ° C for 10 minutes. It was kept warm. A part of the reaction solution was electrophoresed on 1.6 Seakem GTG Agarose (Takara Shuzo), denatured with 0.4 N NaOH, and subjected to force re-blotting on BY0DYNE B Transmembrane (Paul Bio Support). The membrane was neutralized with 0.2 M phosphate buffer (pH 6.8), air-dried, and heated to 80 ° C for 30 minutes by applying ultraviolet rays of 0.12] / cm 2 .
  • This membrane was hybridized with a probe of SEQ ID NO: 8 labeled with [ 32 P] ATP by T4 kinase, washed with 0.2 X SSC (Futtsu Gene) containing 0.1% SDS at 65 ° C, and then washed with BAS2000 ( When the position where the radioactivity was hybridized was examined by Fuji Film Co., Ltd., it was confirmed that an amplification product considered to be derived from the rat urotensin II 1 ike peptide precursor protein gene was migrated at 300 to 400 bp.
  • DNA was extracted from this part of the gel using the QIAGEN Gel Extraction kit (Qiagen), and this was subcloned into the plasmid vector peril using the T0P0 TA cloning kit (Invitrogen), and Escherichia coli XL10-Gold (Stratagene) was used. Company). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen). The reaction for determining the nucleotide sequence was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer) and read using a fluorescent automatic sequencer.
  • SEQ ID NO: 9 which is a 3'-terminal sequence containing a termination codon of cDNA encoding rat urotensin II like peptide precursor protein. Sequence containing the full-length cDNA encoding the rat urotensin II like peptide precursor protein predicted from the 5'-terminal and 3'-terminal sequence information obtained using the RACE method as described above.
  • the single-strand cDNA derived from the spinal cord obtained in Example 1 was used as type I, and PCR was performed using primers of SEQ ID NO: 10 and SEQ ID NO: 11 (synthesized by Amersham Pharmacia Biotech). Done.
  • the primer concentration was set to 0.2 M for each, dNTP was 0.2 mM, Advantage2 (Clontech) 1/50 volume, 10-fold concentrated AdvaiUage2 Buffer 1/10 volume, and the volume was 251.
  • PCR conditions are: 1 minute incubation at 94 ° C, 30 cycles of 94 ° C for 30 seconds, 57 ° C-30 seconds, 72 ° C for 30 seconds, then 10 minutes at 72 ° C Insulated.
  • the R reaction mixture was subjected to electrophoresis using 1.6% Seakem GTG Agarose (Takara Shuzo), and DNA was detected using a QIAGEN Gel Extraction kit (Qiagen) from the 450 bp DNA detected by staining with Cyba I Green (Futatsu Gene). Was extracted and subcloned using a T0P0 TA cloning kit (Invitrogen). Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep kit (Qiagen). The reaction for base sequence determination was performed using DyeDeoxy Terminator Cycle Sequence kit (PerkinElmer) and read using a fluorescent automatic sequencer. As a result, the sequence shown in SEQ ID NO: 12 was obtained.
  • This sequence contained the full-length sequence including the start and stop codons of the cDNA encoding the rat urotensin II 1 ike peptide precursor protein.
  • Escherichia coli XL10-Gold (Stratagene) is transformed with plasmid pcrll-rUII 1 ike into which the cDNA encoding the rat urotensin II like peptide precursor protein has been inserted to transform Escherichia coli XL10-Gold / pcrll-rUII like. Obtained.
  • FIG. 1 shows the DNA sequence of the rat urotensin II like peptide precursor and the corresponding amino acid sequence.
  • the urotensin II like peptide which is a mature peptide predicted from this precursor protein sequence, is different from rat urotensin II, which consists of two amino acids, as predicted from the chromosomal sequence. Residue or 2 residues N-terminal, so it was estimated to be 7 or 14 residues.
  • the urotensin II 1 ike peptide consisting of urotensin II is called rat urotensin II like tide -1 and the urotensin II like peptide consisting of 14 residues is called rat urotensin 11 like peptide-2.
