WO2000032789A1 - Fruit flavour related genes and use thereof - Google Patents
Fruit flavour related genes and use thereof Download PDFInfo
- Publication number
- WO2000032789A1 WO2000032789A1 PCT/NL1999/000737 NL9900737W WO0032789A1 WO 2000032789 A1 WO2000032789 A1 WO 2000032789A1 NL 9900737 W NL9900737 W NL 9900737W WO 0032789 A1 WO0032789 A1 WO 0032789A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- polypeptide
- fragment
- amino acid
- acid sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
Definitions
- the invention disclosed herein relates to strawberry ( fragaria ananassa) and lemon ( ci trus limon) fruit derived genes and enzymes specifically involved in the formation of aliphatic and/ or aromatic esters and other aroma and flavour compounds in fruits. More specifically it relates to a process for improving natural volatile fruit flavours by the control of one or more than one gene implicated in that process.
- strawberry aroma and flavour is quite complex [Zabe- takis and Holden, (1997); J. Sci. Food. Agric 74: 421-434]. Over 300 compounds have been identified which may contribute to flavour/aroma. Qualitatively, the major components of strawberry flavour and aroma may be grouped into several chemical classes including acids, aldehydes, ketones, alcohols, esters, and lactones. Other groups include sulphur compounds, acetals, furans, phenols and even traces of epoxides, and hydrocarbons. Compounds produced by these groups, whilst often present at low levels, may have a significant impact on the overall flavour of strawberry.
- esters are proposed to be qualitatively and quantitatively the most important class of volatiles produced and are a key component of strawberry flavour. Seven volatile esters, ethyl hexanoate, methyl hexanoate, ethyl butanoate, methyl butanoate, hexyl acetate, ethyl propionate and 2 -hexenyl -acetate were reported to contribute largely to the aroma associated with the fruit. However, more then a 100 types of esters have been reported during the years to be identified in strawberry volatile analysis [Zabetakis and Holden, (1997); J. Sci. Food.
- Agric 74: 421- 434] In lemon, the acetate esters derived from cyclic terpene alcohols are used frequently as flavour, fragrance, scent and aroma components.
- the lower fatty acid esters of acyclic terpene alcohols (geraniol, linalool, and citronel- lol) are the acetates (linalyl acetate, geranyl acetate) which are the main flavour components of lemon peel oils. These are used for obtaining citrus notes [Bauer, K and Garbe, D, (1985) . Common fragrance and flavour materials. Preparation, properties and uses. VCH Publishers, Florida, USA] . Formates, propionates, butyrates occur less frequently.
- lemon is a rich source for the ester methyl anthranillate, which is a methyl ester of o-aminobenzoic acid.
- This compound is known to be a major constituent of ci trus limon fruit and flowers and can also be found in the leaves.
- the amino acids valine, leucine and isoleucine have been proposed to serve as flavour precursors in banana fruit, and are metabolised to branched chain alcohols, 2-propanol, isoamyl alcohol, and 2-methylbutanol , respectively [Drawert and Berger,
- fatty acid related enzymes may have a role in the production of flavour volatiles.
- Thiolase is the last enzyme in the ⁇ -oxidation of fatty acids. It catalyses the thiolytic cleavage involving a molecule of CoA.
- the products of this reaction are acetyl -CoA and acyl -CoA derivatives containing two carbon atoms less than the original acyl -CoA molecule that underwent oxidation.
- the acyl -CoA formed in the cleavage reaction may be utilised at the final stage of the biosynthetic pathway for ester formation in fruit. Therefore the profile of fatty acid and amino acid precursors found in each fruit, along with the specificity of the enzymes in the biosynthetic pathway/process leading to ester formation could have a key role in determining the types of esters formed.
- a proposed biosynthetic pathway for volatile ester formation in fruits is illustrated in Figure 1.
- the transamination reaction is catalysed by aminotransferases .
- Aminotransferases or transaminases are enzymes promoting the first step in the catabolism of L-amino acids by removing the ⁇ -amino groups.
- the ⁇ -amino group is transferred to the a-carbon atom of ⁇ -ketoglutarate , leaving behind the ⁇ -keto acid analogue of the amino acid.
- Aminotransferases have been studied in various micro-organisms and some of them have been purified [Gelfand et al , (1997); J. Bacteriol . 130:429- 440, Lee et al . , (1985); J. Gen. Microbiol . 131: 459-467]. No strawberry fruit specific aminotransferase to date has been cloned or characterised.
- Ketoacids produced by transamination can be enzymatically degraded to the corresponding aldehydes or carboxylic acids.
- the enzyme which can catalyse this reaction is pyruvate decarboxylase.
- An EST encoding part of pyruvate decarboxylase, the first to be characterised from a strawberry fruit has been mentioned in patent application WO 97/27295.
- the pyruvate decarboxylase enzyme provides precursors for the biosynthesis of volatile flavour compounds.
- Alcohol dehydrogenase enzymes have been implicated in the interconversion of the aldehyde and alcohol forms of flavour volatiles.
- the mechanism of ester formation has been shown to be a coenzyme A dependent reaction. Esterification is a result of transacylation from acyl-coenzyme A to an alcohol.
- the enzyme is therefore termed as alcohol acyl transferase (AAT) and plays a major role in the biosynthesis of volatile esters.
- the AAT from the fungi Neurospora sp . which was purified to homogeneity acts on various acyl Coenzyme A containing more than a four carbon linear chain but not on acetyl coenzyme A as described for the yeast enzyme [Yamauchi et al . , (1989); Agric. Biol. Chem. 53(6) 1551-1556] .
- Cladosporium cladosporioi - des No. 9 AAT was partially purified and was described to form acetate esters like the yeast enzyme [Yamakawa et al . , (1978); Agric.
- esters from aldehydes that were incubated with whole strawberry fruit has been reported [Yamashita, et al . ,
- the enzyme has high affinity to the aromatic alcohols such as benzyl alcohol and cinnamyl alcohol [Duda- reva et al . , (1998); The Plant Journal 14(3) 297-304] .
- Genes coding for flower aromatic acyl transferases, that acylate plant pigments, causing changes in colour tone have been the subject of a recent patent application [EP 0810287] .
- an aromatic amino transferase enzyme has been purified from lactic acid bacteria and was shown to initiate the conversion of amino acids to cheese flavour compounds [Yvon et al . , (1997); Applied and Environmental Microbiology 414- 419] .
- flavour compounds have been isolated and characterized.
- genes and their peptides at the route of this invention are involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit and can therefore provide a novel method for the in-vivo and in - vi tro biotechnology production of bio-flavours, natural flavour chemicals by recombinant means.
- the object of the present invention is to disclose the genes/peptides involved in the process of volatile ester production, particularly aliphatic esters although not exclusively so, hence fruit flavour and aroma. This is the first time to our knowledge, that the genes/peptides sequences from an entire pathway to the production of volatile esters in fruit, in particularly strawberry, have been disclosed.
- the nucleotide and polypeptide sequences descri- bed in this application can serve as a tool for a vast number of applications related to ester formation and the biotechnological engineering of natural and artificial fruit flavours for the food industry.
- the invention is based on the identification of genes which encode proteins central to the pathway leading to volatile ester formation in fruit. DNA sequences which encode these proteins have been cloned and characterised.
- the nucleic acid/peptide sequences may be used in expression systems, for industrial application and /or to modify plants with the goal to produce natural and/or synthetic flavours.
- Nucleic acid' sequence as used herein refers to an oligonucieotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represents the sense or antisense strand.
- amino acid sequence' as used herein refers to peptide or protein sequence .
- agonist' refers to a molecule which, when bound to a polypeptide causes a change in the polypeptide which modifies the activity of the polypeptide. Agonist may include proteins, nucleic acids, carbohydrates, or any other molecule which binds to the polypeptide.
- Antagonist' or inhibitor' refer to a molecule which when bound to a polypeptide, blocks or modulates the biological or immunological activity of the polypeptide.
- Antagonists or inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecules which bind to the polypeptide.
- Stringency typically occurs in the range from about Tm-5°C (5°C below the Tm of the probe) to about 20°C to 25°C below Tm.
- a stringent hybridisation can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences.
- hybridisation shall include "any process' by which a strand of nucleic acid joins with a complementary strand through base pairing' (Coombs J, (1994) Directory of biotechnology, Stockton press, New York NY) .
- a “deletion' is defined as a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent .
- an “insertion' or “addition' is that change in nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues, respectively, as compared to the naturally occurring polypeptide (s) .
- a “substitution' results from the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively.
- substantially purified refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and that are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
- substantially homologous' means that a particular subject sequence, for example a mutant sequence, varies from the reference sequence by one or more substitutions, deletions, or additions, the net effect of which does not result in an adverse functional dissimilarity between the reference and the subject sequence.
- a variant' of a polypeptide as outlined in the first and second aspects of this invention is defined as an amino acid sequence that is different by one or more amino acid "substitutions'.
- a variant may have "conservative' changes, wherein a substituted amino acid has similar structural or chemical properties eg replacement of leucine with isoleucine. More rarely a variant may have "non-conservative' changes, eg replacement of a glycine with a tryptophan. Similar minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted, without abolishing biological or immunological activity may be found using computer programmes well known in the art, for example, DNAStar software.
- biologically active refers to a polypeptide as outlined in the first and second aspects of the invention, having structural, regulatory, or biochemical function of their naturally occurring counterparts.
- immunologically active' defines the capability of the natural, recombinant or synthetic polypeptide, as outlined in the first and second aspects of the invention, or any oligopeptide thereof, to induce a specific immune response in an appropriate animal or cells and to bind with specific antibodies .
- Natural products' are those products that are obtained directly from plants and sometimes from animal sources by physical procedures.
- Natural identical compounds' are produced synthetically but are chemically identical to their “natural counterparts'.
- Artificial flavour substances are compounds that have not been identified in plant or animal products for human consumption.
- Natural-identical ' aroma substances are with few exceptions the only synthetic compounds used in flavours in addition to “natural products' .
- host cell' refers to a cell in which an alien process is executed by bio-interaction, irrespective of the cell belongs to a unicellular, multi- cellular, a differentiated organism or to an artificial cell, cell culture or protoplast.
