WO1999040226A2 - Determination of a genotype of an amplification product at multiple allelic sites - Google Patents

Determination of a genotype of an amplification product at multiple allelic sites Download PDF

Info

Publication number
WO1999040226A2
WO1999040226A2 PCT/US1999/000499 US9900499W WO9940226A2 WO 1999040226 A2 WO1999040226 A2 WO 1999040226A2 US 9900499 W US9900499 W US 9900499W WO 9940226 A2 WO9940226 A2 WO 9940226A2
Authority
WO
WIPO (PCT)
Prior art keywords
allelic
probes
fluorescence
different
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/000499
Other languages
English (en)
French (fr)
Other versions
WO1999040226A3 (en
Inventor
Kenneth J. Livak
Federico Goodsaid
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Applied Biosystems Inc
Original Assignee
Perkin Elmer Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Perkin Elmer Corp filed Critical Perkin Elmer Corp
Priority to CA2318880A priority Critical patent/CA2318880C/en
Priority to JP2000530635A priority patent/JP4388694B2/ja
Priority to AU23144/99A priority patent/AU758463B2/en
Priority to AT99903026T priority patent/ATE469982T1/de
Priority to DE69942444T priority patent/DE69942444D1/de
Priority to EP99903026A priority patent/EP1053348B1/en
Publication of WO1999040226A2 publication Critical patent/WO1999040226A2/en
Anticipated expiration legal-status Critical
Publication of WO1999040226A3 publication Critical patent/WO1999040226A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6818Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer

Definitions

  • the invention relates generally to an assay for detecting an amplification product and more specifically to an assay for detecting the genotype of the amplification product at two or more different allelic sites.
  • nucleic acid sequence analysis is becoming increasingly important in many research, medical, and industrial fields, e.g. Caskey, Science 236: 1223- 1228 (1987); Landegren et al, Science, 242: 229-237 (1988); and Arnheim et al, Ann. Rev. Biochem., 61: 131-156 (1992).
  • the development of several nucleic acid amplification schemes has played a critical role in this trend, e.g.
  • PCR polymerase chain reaction
  • Innis et al editors, PCR Protocols (Academic Press, New York, 1990); McPherson et al, editors, PCR: A Practical Approach (IRL Press, Oxford, 1991); ligation-based amplification techniques, Barany, PCR Methods and Applications 1: 5-16 (1991); and the like.
  • PCR in particular has become a research tool of major importance with applications in cloning, analysis of genetic expression, DNA sequencing, genetic mapping, drug discovery, and the like, e.g. Arnheim et al (cited above); Gilliland et al, Proc. Natl. Acad.
  • Real time monitoring of a PCR permits far more accurate quantitation of starting target DNA concentrations in multiple-target amplifications, as the relative values of close concentrations can be resolved by taking into account the history of the relative concentration values during the PCR. Real time monitoring also permits the efficiency of the PCR to be evaluated, which can indicate whether PCR inhibitors are present in a sample.
  • Holland, et al. and others have proposed fluorescence-based approaches to provide measurements of amplification products during a PCR. Holland et al, PNAS(USA), 88: 7276-7280 (1991).
  • Such approaches have either employed intercalating dyes (such as ethidiurn bromide) to indicate the amount of double stranded DNA present (Higuchi et al, Biotechnology 10:413-417 (1992), Higuchi et al, Biotechnology 11:1026-1030 (1993), U.S. Patent 5,210,015) or they have employed oligonucleotide probes that are cleaved during amplification by 5' nuclease activity of the polymerase to release a fluorescent product whose concentration is a function of the amount of double stranded DNA present, commonly referred to as a 5' nuclease assay.
  • An example of a 5' nuclease assay is the assay used in the TaqmanTM LS-50 PCR Detection system (Perkin-Elmer).
  • 5' nuclease assays employ oligonucleotide probes labeled with at least one fluorescer and at least one quencher. Prior to cleavage of the probe, the at least one fluorescer excites the quencher(s) rather than producing a detectable fluorescence emission.
  • the oligonucleotide probe hybridizes to a target oligonucleotide sequence for amplification in PCR or similar amplification reactions.
  • the 5' ⁇ 3' nuclease activity of the polymerase used to catalyze the amplification of the target sequence serves to cleave the probe, thereby causing at least one fluorescer to be spatially separated from the one or more quenchers so that the signal from the fluorescer is no longer quenched.
  • a change in fluorescence of the fluorescer and/or a change in fluorescence of the quencher due to the oligonucleotide probe being digested is used to indicate the amplification of the target oligonucleotide sequence.
  • Lee, et al. has reported using PCR in combination with Taq polymerase to distinguish between different alleles at a single allelic site of the human cystic fibrosis gene.
  • Lee, et al Nucl. Acids Res. 21 :3761-3766 (1993).
  • Livak, et al. has reported distinguishing between alleles in the -23 A/T diallelic polymorphism of the human insulin gene where each allelic site was analyzed in a separate amplification reaction. Livak, et al., Nature Genetics, 9:341-342 (1995).
  • Neither Lee, et al. nor Lival, et al. teach how to distinguish between alleles variants at two or more allelic sites in a single amplification reaction.
  • the present invention relates to a method for identifying which members of a first set of two or more substantially homologous sequences are present in a sample of DNA and which members of a second, different set of two or more substantially homologous sequences are also present in the sample of
  • the members of the first and second sets present in the sample are identified in a single reaction.
  • the method includes the steps of: performing a nucleic acid amplification on a sample of DNA which includes a first set of substantially homologous sequences and a second, different set of substantially homologous sequences using a nucleic acid polymerase having 5' ⁇ 3' nuclease activity and one or more primers capable of hybridizing to the sample of DNA in the presence of two or more sets of oligonucleotide probes and amplifying the sets of substantially homologous sequences wherein: each set of substantially homologous sequences includes two or more members which each differ from each other at at least one base position, each set of oligonucleotide probes is for detecting the members of one of the sets of substantially homologous sequences, each set of oligonucleotide probes includes two or more probes which are complementary to different members of a set of substantially homologous sequences, the member being 5' relative to a sequence of the sample DNA to which the primer hybridizes, and at least all but one of the oligon
  • the present invention also relates to a method for determining a presence or absence of the different allelic variants at the two or more different allelic sites by a 5' nuclease amplification reaction.
  • the method includes the steps of: performing a nucleic acid amplification on a sample of DNA having at least two different allelic sites using a nucleic acid polymerase having 5 , ⁇ 3' nuclease activity and at least one primer capable of hybridizing to the sample of DNA and amplifying the at least two different allelic sites in the presence of two or more sets of allelic oligonucleotide probes wherein: each set of allelic oligonucleotide probes is for detecting a different allelic site, each set of allelic oligonucleotide probes includes two or more probes which are complementary to different allelic variants at the allelic site being detected by the set of probes, the allelic site being 5' relative to a sequence of the sample DNA to which the primer hybridizes, and at least all
  • a method for genotyping a sample of DNA at at least two allelic sites by a 5' nuclease amplification reaction includes the steps of: performing a nucleic acid amplification on a sample of DNA having at least two different allelic sites using a nucleic acid polymerase having 5' ⁇ 3' nuclease activity and at least one primer capable of hybridizing to the sample of DNA and amplifying the at least two different allelic sites in the presence of two or more sets of allelic oligonucleotide probes wherein: each set of allelic oligonucleotide probes is for detecting a different allelic site, each set of allelic oligonucleotide probes includes two or more probes which are complementary to different allelic variants at the allelic site being detected by the set of probes, the allelic site being 5' relative to a sequence of the sample DNA to which the primer hybridizes, and at least all but one of the allelic oligonucleotide probe
  • the present invention also relates to a fluorescence signature for genotyping a sample of DNA at at least two allelic sites.
  • the signature includes fluorescence signal contributions of at least three fluorescers to a fluorescence spectrum derived by performing one of the above methods.
  • the present invention also relates to a library of fluorescence signatures for a series of controls, i.e., sequences having known allelic variants at at least two allelic sites.
  • the library of fluorescence signatures can be used to determine which allelic variants are present in a sample of DNA whose genotype is being determined.
  • the present invention also relates to a method for determining a fluorescence signature of a sample of DNA.
  • fluorescence contributions of at least three fluorescers to a fluorescence spectrum taken from a nucleic acid amplification are calculated and normalized relative to an internal standard, the normalized fluorescence contributions corresponding to a fluorescence signature for the sample of DNA for the at least two different allelic sites.
  • the present invention also relates to a method for genotyping a sample of
  • DNA by comparing the fluorescence signature of the DNA sample to control sequences having known genotypes.
  • the present invention also relates to a processor and related instrument for genotyping a sample of DNA at at least two allelic sites by a 5' nuclease assay.
  • the processor includes logic for taking fluorescence spectra of control samples and at least one unknown sample which have undergone a 5' nuclease assay in the presence of allelic probes for the at least two allelic sites and fluorescence spectra of at least three fluorescers used in the 5' nuclease assay and using these spectra to calculate normalized fluorescence contributions of the at least three fluorescers to the unknown and control fluorescence spectra; and logic for determining a genotype of the at least one unknown sample at two or more different allelic sites based on a comparison of the normalized fluorescence contributions of the at least three fluorescers to the spectrum of the unknown sample and normalized fluorescence contributions to the spectra of the control samples.
  • the present invention also relates to a kit for determining which members of at least two different sets of substantially homologous sequences are present in a sample of DNA.
  • the kit includes two or more sets of oligonucleotide probes wherein: each set of oligonucleotide probes is for detecting a different set of substantially homologous sequences, each set of oligonucleotide probes includes two or more probes which are complementary to different members of a set of substantially homologous sequences, and at least all but one of the allelic oligonucleotide probes include a different fluorescer than the other probes and a quencher positioned on the probe to quench the fluorescence of the fluorescer.
  • the present invention also relates to a kit for genotyping a sample of DNA at at least two allelic sites.
  • the kit includes two or more sets of allelic oligonucleotide probes wherein: each set of allelic oligonucleotide probes is for detecting a different allelic site, each set of allelic oligonucleotide probes includes two or more probes which are complementary to different allelic variants at the allelic site being detected by the set of probes, and at least all but one of the allelic oligonucleotide probes include a different fluorescer than the other probes and a quencher positioned on the probe to quench the fluorescence of the fluorescer.
  • the allelic probes are complementary to allelic sites on a target sequence which are separated by between about 50 and 150 bases, more preferably less than 100 bases.
  • the allelic probes optionally have a %GC of at least about 20% and less than about 80%. All of the allelic probes optionally have less than four contiguous guanines. In one embodiment, none of the allelic probes have a guanine at the 5' end.
  • the probes have a melting point temperature (T m ) that is about 3-5°C greater than the annealing temperature used in the amplification reaction. In another variation, the probes have melting point temperatures about 65-70°C, more preferably about 65-67°C.
  • the kit also includes one or more amplification primers.
  • the probe melting point temperature (T m ) is about 5-10 °C greater than the primer's T m , and preferably about 7 °C greater.
  • the primers have a melting point temperature (T,enfin) of about 55-65°C, preferably about 58-63°C, more preferably about 58-60°C.
  • T,III melting point temperature
  • the primer preferably has two or less guanines or cytosines among the five nucleotides at a 3' end of the primer.
  • Figures 1A-1D illustrate the steps of a 5* nuclease assay.
  • Figure 1A illustrates the polymerization of forward and reverse primers.
  • Figure IB illustrates strand displacement of the fluorescer-quencher probe by the 5' ⁇ 3' nuclease activity of a nucleic acid polymerase.
  • Figure 1C illustrates cleavage of the fluorescer by the polymerase.
  • Figure ID illustrates completion of the amplification of the target sequence.
  • Figure 2 illustrates how the 5' nuclease assay can be used to identify the genotype of a target sequence at a single allelic site.
  • Figure 3 shows fluorescence spectra observed in an allelic discrimination experiment such as the one illustrated in Figure 2.
  • Figures 4A-4D illustrates how fluorescer-quencher probes for two or more different allelic sites and a 5' nuclease assay can be used to genotype a target sequence at the two or more different allelic sites.
  • Figure 4A illustrates a nucleic acid amplification reaction being performed on a target sequence having two allelic sites using a nucleic acid polymerase having 5'-» 3' nuclease activity and a primer capable of hybridizing to the target sequence.
  • Figure 4B illustrates the nucleic acid polymerase extending the forward and reverse primers.
  • Figure 4C illustrates extension of the primers continuing and the polymerase performing strand displacement.
  • Figure 4D illustrates the fluorescers and quenchers attached to the digested allelic probes being displaced from the target sequence.
  • Figures 5A-5C illustrates how fluorescer-quencher probes for two or more different allelic sites and a 5' nuclease assay can be used to genotype a sample of DNA at two or more different allelic sites using a different primer for each allelic site.
  • Figure 5 A illustrates a nucleic acid amplification reaction being performed on a DNA sequence using a nucleic acid polymerase having 5 , ⁇ 3' nuclease activity and two primers capable of hybridizing to different DNA sequences.
  • Figure 5B illustrates the nucleic acid polymerase extending the primers and releasing fluorescers for the different allelic sites.
  • Figure 5C illustrates the fluorescers and quenchers attached to the digested allelic probes being displaced from the DNA.
  • Figures 6A and 6B illustrate the impact of having longer or shorter distances between the primer and probe.
  • Figure 6 A illustrates the sequence of a double stranded amplicon with inner and outer primers for amplification of the double stranded amplicon.
  • Figure 6B illustrates amplification curves comparing the fluorescence signal generated when different combinations of primers and probes are used.
  • Figure 7 illustrates that a probe with more Cs than Gs performs better in the 5' nuclease assay.
  • Figures 8 A and 8B illustrate sequences for Amelogenin X and Amelogenin Y respectively from which an amplicon, primers and probe are to be determined.
  • Figure 9 illustrates a comparison of a portion of Amelogenin X to a portion of Amelogenin Y where the symbol
  • Figure 10 illustrates a portion of Amelogenin X ( bases 50-750) with the allelic site to be identified by the 5' nuclease assay illustrated in bold.
  • Figure 11 illustrates bases 251 -500 of Amelogenin X illustrated in Figure
  • Figure 12 illustrates the Amelogenin X amplicon selected by this process.
  • Figure 13 illustrates the normalized relative contributions of FAM, TET, JOE, and TAMRA to spectra derived from performing the above-described 5' nuclease assay on apoE alleles e2, e3, and e4 and on a sample with no template (NT).
  • Figure 14 illustrates a plot of allele value versus well for the ApoE genotyped samples.
  • Figure 15 illustrates a scatter plot diagram of e3 versus e4 for the data shown in Figure 14.
  • oligonucleotide includes linear oligomers of natural or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, and the like; capable of specifically binding to other oligonucleotide sequences by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of basepairing, or the like.
  • monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g., 3-4, to several tens of monomeric units.
  • oligonucleotide is represented by a sequence of letters, such as "ATGCCTG", it will be understood that the nucleotides are in 5' ⁇ 3' order from left to right and that "A” denotes deoxyadenosine, "C” denotes deoxycytidine, “G” denotes deoxyguanosine, and "T” denotes thymidine, unless otherwise noted.
  • Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoranilidate, phosphoramidate, and the like.
  • Target oligonucleotide sequence refers to the sequence which is amplified according to the present invention in order to determine its genotype.
  • the target oligonucleotide sequence is also referred to as the amplicon of the 5' nuclease assay.
  • Oligonucleotide probe refers to the oligonucleotide sequence containing at least one fluorescer and at least one quencher which is digested by the 5' endonuclease activity of the polymerase in order to detect any amplified target oligonucleotide sequences.