  • the N-terminal of the predicted mature peptide is glutamine, the N-terminal of the actual peptide was considered to be pyroglutamic acid.
  • the sequences of the expected rat urotensin II like peptide-1 and -2 in SEQ ID NOs: 14 and 15 are shown.
  • the composition of the reaction mixture was set to 0.4 M for both primer concentration and 2.5 mM MgCh, dNTP 0.2 mM, AmpliTaq Gold (PerkinElmer) 1/100 volume, 10-fold concentrated AmpliTaq Gold Buffer 1/10 volume, volume 20 1 PCR conditions are: After incubating at 95 ° C for 9 minutes, 5 cycles of 95 ° C for 10 seconds, 57 ° C for 15 seconds, 72 ° C for 30 seconds, 95 ° C for 10 seconds, 54 ° C for 15 seconds, The cycle of 72 ° C for 30 seconds was repeated 40 times, and kept at 72 ° C for 7 minutes.
  • the PCR reaction mixture was electrophoresed on 3.5 ⁇ m; Nusieve GTG Agarose (Takara Shuzo), and DNA was extracted from the 420 bp band detected by ethidium bromide staining using GeneClean Spin kit (Bio 101). did. This was subcloned into the plasmid vector pcr2.1 using T0P0 TA cloning kit (Invitrogen) and introduced into E. coli TOP10. Plasmid DNA was purified from the resulting transformant using Q1A prep8 mini prep kit (Qiagen). The reaction for base sequence determination was performed using dRhodamine Terminalor Cycle Sequence kit (PerkinElmer) and decoded using a fluorescent automatic sequencer.
  • nucleotide sequence represented by SEQ ID NO: 20 was obtained. This sequence had high homology to the base sequence of the rat urotensin II like peptide precursor protein gene, and was considered to be a 5 ′ terminal partial sequence of the mouse urotensin II like peptide precursor protein gene.
  • the composition of the reaction solution was such that the primer concentration was 0.4 M for both, dNTP 0.2 mM, ExTaq (Takara Shuzo) 1/50 vol, 10-fold concentrated ExTaq Buffer 1/10 volume, and the liquid volume was 201.
  • the PCR conditions were: incubation at 95 ° C for 1 minute, followed by 40 cycles of 95 ° C for 10 seconds, 47 ° C for 15 seconds, and 72 eC for 30 seconds, and incubation at 72 ° C for 7 minutes. .
  • the KR reaction solution was subjected to electrophoresis using 3.5% Nusieve GTG Agarose (Takara Shuzo), and DM was extracted from a band at around 170 bp detected by staining with ethidium umide (Mermaid Spin kit Hiyo 101). This was subcloned into the plasmid vector pcr2.1 using T0P0 TA cloning kit (Invitrogen) and introduced into E. coli TOP10. QIA prepS from the resulting transformant Plasmid DNA was purified using mini prep kit (Qiagen).
  • the reaction for nucleotide sequence determination was performed using dRhodamine Terminator Cycle Sequence kit (Perkin Elemer Co., Ltd.) and read using a fluorescent automatic sequencer. As a result, the nucleotide sequence represented by SEQ ID NO: 23 was obtained. This sequence corresponds to SEQ ID NO: 20 obtained above over about 50 bases, and has high homology to the base sequence of rat urotensin II like peptide precursor protein gene. It was considered to be a partial sequence at the 3 'end of the ide precursor protein gene.
  • Example 6 Obtaining full-length sequence of cD'A encoding mouse urolensin II like peptide precursor protein by PCR
  • the composition of the reaction solution was such that both the primer concentration was 0.4 iM, dNTP was 0.2 mM, ExTaq (Takara Shuzo) 1/50 volume, 10-fold concentrated ExTaq Buffer 1/10 volume, and the liquid volume was 201 1 1.
  • the PCR conditions were as follows: After incubating at 94 ° C for 1 minute, a cycle of 95 ° C for 10 seconds, 47 ° C for 15 seconds, 72 ° C for 30 seconds was repeated 40 times, and incubated at 72 ° C for 10 minutes. .
  • the PCR reaction solution was subjected to electrophoresis using 3.eve Nusieve GTG Agarose (Takara Shuzo), and DNA was extracted from a band around 430 bp detected by staining with ethidium promide by GeneClean Spinkii (Bio 101). This was subcloned into a plasmid vector pcr2.1 using T0P0 TA cloning k (Invitrogen) and introduced into E. coli TOP10. Plasmid DNA was purified from the resulting transformant using QlAprep8mini pre kil (Qiagen).