- the definition "host cell' in the context of this invention is to encompass the definition "plant cell' .
- Plant cell' by definition is meant by any self- propagating cell bounded by a semi permeable membrane and containing one or more plastids. Such a cell requires a cell wall if further propagation is required.
- Plant cell' includes without limitation, seeds, suspension cultures, embryos, meristematic regions, callous tissues, protoplasts, leaves, roots, shoots, gametophytes, sporophy- tes, pollen and microspores.
- transformed cell' or transgenic cell' is meant a cell (or ancestor of said cell) into which by means of recombinant DNA techniques, DNA encoding the target polypeptide can be introduced.
- micro-organisms refers to microscopic organisms, such as Archaea, Bacteria, Cyanobacteria, Microalgae, Fungi, Yeast, Viruses, Protozoa, Rotifers, Nematodes, Micro-Crustaceans, Micro-Molluscs, Micro-Shellfish, Micro-insects etc.
- plant (s) ' refers to eukaryotic, autotrophic organisms . They are characterised by direct usage of solar energy for their primary metabolism, their permanent cell wall and in case of multicellular individuals their open unlimited growth. In case of heterotrophic plants, the organisms are in an evolutionary context essen- tially derived from autotrophic plants in their structure and metabolism.
- Angiospermae' or flowering plants are seed plants characterised by flowers as specialised organs of plant reproduction and by carpels covering the ovaries.
- Gymno- spermae are seed plants characterised by strobili as specialised organs for plant repoduction and by naked sporophylls bearing the male or female reproductive organs.
- “Ornamental' plants are plants that are primarily in cultivation for their habitus, special shape, (flower, foliage or otherwise) colour or other characteristics which contribute to human well being indoor as cut flowers or pot plants or outdoors in the man made landscape.
- “Vegetables' are plants that are purposely bred or selected for human consumption of foliage, tubers, stems, fruits, flowers of parts of them and that need an intensive cultivation regime.
- “Arable crops' are purposely bred or selected for human objectivity's (ranging from direct or indirect consumption, feed or industrial applications such as fibres) .
- process' is the development of, a method (ology) concerning, the progress of a series of activities in a certain context.
- Biological' process is a process based on metabolic activity in organisms, or essentially derived from that by biochemical, biophysical, physiological, ecological or genetic means.
- Industrial' process is an economically feasible process with high added value, aiming at bulk production.
- promoter' is intended as a nucleotide sequence sufficient to direct transcription. Also included are those promoter elements which are sufficient to render tissue-specific gene expression; such elements may be located in the 5' or 3 ' regions of the native gene.
- operably linked is meant that a gene and a regulatory sequence (s) are connected in such a way as to permit gene expression when the appropriate molecules (for example, transcriptional activator proteins) are bound to the regulatory sequence (s) .
- the definition "fruit' (botanically) is the ripened ovary of a plant and its contents.
- the definition "fruit' (agronomically linguistically) is the ripened ovary and its contents together with any structure with which they are combined, as in case of strawberry or apple, the receptacle.
- the definition "climacteric' is pointing at the phase of increased respiration found at fruit ripening and at senescence.
- the definition “non-climacteric' is pointing at no such phase being present .
- antisense' RNA is an RNA sequence which is complementary to a sequence of bases in the corresponding mRNA: complementary in the sense that each base (or majority of bases) in the antisense strand (read in the 5' to 3' sense) is capable of pairing with the corresponding base (G with C, A with U) , in the mRNA sequence read in the 5' to 3 ' sense.
- ense' RNA is an RNA sequence which is substantially homologous to at least part of the corresponding mRNA sequence .
- FIG. 1 Volatile ester emission during strawberry fruit development.
- the five main volatile esters detected are marked with numbers: 1 -methyl hexanoate; 2-hexyl acetate; 3-hexyl butanoate; 4 -octyl acetate; 5-octyl butyrate.
- a GCMS chromatogram of a mature strawberry fruit of the cultivar Elsanta The analysis was done using the headspace method. Esters are marked with dots.
- FIG. 3 The expression pattern of strawberry alcohol acyl transferase cDNA (SLE27, SEQ ID N0:1A) in various tissues of the cultivar Elsanta by Northern blot analysis.
- the Northern blot was hybridised with a full length cDNA fragment of SEQID:1A (SLE27) .
- FIG. 4 The expression pattern of a lemon alcohol acyl transferase (CLF26, SEQ ID NO:2A) in various tissues of the lemon cultivar Mayer by Northern blot analysis.
- the Northern blot was hybridised with a full length cDNA fragment of SEQ ID 2A (CLF26) .
- FIG. 5 Expression analysis in various tissues of the strawberry cultivar Elsanta by Northern blots analysis.
- the Northern blots where hybridised with full length cDNA fragments corresponding to (a) a thiolase SEQ ID 4A (SLG150) (b) a pyruvate decarboxylase SEQ ID 5A (SLH51) and (c) an alcohol dehydrogenase SEQ ID 6A (SLB39) .
- Figure 6. Strawberry genomic Southern analysis. 10 lg DNA was digested with restriction enzymes Hindlll, EcoRI , Xbal and Xhol, separated on an agarose gel and blotted onto a nylon filter. The DNA was hybridised with a full length 32 P- labelled strawberry alcohol acyl transferase cDNA (SLE27) probe, corresponding to SEQ ID 1A and autoradiographed.
- SLE27 strawberry alcohol acyl transferase cDNA
- Figure 7 A scheme of the pRSET B (Invitrogen) vector used for the expression of various alcohol acyl transferases in E . coli .
- SAAT SEQ ID NO: IB protein using GC-MS.
- A Butanol and butyl acetate standards.
- B SAAT protein + butanol + acetyl-CoA.
- C As in B, protein absent.
- FIG. 9 Western blot loaded with protein corresponding to four different treatments carried out on the pellet, supernatant and elute from a Ni-NTA column after expression of strawberry alcohol acyl transferase (SLE 27, SEQ ID N0:1A) in E. coli .
- SLE 27, SEQ ID N0:1A strawberry alcohol acyl transferase
- FIG. 9 Western blot loaded with protein corresponding to four different treatments carried out on the pellet, supernatant and elute from a Ni-NTA column after expression of strawberry alcohol acyl transferase (SLE 27, SEQ ID N0:1A) in E. coli .
- SLE 27 strawberry alcohol acyl transferase
- FIG. 10 Gene expression profiles of strawberry alcohol acyl transferase (SLE 27, SEQ ID NO: 1A) ) , alcohol dehydrogenase (SLF138, SEQ ID NO: 11A) , pyruvate decarboxylase (SLH 51, SEQ ID NO: 5A) , alcohol dehydrogenase (SLG16, SEQ ID NO:12A) and amino transferase (SLF96, SEQ ID NO: 3A) . Ex- pression ratios were monitered during fruit development and ripening in the red stage vs green fruit and red fruit v.s turning fruit .
- FIG. 11 SLE27 (SAAT), SEQ ID NO: IB (SAAT) - induced [ 14 C] - acetyl-CoA incorporation in esters.
- A Flame ionization detector (FID) -signal of unlabelled standards of 1, hexyla- cetate; 2, 1-hexanol; 3, octylacetate and 4, 1-octanol.
- B and C Radio-GC chromatograms of labelled products formed by the SAAT protein from 0.1 mM [ 14 C] -acetyl-CoA and alcohols with (B) 2 mM 1-octanol or (C) 2 mM 1-hexanol.
- the invention provides an insolated DNA sequence encoding
- the DNA sequence encodes a polypeptide having at least 50% homology, more preferably at least 70% homology, with any of the amino acid sequences SEQ ID NO: IB or SEQ ID NO: 2B, or a fragment thereof.
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- the DNA sequence has a nucleic acid sequence
- the invention provides a purified and isolated polypeptide,
- polypeptide (b) having at least 30% homology with the amino acid sequence SEQ ID NO: IB or at least 40% homology with the amino acid sequence SEQ ID NO: 2B, or (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol acyl transferase activity and is involved in the biosynthetic pathway for ali- phatic and/or aromatic ester production in fruit .
- the polypeptide has at least 50% homology, more preferably at least 70% homology, with any of the amino acid sequences SEQ ID NO: IB or SEQ ID NO: 2B, or a fragment thereof .
- nucleotide sequences may be advantageous to produce nucleotide sequences according to the first aspect of the invention as defined above or derivatives thereof possessing a substanti- ally different codon usage. It is known by those skilled in the art that as a result of degeneracy of the genetic code, a multitude of gene sequences, some bearing minimal homology to the nucleotide sequences of any known and any naturally occurring genes may be produced. The invention contemplates each and every possible variation of the nucleotide sequences that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring gene sequences, and all such variations are to be considered as being specifically disclosed.
- nucleotide sequences of the invention may be used in molecular biology techniques that have not been developed, providing the new techniques rely on properties of nucleotide sequences that are currently known, including but are not limited to such properties such as the triplet genetic code and specific base pair interactions.
- Altered nucleic acid sequences of this invention include deletions, insertions, substitutions of different nucleotides resulting in the polynucleotides that encode the same or are functionally equivalent. Deliberate amino acid substitution may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, and/or the amphipathetic nature of the residues as long as the biolo- gical activity of the polypeptide is retained. Included in the scope of the present invention are alleles of the polypeptides according to the second aspect of the invention as defined above. As used herein, an "allele' or "allelic sequence' is an alternative form of the polypeptides described above.
- Alleles result from a mutation, eg a change in the nucleic acid sequence, and generally produce altered mRNA or polypeptide whose structure or function may or may not be altered. Any given polypeptide may have none, or more allelic forms. Common allelic changes that give rise to alleles are generally ascribed to natural deletions, additions or substitutions of amino acids . Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
- polynucleotide sequences of the present invention can be used as probes for the isolation of similar sequences from the strawberry genome and lemon genome.
- a cDNA of the gene sequences of the invention it would be possible by those skilled in the art to obtain comparable gene sequences from various tissues, particularly fruit tissues, from climacteric and non climacteric plants.