  • the oligonucleotide probes used in the invention will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' ⁇ 3' nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers.
  • Perfectly matched in reference to a duplex means that the oligonucleotide strands making up the duplex form a double-stranded structure with one other such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand.
  • the term also comprehends the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2-aminopurine bases, and the like, that may be employed.
  • a mismatch in a duplex between a target oligonucleotide sequence and an oligonucleotide probe or primer means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding.
  • substantially homologous sequences refers to two or more sequences (or subregions of a sequence) which are homologous except for differences at one or more base positions. Two allelic variants which differ by only one nucleotide is an example of a set of substantially homologous sequences. The substantially homologous sequences are preferably at least 90% homologous.
  • nucleoside includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g., as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).
  • "Analogs" in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g., described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990), or the like, with the only proviso that they are capable of specific hybridization.
  • Such analogs include synthetic nucleosides designed to enhance binding properties, reduce degeneracy, increase specificity, and the like.
  • the present invention relates to a 5' nuclease assay in which a first set of fluorescer-quencher probes is used to identify which members of a first set of two or more substantially homologous sequences are present in a sample of DNA and a second set of fluorescer-quencher probes is used in the same reaction to identify which members of a second set of two or more substantially homologous sequences are also present in the sample of DNA.
  • the 5' nuclease assay is performed in a single reaction containing both the first and second sets of probes.
  • the assay enables one to determine which members of first set of substantially homologous sequences are present in the sample while simultaneously enabling one to determine which members of second set of substantially homologous sequences are present in the sample.
  • One application of the 5' nuclease assay is determining the genotype of a sample of genomic DNA at the two or more different allelic sites.
  • the two or more different allelic sites may be on a single strand of DNA or may be on different strands of DNA.
  • the two or more different allelic sites may be amplified by a single amplification primer, for example when the allelic sites are on the same strand of DNA and adjacent each other, or by multiple different amplification primers.
  • the present invention also relates to a 5' nuclease assay adapted to determine the allelic genotype of a sample of DNA at multiple allelic sites, devices and kits for performing the assay, and the fluorescence spectrum and fluorescence signature produced by performing the assay.
  • the present invention also relates to devices, logic and software used to analyze the fluorescence spectrum and fluorescence signature produced by performing the assay.
  • performance of the assay of the present invention produces a fluorescence spectrum which is characteristic of a sample of DNA which includes a particular combination of members of the multiple sets of the two or more substantially homologous sequences in the sample of DNA.
  • performance of the assay when used to determine the genotype of a sample of DNA at two or more allelic sites, produces a fluorescence spectrum which is characteristic of a sample of DNA having that genotype which has been subjected to the assay, i.e., using the particular temperatures, primers and probes used to perform the assay.
  • a fluorescence signature can be produced which is characteristic of a sample of DNA.
  • the fluorescence signature of a given unknown sample can then be compared to that of samples having the various different known combinations of members in order to determine which members of the two or more sets are present in the sample.
  • the fluorescence signature produced as a result of performing the assay can be compared to the fluorescence signatures of the various known genotypes in order to determine the genotype of the unknown sample.
  • the present invention utilizes a variation of a 5' nuclease assay in order to determine the presence of members of two different sets of substantially homologous sequences in a sample of DNA.
  • a 5' nuclease assay involves the digestion of an oligonucleotide probe containing a fluorescer and quencher during a nucleic acid amplification reaction to evidence the amplification of a particular member.
  • Figures 1 A- ID illustrate the steps of a 5' nuclease assay.
  • a nucleic acid amplification reaction is performed on a target sequence (double stranded sequence 10) using a nucleic acid polymerase (not shown) having 5' ⁇ 3' nuclease activity and a primer (forward and reverse primers 12, 14) capable of hybridizing to the target sequence 10 in the presence of an oligonucleotide probe
  • the oligonucleotide probe 16 which is capable of hybridizing to the target sequence downstream relative to one of the primers.
  • the oligonucleotide probe 16 includes a fluorescer (F) and quencher (Q).
  • the binding site of the oligonucleotide probe 16 is located downstream (3') relative to the binding site for the forward primer 14 used to amplify the target sequence 10.
  • the oligonucleotide probe 16 is preferably constructed such that the polymerase can not extend the 3' end of the probe. This may be accomplished by attaching the fluorescer or quencher to the terminal 3' carbon of the oligonucleotide probe by a linking moiety.
  • the nucleic acid polymerase extends the forward and reverse primers 12, 14.
  • PCR is carried out using a Taq DNA polymerase, e.g., AMPLITAQTM or AMPLITAQTM Gold
  • thermostable DNA polymerase (Perkin-Eimer, Norwalk, CN), or an equivalent thermostable DNA polymerase.
  • the polymerase During extension of the primer, the polymerase encounters the probe hybridized to the target sequence and performs strand displacement by digesting the probe. As illustrated in Figure 1C, digestion of the probe results in release of the fluorescer (or quencher) from the probe. This causes the fluorescer and quencher on the probe to become spatially separated from each other, thereby creating a change in fluorescence in the sample to indicate the extension of the primer 12 and hence the amplification of the target sequence 10. As illustrated in Figure ID, both the fluorescer and quencher are ultimately displaced from the target sequence.
  • nucleic acid amplification reactions employing fluorescer-quencher probes can be found in many publications, including, for example, Holland, et al., PNAS (USA) 88:7276-7280 (1992); Holland, et al., Clinical Chemistry, 38:462-463 (1992); Lee, et al., Nucleic Acid Research, 21 : 3761-3766 (1993), Livak, et al., PCR Methods and Applications, 4:357-362 (1995) and U.S. Application Serial No. 08/559,405 which is incorporated herein by reference.
  • the fluorescer can be any molecule capable of generating a fluorescence signal.
  • the quencher molecule can be any molecule capable of absorbing the fluorescence energy of the excited fluorescer, thereby quenching the fluorescence signal that would otherwise be released from the excited fluorescer.
  • the quencher In order for a quencher molecule to quench an excited fluorescer, the quencher must generally be within a minimum quenching distance of the excited fluorescer at some time prior to the fluorescer releasing the stored fluorescence energy.
  • a variety of different fluorescer-quencher probes have been developed for use in this method.
  • probes were developed where the fluorescer and quencher were always in close proximity with each other on the probe so that the quencher efficiently quenched the fluorescer.
  • the design of fluorogenic probes has since been simplified by the discovery that probes with a reporter dye on the 5' end and a quencher dye on the 3' end exhibit adequate quenching for performance in the 5' nuclease assay. Livak, et al., PCR Methods and Applications 4: 357-362 (1995).
  • probes have been developed where the fluorescer and quencher are positioned such that they exist in at least one single-stranded conformation when unhybridized where the quencher molecule quenches the fluorescence of the fluorescer and exist in at least one conformation when hybridized to a target oligonucleotide sequence where the fluorescence of the fluorescer is unquenched.
  • the fluorescer and quencher need not be positioned at a specific distance within a probe in order to achieve effective quenching to be detected. This facilitates the design and synthesis of these probes.
  • Probes have also been developed where the probe hybridizes to itself to form a loop such that the quencher molecule is brought into proximity with the fluorescer in the absence of a complementary nucleic acid sequence to prevent the formation of the hairpin structure.
  • probes specific for allele A and allele B are included in the PCR assay.
  • the probes can be distinguished by labeling each with a different fluorescent reporter dye, illustrated in the figure as FAM (6-carboxy-fluorescein) and TET (6-carboxy-
  • FIG 3 shows fluorescence spectra observed in an allelic discrimination experiment such as the one illustrated in Figure 2.
  • each of the three possible genotypes has a spectrum distinct from each other and from the spectrum of unreacted probe (no DNA).
  • the genotype of the unknown sample can be determined. For example, a substantial increase in the FAM or TET fluorescent signal indicates homozygosity for the allele that is complementary to the probe containing the fluorescer whose signal increased. An increase in both FAM and TET signals indicates heterozygosity.
  • the fluorescence spectra of FAM and TET have significant overlap. As can be seen from Figure 3, it is difficult to distinguish between a spectrum having a strong FAM signal (1/1 homozygote), a spectrum having a strong TET signal (2/2 homozygote), and a spectrum having a moderate FAM and TET signals (heterozygote).
  • the use of additional allelic probes having additional fluorescers in the same assay would further complicate the differentiation of fluorescence spectra derived from different genotypic samples.
  • Applicants provide an assay for determining the genotype of a target sequence at multiple allelic sites using at least four allelic probes having a total of at least three different fluorescers by determining a fluorescence signature for each sample based on the fluorescence spectra produced via the 5' nuclease assay.
  • the present invention relates to an adaption of a 5' nuclease assay, such as the assay illustrated in Figures 1A-1D, to determine the presence of members of two different sets of substantially homologous sequences in a sample of DNA in a single assay. While the present invention will now be described with regard to the detection of a multiple allelic genotype of a sample of genomic DNA, it is noted that the invention is not intended to be limited to this particular application but rather is intended to be applicable generically to the identification of members of multiple sets of two or more substantially homologous sequences in a sample of
  • Figures 4A-4D and 5 A-5D illustrate how fluorescer-quencher probes for two or more different allelic sites and the 5' nuclease assay can be used to genotype a sample of DNA at the two or more different allelic sites. It is noted that DNA for only a single genotype is illustrated in Figures 4A-4D and 5A-5D. It should be noted that if a sample of DNA contains DNA for more than one genotype, i.e., a heterozygote, different groups of probes will hybridize to the DNA for each genotype.
  • Figures 4A-4D illustrate performance of the 5' nuclease assay where the two or more different allelic sites are sufficiently near each other on the same strand of DNA such that it is possible to amplify both allelic sites with a single primer.
  • Figures 5A-5D illustrate the performance of the 5' nuclease assay where the two or more different allelic sites are amplified using different primers.
  • a nucleic acid amplification reaction is performed on a target sequence (double stranded sequence 40) using a nucleic acid polymerase (not shown) having 5'- 3' nuclease activity and a primer (forward and reverse primers 42, 44) capable of hybridizing to the target sequence 40.
  • the amplification reaction is performed in the presence of a first set of allelic probes 46A, 46B for a first allelic site 47 and a second set of allelic probes 48 A, 48B for a second allelic site 49.
  • Each set of allelic probes includes at least two probes which differ from each other by at least one nucleotide. All of the allelic probes are complementary to allelic sites on the target sequence which are downstream (3') relative to the sequence to which one of the primers is complementary. As illustrated in Figure 4A, all but one of the allelic probes includes a different fluorescer (F l5 F 2 , F 3 ) and a quencher (Q).
  • the allelic probe 48B which does not include a fluorescer optionally can include a fluorescer.
  • the fluorescer on allelic probe 48B should be different than the other fluorescers (i.e., F 4 ).
  • one of the probes from the first set (46A) hybridizes to the first allelic site 47 and one of the probes from the second set (48A) hybridizes to the second allelic site 49. While only one probe from each set is shown to hybridize to a particular allelic site, it should be noted that other probes of the set can also hybridize to the site. In this regard, the different allelic probes of each set compete to hybridize to the allelic site.
  • the allelic probe which perfectly matches the allelic site will be thermodynamically favored for hybridizing to the allelic site over probes in the set which include a mismatch.
  • cleavage of the allelic probe by the polymerase is more efficient for perfectly matched allelic probes than for allelic probes with a mismatch.
  • the nucleic acid polymerase extends the forward and reverse primers 42, 44.
  • PCR is carried out using a Taq DNA polymerase, e.g., AMPLITAQTM or AMPLITAQTM Gold (Perkin-Elmer, Norwalk, CN), or an equivalent thermostable DNA polymerase.
  • a Taq DNA polymerase e.g., AMPLITAQTM or AMPLITAQTM Gold (Perkin-Elmer, Norwalk, CN), or an equivalent thermostable DNA polymerase.
  • the polymerase encounters whichever allelic probe is hybridized to the first allelic site (illustrated as probe 46A) and performs strand displacement by beginning to digest that probe. As illustrated in Figure 4B, digestion of that probe results in the release of the fluorescer (shown as F,) attached to that digested allelic probe.
  • extension of the primers continues and the polymerase encounters whichever allelic probe is hybridized to the second allelic site (illustrated as probe 48 A) and performs strand displacement by digesting that probe.
  • digestion of that probe results in the release of the fluorescer (shown as F 3 ) attached to that digested allelic probe.
  • both the fluorescers and quenchers attached to the digested allelic probes are ultimately displaced from the target sequence.
  • a fluorescence spectrum of the sample is taken after at least one amplification cycle which reflects the relative number of the different fluorescers and quenchers which have been released.
  • Figures 5A-5C illustrate the performance of the 5' nuclease assay where the two or more different allelic sites are amplified using different primers.
  • a nucleic acid amplification reaction is performed on a two separate sequences (double stranded sequences 50, 51) using a nucleic acid polymerase (not shown) having 5'- 3' nuclease activity and primers (forward 52, 53 and reverse primers 54, 55) capable of hybridizing to each target sequence 50, 51.
  • primers forward 52, 53 and reverse primers 54, 55
  • the amplification reaction is performed in the presence of a first set of allelic probes 56 A, 56B for a first allelic site 57 and a second set of allelic probes 58 A, 58B for a second allelic site 59.
  • Each set of allelic probes includes at least two probes which differ from each other by at least one nucleotide.
  • allelic probes are complementary to allelic sites on the target sequence which are downstream (3') relative to the sequence to which one of the primers is complementary. As illustrated in Figure 5 A, all but one of the allelic probes includes a different fluorescer (F,, F 2 , F 3 ) and a quencher (Q).
  • the allelic probe 58B which does not include a fluorescer optionally can include a fluorescer.
  • the fluorescer on allelic probe 58B should be different than the other fluorescers (i-e., F 4 ).