  • the reaction was performed using a reaction for nucleotide sequence determination (Rhodamine Terminator Cycle Sequence kit (No, Kin-Ile-Rima), and the sequence was read using a fluorescent automatic sequencer, and as a result, the sequence shown in SEQ ID NO: 5 was obtained.
  • This sequence contains the mouse urotensin II like peptide It contained the full-length sequence including the start and stop codons of the cDNA encoding the precursor protein.
  • Escherichia coli XL10-Gold / pcr2.1-mULP was obtained by transforming E. coli TOPI0 (Invitrogen) with the plasmid pcr2.mULP into which the cDNA encoding the mouse urotensin II like peptide precursor protein was inserted.
  • FIG. 2 shows the DNA sequence of the mouse urotensin II 1 ike peptide precursor and the corresponding amino acid sequence.
  • the mouse urotensin II like peptide which is a mature peptide predicted from this precursor protein sequence, was estimated to have 17 residues, similar to rat urotensin II like Sir tide-1. Also, since the N-terminal of the predicted mature peptide is dalmin, the N-terminal of the actual peptide was considered to be pyroglutamic acid.
  • the sequence of mouse urotensin II like peptide predicted by SEQ ID NO: 27 is shown.
  • the cleavage site of the mature peptide assumed here is atypical, so if the Arg residue at position 103 or 99 in the amino acid sequence of the precursor protein is used as the cleavage site, Furthermore, the sequence shown in SEQ ID NO: 33 consisting of 20 residues long at the N-terminus or the sequence shown in SEQ ID NO: 34 consisting of 24 residues can be considered as a mature peptide structure.
  • Example 7 Rat urotens in 11 like peptide-1 Glu-Arg-Lys-Gln-His-Gly- Thr-Ala-Pro-Glu-Cys-Phe-T ⁇ -Lys-Tyr-Cys-Ile-0H ( Production of SEQ ID NO: 14)
  • Boc-Ile-OCH Factory PAM resin (0.746m mole / g resin) 0.5m mole is put into the reaction soda of peptide synthesizer ABI 430A, and Boc-strategy ( ⁇ - ⁇ ) Boc-Cys (MeBzl), Boc-Tyr (Br-Z), Boc-Lys (Cl-Z), Boc-Tr (CH0), Boc Phe, Boc-Cys (MeBzl), Boc-Glu ( OcHex), Boc-Pro, Boc-Ala, Boc-Thr (Bzl), Boc-Gly, Boc-His (Bom), Boc-Gin, Boc-Ly
  • a commercially available Boc-lie- 0C3 ⁇ 4-PAM resin (0.746 mmole / g resin) 0.5 mmo 1 e portion is placed in a reaction solution of a peptide synthesizer ABI 430A, and Boc-strate (BMP-Strategy (KMP-HOBt) peptide synthesis method).
  • the precipitate was extracted with 50% acetic acid aqueous solution to remove the insoluble portion.
  • the extract was concentrated sufficiently and then applied to a Sephadex (trade name) G-25 column (2.0 X 80 cm) filled with 50% acetic acid aqueous solution. Then, develop with the same solvent, collect the main fractions, and attach them to a reversed-phase chromatography column (2.6 60 cm) packed with LiChroprep (trade name) RP-18. Water 2001)], and linear gradient elution was performed using 300 ml of 0.1% TFA water and 300 ml of 0.1% TFA-containing 40% acetonitrile. The main fractions were collected and concentrated.
  • Wakosi 1 5C18T 4.6 100mm Eluent A solution 0. TFA water, B solution-Acetonitrile containing 0.1% TFA, A / B: 95/5 to 45/55, linear gradient elution (25 minutes)
  • Rat urotensin II 1 ike peptide-2 Gln-His-Gly-Tr-Ala-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys-Ile- Production of OH (SEQ ID NO: 15)
  • Example 1 mouse urotensin II like peptide: pGlu-His-Lys-Gln-His-Gly-Ala-Ala-Pro-Glu-Cys-Phe-Trp-Lys-Tyr-Cys- Production of Ile (SEQ ID NO: 27) Boc-during production of rat urotensin II like peptide-1 described in Example 7
  • CHO / rSENR cells (same cells as CH0 / SENR cells described in 000/32627) were seeded at 5 ⁇ 10 4 cells / well on a 24-well plate, and cultured for 24 hours. The solution was added to be well. [3 ⁇ 4] Sixteen hours after the addition of arachidonic acid, the cells were washed with Hanks' solution (HBSS) containing 0.05% serum albumin (BSA), and the synthetic rat urotensin II! HBSS 5001 containing 0.05% BSA to which the ike peptide was added was added. After incubating at 37 ° C.