- One aspect of the invention is to provide for hybridisation or PCR probes which are capable of detecting polynucleotide sequences, including genomic sequence (s), encoding the polypeptides of the invention, or closely related molecules.
- the specificity of the probe whether it is made from a highly specific region, eg 10 unique nucleotides in the 5' regulatory region, or a less specific region, e.g. in the 3' region, and the stringency of the hybridisation or amplification (maximal, high, intermediate, low) will determine whether the probe identifies only naturally occurring sequence (s) encoding the polypeptide, allele's or related sequences. Additional alcohol acyltransferase sequences from melon, strawberry, vesca, banana, apple, mango and lemon were obtained using primers. These additional sequences are covered by the first aspect of invention. The nucleic acid sequences are shown in SEQ ID NO: 16A to 23A, respectively.
- amino acid sequences are shown in SEQ ID NO:16B to 23B, respectively. Apart from the applications as disclosed herein said sequences can be used in combination for the synthesis of a broader range of esters via recombinant means or via transgenic approaches and/or for the synthesis of new flavours .
- Probes may also be used for the detection of related sequences and preferably contain at least 50% of any of the nucleotides from any one of the gene encoding sequences according to the present invention.
- the hybridisation probes may be derived from the nucleotide sequence, or from genomic sequence including promoter, enhancer element and introns .
- Hybridisation probes may be labelled by a variety of reporter groups, including radionuclides such as 32 P or 35 S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
- RNA polymerase as T7 or SP6 RNA polymerase and the appropriately radioactively labeled nucleotides.
- the invention provides a recombinant expression vector comprising a coding sequence which is operably linked to a promoter sequence capable of directing expression of said coding sequence in a host cell for said vector, and a transcription termination sequence, in which the coding sequence is a DNA sequence according to the invention.
- the invention provides a replicative cloning vector comprising an isolated DNA sequence of the invention and a replicon operative in a host cell for said vector.
- initiation signals may also be required for efficient translation of the polypeptides of the invention. These signals include the ATG initiation codon and adjacent sequences. In cases where the polypeptides, their initiation codons and upstream sequences are inserted into the appropriate expression vector, no additional translatio- nal control systems including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in the correct reading frame to ensure transcription of the entire insert. Exogenous transcriptional elements and initation codons can be of various origins, both natural and synthetic.
- Enhancers appropriate to the cell system in use (Scharf D et al (1994) Results Prob Cell Differ 20: 125- 62; Bittner et al . (1987) Methods in Enzymol 153: 516-544) .
- a host strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion.
- Such modifications of the polypeptide include, but are not limited to, acylation, carboxylation, glycosylation, phos- phorylation and lipidation.
- Post translation processing which cleaves a "prepro' form of the protein may also be important for correct insertion, folding and/or function.
- Different host cells which have the correct cellular machi- nery and characteristic mechanisms for such post-translatio- nal activities maybe chosen to ensure correct modification and processing of the introduced, foreign protein.
- the nucleotide sequences of the present invention can be engineered in order to alter the coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expres- sion of the gene product.
- mutations may be introduced using techniques which are well known in the state of the art, e.g. site directed mutagenesis to insert new restriction sites, to alter glycosylation patterns, to change codon usage, to produce splice variants etc. Codons may be selected to increase the rate at which expression of the peptide occurs in a particular procaroytic or eukaroytic expression host in accordance with the frequency with which particular codons are utilised by the host (Murray E et al .
- RNA transcripts having more desirable properties such as a greater half life, than transcripts produced from naturally occurring sequences.
- the various fragments comprising the regulatory regions and open reading frame may be subjected to different processing conditions, such as ligation, restriction enzyme digestion, resection, in-vi tro mutagenesis, primer repair, use of linkers and adapters and the like.
- nucleotide transitions, trans- versions, insertions, deletions and the like may be performed on the DNA which is employed in the regulatory regions and/or open reading frame.
- the expression cassette may be wholly or partially derived from natural sources endogenous to the host cell.
- the various DNA constructs (DNA sequences, vectors, plasmids, expression cassettes) of the invention are isolated and/or purified, or synthesised and thus are not naturally occurring.
- the invention further contemplates the use of yet undescribed biological and non biological based expression systems and novel host(s) systems that can be can be utilised to contain and express the gene coding sequence (s) of the invention.
- "Antisense' or "partial sense' or other techniques may also be used to reduce the expression of genes in the pathway leading to the production of flavour volatile esters. Full length "sense' techniques may be designed to increase or reduce the expression of genes in the pathway leading to the production of flavour volatiles.
- the "anti- sense' or "partial sense' molecules may be designed to block translation of mRNA by preventing the transcript from binding to the ribosomes .
- Ribozymes are enzymatic RNA molecules capable of catalysing the specific cleavage of RNA.
- ribozyme action involves sequence- specific hybridisation of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyse endonucleolytic cleavage of gene sequences of the invention.
- Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC.
- RNA sequences of between 15 and 20 ribonu- cleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucieotide inoperable.
- the suitability of candidate targets may also be evaluated by testing accessibility to hybridisation with complementary oligonucleotides using ribonuclease protection assays .
- Antisense' molecules and ribozymes of the inven- tion may be prepared by any method known in the art for the synthesis of RNA molecules . These include techniques for chemically synthesizing oligonucleotides such as solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in -vi tro and in -vivo trans- cription of DNA sequences of the invention. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 and SP6. Alternatively, antisense cDNA constructs that synthesise antisense RNA constitutively or inducibly can be introduced into cell lines, cells or tissues.
- RNA molecules may be modified to increase intracellular stability and half -life. Possible modifications include, but are not limited to, the addition of flanking sequences, at the 5' and/or 3' end of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule .
- vector/host expression systems can be utilised to contain and express the gene coding sequences of the invention.
- microorganisms such as bacteria (e.g. E coli , B subtilis, Streptomyces, Pseudomonads) transformed with recombinant bacteri- ophage, plasmid or cosmid DNA expression systems, yeast (e.g S. cerevisiae, Kluyveromyces lactis , Pichia pastoris, Hansenula polymorpha , Schizosacch .
- cauliflower mosaic virus CaMV
- tobacco mosaic virus TMV
- bacterial expression vectors e.g Ti or Pbr322 plasmid
- mammalian cell systems Choinese hamster ovary (CHO) , baby hamster kidney (BHK) , Hybridoma' s, including cell lines of mouse, monkey, human and the like.
- the expression of a sequence (s) of the invention may be driven by a number of previously defined promoters, including inducible and developmentally regulated promoters.
- the invention further contemplates the use of the individual promoters of the polynucleotide sequence (s) of the present invention for this purpose.
- an alcohol acyl transferase promoter (s) pertaining to SEQ ID IA and SEQ ID 2A or any promoters particularly responsive to ripening events may be used to drive the tissue specific expression of the target genes.
- viral promoters such as the 35S and the 19S promoters of CaMV (Brisson et al .
- Promoters or enhancers derived from the genomes of plant cells tissue specific promoters i.e fruit specific promoters, Fbp7 (Columbo et al . 1997; Plant Cell 9; 703-715), 2A11 promoter (Pear et al . , 1989, Plant Molecular Biology, 13:639-651), small subunit of Rubisco (Corruzzi et al . , 1984; EMBO J 3:16; Broglie et al .
- Suitable terminator sequences include that of the agrobacterium tumefaciens nopaline synthase gene (Nos 3' end), the tobacco ribulose bisphosphate carboxylase small subunit termination region; and other 3' regions known to those skilled in the art. These constructs can be introduced into plant cells by direct DNA transformation, or pathogen mediated transfec- tion.
- the invention provides a method for regulating aliphatic and/or aromatic ester formation in fruit, comprising inserting into the genome of a fruit-producing plant one or more copies of one or more DNA sequences of the invention.
- genes according to the present invention involved in the biosynthetic pathway leading to volatile ester formation, hence flavour may be either increased or reduced depending on the characteristics desired for the modified plant part.
- the gene sequence may be in the same "sense' or "antisense' orientation as the endogenous target gene.
- Methods well known to those skilled in the art can be used to construct recombinant vectors which will express "sense' or “antisense' polynucleotides encoding the gene sequences of the present invention.
- Such technology is now well known in the art.
- the target "plant cell' may be part of a whole plant or may be an isolated cell or part of a tissue which may be regenerated into a whole plant.
- the target plant may be selected from any mono- cotyledonous or dicotyledonous plant species.
- Suitable plants include any fruit bearing plant such as strawberry, citrus (lemon), banana, apple, pear, melon, sweet pepper, peach or mango.
- Other suitable plant hosts include vegeta- ble, ornamental (to include sunflower) and arable crops (to include soybean, sunflower, corn, peanut, maize, wheat, cotton, safflower, and rapeseed) .
- the gene sequences, cDNA, genomic DNA, or synthetic polynucleotide, used in the transformation vector construct may be derived from the same plant species, or may be derived from other plant species (as there will be sufficient homology to allow modification of related enzyme gene function) .
- the procedure or method for preparing a transfor- mant can be performed according to the conventional techni- que used in the fields of molecular biology, biotechnology and genetic engineering.
- the invention provides a plant and propagating material thereof which contains in its genome a DNA sequence of the invention or a vector as defined above.
- the invention provides a genetically modified strawberry or lemon plant and propagating material derived therefrom which has a genome comprising an expression vector for over-expression or down- regulation of an endogenous strawberry or lemon plant gene counterpart of any of the DNA sequences of the invention.
- a gene coding sequence (s) of the invention may be ligated into the adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non essential El or E3 region of the viral genome will result in a variable virus capable of expressing the gene sequence (s) in infected host cells (Logan and Shark (1984) Proc Natl Acad . Sci 81:3655- 59)
- transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.
- RSV Rous sarcoma virus
- insect cells such as silkworm cells or larvae themselves may be used as a host.
- Autographa calif orni ca nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae .
- the gene coding sequence (s) of the invention may be cloned into the nones- sential region of the virus, such as the polyhedrin gene, and placed under control of a polyhedrin promoter. Successful insertion of the sequence (s) will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein coat .