  • one of the probes from the first set (56 A) hybridizes to the first allelic site 57 and one of the probes from the second set (58 A) hybridizes to the second allelic site 59. While only one probe from each set is shown to hybridize to a particular allelic site, it should be noted that other probes of the set can also hybridize to the site.
  • the nucleic acid polymerase (not shown) extends the forward and reverse primers 52, 53, 54, and 55.
  • PCR is carried out using a Taq DNA polymerase, e.g., AMPLITAQTM or AMPLITAQTM
  • thermostable DNA polymerase (Perkin-Elmer, Norwalk, CN), or an equivalent thermostable DNA polymerase.
  • the polymerase encounters whichever allelic probe is hybridized to the first allelic site (illustrated as probe 56 A) and performs strand displacement by beginning to digest that probe.
  • the polymerase also encounters whichever allelic probe is hybridized to the second allelic site
  • probe 58 A (illustrated as probe 58 A) and performs strand displacement by beginning to digest that probe.
  • digestion of that probe results in the release of fluorescers (shown as F,, F 3 ) attached to the digested allelic probes.
  • fluorescers shown as F,, F 3
  • both the fluorescers and quenchers attached to the digested allelic probes are ultimately displaced from the sequence being amplified.
  • a fluorescence spectrum of the sample is taken after at least one amplification cycle which reflects the relative number of the different fluorescers and quenchers which have been released.
  • a number of factors contribute to the assay's ability to discriminate between perfectly matched allelic probes and probes with only a single mismatch, even a single mismatch within a probe that is 20-30 nucleotides long.
  • a mismatch has a disruptive effect on hybridization which make perfectly matching probes thermodynamically favored over mismatched probes. For example, a mismatched probe will have a lower melting temperature (T m ) than a perfectly matched probe.
  • mismatches have an even greater disruptive effect on hybridization than single mismatches.
  • multiple mismatch probes are even less thermodynamically favored than perfectly matched probes.
  • Proper choice of an annealing/extension temperature in the PCR will favor hybridization of an exact-match probe over a mismatched probe.
  • the thermal window defining this choice is bracketed by the thermal transitions for the binding of a probe to its homologous or heterologous targets. By raising or lowering the annealing temperature, discrimination against a mismatch can be increased or reduced respectively.
  • One of the features of the 5' nuclease assay which enables its use for distinguishing between different substantially homologous sequences at multiple different sites (such as identifying different alleles at multiple allelic sites) is the inefficient cleavage of probes when there is even a single mismatch within a probe that is 20-30 nucleotides long.
  • the assay is performed under competitive conditions. Multiple probes to the same allelic site are present in the same reaction vessel. Part of the discrimination against a mismatch is that the probe that is perfectly matched functions to prevent the mismatched probe from binding because of the perfectly matched probe's stable hybridization to the sequence being amplified.
  • the 5' end of the allelic probe must also be displaced before it is cleaved.
  • the 5' nuclease activity of Taq DNA polymerase is believed to recognize a forked structure with a displaced 5' strand of 1-3 nucleotides. Landegren, et al., Science
  • a key advantage of the present invention for determining the genotype of a sample of DNA at multiple allelic sites is that it does not rely on the 5' nuclease assay working with 100% efficiency to distinguish between substantially homologous sequences such as alleles, i.e., where only perfectly matched allelic probes are cleaved and no mismatched allelic probes are cleaved. Rather, the present invention assumes that a certain degree of inefficiency occurs and relies on that degree of inefficiency to be highly consistent sample to sample. By generating a fluorescence spectrum and a fluorescence signature for each genotype which uniquely reflects the assay's inherent inefficiency for that genotype given the particular conditions, probes and primers used, the genotype of unknown sequences can be determined.
  • An important aspect of the present invention is the processing of a fluorescence spectrum generated by performing the 5' nuclease assay in order to determine which members of the sets of substantially homologous sequences are present, for example, in order to determine the genotype of a genomic sample of DNA.
  • the fluorescence signal generated by the fluorescers and quenchers present in the reaction mixture will change as the DNA sample is amplified and several of the allelic probes are digested.
  • the fluorescence signal from the reaction mixture will include contributions from the different fluorescers (F F 2 and F 3 ), the quencher, as well as from an internal standard. In order to determine which allelic probes were digested and what genotype is present, it is necessary to unravel the different contributions of the allelic probes and their fluorescent components to that spectrum.
  • the first step in the analysis of a fluorescence signal derived from a 5' nuclease reaction is the creation of a reference library of spectra of the fluorescers and quenchers on the allelic probes used in the 5' nuclease assay. These spectra are expressed as normalized 1 x n matrixes of fluorescence intensity values where n represents fluorescence measurements at a series of n wavelengths, n preferably being 32 values. The matrixes are normalized by setting the largest value in the matrix to 1.
  • the reference library of spectra and their associated 1 x n matrixes can be stored in a database or taken at the time of analysis.
  • a 5' nuclease assay is then performed on a series of samples including samples containing genomic DNA whose genotype is known ("Control”); samples containing genomic DNA whose genotype is unknown (“Unknowns”); and samples containing no template ("NT").
  • Fluorescence spectra are taken of the control and unknown samples and expressed as 1 x n matrixes of fluorescence intensity values where n represents fluorescence measurements at a series of n wavelengths, n preferably being 32 values.
  • the matrixes may optionally be normalized by setting the largest value in the matrix to 1.
  • the 1 x n matrixes representing the fluorescent spectra of the control and unknown spectra are then analyzed to determine the relative fluorescent contributions of the fluorescent species present in the 5' nuclease assay using the 1 x n matrix representations of the reference library spectra. Determination of the relative fluorescent contributions of the different fluorescent species can be performed by the multicomponent analysis method described in Application Serial No. 08/659, 115 entitled "MULTICOMPONENT ANALYSIS METHOD
  • the contributions of the different fluorescent species are normalized using a passive fluorescent internal standard.
  • the internal standard is passive in the sense that its fluorescence does not significantly change during a nucleic acid amplification reaction.
  • the use of an internal standard in nucleic acid amplification reactions and for normalizing fluorescence spectra is described in Application Serial No. 08/657,989 entitled "PASSIVE INTERNAL REFERENCES FOR THE DETECTION OF NUCLEIC ACID AMPLIFICATION
  • PRODUCTS which is incorporated herein by reference.
  • fluorescence signature is used herein to describe the relative contributions of the different fluorescent species to the spectra produced by performance of the 5' nuclease assay because the relative contributions can be used to distinguish the spectra of the different controls from each other and can also be used to identify the genotype of an unknown sample of DNA based on a comparison of the relative contributions to the spectrum for the unknown to the relative contributions to the spectra for the different controls.
  • the fluorescence signature is not only dependent on which members of the sets of substantially homologous sequences present in the sample (e.g., which allelic variants are present) but is also dependent on a series of assay dependent variables including the given 5' nuclease assay conditions (time, temperature), the probes, primers and polymerase used, the relative hybridization competition between the probes and the algorithm used to calculate the contribution of the different fluorescent species.
  • assay dependent variables including the given 5' nuclease assay conditions (time, temperature), the probes, primers and polymerase used, the relative hybridization competition between the probes and the algorithm used to calculate the contribution of the different fluorescent species.
  • the determination of fluorescence signatures for ApoE genotyping is described below.
  • the fluorescence signature of each unknown is compared to the fluorescence signatures of each of the controls and the NT in order to genotype each unknown. If the amplification reaction was successful, the fluorescence signature of the unknown should match the fluorescence signature of a single control or a 50-50 mixture of two controls for a heterozygote. If the amplification reaction was unsuccessful, the fluorescence signature of the unknown will not match any of the controls and should match the NT signature. As an example of the present invention, the determination of ApoE genotypes from fluorescence signatures is described below.
  • the present invention also relates to a kit for determining which members of at least two different sets of substantially homologous sequences are present in a sample of DNA.
  • the kit may be for determining the genotype of a sample of genomic DNA at at least two different allelic sites using a 5' nuclease assay.
  • the kit may also be for differentiating between two or more sets of two or more substantially homologous sequences where the substantially homologous sequences are not related to each other as allelic variants, for example, sequences from different strains of microorganisms.
  • the kit includes at least two sets of probes where each set of probes is for distinguishing between two or more substantially homologous sequences, the two or more substantially homologous sequences differing from each other by at least one nucleotide, and each probe in the set perfectly matching one of two or more substantially homologous sequences.
  • the kit may optionally also include additional sets of probes, amplification primers and
  • the probes of the two or more sets include at least three different fluorescers.
  • One probe may optionally not include a fluorescer or include a fluorescer which is present in a different set.
  • the at least two sets of probes should be selected so as to produce distinguishable fluorescence signatures for the different genotypes being detected.
  • the kit includes at least a first set of allelic probes for genotyping a first allelic site and second set of allelic probes for genotyping a second allelic site.
  • the kit may optionally also include additional sets of allelic probes, amplification primers and or a polymerase for use in the assay.
  • Each set of probes includes at least two probes which are capable of hybridizing to the allelic site but differ from each other by at least one nucleotide.
  • the allelic probes of the two or more sets include at least three different fluorescers.
  • One probe may optionally not include a fluorescer or include a fluorescer which is present in a different set. The at least two sets of probes should be selected so as to produce distinguishable fluorescence signatures for the different genotypes being detected.
  • the kit may also include sample DNA which can serve as a control in the assay.
  • the sample DNA can include specific members of the substantially homologous sequences.
  • the sample DNA has a known genotype at first and second allelic sites.
  • the kit may also include a fluorescent material for use as a passive internal standard.
  • the kit may also include buffer or other reagents for performing the 5' nuclease assay.
  • the following guidelines have been developed for performing a 5' nuclease assay such as the assay used in the present invention to detect the genotype of a sample of DNA at an allelic site.
  • the guidelines assist one of ordinary skill in the selection of the primer sequences, probe sequences and the section of sequence to be amplified (the amplicon) in the assay.
  • Figure 6 A illustrates the sequence of a double stranded amplicon 62. Also illustrated are sequences for inner 64, 64' and outer 66, 66' primers (sequences in arrows) for amplification of the double stranded amplicon 62. Also illustrated are sequences for oligonucleotide probes 68, 68' (small case) for use in the fluorescence-based detection method.
  • Figure 6B illustrates amplification curves (1) where two inner primers (64, 64') are used; (2) where inner and outer primers (64, 66') are used; (3) where inner and outer primers
  • the %GC percentage of bases in a sequence which are either G or C
  • the %GC should be at least about 20% and less than about of 80%. This acceptable %GC range is quite broad. The reason for this flexibility is that primers and probes which meet the tight T m ranges defined below can be designed within this broad range of %GC.
  • the primers should be selected to hybridize to a region which is conserved between different sources of DNA. If the primer selected hybridizes to a polymorphic region, the primer will or will not amplify DNA in the sample depending on the source of the sample. By selecting a primer which hybridizes to a non-polymorphic region, the primer should be able to amplify most samples.
  • the primers and probes should have less than four contiguous guanines (G). The requirement for no more than 3 contiguous Gs stems from the reduced yield of reactions in which these structures are found. This reduced yield is due to the relatively stable secondary structure created when 4 or more contiguous Gs are found.
  • the probe melting point temperature (T m ) is about 3- 5°C greater than the annealing temperature used in the amplification reaction and the primer melting point temperature (T ra ) is about 2-4°C less than the annealing temperature.
  • the annealing temperature is about 60-64°C and is more preferably about 62°C.
  • the probe melting point temperature is preferably about 65-67°C and the primer melting point temperature is preferably about 58-60°C.
  • the probe melting point temperature (T m ) is preferably about 5-10 °C greater than the primer's T m , more preferably about 7 °C greater.
  • the probe has a melting point temperature (T m ) of about 65-70°C, more preferably about 65-67°C.
  • the primers preferably have a melting point temperature (T m ) of about 55-65°C, more preferably about 58-63°C, most preferably about 58-60°C.
  • the strand When selecting which strand of a double stranded target to make the probe complementary to, it is preferred to choose the strand where the resulting probe has more Cs than Gs. This requirement is based on the observation that a probe with more Cs than Gs yields probes which perform better in the 5' nuclease assay, as illustrated in the result shown in Figure 7.
  • the probe sequence should not have a guanine (G) at the 5' end. This is because a G adjacent to the fluorescer quenches the fluorescer fluorescence somewhat even after cleavage.
  • the primers should be selected after the probe preferences are applied and potential probe sequences are selected.
  • the primers are preferably chosen to bracket the probe within the shortest possible amplicon length.
  • the primer sequence is preferably selected to be as close as possible to the probes without overlapping the probes.
  • Amplicons are preferably less than 150 bp in length and more preferably are less than about 100 bp in length. Short amplicons are preferred because shorter sequences increase the probability that the PCR amplification will work.
  • the forward and reverse primers should be as close as possible to the probe without overlapping the probe.
  • the primers preferably have a melting point temperature about 2-4°C below the annealing temperature used in the amplification. For example, when a preferred annealing temperature of 62° is used, the melting point temperature of the primers is preferably about 58-60°C .
  • the five nucleotides at the 3' end of the forward and reverse primers should have only one or two guanines (G) or cytosines (C).
  • the primers should also preferably be chosen with relatively unstable 3' ends in order to reduce non-specific priming.
  • Such primers typically have no more than 2 guanines (G) and cytosines (C) total among the last five 3' end nucleotides.
  • Figures 8A and 8B illustrate sequences for Amelogenin X [SEQ. I.D. NO. 1] and Amelogenin Y [SEQ. I.D. NO. 2] respectively from which an amplicon, primers and probe are to be determined.
  • Figure 9 illustrates a comparison of a portion of Amelogenin X to a portion of Amelogenin Y where the symbol