  • HBSS Hanks' solution
  • BSA serum albumin
  • rat urotensin II The release of arachidonic acid metabolites into the medium was confirmed by the like peptide in a peptide concentration-dependent manner (Fig. 3). EC 5 at this time. The value was 1.1 nM. A similar activity was also confirmed when the rat urotensin II like peplide-1 (SEQ ID NO: 14) synthesized in Example 7 was administered (EC 5, value: 1.7 nM).
  • mice urotensin II like peptide SEQ ID NO: 27
  • rat urotensin II 1 ike peptide-1 and -2 or mouse urotensin II like peptide were administered to human SENR expressing CH0 cells (CHO / hSENR cells described in TO 00/32627). Is done.
  • Example 14 Effect of Synthetic Rats urotensin II 1 ike Sir and urotensin II 1 ike peptide-2 on Blood Pressure of Rats Under Anesthesia
  • the effect of the rat urotensin II 1 ike peptide-2 (SEQ ID NO: 15) synthesized in Example 9 on blood pressure in anesthetized rats was measured by the following method.
  • Anesthetized 8-9-week-old male Wistar rat purchased from Nippon Chars River
  • Nembutal Injection Nembutal Injection (Dainippon Pharmaceutical, 50 mg / ml sodium pentobarbital, 50 mg / kg intraperitoneally) and connected to transducer
  • the catheter for blood pressure measurement (SP-55) was inserted into the left carotid artery, and the catheter for intravenous administration (SP-35) was inserted into the left femoral artery.
  • Synthetic rat urotensin II like peptide-2 was dissolved in physiological saline containing 0.05% BSA and administered to the left femoral vein so as to be 10 nmo1 / kg. Blood pressure was recorded continuously with a polygraph (NEC Saneisha). The blood pressure of the rats was reduced by the administration of the peptide, and the rat urotensin 11 1 ike Sir tide-2 showed a hypotensive effect. When the rat urotensin 111 ike peptide-2 was administered at a dose of 10 nmol / kg, the reduced blood pressure compared to the mean blood pressure before administration was about 35 mniHg.
  • Example 15 Synthetic rat urotensin II 1 ike peptid-1 against rat carotid artery Shrink action
  • rat urotensin II like peptide-1 (SEQ ID NO: 14) synthesized in Example 7 on rat thoracic aorta is measured by the following method.
  • the thoracic aorta is excised from this rat and a 5 mm wide ring specimen is prepared. Sample mixed gas (95% 0 2 -5 C0 2 ) was bubbled through 37.
  • rat urotensin II likepepiide-1 (SEQ ID NO: 14) synthesized in Example 7 for promoting the binding of S] -guanosine 5 '(7' thio) in osphate to the rat SENR-expressing CH0 cell membrane fraction was determined by the following method. Measured by First, the method for preparing the membrane fraction is described. 1 X 10 s number of CHO / rSENR cells 10 ml of Homojinetoba' fur (10 mM NaHC0 3, 5 mM EDTA, 0.
  • the measurement of GTP ⁇ S binding activity is as follows. Rat SE T R expressing CH0 cells membrane fraction
  • the membrane dilution buffer 50 mM Tris-HCl buffer (pH 7.4), 5 mM.MgCl 150 m.MNaCl, 1 a M GDP
  • was diluted with a protein concentration 30 it g Make a 1 / ml cell membrane fraction solution for the assay.
  • the mixture was filtered through a filter, further filters washing buffer (50 mM Tris-HCl buffer (H 7.4), 5 mM MgCl 2, 1 mM EDTA, 0.)% BSA) was washed twice with 1.5 ml, of the filter Radioactivity is measured with a liquid scintillation counter.
  • Rat urotensin II like peptide- 1 in a dose dependent manner, to binding to the membrane fraction [35 S] -guanosine 5'- increase ( ⁇ -thio) triphosphate amount. Similar activity is also confirmed when rat urotensin II like peptide-2 (SEQ ID NO: 15) or mouse urotensin II 1 ike peptide (SEQ ID NO: 27) is administered.