- the recombinant viruses are then used to infect S frugiperda cells or Trichoplusia larvae in which the gene sequence or sequences are expressed (Smith et al .
- control elements or regulatory sequences of the described systems vary in their strength and specificities and are those nontranslated regions of the vector, enhancers, promoters and 3' untranslated regions, which interact with host cellular proteins to carry out transcription and translation.
- any number of suitable transcription and translation elements including constitutive and inducible promoters, may be used.
- inducible promoters such as the hybrid lacZ promoter of the Bluescript ® phagemid (Strategene, La Jolla) or pSPORT (Gibco BRL) and ptrp-lac hybrids and the like may be used.
- the baculovirus polyhedrin promoter may be used for insect cells.
- a promoter for filamentous organisms for example, amalyse, trp C, and the like may be used.
- a promoter for yeast for example glyceraldehyde-3 -phosphate dehydrogenase may be used.
- viral promoters such as the SV40 early promoter, SV40 late promoter and the like may be used.
- yeast Saccha - romyces cerevisiae a number of vectors containing constitutive or inducible promoters such as the alpha factor, alcohol oxidase and PGH may be used.
- constitutive or inducible promoters such as the alpha factor, alcohol oxidase and PGH.
- cell lines which stably express the polypeptides of the invention may be transformed using expression vectors which contain viral origins of replication or endogenous expression elements and a selectable marker gene. Following the introduction of the vector, cells may be allowed to grow for one to two days in an enriched media before they are swit- ched to selective media.
- the purpose of the selectable marker is to confer resistance to selection and its presence allows growth and recovery of cells which successfully express the introduced sequences. Resistant clumps of stable transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.
- the gene of interest is also present, its presence and expression must be confirmed.
- the gene sequence (s) of the invention are inserted within a marker gene sequence, recombinant cells can be identified by the absence of gene function.
- a marker gene can be placed in tandem with the gene sequence of interest, under the control of a single promoter. Expression of the marker gene in response to indue- tion or selection usually indicates expression of the tandem gene as well.
- Anti -metabolite, antibi- otic or herbicide resistance can be used as the basis of selection; for example, dhfr which confers resistance to methotrextate (Wiger M. et al . (1980) Proc Na tl Acad Sci 77:
- Host cells transformed with a nucleotide sequence (s) of the invention may be cultured under conditions suitable for expression and recovery of the encoded protein from cell culture.
- the protein produced by recombinant cells may be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides sequences of the invention can be designed with signal sequences for direct secretion of the protein product, through a prokaroytic or eukaryotic cell membrane.
- Other recombinant constructions may join the gene sequences of the invention, to a nucleotide sequence encoding a polypeptide domain, which will facilitate purification of soluble proteins (Kroll DJ et al . (1993). DNA Cell Biol 12: 441-53) .
- the invention provides a method for producing aromatic and/or aliphatic esters in microorganisms, plant cells or plants comprising inserting into the genome of the microorganism or plant one or more copies of DNA sequences of the invention, and feeding an alcohol and an acyl -CoA to the microorganism or plant (cell) .
- host cells which contain the gene sequences or polypeptides thereof according to the invention may be identified by a variety of procedures known to those skilled in the art. These procedures include, but are not limited to DNA-DNA, DNA-RNA hybridisation, amplification using probes (portions or fragments of polynucleotides) , protein bioassay or immunoassay techniques which include membrane, solution or chip based technologies for the detection and /or quantification of the nucleic acid or protein.
- Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers based on the gene sequences of the invention to detect transformants containing DNA or RNA encoding the polypeptides.
- oligonucleotides' or oligomers' refer to nucleic acid sequence of at least 10 nucleotides and as many as about 60 nucleotides, preferably about 15-30 nucleotides, and more preferably about 20-25 nucleotides which can be used as a probe or amplimer.
- Polynucleotide sequences according to the invention encoding alcohol acyl transferase polypeptides may be used to detect volatile ester (aliphatic and aromatic) formation in fruits.
- PCR as described in US patent Nos 4,683,195 and 4,965,188, provides additional uses for oligonucleotides based on the alcohol acyl transferase sequence.
- oligomers are chemically synthesised, but they may be generated enzymatically or produced from a recombinant source.
- Oligomers generally comprise two nucleotide sequences, one with sense orientation (5' -3') and one with antisense (3' -5'), employed under less stringent conditions for detection and /or quantitation of closely related DNA or RNA sequences.
- polynucleotide sequences encoding the alcohol acyl transferase protein may be used in the hybridisation or PCR assay of plant tissues, more specifically fruit tissues, to detect alcohol acyl transferase protein presence.
- the form of such quantitative methods may include, Southern or Northern analysis, dot/slot blot or other membrane based technologies; PCR technologies such as DNA Chip, Taqman and ELISA Technologies. All of these technologies are well known in the art and are the basis of many commercially owned diagnostic kits.
- the polynucleotide sequences according to the present invention herein provide the basis for assays that detect signal transduction events associated with volatile ester production, aliphatic and aromatic, hence flavour formation.
- Means for producing labelled hybridisation or PCR probes for detecting sequences related to polynucleotides as outlined in the first and second aspects of the invention include oligolabeling, nick translation, end labelling of PCR amplification using a labelled nucleotide.
- the gene sequence or sequences of the invention, or any portion of it may be cloned into a vector for the production of the mRNA probe.
- Such vectors are known in the art, are commercially availa- ble, and may be used to synthesise RNA probes in-vitro by addition of an appropriate RNA polymerase, such as T7, T3 , or SP6 and labelled nucleotides.
- an appropriate RNA polymerase such as T7, T3 , or SP6 and labelled nucleotides.
- RNA polymerase such as T7, T3 , or SP6 and labelled nucleotides.
- RNA polymerase such as T7, T3 , or SP6 and labelled nucleotides.
- Suitable reporter molecules or labels include fluorescent, chemiluminescent , or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like.
- natural, modified or recombinant polynucleotide sequences according to the invention may be ligated to a heterologous sequence to encode a fusion protein.
- a fusion protein may be engineered with one or more additional domains added to facilitate protein purification (i.e. a cleavage site located between the sequence of the polypeptide and the heterologous protein sequence) so that the polypeptide of the invention may be purified away from the heterologous moiety.
- the invention further contemplates the creation of fusion proteins, chosen from the group of sequences of the invention, degenerate variants thereof, functional equiva- lents thereof, pertaining to "fruit' of strawberry and lemon, or gene sequences with substantial homology to the sequences of the invention from other "fruit' tissues concerned with the pathway for the formation of aliphatic or aromatic esters, hence flavour.
- purification facilita- ting domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilised metals, protein A domains that allow purification on immobilised immunoglobin, and the domain utilised in the FLAGS extension/affinity purification system (Immunex Corp, Seattle, WA) .
- a cleavable linker such as factor XA, thrombin or enterokinase (Invitrogen, San Diego CA) between the purification domain and the polypeptide is useful to facilitate purification.
- One such expression vector provides for the expression of a fusion protein comprising gene sequence (s) which encode polypeptides of the invention, and contains nucleic acid encoding six histidine residues followed by thioredoxin and the enterokinase cleavage site.
- the histidine residues facilitate purification on IMIAC (immobilised metal ion affinity chromatography as described in Porath et al . , (1992) Protein Expression and Purification 3:263-281) while the enterokinase cleavage site provides a means for purifying the polypeptide from the fusion protein.
- the invention provides an isolated DNA sequence encoding
- polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has aminotransferase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- polypeptide (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has aminotransferase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence encoding (a) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 4B, or
- polypeptide having at least 90% homology with the amino acid sequence SEQ ID NO: 4B or (c) a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has thiolase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provies an isolated DNA sequence having a nucleic acid sequence
- polypeptide (a) or (b) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has thiolase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence encoding
- polypeptide (a) or (b) which polypeptide or fragment of polypeptide has pyruvate decarboxylase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit .
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- polypeptide (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has pyruvate decarboxylase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence encoding (a) a polypetide having an amino acid sequence as shown in SEQ ID NO: 6B, or (b) a polypeptide having at least 75% homology with the amino acid sequence SEQ ID NO: 6B, or (c) a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for ali- phatic and/or aromatic ester production in fruit .
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- polypeptide (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for ali- phatic and/or aromatic ester production in fruit .
- the invention provides an isolated DNA sequence encoding
- SEQ ID NO: 10B or (c) a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit .
- the invention provides an isolated DNA sequence having a nucleic acid sequence (a) selected from the group consisting of sequences SEQ ID NO: 7A, 8A, 9A and 10A, which encodes a polypeptide having alcohol dehydrogenase activity and being involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit, or
- polypeptide (a) or (b) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit .
- the invention provi- des an isolated DNA sequence encoding
- polypeptide (a) or (b) which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- polypeptide (a) or (b) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for ali- phatic and/or aromatic ester production in fruit .
- the invention provides an isolated DNA sequence encoding
- the invention provides an isolated
- DNA sequence having a nucleic acid sequence having a nucleic acid sequence
- polypeptide 13B or (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has alcohol dehydrogenase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provi des an isolated DNA sequence encoding (a) a polypeptide having an amino acid sequence as shown in SEQ ID NO:15B, or (b) a polypeptide having at least 41% homology, preferably at least 50% and more preferably at least 80% homology, with the amino acid sequence SEQ ID NO:15B, or
- polypeptide (a) or (b) which polypeptide or fragment of polypeptide has esterase activity and is involved in the biosynthesis pathway for aliphatic and/or aromatic ester production in fruit.
- the invention provides an isolated DNA sequence having a nucleic acid sequence
- SEQ ID NO:15A which encodes a polypeptide having esterase activity and being involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit, or (b) complementary to SEQ ID NO:15A, or
- the invention provides a purified and isolated polypeptide, (a) having an amino acid sequence as shown in SEQ ID NO: 15B, or
- polypeptide (c) being a fragment of polypeptide (a) or (b) , which polypeptide or fragment of polypeptide has esterase activity and is involved in the biosynthetic pathway for aliphatic and/or aromatic ester production in fruit.
- nucleotide sequences which are suitable as primers for obtaining additional alcohol acyltransferase sequences from various fruit by cloning.