  • Figure 10 illustrates a portion of Amelogenin X ( bases 50-750). with the allelic site to be identified by the 5' nuclease assay illustrated in a bold.
  • Figure 11 illustrates a bases 251 -500 of Amelogenin X illustrated in Figure 10 along with its complementary (antisense) strand. [SEQ. I.D. NO. 3]. The allelic site to be identified by the 5' nuclease assay is indicated in bold.
  • a probe complementary to the allelic site of Amelogenin X to be detected is then selected.
  • the probe should be selected to be complementary to either the sense or antisense strand based on which probe has more Cs than G's.
  • the length of the probe should be adjusted so that the probe has the desired melting point temperature, preferably between about 65-67°C.
  • the following probe is an example of a suitable probe for this allelic site of Amelogenin X based on this selection process: CCAGCAACCAATGATGCCCGTT [SEQ. I.D. NO. 4] .
  • the forward primer to be used in the assay is then selected by searching for primers complementary to a region of Amelogenin X which is closest to the allelic site and uninterrupted by polymorphisms between Amelogenin X and Amelogenin Y.
  • the reverse primer to be used in the assay is then selected by searching for suitable primers which are also uninterrupted by polymorphisms between
  • FIG. 12 illustrates the Amelogenin X amplicon selected by this process with the forward and reverse promoters indicated by the arrows. The allelic site is indicated in shadow.
  • the striked-out sequences are sequences where polymorphisms between Amelogenin X and Amelogenin Y are present.
  • the Amelogenin Y probe is then selected to have a melting point temperature within the same range as Amelogenin X, preferably between about 65- 67°C as stated above.
  • the following probe is an example of a suitable probe for this allelic site of Amelogenin Y based on this selection process: CCAGCAAGCACTGATGCCTGTTC [SEQ. I.D. NO. 5].
  • the probe and primer design constraints outlined above provide reproducible physicochemical parameters for the target amplicons. Amplifications for all amplicons selected through this process can be run under the same reaction mixture formulation and thermocycler parameters. Table 1 provides ranges for a preferred reaction mixture formulation as well as a specific example of a reaction mixture formulation that is preferably used in the assay. The reaction mixture formulations outlined in Table 1 has been found to be stable over 90 days at 2-8°C.
  • Reagents in the TaqMan PCR Core Reagent Kit Part No.. N80802278 and 20% Glycerol (Part No. 402929) sold by Applied Biosystems - Perkin Elmer are preferably used to prepare the reaction mixture.
  • Glycerol is used in the reaction mixture to help melt GC base pairs.
  • Gelatin and TWEEN 20 are used to stabilize ROX fluorescence which otherwise decreases over time.
  • AMPLITAQTM Gold is used as the polymerase as part of a hot start method because AMPLITAQTM Gold does not operate until activated by incubation at
  • AmpErase UNGTM is used in combination with AMPLITAQTM Gold.
  • AmpErase UNGTM recognizes U in DNA and takes U out of the amplicons, leaving a phosphate backbone.
  • the reaction temperature is raised to 95°C for AMPLITAQTM Gold, the phosphate backbone where the U's have been removed falls apart. This serves to prevent amplification of contaminating amplicons from previous amplifications.
  • the relatively high (5mM) final concentration of MgCl 2 in the reaction mixture follows a strategy of requiring all generic reagents to be present in excess for this reaction.
  • An inherent property of 5' nuclease assays is that for a signal to be generated the probe must be hybridized to the extension complex during the PCR. Using a high concentration of Mg +2 shifts the hybridization equilibrium toward the probe being hybridized. The result is that the probe hybridization is much more stable and the reactions more robust and reproducible.
  • Table 2 outlines the preferred Thermal Cycle Parameter Settings for these amplification reactions. More than one type of target quantitation test may be run in a 96-well plate, since all tests share the same thermocycler parameter settings.
  • primer and probe concentration optimizations are required for tests run with primers, probes, reaction mixture and thermocycler parameters as outlined here.
  • the purpose of the primer concentration optimizations is to obtain an effective T m that results in optimum PCR and maximum end point values.
  • the purpose of the probe concentration optimizations is to reach the minimum probe concentrations required for optimum 5' nuclease performance and maximum fluorescent signal.
  • the concentration for each primer is independently optimized to determine the minimum primer concentration which yields maximum end point values.
  • the concentration for each probe is optimized for each target to determine the minimum probe concentration that yields the best yield and C ⁇ .
  • a template with the target sequence is required for the optimization.
  • This template may be genomic DNA or cDNA generated from a reverse transcription reaction, or a plasmid which contains the target sequence.
  • Primer concentrations may be optimized at the 62°C elongation temperature defined above.
  • the forward and reverse primers are cooptimized by running the wells defined by the 3 x 3 matrix shown in Table 4 at a lOOnM probe concentration. A minimum of 4 replicate wells is run for each of the 9 conditions defined by this matrix.
  • the primer concentration ranges (50-900nM) in this matrix correspond to an effective T m range of +/- 2°C around the nominal T m for these primers.
  • Table 5 shows the matrix to use in the optimization of primer concentrations. This matrix should be run with the reaction mixture whose composition is described in Table 1 and the Thermal Cycle Parameter Settings outlined in Table 2. A probe concentration of 1 OOnM may be used for the primer concentration optimization associated with this matrix. The best combination of primer concentrations will be the one resulting in the lowest threshold cycle (C ⁇ ) and highest end point (R chlor) values.
  • Probe concentrations are optimized at the 62°C elongation temperature and optimum forward and reverse primer concentrations defined above. When a single probe is used, its concentration is optimized by running wells at 25nM intervals between 25 and 225nM. The purpose of this optimization is to choose the minimum probe concentration yielding the maximum R Sil and minimum C t . A minimum of 4 replicate wells are run for each of the 9 conditions defined by this matrix. Probe concentrations need to be shown not to be limiting. In a quantitative application, the signal-to-noise is optimized at a maximum.
  • Table 5 shows the matrix to use in the optimization of probe concentrations. This matrix should be run with the reaction mixture from Table 1 the Thermal Cycle Parameter Settings from Table 2, and the optimum forward and reverse primer concentrations from the primer concentration optimization matrix.
  • Oligonucleotide probes for use in the 5' nuclease assay of the present invention can be synthesized by a number of approaches, e.g., Ozaki et al, Nucleic Acids Research, 20: 5205-5214 (1992); Agrawal et al. , Nucleic Acids
  • oligonucleotide probes of the invention are conveniently synthesized on an automated DNA synthesizer, e.g., an Applied Biosystems, Inc. (Foster City, California) model 392 or 394 DNA/RNA Synthesizer, using standard chemistries, such as phosphoramidite chemistry, e.g., disclosed in the following references: Beaucage and Iyer, Tetrahedron, 48: 2223-
  • the oligonucleotide probe is in the range of 15-60 nucleotides in length. More preferably, the oligonucleotide probe is in the range of 18-30 nucleotides in length.
  • the precise sequence and length of an oligonucleotide probe of the invention depends in part on the nature of the target oligonucleotide sequence to which it binds. The binding location and length may be varied to achieve appropriate annealing and melting properties for a particular embodiment. Guidance for making such design choices can be found in many of the above-cited references describing the 5' nuclease assays.
  • the 3' terminal nucleotide of the oligonucleotide probe is blocked or rendered incapable of extension by a nucleic acid polymerase.
  • Such blocking is conveniently carried out by the attachment of a reporter or quencher molecule to the terminal 3' carbon of the oligonucleotide probe by a linking moiety.
  • the fluorescers are fluorescent organic dyes derivatized for attachment to the terminal 3' carbon or terminal 5' carbon of the probe via a linking moiety.
  • quencher molecules are also organic dyes, which may or may not be fluorescent, depending on the embodiment of the invention.
  • the quencher molecule is fluorescent.
  • the absorption band of the quencher should substantially overlap the fluorescent emission band of the fluorescer.
  • Non-fluorescent quencher molecules that absorb energy from excited fluorescers, but which do not release the energy radiatively, are referred to in the application as chromogenic molecules.
  • Exemplary fluorescer-quencher pairs may be selected from xanthene dyes, including fluoresceins, and rhodamine dyes. Many suitable forms of these compounds are widely available commercially with substituents on their phenyl moieties which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide.
  • xanthene dyes including fluoresceins, and rhodamine dyes.
  • substituents on their phenyl moieties which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide.
  • Several particular classes of dyes that may be used are the energy transfer fluorescent dyes described in "ENERGY TRANSFER DYES WITH ENHANCED FLUORESCENCE,” Application Serial No.: 08/726.462; "ENERGY TRANSFER DYES WITH ENHANCED
  • FLUORESCENCE Application Serial No.: 08/642,330; and 4,7- dichlororhodamine dyes described in U.S. Application Serial No.: 08/672,196; entitled: "4,7-DICHLORORHODAMINE DYES" which are incorporated herein by reference.
  • Another group of fluorescent compounds are the naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are l-dimethylaminonaphmyl-5 -sulfonate, l-anilino-8- naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate.
  • dyes include 3-phenyl-7-isocyanatocoumarin, acridines, such as 9- isothiocyanatoacridine and acridine orange; N-(p-(2- benzoxazolyl)phenyl)maleimide; benzoxadiazoles, stilbenes, pyrenes, and the like.
  • fluorescer and quencher molecules are selected from fluorescein and rhodamine dyes.
  • fluorescein and rhodamine dyes These dyes and appropriate linking methodologies for attachment to oligonucleotides are described in many references, e.g., Khanna et al. (cited above); Marshall, Histochemical J., 7: 299-303 (1975); Menchen et al., U. S. Patent 5, 188,934; Menchen et al. , European Patent Application 87310256.0; and
  • linking moieties are employed that can be attached to an oligonucleotide during synthesis, e.g., available from Clontech Laboratories (Palo Alto, CA).
  • Rhodamine and fluorescein dyes are also conveniently attached to the 5' hydroxyl of an oligonucleotide at the conclusion of solid phase synthesis by way of dyes derivatized with a phosphoramidite moiety, e.g., Woo et al., U. S. Patent 5,231, 191; and Hobbs, Jr., U. S. Patent 4,997,928.
  • Apolipoprotein (apo) E plays a central role in lipoprotein metabolism by mediating interactions between lipoproteins and liporeceptors.
  • Three common variants of apoE have been identiffied by isoelectric focusing and have been designated E2, E3 and E4.
  • Genetic variation in apoE affects serum cholesterol levels, propensity to coronary artery disease, and propensity to develop late onset Alzheimer's disease.
  • the common protein variants E2, E3, and E4 are encoded by three alleles of the apoE gene termed e2, e3, and e4. These alleles are illustrated in Table 6. As illustrated, the apoE alleles differ by single base substitutions in two codons, 112 and 158. Thus, genotyping of apoE requires determination of base identity at two distinct allelic sites in the apoE gene.
  • the two allelic sites are close enough so they can be amplified as a single apoE amplicon. However, the sites are too far apart to be assayed by a single probe.
  • Gel methods such as sequencing or restriction digests of PCR products can assay both polymorphic sites in a single reaction product, but they require the use of labor intensive gels.
  • the non-gel methods described to date assay each polymorphic site separately so that two reactions are required to determine an individuals apoE genotype.
  • the probes used in the 5' nuclease assay to distinguish the various apoE alleles are:
  • the bolded base is complementary to the polymorphic T or C at each codon.
  • AEl 12T1 hybridizes to the e2 and e3 alleles which each include A at codon 112. Since AEl 12T1 does not include a fluorescer, samples of e2 and e3 do not produce a signal for the 112 codon allele.
  • AEl 12T2 hybridizes to the e4 allele which include G at codon 112. Since AEl 12T2 includes TET as the fluorescer, samples of e4 produce a TET signal for the 112 codon allele.
  • AE158TF1 hybridizes to the e2 allele which includes A at codon 158. Since AE158TF1 includes FAM as the fluorescer, samples of e2 produce a FAM signal for the 158 codon allele.
  • AE158CJ2 hybridizes to the e3 and e4 alleles which include G at codon 158. Since AE158CJ2 includes JOE as the fluorescer, samples of e3 and e4 produce a JOE signal for the 158 codon allele. Table 7 summarizes the fluorescence signals that would be expected for the various apoE alleles. As can be seen from Table 7, a distinctive spectrum can be expected for each allelic variant, thus allowing discrimination of the alleles and detection of heterozygote combinations.
  • 64 X X Codons 112 and 158 were amplified as part of a 273 base amplicon using the following primers:
  • ApoE-Fl ACGCGGGCACGGCTGTC forward primer
  • ApoE-Rl CTCGCGGATGGCGCTGA reverse primer
  • the fluorescence of each reaction was measured on an ABI Prism 7200 or 7700.
  • the software on the instrument uses a reference library of the pure dye spectra as well as logic for determining the fluorescence contribution of the different fluorophores to the spectrum by multicomponenting analysis.
  • Present in the reaction are the 3 fluorescers (TET, FAM, and JOE), the quencher (TAMRA), and a passive internal reference (ROX).
  • TET, FAM, and JOE the quencher
  • ROX passive internal reference
  • the ROX signal is used to normalize the other signals by dividing the FAM, TET, JOE, and TAMRA signals by the ROX signal.
  • Figure 13 illustrates the normalized relative contributions of FAM, TET, JOE, and TAMRA to spectra derived from performing the above-described 5' nuclease assay on apoE alleles e2, e3, and e4 and on a sample with no template (NT). These are the fluorescence signatures for the different alleles.
  • the determination of the relative contributions of FAM, TET, JOE, and TAMRA to the fluorescence signal can result in some seemingly illogical results which prevent the fluorescence data from being read directly in order to determine a genotype of an unknown.
  • the JOE signal is shown to be negative for samples with the e2, allele and with no template (NT).
  • the e3 allele has a stronger TET signal than a JOE signal despite the fact that one would expect the e3 allele to only have a JOE signal.
  • a plate was run containing 3 NT controls, 3 e2 controls, 3 e3 controls, 3 e4 controls, and 84 unknowns samples according to the assay described in Section 9.
  • Each unknown reaction contained 50 ng genomic DNA from one of 84 human individuals. Reaction volume was 25 ⁇ l.
  • normalized fluorescence signatures were determined for the each sample. By comparing to the NT controls to the fluorescence of the unknown samples, three unknowns were determined to have not undergone significant amplification. Further analysis of these samples was discontinued.
  • This matrix was then used to calculate NT, e2, e3, and e4 values for each unknown.
  • Figure 14 illustrates a plot of allele value versus well for the 84 genotyped samples. This plot is obtained by removing the NT contribution to the spectra and then renormalizing the signature without NT. This enables one to have 1 , 0.5, or 0 allele values where each allele has an allele value of 0.5. It can be seen that the allele values cluster around 0.0, 0.5, and 1.0 as would be expected. The most common genotype is an e3 homozygote. These individuals have an e3 value of approximately 1.0 and e2 and e4 values of approximately 0. Another way of viewing the data shown in Figure 14 is as a scatter plot diagram of e3 value versus e4 value shown in Figure 15. Because of the normalization, any individual which has a value of 0 for both e3 and e4 must be an e2 homozygote.
  • This assay can be used as a diagnostic tool for assessing the risk for coronary artery disease and/or late-onset Alzheimer's disease.
  • CCTGTGCACC CCATGCAGCC CCTGCCGCCA CAGCCACCTC TGCCTCCGAT 550 GTTCCCCATG CAGCCCCTGC CTCCCATGCT TCCTGATCTG ACTCTGGAAG 600