  • Rat urolensin II 1 ike lord tide-1 and -2 are also confirmed when mouse urotensin II like peptide is administered to the membrane fraction of human SENR-expressing CH0 cells prepared in the same manner as above. Is done.
  • Example 17 Preparation of Isotope-Labeled Rat urotensin II iike Peptide-1 An isotope-labeled rat urotensin II like peptide-1 for use in a binding inhibition experiment was prepared as follows.
  • rat urolensin II like peptide-1 (SEQ ID NO: 14) synthesized in Example 7 was dissolved in 25 1 of 0.4 M sodium acetate (pH 5.6), and 200 ng of lactoperoxidase (Wako Pure Chemical Industries, Ltd.) was added thereto. After addition of ⁇ mCi, 'mCi [' 25 1] -sodium iodide (Amersham Pharmacia Biotech) and 200 ng of hydrogen peroxide (10a1) were added. After allowing to stand at room temperature for 10 minutes, 200 ng of hydrogen peroxide (101) was further added and allowed to stand for 10 minutes.
  • CHO / rSENR cells are seeded at 5 ⁇ 10 4 cells / well on a 24-well plate, cultured for 48 hours, and then the cells are washed with 0.5 ml of MEM ⁇ medium containing 0.053 ⁇ 4 BSA (hereinafter referred to as MEM a containing 0.053 ⁇ 4 BSA).
  • MEM a containing 0.053 ⁇ 4 BSA
  • the medium is called a reaction buffer).
  • rat SENR binding activity of the test sample is expressed as a ratio of the value obtained by subtracting the radioactivity of the cell lysate to which the sample was added from the total binding to the specific binding.
  • a similar binding inhibition experiment can also be performed using [
  • labeled rat Bok urotensin II like peptide-1 and - can be implemented using two or mouse urotensin II like peptide and human SEN-R expression CH0 cells.
  • Example 19 Binding Inhibition Experiment Using Isotope-Labeled Rat urolensin II 1 ike peptide-1 and CHO / rSENR Cell Membrane Fraction
  • Example 1 7 [125 1] -labeled rat urotensin II] ike peptide- 1 and rack G
  • the method of a binding inhibition experiment using the membrane fraction of CHO cells expressing SENR is described below.
  • the membrane fraction prepared from the CHO / rSENR cells described in Example 16 was treated with a membrane dilution buffer (50 mM Tris-HCl buffer (H7.4), 5 mM MgC, 0.
  • the mixture was filtered through a filter, and the filter was further washed twice with 1.5 ml of membrane dilution buffer. Then, the radioactivity of the filter was measured by a gamma counter. Specific binding is the value of total binding minus non-specific binding.
  • the rat SENR binding activity of the test sample is shown as a ratio of the value obtained by subtracting the radioactivity of the cell membrane fraction to which the sample was added from the total binding to the specific binding. Binding inhibition by unlabeled rat urotensin II] ike peptide-1 in this experiment were observed, the IC 5. The value was 1.2 nM.
  • a similar binding inhibition experiments [ '25 1] labeled rat urotensin II l ike peptide-2 (SEQ ID NO: 15) or mouse urotensin II like peptide (SEQ ID NO: 27) can also be carried out with .
  • the method can be carried out using a [
  • the DNA encoding the polypeptide of the present invention or the polypeptide of the present invention can be obtained by (1) searching for the physiological action of the polypeptide of the present invention; (2) preparing a synthetic oligonucleotide probe or PCR primer; Ligand DNA Acquisition of DNA encoding precursor protein 4 Development of receptor-binding assay system using recombinant receptor protein expression system and screening of drug candidate compounds ⁇ Acquisition of antibodies and antisera 6 Development of diagnostic drugs using DNA, RNA, antibodies or antisera, 7Central nervous function regulators, circulatory function regulators, heart function regulators, kidney function regulators, urinary function regulators, sensory organ function regulators, etc. It can be used for the development of medicines, and gene therapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Vascular Medicine (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)