- These nucleotide sequences (motifs) encode: the amino acid sequence as set forth in SEQ ID NO:14B, or
- the invention further provides a method for regulating aliphatic and/or aromatic ester formation in fruit comprising inserting into the genome of a fruit-producing plant one or more copies of one or more DNA sequences as defined above encoding various enzymes involved in the biosynthetic pathway for aliphatic and/or aromatic ester formation in fruit.
- the levels of protein may be increased for example by the incorporation of additional genes.
- the additional genes maybe designed to give either the same or different spatial or temporal patterns of expression in the fruit as the target gene .
- the invention provides a genetically modified strawberry or lemon plant and propagating material derived therefrom which has a genome comprising an expres- sion vector for overexpression or downregulation of an endogenous strawberry or lemon plant gene counterpart of any of the DNA sequences as defined above encoding various enzymes involved in the biosynthetic pathway for aliphatic and/or aromatic ester formation in fruit.
- the invention provides a method for producing aromatic and/or aliphatic esters in microorganisms, plant cells or plants comprising inserting into the genome of the microorganism or plant one or more copies of DNA sequences of this invention encoding a polypeptide having alcohol acyl transferase activity, and one or more copies of DNA sequences of this invention encoding a polypeptide having alcohol dehydrogenase activity, and feeding aldehydes and acyl-CoA to the microorganism or plant (cell) .
- the above method further comprises inserting one or more copies of DNA sequences of this invention encoding a polypeptide having pyruvate decarboxylase activity, and feeding alpha-keto acids and acyl-CoA to the microorganism or plant (cell) .
- the above method further comprises inserting one or more copies of DNA sequences of this invention encoding a polypeptide having aminotransferase activity, and feeding amino acids and acyl- CoA to the microorganism or plant (cell) .
- the above method further comprises inserting one or more copies of DNA sequences of this invention encoding a polypeptide having thiolase activity, and feeding amino acids and fatty acids to the microorganism or plant (cell) .
- the DNA sequences of this invention encoding a polypeptide having esterase activity can be disrupted to increase the amount of volatile esters. Molecular strategies to accomplish this are well known in the art.
- Strawberry and citrus are among the most popular fruits for natural flavour ingredients because of their flavour, fragrance, aroma and scent.
- Examples of commercially important aliphatic esters are ethyl acetate (used in artificial fruit and brandy flavours) , ethyl butyrate (the primary constituent of apple aromas) , isoamyl acetate (the main component of banana aroma) and ethyl butyrate (has a fruity odour, reminiscent of pineapple) .
- Flavour usage of these esters is among the highest of all natural flavour ingredients.
- the invention further contemplates the use of the polynucleotide sequences according to the present invention, for the industrial production of "fruit' flavours which are natural to match the odour fidelity of the natural fruit.
- this present invention further contemplates the production of novel flavours by the use of the polynucleotide sequences according to the present invention, alone or in combination, to provide novel avenues for natural flavour production in the future.
- the invention further contemplates the generation of strawberry and lemon plants which amongst other phenoty- pic modifications may have one of the following characteristics : (a) reduced/enhanced flavour from the reduced/enhanced production of volatile esters,
- the gene sequences of the present invention are used for the manipulation of flavour in other "fruits' and or/ industrial processes.
- the genes/ peptides of the present invention in particular SEQID 1A (strawberry SLE27) and SEQ ID IB (lemon CLF26) may be used in the following industrial applications; with particular reference to the manipulation of fruit derived products, however, not exclusively limited to these: a) in the processed food industry as food additives to enhance the flavour of syrups, ice-creams, frozen desserts, yoghurts, confectionery, and like products , b) flavouring agents for oral medications and vitamins , c) providing additional flavour/aroma in beverages, including alcoholic beverages, d) enhancing or reducing fruit flavour/aroma/fragrance/scent , e) enhancing the flavour/aroma of "natural products (eg flower scent however, including but not exclusively limited to flower scent) , f) enhancing the flavour/aroma of "synthetic or artificial products' ,
- esters aromatic and aliphatic
- Methyl anthranillate a methyl ester of o-aminobenzoic acid, apart from being a very important perfumary, aroma, scent ester (it imparts a peculiar aroma known as ""foxy" to grapes of the North american species Vitis Labrusca)
- scent ester it imparts a peculiar aroma known as ""foxy" to grapes of the North american species Vitis Labrusca
- the same compound is known to serve as a pheromone in various insects.
- the present invention also relates to antibodies which specifically bind to the polypeptides as claimed in the invention, compositions comprising substantially puri- fied polypeptides, fragments thereof, agonists or alternatively antagonists, and methods of producing polypeptides.
- a number of expression vectors may be selected depending on the used of the polypeptide (s) according to the invention. For example, when large quanti- ties of the polypeptide are needed for the induction of the antibody, vectors which drive high levels of expression of fusion proteins that are readily purified are desirable. Such vectors include, but are not limited to the multifunctional E .
- coli cloning and expression vectors such as Bluescript ® (Stratagene) , in which the gene sequence (s) according to the invention, can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that the hybrid protein is produced; pPIN vectors (Van Heekle and Schuster (1989) J Biol chem 264 : 503-5509); and the like.
- pGEX vectors Promega, Madison WI
- GST glutathione-S- transferase
- fusion proteins are soluble and can be easily purified from lysed cells by absorption to gluthionine-agarose beads followed by elution in the presence of free gluthionine .
- Proteins made in such systems are designed to include heparin or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- amino acid sequences of the polypeptides, or any parts thereof may be altered by direct synthesis or by genetic means known by those skilled in the art, and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.
- Fragments of the polypeptides according to the invention may be produced by direct peptide synthesis using solid phase techniques (c.f . Stewert et al . (1969) Solid Phase Peptide Synthesis, WH Freeman Co, San Fancisco, Merrifield J (1963) J Am Chem Soc 85:2149-2154) .
- In vi tro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using Applied Biosystems 431A Peptide Synthesizers (Perkin Elmer, Forster City CA) in accordance with the instructions provided by the manufacturer.
- Various fragments of each of the polypepides may be chemically synthesised separately and combined using chemical methods to produce full length molecules.
- the invention further contemplates a diagnostic assay using antibodies raised to each of the polypeptides of the present invention, with or without modification.
- diagnostic assays for alcohol acyl transferase include methods utilising the antibody and a label to detect the alcohol acyl transferase protein in various fruit extracts.
- the polypepti- des and antibodies are labelled by joining them, either covalently or non covalently, with a reporter molecule.
- reporter molecules are known and several of them have been previously described (cf . reporter genes) .
- Polynucleotide sequence (s) of the invention SEQ ID 1A strawberry (SLE27) , SEQ ID 2A, lemon alcohol acyl transferase proteins (CLF26), or any part thereof, may be used for diagnostic purposes, to detect and quantify gene expression in various tissues (eg leaves, stems and in particular fruits (climacteric and non climacteric) ) , hence volatile ester (aliphatic and aromatic) formation, hence flavour at various stages of plant maturation.
- the diagnostic assay is useful to distinguish between absence, presence and excess expression of the alcohol acyl transferase proteins and to monitor expression levels during development.
- the following examples are offered by way of illustration and not by limitation.
- the composition of the headspace of the strawberries was analysed using Solid Phase Micro-extraction for trapping and concentrating the emitted volatiles.
- the fibres used were 100 ⁇ m Polydimethyl siloxane (PDMS) supplied by Supelco. Analysis was performed on a Fisons GC 8000 system, coupled to the Fisons MD800 mass spectrometer. The gas chromatograph was temperature programmed, with a plateau at 80 °C for 2 min., followed by a ramp of 8°C/min to 250 °C for 5 min. The injector port was operated at 250 °C for thermal desorp- tion during 60 sec. of the SPME fibers, using the deactivated standard 0.7 ml split/splitless injection port liner with zero split.
- the column used was a HP-5 with a length of 50 m and internal diameter of 0.32 mm and a film thickness of 1.03 ⁇ m, and operated with helium at a pressure of 38kPa.
- Eluted components were identified by their mass spectrum, using the Fisons Masslab software and the NIST library. The identity of the components was verified where possible by using known substances as reference (most of them obtained from Aldrich) .
- FIG. 1 shows a typical chromatogram obtained after head- space measurement of red ripe fruit of strawberry grown in the greenhouse. The importance of esters to the overall volatile emission from the ripe strawberry fruit can be clearly observed.
- Example 2 Construction of a strawberry red fruit stage and lemon young fruit peel cDNA library, mass excision and random sequencing
- the cultivar used was Fragaria X ananassa Duch . cv. Elsanta .
- Plant material for the isolation of RNA from lemon was the green peel of a small fruit (1.2 x 2 cm) of the cultivar. Isolation of RNA from lemon was done using the same method as described for strawberry.
- the cDNA libraries for both strawberry and lemon where produced as a custom service by (Stratagene) in the lambda zap vector.
- the ExAssistTM/SOLRTM system (Stratagene) was used for mass excision of the pBluescript SK ( - ) phagemid. The excision was done according to the manufacturer's instructions using 20 x 10 3 pfu from the non amplified library for each excision. High quality plasmid DNA from randomly picked colonies was extracted using the QIAGEN BioROBOT 9600. Colonies were grown overnight in 3ml Luria Broth medium (lOg/l tryptone, 5 g/liter yeast extract, 5 g/liter NaCl) supplemented with 100 mg/litre Ampicillin, centrifuged at 3000 RPM for 10 min. and the pellet was used directly for plasmid DNA isolation by the robot. Each DNA isolation round consisted of 96 cultures .
- Insert size was estimated by agarose gel electrophoresis after restriction enzyme digestion of the pBlue- Script (SK-) vector with EcoRI and Xhol. Inserts with length above 500 bp were used for sequencing. Plasmid DNA from the selected samples were used for polymerase chain reaction (PCR) sequencing reactions using the ABI PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit and the MJ Research PTC-200 DNA EngineTM thermal cycler. The T3 and T7 universal primers were used for sequencing from the 5' and 3 ' ends respectively. PCR program was according to the Dye Terminator manufacture's protocol (ABI PRISM). The ABI 373, 370A and 310 sequencers (Applied Bio-systems) were used.