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Amplifiers (AREA)
  • Analysing Materials By The Use Of Radiation (AREA)
PCT/US1999/000499 1998-02-04 1999-01-08 Determination of a genotype of an amplification product at multiple allelic sites Ceased WO1999040226A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA2318880A CA2318880C (en) 1998-02-04 1999-01-08 Determination of a genotype of an amplification product at multiple allelic sites
JP2000530635A JP4388694B2 (ja) 1998-02-04 1999-01-08 複数のアレル部位における増幅産物のゲノム型決定
AU23144/99A AU758463B2 (en) 1998-02-04 1999-01-08 Determination of a genotype of an amplification product at multiple allelic sites
AT99903026T ATE469982T1 (de) 1998-02-04 1999-01-08 Bestimmung des genotyps eines amplifikationsproduktes an mehreren allelen stellen
DE69942444T DE69942444D1 (de) 1998-02-04 1999-01-08 Bestimmung des genotyps eines amplifikationsproduktes an mehreren allelen stellen
EP99903026A EP1053348B1 (en) 1998-02-04 1999-01-08 Determination of a genotype of an amplification product at multiple allelic sites

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1859598A 1998-02-04 1998-02-04
US09/018,595 1998-02-04

Publications (2)

Publication Number Publication Date
WO1999040226A2 true WO1999040226A2 (en) 1999-08-12
WO1999040226A3 WO1999040226A3 (en) 2000-08-17

Family

ID=21788757

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/000499 Ceased WO1999040226A2 (en) 1998-02-04 1999-01-08 Determination of a genotype of an amplification product at multiple allelic sites

Country Status (8)

Country Link
US (5) US6154707A (https=)
EP (1) EP1053348B1 (https=)
JP (1) JP4388694B2 (https=)
AT (1) ATE469982T1 (https=)
AU (1) AU758463B2 (https=)
CA (1) CA2318880C (https=)
DE (1) DE69942444D1 (https=)
WO (1) WO1999040226A2 (https=)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001299392A (ja) * 2000-04-25 2001-10-30 Otsuka Pharmaceut Co Ltd Catch22症候群検出方法
EP1230387A4 (en) * 1999-10-22 2003-03-05 New York Health Res Inst ASSAYS OF VARIANTS OF SHORT SEQUENCES
WO2003035864A1 (en) * 2001-10-26 2003-05-01 Matsushita Electric Industrial Co., Ltd. Method of detecting target nucleic acid and nucleic acid probe
WO2001090419A3 (en) * 2000-05-23 2003-07-10 Variagenics Inc Methods for genetic analysis of dna to detect sequence variances
US6653473B2 (en) 1999-12-08 2003-11-25 Epoch Biosciences, Inc. Fluorescent quenching detection reagents and methods
US6660845B1 (en) 1999-11-23 2003-12-09 Epoch Biosciences, Inc. Non-aggregating, non-quenching oligomers comprising nucleotide analogues; methods of synthesis and use thereof
EP1509624A2 (en) * 2002-05-31 2005-03-02 Secretary, Department Of Atomic Energy Met/fret based method of target nucleic acid detection whereby the donor/acceptor moieties are on complementary strands
WO2006127507A3 (en) * 2005-05-20 2007-04-05 Integrated Dna Tech Inc Compounds and methods for labeling oligonucleotides
EP1911852A1 (en) * 2006-10-12 2008-04-16 Bio-Rad Pasteur Double-stranded probes for the fluorescent detection of nucleic acids
WO2008110622A1 (de) * 2007-03-14 2008-09-18 Aj Innuscreen Gmbh Verfahren und testkit zum schnellen nachweis spezifischer nukleinsäuresequenzen, insbesondere zum nachweis von mutationen oder snp's
US7435541B2 (en) 2000-05-23 2008-10-14 Sequenom, Inc. Restriction enzyme genotyping
US7897736B2 (en) 1999-12-08 2011-03-01 Elitech Holding B.V. Fluorescent quenching detecting reagents and methods
US8669056B2 (en) 2002-12-31 2014-03-11 Cargill Incorporated Compositions, methods, and systems for inferring bovine breed
US8916345B2 (en) 2010-03-26 2014-12-23 Integrated Dna Technologies, Inc. Methods for enhancing nucleic acid hybridization
US10087445B2 (en) 2010-03-26 2018-10-02 Integrated Dna Technologies, Inc. Modifications for antisense compounds