Abstract

Cette invention concerne un peptide de type urotensine II qui est originaire d'un rat ou d'une souris et qui est un ligand SENR, ou un sel de celui-ci. Cette invention concerne également un acide nucléique codant ce ligand SENR, ainsi qu'un procédé et un kit permettant de cribler un composé capable de modifier les propriétés de liaison du ligand SENR au SENR, etc. L'ADN codant le polypeptide susmentionné ou le polypeptide peuvent être utilisés dans les applications suivantes: (1) recherche des effets physiologiques du polypeptide susmentionné; (2)construction de sondes d'oligonucléotides synthétiques ou de déclencheur de RCP; (3) acquisition d'ADN codant un ligand SENR ou un précurseur de protéine; (4) développement d'un système d'analyse de liaison de récepteur et criblage de composés présentant un intérêt pour des médicaments à l'aide d'un système d'expression de protéine de récepteur recombinant; (5) acquisition d'un anticorps et d'un antisérum; (6) développement de diagnostics de l'ADN, de l'ARN, de l'anticorps ou de l'antisérum; développement de médicaments tels que des agents régulant les fonctions nerveuses centrales, des agents régulant les fonctions circulatoires et des agents régulants les fonctions cardiaques; (8) thérapie génique; etc.
PCT/JP2000/004484 1999-07-08 2000-07-06 Nouvelle substance physiologiquement active, procede de production et utilisation WO2001004298A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU58484/00A AU5848400A (en) 1999-07-08 2000-07-06 Novel physiologically active substance, process for producing the same and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP19409199 1999-07-08
JP11/194091 1999-07-08

Publications (1)

Publication Number Publication Date
WO2001004298A1 true WO2001004298A1 (fr) 2001-01-18

Family

ID=16318811

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/004484 WO2001004298A1 (fr) 1999-07-08 2000-07-06 Nouvelle substance physiologiquement active, procede de production et utilisation

Country Status (2)

Country Link
AU (1) AU5848400A (fr)
WO (1) WO2001004298A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066143A1 (fr) * 2000-03-07 2001-09-13 Takeda Chemical Industries, Ltd. Agents vasoactifs
WO2002014513A1 (fr) * 2000-08-10 2002-02-21 Takeda Chemical Industries, Ltd. Utilisation de polypeptide
WO2004037863A1 (fr) * 2002-10-25 2004-05-06 Takeda Pharmaceutical Company Limited Anticorps et utilisation dudit anticorps

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000032627A1 (fr) * 1998-11-30 2000-06-08 Takeda Chemical Industries, Ltd. Nouvelle substance physiologiquement active et ses procedes d'obtention et d'utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000032627A1 (fr) * 1998-11-30 2000-06-08 Takeda Chemical Industries, Ltd. Nouvelle substance physiologiquement active et ses procedes d'obtention et d'utilisation