- PCR polymerase chain reaction
- Sequen- ces were edited manually to remove vector and non reliable sequences and submitted to the Blast homology search program using BlastX and BlastN (Altschul et al . J. Mol . Biol . 215, 403 - 410, 1990) provided by the National Centre for Bio- technological Information on the world wide web.
- the stra - berry and lemon sequencing data received from the Blast search was transferred using a self designed macro program to a database made using the software Access (Microsoft) . Sequences with a BlastX score above 80 were considered as having a significant homology (Pearson, Curr. Opinion . Struct .
- Plasmid DNA from the selected cDNAs was used for PCR sequencing reactions using the ABI PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit and the MJ Research PTC-200 DNA EngineTM thermal cycler. Each individual selected cDNA was sequenced completely on both strands. DNA and protein alignment "contigs' were performed using the GeneWorks software (IntelliGenetics , Oxford).
- RNA isolation from both strawberry and lemon tissues was done as described for the preparation of total RNA for the construction of the cDNA libraries [Manning K. Analytical Biochemistry 195, 45-50 (1991)] .
- green house grown plant material was used. From strawberry the different tissues/organs used for RNA isolations were; leaf, root, petiole, flower, green fruit, white fruit, turning fruit, red fruit, red fruit without seeds, seeds and overripe fruit.
- the different tissues/organs used were; root, leaf, flower bud, albedo, green fruit peel (1.2 x 2 cm) , green fruit peel (2 3 cm) , green fruit peel (3.5 x 6 cm) , green fruit peel (6 8 cm) , yellow fruit peel (2 weeks fruit detached) .
- the expression pattern of strawberry alcohol acyl transferase is in perfect match with the accumulation of volatile esters in the strawberry plant.
- the gene SLE27, (SEQ ID NO: 1A) is expressed at it lowest level in the white fruit, gradually increasing as fruit develops reaching its highest levels in the turning stage and the red stage when the volatile ester compounds can be detected at their maximum.
- the expression of the lemon alcohol acyl transferase (CLF26 SEQ ID NO:2A) seems to be correlated with the accumulation of volatile monoterpene compounds in the lemon tree tissues/organs ( Figure 4) .
- the data shown provides evidence that thiolase (SLG150, SEQ ID NO: 4A) , alcohol dehydrogenase (SLB39, SEQ ID NO: 6A) and pyruvate decarboxylase (SLH51, SEQ ID NO: 5A) are involved in ripening processes such as the production of strawberry flavour and aroma compounds.
- the expression levels derived from four images were statistically analysed with an analysis of variance modelling the factors dye, origin, and spot levels on a logarithmic scale giving the significant ratios of expression between the spots of origin (eg. green versus red) .
- the expression profiles Of SEQ ID 1A, SEQ ID 3A, SEQ ID 5A, SEQ ID 11A, SEQ ID 12A analysed in the green versus red and turning versus red stages of fruit development are outlined in Figure 10.
- the co-ordinated expression pattern of the genes during straw- berry fruit development is in perfect match with the accumulation of volatile ester compounds aromatic and aliphatic during strawberry fruit development.
- alcohol acyl transferase enzyme activity was detected by Perez et al . , (J. Agric.
- Genomic DNA was isolated from green house grown strawberry plants (cv. Elsanta) . Young folded leaves kept 2 days in water in the dark were used for the isolation. 1 gram of leaf material was ground in liquid nitrogen and immediately added to 7 ml DNA extraction buffer (100 mM Tris-Cl, 1.4 M NaCl, 20 mM EDTA, 2% CTAB, 0.2% ⁇ - mercaptoethanol). After incubation for 30 min. at 600C one volume of chloroform: iso- amyl alcohol (24:1) was added to the tubes. The samples were then centrifuged for 10 min. at 4000 rpm and the aqueous phases were transferred to 4.5 ml isopropanol and incubated for 30 min. at -20°C. Nucleic acids were spun down at 4000 rpm for 12 min. washed with 70% ethanol and air dried.
- 7 ml DNA extraction buffer 100 mM Tris-Cl, 1.4 M NaCl, 20 mM EDTA,
- the blot was washed first under low stringency conditions (52°C with 2 times half an hour 2xSSC/0.1% SDS) and after observation of the results by autoradiography of the film they were washed further under stringent conditions (65°C with 2 times half an hour O.lxSSC/0.1% SDS) and autoradiographed again.
- Alcohol acyltransferase sequences from other fruit Additional alcohol acyltransferase sequences from melon, strawberry vesca, banana, apple, lemon and mango were obtained using degenerate primers synthesised to the motif sequence ID number 14B using methods well known in the art such as polymerase chain reaction (PCR) and reverse genetic approaches such as RT-PCR.
- PCR polymerase chain reaction
- RT-PCR reverse genetic approaches
- the esterase gene was cloned using PCR techniques using the following degenerate primer : 5'-GG (T/A) TGGGG I (T/G) CTA(T/C) TCTTGC-3' ) and reverse genetic approaches such as RT-PCR.
- degenerate primer 5'-GG (T/A) TGGGG I (T/G) CTA(T/C) TCTTGC-3' ) and reverse genetic approaches such as RT-PCR.
- the E. coli expression vector pRSETB (Invitrogen), was used for expression studies of strawberry alcohol acyl transfe- rase (SLE27, SEQ ID NO: 1A) .
- This pRSETB vector contains the T7 promoter which can be induced by isopropyl -beta-D- thiogalactopyranoside (IPTG) and therefore by inserting the desired gene downstream of this promoter, the gene can be expressed in E. coli .
- IPTG isopropyl -beta-D- thiogalactopyranoside
- DNA inserts were positi- oned downstream and in frame with a sequence that encodes an N-terminal fusion peptide.
- This sequence includes (in 5' to 3' order from the N-terminal to C-terminal) , an ATG translation initiation codon, a series of six Histidine residues that function as a metal binding domain in the translated protein, the Anti-Xpress epitope, and the enterokinase cleavage recognition sequence.
- the original pRSETB was primarily used for the insertion of the gene encoding the Green Fluorescent Protein (GFP) .
- the GFP gene was fused to the pRSETB vector using the BamHI and HindiII restriction sites located at the multiple cloning site (MCS) as can be seen in Figure 7.
- MCS multiple cloning site
- This construct for the expression of GFP served as control for the experiments together with the empty pRSETB vector.
- Cloning the GFP gene to the pRSETB vector inserted an additional Sail restriction site at the 3' of the GFP gene and together with the BamHI site located at the 5' of the GFP gene served as sites for the cloning of the strawberry alcohol acyl transferase gene (SLE27, SEQ ID N0:1A).
- the BamHI and Sail sites were introduced to the 5" and 3' respectively of the strawberry alcohol acyl transferase coding sequence by the use of PCR.
- the 452 amino acid open reading frame of the SLE27 (SEQ ID N0:1A) clone was amplified with the pfu DNA polymerase (Stratagene) and primers AAP165 (5' -CGGATCCGGAGAAAATTGAGGTCAG) and AAP166 (5'-CGTCGA- CCATTGCACGAGCCACATAATC) according to the manufacturers instructions.
- the PCR product was cloned into PCR-script vector (Stratagene) , cut out with BamHI and Sail and further inserted (as a translation fusion) into the corresponding restriction sites in the pRSETB vector.
- the pRSET B vector harbouring the strawberry alcohol acyl transferase (SLE27, SEQ ID NO: 1A) was used to transform E. coli strain BL21 Gold DE3 (Stratagene) as described by the manufacturer.
- E. coli strain BL21 Gold DE3 (Stratagene)
- For bacterial expression typically 1 ml of overnight liquid culture grown at 37°C in Luria Broth (LB) medium (lOg/1 tryptone, 5 g/liter yeast extract, 5 g/liter NaCl) supplemented with 100 mg/liter Ampicillin was diluted 50 times in the same medium and grown until the OD 600 reached 0.4 (usually at 37°C except when different temperatures for growth during induction were examined) .
- IPTG Isopropylthio-beta-D-galactoside
- Dithiothreitol (DTT) ] The samples were heated for 5-10 min at 95°C, followed by a short spin of 30 seconds, full speed. From the samples lO ⁇ l was loaded on 10% SDS-gel (mini-gel, lmm, 7x9cm) . The gels were run with standard buffer (25mM Tris 192mM, glycine 0.1% SDS, pH 8.3) at 100-200V, 50-30mA, ca 3hr with 16°C water cooling. After complete run, gels were used for Coomassie Brilliant Blue (CBB) stain or Western blot. For CBB staining, the gel was fixed during lhour in 40% Methanol, 10% Acetic Acid in water.
- CBB Coomassie Brilliant Blue
- Transfer buffer was Towbin buffer plus 0.1% SDS (25mM Tris, 192mM
- Transfer was submarine (Novex blot unit, plate electrodes, 3cm distance) at 200mA overnight plus 2hr. at 400mA, cooled in ice-water with cooling block. Transfer was checked by using pre- stained markers as a reference .
- Second Antibody is GAR-AP (Boehringer) 1/3000 in 2% BSA TBS-Tw (TBS + 0.05% Tween - 20) for l-2hr.
- the staining reaction was with nitroblue tetrazolium/5-bromo-4 -chloro-3-indolphospha- te/alkaline phosphatase-buffer (45 ⁇ l nitroblue tetrazolium 30mg/ml in 70% dimethylformamide, 33 ⁇ l 5-bromo-4-chloro-3- indol phosphate 15mg/ml in dimethylformamide in 10ml of alkaline phosphatase buffer) .
- the staining reaction was stopped by rinsing with water.
- the molecular weight of the recombinant SLE27 (SEQ ID NO: IB) protein (SAAT) recombinant protein was 54 kDa.
- the enzyme exhibited a broad pH range (pH optimum around 8.3).
- GFP Green Fluorescent Protein
- the oven temperature was programmed at 2 min at 80°C, then an increase of 8°C min "1 to 250°C, and finally 5 min at 250°C.
- Mass spectra of eluting compounds were generated at 70eV each second.
- the MD 800 Masslab software (Interscience) was used to record mass spectra and to calculate peak areas. Volatile compounds were identified by screening the NIST library for comparable mass spectra and by comparison with authentic reference compounds.
- the histidine-released protein elute from E. coli expressing the strawberry alcohol acyl transferase gene (SLE27, SEQ ID NO: 1
- the alcohol acyltransferase activity of the SLE27- encoded enzyme (SEQ ID NO : IB : SAAT) encoded protein was established in two ways: (1) For the activity with different alcohols and acetyl-CoA, [ 14 C] -acetyl-CoA was used as substrate and the formation of (radio-labeled) products analyzed using radio-gas chromatography and quantified using liquid-scintillation counting. Radio-GLC was performed essentially as described previously [Bouwmeester , H.J. (1999) Plant Physiol .
- n-hexanoyl CoA (C6:0) 1-propanol 1-propyl hexanoate* wine-like, cheese n-decanoyl CoA (C10:0) 1-butanol 1 -butyl decanoate" Brandy (Whisky- Cognac) -like odor bbeennzzooyyll CCooAA ((CC77::00)) 1-butanol 1-butyl benzoate" mild floral-balsamic odor
- the alcohol acyl transferase activity of the proteins having the sequences SEQ ID NO:16B to 23B, derived from strawberry vesca, banana, apple, mango, lemon (3x) and melon, respectively, was established in a similar way as described for strawberry protein encoded by SEQ ID NO : 1A in Example 4. From an overnight culture of E.coli, 0.75 ml was transferred into a 2 ml glass crimp vial, 0.3 g CaCl2 was added and a small magnetic stirrer was put into the vial. The vial was closed with a crimp cap, and incubated during 15 min at 50 deg. celsius.
- the headspace of the vial was sampled with a 100 micro PDMS solid phase microextraction (SPME) device, supplied by Supelco, during this period.
- SPME solid phase microextraction
- the SPME fibre was transferred into the injection port of a Fisons G8600 gaschromatograph, and desorbed at 250 deg. Celsius during 10 seconds. Bottom split was closed during this period of 10 seconds, and reopened afterwards.
- a HP-5 column was used with 50m length, 0.32 mm ID and 1.05 micron film thickness.
- the oven was programmed for 2 min. at 80 deg. Celsius, ramp of 8 deg Celsius /min. to 250 deg. Celsius, for 5 min. at a head pressure of 47 kPa .
- a MD 800 mass spectrometer was used for the detection and identification of volatile esters, and the resulting mass spectra from M/z 35 to 400 were compared with the NIST database for identification. Where possible, retention times were compared to that of authentic reference compounds, obtained from Sigma or Aldrich.
- Fig. 12-18 shows the results of using SEQ ID N0:1A for comparison.
- the data obtained by the chromatograms are summarized in the following tables 3 to 9, respectively.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BR9915881-7A BR9915881A (pt) | 1998-12-02 | 1999-12-02 | Sequência de dna isolada, polipeptìdeo purificado e isolado, vetor de expressão recombinante, vetor de clonagem replicativo, método para regular a formação de éster alifático e/ou aromático em frutas, planta e material de propagação da mesma, planta de morango ou limão geneticamente modificada e material de propagação derivado da mesma, método para produzir ésteres aromáticos e/ou alifáticos em microorganismos, células de plantas ou plantas, anticorpo, kit diagnóstico, e, método para triar frutas |
CA002353577A CA2353577A1 (en) | 1998-12-02 | 1999-12-02 | Fruit flavour related genes and use thereof |
EP99958511A EP1135507A1 (en) | 1998-12-02 | 1999-12-02 | Fruit flavour related genes and use thereof |
AU15862/00A AU769932B2 (en) | 1998-12-02 | 1999-12-02 | Fruit flavour related genes and use thereof |
NZ512208A NZ512208A (en) | 1998-12-02 | 1999-12-02 | Fruit flavour related genes that control ester formation |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP98204018A EP1006190A1 (en) | 1998-12-02 | 1998-12-02 | Fruit flavour related genes and use thereof |
EP98204018.0 | 1998-12-02 | ||
EP99200739 | 1999-03-12 | ||
EP99200739.3 | 1999-03-12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000032789A1 true WO2000032789A1 (en) | 2000-06-08 |
Family
ID=26150927
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/NL1999/000737 WO2000032789A1 (en) | 1998-12-02 | 1999-12-02 | Fruit flavour related genes and use thereof |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1135507A1 (pt) |
AU (1) | AU769932B2 (pt) |
BR (1) | BR9915881A (pt) |
CA (1) | CA2353577A1 (pt) |
NZ (1) | NZ512208A (pt) |
WO (1) | WO2000032789A1 (pt) |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001072984A1 (en) * | 2000-03-31 | 2001-10-04 | International Flower Developments Pty. Ltd. | Plant anthocyanidin rutinoside aromatic acyl transferases |
WO2005003362A2 (en) * | 2003-03-10 | 2005-01-13 | Athenix Corporation | Methods to confer herbicide resistance |
WO2008153676A2 (en) * | 2007-05-21 | 2008-12-18 | The Regents Of The University Of California | Pentose phosphate pathway and fermentation enzyme-encoding nucleotide sequences with refined translational kinetics and methods of making same |
US7807881B2 (en) | 2003-03-10 | 2010-10-05 | Athenix Corp. | Methods to confer herbicide resistance |
WO2012149009A3 (en) * | 2011-04-29 | 2012-12-20 | Bangladesh Jute Research Institute | Polynucleotides encoding enzymes from the jute lignin biosynthetic pathway |
WO2014038216A1 (ja) | 2012-09-10 | 2014-03-13 | 三菱レイヨン株式会社 | メタクリル酸及び/又はそのエステルの製造方法 |
WO2014038214A1 (ja) | 2012-09-10 | 2014-03-13 | 三菱レイヨン株式会社 | メタクリル酸エステルの製造方法 |
US8829265B2 (en) | 2004-01-09 | 2014-09-09 | Syngenta Participations Ag | Melon plants |
WO2015050904A3 (en) * | 2013-10-02 | 2015-05-28 | Fabric Media | Products combined with synthetic genetic material |
WO2015133146A1 (ja) * | 2014-03-07 | 2015-09-11 | 富山県 | メタクリル酸エステルの製造方法および新規メタクリル酸エステル合成酵素 |
WO2017167623A1 (en) * | 2016-03-30 | 2017-10-05 | Basf Se | Fermentative production of n-butylacrylate using alcohol acyl transferase enzymes |
WO2021127648A1 (en) * | 2019-12-19 | 2021-06-24 | Auburn University | Microbial ester production |
CN115896137A (zh) * | 2022-12-01 | 2023-04-04 | 沈阳农业大学 | 一种南果梨PuAAT基因、其过表达载体及应用 |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994013797A1 (en) * | 1992-12-15 | 1994-06-23 | Commonwealth Scientific & Industrial Research Organisation | Dna molecules encoding inducible plant promoters and tomato adh2 enzyme |
WO1997027295A1 (en) * | 1996-01-23 | 1997-07-31 | Horticulture Research International | Fruit ripening-related genes |
-
1999
- 1999-12-02 BR BR9915881-7A patent/BR9915881A/pt not_active IP Right Cessation
- 1999-12-02 EP EP99958511A patent/EP1135507A1/en not_active Withdrawn
- 1999-12-02 WO PCT/NL1999/000737 patent/WO2000032789A1/en not_active Application Discontinuation
- 1999-12-02 NZ NZ512208A patent/NZ512208A/en unknown
- 1999-12-02 AU AU15862/00A patent/AU769932B2/en not_active Ceased
- 1999-12-02 CA CA002353577A patent/CA2353577A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994013797A1 (en) * | 1992-12-15 | 1994-06-23 | Commonwealth Scientific & Industrial Research Organisation | Dna molecules encoding inducible plant promoters and tomato adh2 enzyme |
WO1997027295A1 (en) * | 1996-01-23 | 1997-07-31 | Horticulture Research International | Fruit ripening-related genes |
Non-Patent Citations (14)
Title |
---|
AHARONI A. ET AL.: "Isolation and characterization of cytochrome P-450 cDNAs from strawberry fruit", FASEB JOURNAL SUPPL., vol. 11, no. 9, July 1997 (1997-07-01), pages A811, XP002107097 * |
AN G.: "AC AT000069", EMBL DATABASE, 22 April 1998 (1998-04-22), Heidelberg, XP002107089 * |
BOJORQUEZ G. ET AL.: "Peroxisomal thiolase mRNA is induced during mango fruit ripening", PLANT MOLECULAR BIOLOGY, vol. 28, no. 5, August 1995 (1995-08-01), pages 811 - 820, XP002107093 * |
BOUDET A. ET AL.: "AC I14661", EMBL DATABASE, 6 October 1995 (1995-10-06), Heidelberg, XP002107092 * |
LAUTER F.: "AC X92855", EMBL DATABASE, 8 November 1996 (1996-11-08), Heidelberg, XP002107090 * |
LOPEZ-GOMEZ R ET AL: "Changes in mRNA and protein synthesis during ripening in mango fruit.", JOURNAL OF PLANT PHYSIOLOGY 1993, vol. 141, no. 1, 1993, pages 82 - 87, XP000905556, ISSN: 0176-1617 * |
MANNING K. ET AL.: "Ripening enhanced genes of strawberry: their expression, regulation and function", ACTA HORTICULTURAE, no. 439, 1997, pages 165 - 167, XP002107095 * |
MANNING K.: "Genetic and environmental manipulation of horticultural crops", 1998, CAB INTERNATIONAL, WALLINGFORD, XP002107099 * |
MANNING K.: "Isolation of a set of ripening-related genes from strawberry: their identification and possible relationship to fruit quality traits", PLANTA, vol. 205, 1998, pages 622 - 631, XP002107094 * |
MEDINA-ESCOBAR N. ET AL.: "AC U63534", EMBL DATABASE, 6 January 1999 (1999-01-06), Heidelberg, XP002107098 * |
PÉREZ A. ET AL.: "Evolution of strawberry alcohol acyltransferase activity during fruit development and storage", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, vol. 44, 1996, pages 3286 - 3290, XP002107096 * |
STERKY F. ET AL.: "EST sequence AC AI164913", EMBL DATABASE, 11 November 1998 (1998-11-11), Heidelberg, XP002136726 * |
WILKINSON J Q ET AL: "IDENTIFICATION OF MRNAS WITH ENHANCED EXPRESSION IN RIPENING STRAWBERRY FRUIT USING POLYMERASE CHAIN REACTION DIFFERENTIAL DISPLAY", PLANT MOLECULAR BIOLOGY, vol. 27, no. 6, 1 March 1995 (1995-03-01), pages 1097 - 1108, XP000670213 * |
WILLIAMSON J. ET AL.: "AC U24561", EMBL DATABASE, 19 July 1995 (1995-07-19), Heidelberg, XP002107091 * |
Cited By (37)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7173164B2 (en) | 2000-03-31 | 2007-02-06 | International Flower Developments Pty. Ltd. | Plant anthocyanidin rutinoside aromatic acyl transferases |
WO2001072984A1 (en) * | 2000-03-31 | 2001-10-04 | International Flower Developments Pty. Ltd. | Plant anthocyanidin rutinoside aromatic acyl transferases |
WO2005003362A2 (en) * | 2003-03-10 | 2005-01-13 | Athenix Corporation | Methods to confer herbicide resistance |
WO2005003362A3 (en) * | 2003-03-10 | 2005-04-21 | Athenix Corp | Methods to confer herbicide resistance |
US7807881B2 (en) | 2003-03-10 | 2010-10-05 | Athenix Corp. | Methods to confer herbicide resistance |
US8829265B2 (en) | 2004-01-09 | 2014-09-09 | Syngenta Participations Ag | Melon plants |
WO2008153676A2 (en) * | 2007-05-21 | 2008-12-18 | The Regents Of The University Of California | Pentose phosphate pathway and fermentation enzyme-encoding nucleotide sequences with refined translational kinetics and methods of making same |
WO2008153676A3 (en) * | 2007-05-21 | 2009-03-05 | Univ California | Pentose phosphate pathway and fermentation enzyme-encoding nucleotide sequences with refined translational kinetics and methods of making same |
WO2012149009A3 (en) * | 2011-04-29 | 2012-12-20 | Bangladesh Jute Research Institute | Polynucleotides encoding enzymes from the jute lignin biosynthetic pathway |
JPWO2014038214A1 (ja) * | 2012-09-10 | 2016-08-08 | 三菱レイヨン株式会社 | メタクリル酸エステルの製造方法 |
WO2014038216A1 (ja) | 2012-09-10 | 2014-03-13 | 三菱レイヨン株式会社 | メタクリル酸及び/又はそのエステルの製造方法 |
WO2014038214A1 (ja) | 2012-09-10 | 2014-03-13 | 三菱レイヨン株式会社 | メタクリル酸エステルの製造方法 |
CN104619851A (zh) * | 2012-09-10 | 2015-05-13 | 三菱丽阳株式会社 | 甲基丙烯酸酯的制造方法 |
EP2848694B1 (en) | 2012-09-10 | 2018-08-01 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid ester |
US20150184207A1 (en) * | 2012-09-10 | 2015-07-02 | Mitsubishi Rayon Co., Ltd. | Method for producing methacrylic acid ester |
EP2848694A4 (en) * | 2012-09-10 | 2015-08-05 | Mitsubishi Rayon Co | PROCESS FOR THE PREPARATION OF METHACRYLIC ACID ESTERS |
KR20140092386A (ko) | 2012-09-10 | 2014-07-23 | 미쯔비시 레이온 가부시끼가이샤 | 메타크릴산 및/또는 그의 에스테르의 제조 방법 |
KR101561793B1 (ko) | 2012-09-10 | 2015-10-19 | 미쯔비시 레이온 가부시끼가이샤 | 메타크릴산에스테르의 제조 방법 |
JP2017136076A (ja) * | 2012-09-10 | 2017-08-10 | 三菱ケミカル株式会社 | メタクリル酸エステルの製造方法 |
JPWO2014038216A1 (ja) * | 2012-09-10 | 2016-08-08 | 三菱レイヨン株式会社 | メタクリル酸及び/又はそのエステルの製造方法 |
US10851392B2 (en) | 2012-09-10 | 2020-12-01 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid ester |
US10294500B2 (en) | 2012-09-10 | 2019-05-21 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid and/or ester thereof |
EP3395951A3 (en) * | 2012-09-10 | 2018-11-07 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid ester |
KR20170018099A (ko) | 2012-09-10 | 2017-02-15 | 미쯔비시 레이온 가부시끼가이샤 | 메타크릴산 및/또는 그의 에스테르의 제조 방법 |
EP3395951A2 (en) | 2012-09-10 | 2018-10-31 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid ester |
WO2015050904A3 (en) * | 2013-10-02 | 2015-05-28 | Fabric Media | Products combined with synthetic genetic material |
WO2015133146A1 (ja) * | 2014-03-07 | 2015-09-11 | 富山県 | メタクリル酸エステルの製造方法および新規メタクリル酸エステル合成酵素 |
EP3115460A4 (en) * | 2014-03-07 | 2017-05-03 | Mitsubishi Rayon Co., Ltd. | Method for producing methacrylic acid ester, and novel methacrylic acid ester synthase |
JPWO2015133146A1 (ja) * | 2014-03-07 | 2017-04-06 | 公立大学法人 富山県立大学 | メタクリル酸エステルの製造方法および新規メタクリル酸エステル合成酵素 |
EP3115460A1 (en) * | 2014-03-07 | 2017-01-11 | Mitsubishi Rayon Co., Ltd. | Method for producing methacrylic acid ester, and novel methacrylic acid ester synthase |
CN106062204A (zh) * | 2014-03-07 | 2016-10-26 | 三菱丽阳株式会社 | 甲基丙烯酸酯的制造方法及新的甲基丙烯酸酯合成酶 |
US10570426B2 (en) | 2014-03-07 | 2020-02-25 | Mitsubishi Chemical Corporation | Method for producing methacrylic acid ester and novel methacrylic acid ester synthetase |
KR20160108546A (ko) | 2014-03-07 | 2016-09-19 | 미쯔비시 레이온 가부시끼가이샤 | 메타크릴산에스테르의 제조 방법 및 신규 메타크릴산에스테르 합성 효소 |
WO2017167623A1 (en) * | 2016-03-30 | 2017-10-05 | Basf Se | Fermentative production of n-butylacrylate using alcohol acyl transferase enzymes |
US11913054B2 (en) | 2016-03-30 | 2024-02-27 | Basf Se | Fermentative production of n-butylacrylate using alcohol acyl transferase enzymes |
WO2021127648A1 (en) * | 2019-12-19 | 2021-06-24 | Auburn University | Microbial ester production |
CN115896137A (zh) * | 2022-12-01 | 2023-04-04 | 沈阳农业大学 | 一种南果梨PuAAT基因、其过表达载体及应用 |
Also Published As
Publication number | Publication date |
---|---|
CA2353577A1 (en) | 2000-06-08 |
AU1586200A (en) | 2000-06-19 |
BR9915881A (pt) | 2002-02-05 |
AU769932B2 (en) | 2004-02-12 |
NZ512208A (en) | 2003-12-19 |
EP1135507A1 (en) | 2001-09-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Laudert et al. | Cloning, molecular and functional characterization of Arabidopsis thaliana allene oxide synthase (CYP 74), the first enzyme of the octadecanoid pathway to jasmonates | |
AU769932B2 (en) | Fruit flavour related genes and use thereof | |
US7524678B2 (en) | Materials and methods for the alteration of enzyme and acetyl CoA levels in plants | |
US8017386B2 (en) | Divinyl ether synthase gene and protein, and uses thereof | |
US6274790B1 (en) | Nucleic acids encoding a plant enzyme involved in very long chain fatty acid synthesis | |
US5850022A (en) | Production of myristate in plant cells | |
US5654495A (en) | Production of myristate in plant cells | |
US6610527B1 (en) | Compositions and methods for Taxol biosynthesis | |
CA2547320C (en) | Fatty acid elongase (fae) genes and their utility in increasing erucic acid and other very long-chain fatty acid proportions in seed oil | |
AU750707C (en) | Nucleic acids encoding a plant enzyme involved in very long chain fatty acid synthesis | |
EP1006190A1 (en) | Fruit flavour related genes and use thereof | |
US6160203A (en) | DNA strands coding for glycerol-e-phosphate acyltransferase | |
AU2003291789B2 (en) | Enzymes and polynucleotides encoding the same | |
EP0692537A2 (en) | Recombinant gibberellin DNA and uses thereof | |
JP2002360248A (ja) | 除草的に活性な化合物の同定のためのvlcfaeの使用 | |
WO2003046163A2 (en) | Multifunctional caffeic acid o-methyltransferase | |
JP2004506406A (ja) | アレンオキシドシクラーゼ遺伝子およびジャスモン酸産生におけるその使用 | |
CA2700545C (en) | Novel genes involved in petroselinic acid biosynthesis and method for producing petroselinic acid | |
CA2437863C (en) | Isoprenoid synthases | |
Aluru | Molecular characterization of genes expressed in habanero (Capsicum chinense) placenta: A site of capsaicinoid biosynthesis | |
Wiens | Functional genomics of BAHD acyltransferases in different varieties of the wine grape, Vilis vinifera | |
MXPA00002004A (en) | Fatty acid hydroperoxide lyase nucleic acid sequences | |
JP2013074829A (ja) | テルピネオール合成酵素をコードするポリヌクレオチドおよびその用途 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENP | Entry into the national phase |
Ref country code: AU Ref document number: 2000 15862 Kind code of ref document: A Format of ref document f/p: F |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2353577 Country of ref document: CA Ref country code: CA Ref document number: 2353577 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 512208 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 15862/00 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999958511 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1999958511 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09857518 Country of ref document: US |
|
WWG | Wipo information: grant in national office |
Ref document number: 15862/00 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999958511 Country of ref document: EP |