Families Citing this family (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4034351B2 (ja) 1996-04-25 2008-01-16 バイオアレイ ソリューションズ エルエルシー 粒子近接表面の光制御した動電学的アッセンブリ
AU741141B2 (en) * 1997-11-04 2001-11-22 Roche Diagnostics Gmbh Specific and sensitive method for detecting nucleic acids
AU758463B2 (en) 1998-02-04 2003-03-20 Applied Biosystems, Llc Determination of a genotype of an amplification product at multiple allelic sites
US7585632B2 (en) * 1999-10-29 2009-09-08 Hologic, Inc. Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
DE60117556T2 (de) 2000-06-21 2006-11-02 Bioarray Solutions Ltd. Multianalytische molekularanalyse durch verwendung anwendungsspezifischer zufallspartikelarrays
GB0016516D0 (en) * 2000-07-06 2000-08-23 Owen Mumford Ltd Improvements relating to needle protection devices
US7267945B2 (en) * 2001-03-26 2007-09-11 Applera Corporation Methods of determining the presence of polynucleotides employing amplification
US20030143554A1 (en) * 2001-03-31 2003-07-31 Berres Mark E. Method of genotyping by determination of allele copy number
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
KR100944674B1 (ko) * 2001-06-28 2010-03-04 노바티스 백신즈 앤드 다이아그노스틱스 인코포레이티드 파르보바이러스 b19의 진단 분석
EP1463825B1 (en) 2001-10-15 2017-12-06 BioArray Solutions Ltd. Multiplexed analysis of polymorphic loci by concurrent interrogation and enzyme-mediated detection
US20110111389A1 (en) * 2001-11-07 2011-05-12 Diagcor Bioscience Incorporation Limited Rapid genotyping analysis for human papillomavirus and the device thereof
US7732138B2 (en) * 2001-11-07 2010-06-08 Diagcor Bioscience Incorporation Limited Rapid genotyping analysis and the device thereof
US20050079493A1 (en) * 2002-11-09 2005-04-14 Tam Joseph Wing On DNA fingerprinting using allelic specific oligonucleotide reversed dot blot (ASO-RDB) flow through hybridization process and device
DE60323214D1 (de) * 2002-03-05 2008-10-09 Physiogenix Inc Verfahren und zusammensetzungen für die pharmakologische und toxikologische auswertung von testsubstanzen
US7176002B2 (en) * 2002-05-16 2007-02-13 Applera Corporation Universal-tagged oligonucleotide primers and methods of use
CN105258988A (zh) 2002-06-20 2016-01-20 徕卡病理系统墨尔本控股有限公司 带有排放机构的生物反应装置
AU2003901871A0 (en) * 2003-03-31 2003-05-08 Vision Biosystems Limited A method and apparatus for fluid dispensation, preparation and dilation
WO2004018626A2 (en) * 2002-08-21 2004-03-04 Epoch Biosciences, Inc. Abasic site endonuclease assay
US7526114B2 (en) 2002-11-15 2009-04-28 Bioarray Solutions Ltd. Analysis, secure access to, and transmission of array images
WO2004055709A2 (en) * 2002-12-13 2004-07-01 Applera Corporation Methods for identifying, viewing, and analyzing syntenic and orthologous genomic regions between two or more species
US7851150B2 (en) * 2002-12-18 2010-12-14 Third Wave Technologies, Inc. Detection of small nucleic acids
US7858301B2 (en) * 2003-05-07 2010-12-28 Bioarray Solutions, Ltd. Method of probe design for nucleic acid analysis by multiplexed hybridization
US20050089889A1 (en) * 2003-06-20 2005-04-28 Ramsing Niels B. Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same
US20050038776A1 (en) * 2003-08-15 2005-02-17 Ramin Cyrus Information system for biological and life sciences research
WO2005029705A2 (en) 2003-09-18 2005-03-31 Bioarray Solutions, Ltd. Number coding for identification of subtypes of coded types of solid phase carriers
US20050221357A1 (en) * 2003-09-19 2005-10-06 Mark Shannon Normalization of gene expression data
US7417726B2 (en) * 2003-09-19 2008-08-26 Applied Biosystems Inc. Normalization of data using controls
CA2539824C (en) 2003-09-22 2015-02-03 Xinwen Wang Surface immobilized polyelectrolyte with multiple functional groups capable of covalently bonding to biomolecules
US7332280B2 (en) * 2003-10-14 2008-02-19 Ronald Levy Classification of patients having diffuse large B-cell lymphoma based upon gene expression
CA2899287A1 (en) 2003-10-28 2005-05-12 Bioarray Solutions Ltd. Optimization of gene expression analysis using immobilized capture probes
WO2005045060A2 (en) 2003-10-29 2005-05-19 Bioarray Solutions, Ltd. Multiplexed nucleic acid analysis by fragmentation of double-stranded dna
US7439341B2 (en) 2003-11-14 2008-10-21 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
EP1561823A1 (de) * 2004-02-04 2005-08-10 Biotez Berlin-Buch GmbH Verfahren zum Nachweis von Einzelnukleotid-polymorphismen (SNP) in Genen des Arzneimittelmetabolismus und Testkit zur Durchführung des Verfahrens
US20050255485A1 (en) * 2004-05-14 2005-11-17 Livak Kenneth J Detection of gene duplications
US7575863B2 (en) * 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
WO2006034387A1 (en) * 2004-09-21 2006-03-30 Applera Corporation TWO-COLOR REAL-TIME/END-POINT QUANTITATION OF MICRORNAS (miRNAs)
US20060111915A1 (en) * 2004-11-23 2006-05-25 Applera Corporation Hypothesis generation
US8084260B2 (en) * 2004-11-24 2011-12-27 Applied Biosystems, Llc Spectral calibration method and system for multiple instruments
WO2006061994A1 (ja) * 2004-12-08 2006-06-15 Takeshi Yamamoto 遺伝子配列検査法
US20060166238A1 (en) * 2004-12-22 2006-07-27 Ramsing Niels B Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same
US8486629B2 (en) 2005-06-01 2013-07-16 Bioarray Solutions, Ltd. Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation
EP2477029A1 (en) 2005-06-02 2012-07-18 Fluidigm Corporation Analysis using microfluidic partitioning devices
WO2007024800A2 (en) * 2005-08-22 2007-03-01 Applera Corporation Device and method for making discrete volumes of a first fluid in contact with a second fluid, which are immiscible with each other
WO2007147079A2 (en) * 2006-06-14 2007-12-21 Living Microsystems, Inc. Rare cell analysis using sample splitting and dna tags
US20080090239A1 (en) * 2006-06-14 2008-04-17 Daniel Shoemaker Rare cell analysis using sample splitting and dna tags
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
WO2007147074A2 (en) 2006-06-14 2007-12-21 Living Microsystems, Inc. Use of highly parallel snp genotyping for fetal diagnosis
US20080050739A1 (en) 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
EP2589668A1 (en) * 2006-06-14 2013-05-08 Verinata Health, Inc Rare cell analysis using sample splitting and DNA tags
EP2116614A1 (en) * 2008-05-06 2009-11-11 Qiagen GmbH Simultaneous detection of multiple nucleic acid sequences in a reaction
US8383346B2 (en) * 2008-06-13 2013-02-26 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
US20090312196A1 (en) * 2008-06-13 2009-12-17 Codexis, Inc. Method of synthesizing polynucleotide variants
EP3023494B1 (en) * 2008-06-13 2018-11-28 Codexis, Inc. Method of synthesizing polynucleotide variants
HUE031848T2 (en) 2008-09-20 2017-08-28 Univ Leland Stanford Junior Non-invasive diagnosis of fetal aneuploidy by sequencing
JP5709840B2 (ja) * 2009-04-13 2015-04-30 キヤノン ユー.エス. ライフ サイエンシズ, インコーポレイテッドCanon U.S. Life Sciences, Inc. 動的シグナルの相関分析による、パターン認識、機械学習、および自動遺伝子型分類の迅速な方法
US20110312503A1 (en) 2010-01-23 2011-12-22 Artemis Health, Inc. Methods of fetal abnormality detection
US9506057B2 (en) 2010-03-26 2016-11-29 Integrated Dna Technologies, Inc. Modifications for antisense compounds
US20120083035A1 (en) 2010-09-30 2012-04-05 Dharmacon, Inc. Modified Cell Lines for Increasing Lentiviral Titers
US9617588B2 (en) 2010-10-05 2017-04-11 Thermo Fisher Scientific Baltics Uab Enzyme mixture
EP2852682B1 (en) 2012-05-21 2017-10-04 Fluidigm Corporation Single-particle analysis of particle populations
WO2017177025A1 (en) * 2016-04-06 2017-10-12 Life Technologies Corporation Compositions, methods, and kits for synthesis and detection of nucleic acids
JP6846636B2 (ja) * 2017-02-28 2021-03-24 パナソニックIpマネジメント株式会社 核酸検出用オリゴヌクレオチド
WO2022155397A1 (en) * 2021-01-15 2022-07-21 Nuprobe Usa, Inc. Cycle multiplexing for highly multiplexed quantitative pcr

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5075216A (en) 1988-09-23 1991-12-24 Cetus Corporation Methods for dna sequencing with thermus aquaticus dna polymerase
WO1992001814A2 (en) 1990-07-24 1992-02-06 F. Hoffmann-La-Roche Ag The reduction of non-specific amplification during in vitro nucleic acid amplification using modified nucleic acid bases
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5403707A (en) * 1993-05-14 1995-04-04 Eastman Kodak Company Diagnostic compositions, elements, methods and test kits for amplification and detection of retroviral DNA using primers having matched melting temperatures
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
US5834181A (en) 1994-07-28 1998-11-10 Genzyme Corporation High throughput screening method for sequences or genetic alterations in nucleic acids
EP0803058B1 (en) * 1994-12-30 2008-11-05 Georgetown University Fluorometric assay for detecting nucleic acid cleavage
DE19524579C2 (de) * 1995-07-06 1997-12-18 Daimler Benz Ag Transformator als Strombegrenzer
US5759781A (en) * 1995-12-22 1998-06-02 Yale University Multiparametric fluorescence in situ hybridization
US5792610A (en) * 1996-05-01 1998-08-11 Biorad Laboratories, Inc. Method for conducting multiparametric fluorescence in situ hybridization
EP0892808B1 (en) * 1996-04-12 2008-05-14 PHRI Properties, Inc. Detection probes, kits and assays
US6015667A (en) * 1996-06-03 2000-01-18 The Perkin-Emer Corporation Multicomponent analysis method including the determination of a statistical confidence interval
US5736333A (en) * 1996-06-04 1998-04-07 The Perkin-Elmer Corporation Passive internal references for the detection of nucleic acid amplification products
AU758463B2 (en) * 1998-02-04 2003-03-20 Applied Biosystems, Llc Determination of a genotype of an amplification product at multiple allelic sites
US5952202A (en) * 1998-03-26 1999-09-14 The Perkin Elmer Corporation Methods using exogenous, internal controls and analogue blocks during nucleic acid amplification

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
ABRAVAYA ET AL., NUCLEIC ACIDS RESEARCH, vol. 23, 1995, pages 675 - 682
BARANY ET AL., PNAS (USA), vol. 88, 1991, pages 189 - 193
GIBBS ET AL., NUCLEIC ACIDS RESEARCH, vol. 17, 1989, pages 2437 - 2448
GROSSMAN ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4527 - 4534
IKUTA ET AL., NUCLEIC ACIDS RESEARCH, vol. 15, 1987, pages 797 - 811
LANDEGREN ET AL., SCIENCE, vol. 241, 1988, pages 1077 - 1080
LIVAK ET AL., NATURE GENETICS, vol. 9, 1995, pages 341 - 342
MARSHALL, HISTOCHEMICAL J., vol. 7, 1975, pages 299 - 303
NEWTON ET AL., NUCLEIC ACIDS RESEARCH, vol. 17, 1989, pages 2503 - 2516
NICKERSON ET AL., PNAS (USA), vol. 87, 1990, pages 8923 - 8927
SAIKI ET AL., PNAS (USA), vol. 86, 1989, pages 6230 - 6234
SYVANEN ET AL., AMERICAN JOURNAL OF HUMAN GENETICS 1993, vol. 52, 1993, pages 46 - 59
VERLAAN-DE VRIES ET AL., GENE, vol. 50, 1980, pages 313 - 320
WALLACE ET AL., NUCLEIC ACIDS RESEARCH, vol. 9, 1981, pages 879 - 894
WU ET AL., GENOMICS, vol. 4, 1989, pages 560 - 569
ZHANG, NUCLEIC ACIDS RESEARCH, vol. 19, 1991, pages 3929 - 3933

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1230387A4 (en) * 1999-10-22 2003-03-05 New York Health Res Inst ASSAYS OF VARIANTS OF SHORT SEQUENCES
US9260761B2 (en) 1999-10-22 2016-02-16 Phri Properties, Inc. Assays for short sequence variants
JP2003518924A (ja) * 1999-10-22 2003-06-17 ザ パブリック ヘルス リサーチ インスティテュート オブ ザ シティ オブ ニューヨーク,インコーポレーテッド 短い配列の変異体を検出するためのアッセイ
JP4919568B2 (ja) * 1999-10-22 2012-04-18 ピーエイチアールアイ プロパティーズ,インコーポレイテッド 短い配列の変異体を検出するためのアッセイ
US7662550B1 (en) 1999-10-22 2010-02-16 Phri Properties, Inc. Assays for short sequence variants
US6972328B2 (en) 1999-11-23 2005-12-06 Epoch Biosciences, Inc. Non-aggregating non-quenching oligomer comprising nucelotide analogs, method of synthesis and use thereof
US6660845B1 (en) 1999-11-23 2003-12-09 Epoch Biosciences, Inc. Non-aggregating, non-quenching oligomers comprising nucleotide analogues; methods of synthesis and use thereof
US7897736B2 (en) 1999-12-08 2011-03-01 Elitech Holding B.V. Fluorescent quenching detecting reagents and methods
US6699975B2 (en) 1999-12-08 2004-03-02 Epoch Biosciences, Inc. Fluorescent quenching detection reagents and methods
US6790945B2 (en) 1999-12-08 2004-09-14 Epoch Biosciences, Inc. Fluorescent quenching detection reagents and methods
US6653473B2 (en) 1999-12-08 2003-11-25 Epoch Biosciences, Inc. Fluorescent quenching detection reagents and methods
JP2001299392A (ja) * 2000-04-25 2001-10-30 Otsuka Pharmaceut Co Ltd Catch22症候群検出方法
US7435541B2 (en) 2000-05-23 2008-10-14 Sequenom, Inc. Restriction enzyme genotyping
WO2001090419A3 (en) * 2000-05-23 2003-07-10 Variagenics Inc Methods for genetic analysis of dna to detect sequence variances
WO2003035864A1 (en) * 2001-10-26 2003-05-01 Matsushita Electric Industrial Co., Ltd. Method of detecting target nucleic acid and nucleic acid probe
EP1509624A2 (en) * 2002-05-31 2005-03-02 Secretary, Department Of Atomic Energy Met/fret based method of target nucleic acid detection whereby the donor/acceptor moieties are on complementary strands
US11053547B2 (en) 2002-12-31 2021-07-06 Branhaven LLC Methods and systems for inferring bovine traits
US10190167B2 (en) 2002-12-31 2019-01-29 Branhaven LLC Methods and systems for inferring bovine traits
US9982311B2 (en) 2002-12-31 2018-05-29 Branhaven LLC Compositions, methods, and systems for inferring bovine breed
US8669056B2 (en) 2002-12-31 2014-03-11 Cargill Incorporated Compositions, methods, and systems for inferring bovine breed
US7645872B2 (en) 2005-05-20 2010-01-12 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7803936B2 (en) 2005-05-20 2010-09-28 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7605243B2 (en) 2005-05-20 2009-10-20 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7476735B2 (en) 2005-05-20 2009-01-13 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
WO2006127507A3 (en) * 2005-05-20 2007-04-05 Integrated Dna Tech Inc Compounds and methods for labeling oligonucleotides
US9194007B2 (en) 2006-10-12 2015-11-24 Bio-Rad Innovations Double-stranded probes for the fluorescent detection of nucleic acids
WO2008044129A3 (en) * 2006-10-12 2008-06-19 Bio Rad Pasteur Double-stranded probes for the fluorescent detection of nucleic acids
EP1911852A1 (en) * 2006-10-12 2008-04-16 Bio-Rad Pasteur Double-stranded probes for the fluorescent detection of nucleic acids
WO2008110622A1 (de) * 2007-03-14 2008-09-18 Aj Innuscreen Gmbh Verfahren und testkit zum schnellen nachweis spezifischer nukleinsäuresequenzen, insbesondere zum nachweis von mutationen oder snp's
US8916345B2 (en) 2010-03-26 2014-12-23 Integrated Dna Technologies, Inc. Methods for enhancing nucleic acid hybridization
US10087445B2 (en) 2010-03-26 2018-10-02 Integrated Dna Technologies, Inc. Modifications for antisense compounds

Also Published As

Publication number Publication date
CA2318880C (en) 2010-07-27
US6884583B2 (en) 2005-04-26
AU758463B2 (en) 2003-03-20
US20020164630A1 (en) 2002-11-07
JP2002502615A (ja) 2002-01-29
US20040053302A1 (en) 2004-03-18
AU2314499A (en) 1999-08-23
US20120053069A1 (en) 2012-03-01
ATE469982T1 (de) 2010-06-15
EP1053348A2 (en) 2000-11-22
EP1053348B1 (en) 2010-06-02
US6154707A (en) 2000-11-28
DE69942444D1 (de) 2010-07-15
US7132239B2 (en) 2006-11-07
US20080187913A1 (en) 2008-08-07
CA2318880A1 (en) 1999-08-12
WO1999040226A3 (en) 2000-08-17
JP4388694B2 (ja) 2009-12-24

Similar Documents

Publication Publication Date Title
CA2318880C (en) Determination of a genotype of an amplification product at multiple allelic sites
US7348141B2 (en) Hybridization beacon and method of rapid sequence detection and discrimination
US6270967B1 (en) Method for detecting a nucleic acid base sequence
AU781136B2 (en) Methods and oligonucleotides for detecting nucleic acid sequence variations
US7998673B2 (en) Hybridisation beacon and method of rapid sequence detection and discrimination
AU2001242634A1 (en) Hybridisation beacon and method of rapid sequence detection and discrimination
JP2002530120A (ja) 核酸を検出するためのドナー分子およびアクセプター分子を利用するプライマー伸長方法
GB2312747A (en) Primers with non-complementary tails for detection of diagnostic base sequences
AU2003204856B2 (en) Determination of a Genotype of an Amplification Product at Multiple Allelic Sites
AU2007201863A1 (en) Determination of a genotype of an amplification product at multiple allelic sites
EP1061134A2 (en) Oligonucleotides for amplification and detection of hemochromatosis genes
EP1400597A1 (en) Oligonucleotides for amplification and detection of hemochromatosis gene
ZA200207652B (en) Hybridisation beacon and method of rapid sequence detection and discrimination.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2318880

Country of ref document: CA

Ref country code: CA

Ref document number: 2318880

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 23144/99

Country of ref document: AU

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 530635

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

WWE Wipo information: entry into national phase

Ref document number: 1999903026

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999903026

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 23144/99

Country of ref document: AU