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ITOH H. ET AL.: "Functional receptors for fish neuropeptide urotensin II in major rat arteries", EUR. J. PHARMACOL., vol. 149, no. 1-2, 1988, pages 61 - 66, XP002933948 *
LIU QINGYUN ET AL.: "Identification of urotensin II as the endogenous ligand for the orphan G-protein-coupled-receptor GPR14", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 266, no. 1, December 1999 (1999-12-01), pages 174 - 178, XP002933800 *
MASAKI MORI ET AL.: "Urotensin II is the endogenous ligand of a G-protein-coupled orphan receptor, SENR(GPR14)", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 265, no. 1, November 1999 (1999-11-01), pages 123 - 129, XP002933798 *
ROBERT S. AMES ET AL.: "Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14", NATURE, vol. 401, September 1999 (1999-09-01), pages 282 - 286, XP002933799 *
YOLAINE COULOUARN ET AL.: "Cloning of the cDNA encoding the urotensin II precursor in frog and human reveals intense expression of the urotensin II gene in motoneurons of the spinal cord", PROC. NATL. ACAD. SCI. USA, vol. 95, December 1998 (1998-12-01), pages 15803 - 15808, XP002933947 *
YOLAINE COULOUARN ET AL.: "Cloning, sequence analysis and tissue distribution of the mouse and rat urotensin II precursors", FEBS LETTERS, vol. 457, 20 August 1999 (1999-08-20), pages 28 - 32, XP002933946 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066143A1 (fr) * 2000-03-07 2001-09-13 Takeda Chemical Industries, Ltd. Agents vasoactifs
WO2002014513A1 (fr) * 2000-08-10 2002-02-21 Takeda Chemical Industries, Ltd. Utilisation de polypeptide
WO2004037863A1 (fr) * 2002-10-25 2004-05-06 Takeda Pharmaceutical Company Limited Anticorps et utilisation dudit anticorps

Also Published As

Publication number Publication date
AU5848400A (en) 2001-01-30

Similar Documents

Publication Publication Date Title
US7799533B2 (en) Polypeptides, their production and use
US7671174B2 (en) Ligand to GPR8
AU6230699A (en) Novel g protein-coupled receptor proteins, dnas thereof and ligands to the same
CA2387711A1 (fr) Proteine recepteur couplee a une proteine g et adn correspondant
EP0711831A2 (fr) Récepteur couplé à une protéine G de lapin
CA2406855A1 (fr) Nouveaux polypeptides appartenant a la famille insuline/igf/relaxine et adn correspondants
WO2000032627A1 (fr) Nouvelle substance physiologiquement active et ses procedes d'obtention et d'utilisation
WO2001004298A1 (fr) Nouvelle substance physiologiquement active, procede de production et utilisation
US20030148943A1 (en) Novel tachykinin-like polypeptides and use thereof
EP1394543B1 (fr) Methode de balayage
EP1559721B1 (fr) Ligands fprl1 et utilisations de ceux-ci
JP4429410B2 (ja) 新規生理活性物質、その製造法および用途
JPH08143597A (ja) ヒト・ニューロテンシンレセプター蛋白質、その製造法および用途
JP2001069996A (ja) 新規生理活性物質、その製造法および用途
JP4284034B2 (ja) スクリーニング方法
JP4959880B2 (ja) Ｇｐｒ８に対するリガンドおよびそのｄｎａ
JPH111497A (ja) 新規膜タンパク質およびそのｄｎａ
WO2003072780A1 (fr) Nouvelles protéines, leurs adn et leur utilisation
JP2001309792A (ja) スクリーニング方法
JP2001128688A (ja) ポリペプチド、その製造法および用途
EP1227105A1 (fr) Polypeptides ligands du ghsr et leurs adn
JP2001149072A (ja) 新規ｇ蛋白質共役型レセプター蛋白質、そのｄｎａおよびそのリガンド
CA2285628A1 (fr) Polypeptides ligands pour le recepteur couple a la proteine g, provenant de l'hypohyse humaine
JP2002233386A (ja) Ｒｆｒｐ含有プロラクチン分泌調節剤
JP2003174889A (ja) 新規ｒｆｒｐ−３およびそのｄｎａ

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AU AZ BA BB BG BR BY BZ CA CN CR CU CZ DM DZ EE GD GE HR HU ID IL IN IS JP KG KR KZ LC LK LR LT LV MA MD MG MK MN MX MZ NO NZ PL RO RU SG SI SK TJ TM TR TT UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP