WO1999040187A1 - Acides nucleiques pour la modulation de l'activation cellulaire - Google Patents

Acides nucleiques pour la modulation de l'activation cellulaire Download PDF

Info

Publication number
WO1999040187A1
WO1999040187A1 PCT/EP1999/000759 EP9900759W WO9940187A1 WO 1999040187 A1 WO1999040187 A1 WO 1999040187A1 EP 9900759 W EP9900759 W EP 9900759W WO 9940187 A1 WO9940187 A1 WO 9940187A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acids
cells
rsk3
dna
acids according
Prior art date
Application number
PCT/EP1999/000759
Other languages
German (de)
English (en)
Inventor
Hinrich Abken
Original Assignee
Hinrich Abken
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE1998138967 external-priority patent/DE19838967A1/de
Priority claimed from DE1998159056 external-priority patent/DE19859056A1/de
Application filed by Hinrich Abken filed Critical Hinrich Abken
Priority to EP99906220A priority Critical patent/EP1053316A1/fr
Priority to JP2000530601A priority patent/JP2002517181A/ja
Publication of WO1999040187A1 publication Critical patent/WO1999040187A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/15—Nucleic acids forming more than 2 strands, e.g. TFOs

Definitions

  • the invention relates to nucleic acids, their derivatives and sequence-specific binding substances which inhibit the expression of the CD30 antigen and / or the ribosomal S6 kinase pp90rsk3, pharmaceutical compositions which contain such nucleic acids, and the use of such nucleic acids for modulating cellular activation, for suppressing and Prevention of immune dysregulation, reduction of viral load and elimination of CD30 + and / or pp90rsk3 + cells and their tumors.
  • the cell responds to environmental signals with a complex network of cellular activation to ensure an adequate response.
  • the seemingly unlimited variety of physical and chemical influences is contrasted by the cell with a versatile, modulatable physiological pattern of specific responses through cellular activation.
  • Dysregulations of cellular activation are common, however, the environmental factors that trigger them or the deregulated signals of the cell are only rarely known.
  • the spectrum of diseases with deregulated cellular activation is diverse and includes cells from all tissues and differentiations, e.g. Epithelial cells in response to bacterial toxins, or immune cells in response to chronic viral infections, chronic inflammatory and atopic diseases such as e.g. atopic dermatitis (neurodermatitis). Some of these diseases are very common, with manifestations of atopic syndrome affecting up to 15% of the population.
  • the CD30 antigen is a phosphorylated 105-120 kDa membrane glycoprotein that is assigned to the TNF / NGF receptor family based on sequence homologies and is expressed by some lymphocyte subpopulations (Schwab et al., Nature 299, 65-67 (1982); WO93 / 10232; and Dürkop et al., Cell 68, 421-427, 1992).
  • the CD30 antigen is preferred, but not exclusively, found on Th2 T cells, especially in a subpopulation (15-20%) of activated CD45RO + "memory" T cells, of which 85% of the cells coexpress the CD4 antigen. Cells with persistent viral infections and cells from numerous virus-associated tumors also express the CD30 antigen.
  • CD30 cross-linking on the cell surface leads to a confusing variety of cellular functions, e.g. to increase T cell proliferation (Smith et al., Cell 73, 1349-1360, 1993), to induce the transcription factor NFKB (McDonald et al., Europ. J. Immunol.
  • the ribosomal S6 kinases form a family of mitogen-activated protein kinases. They are ubiquitously expressed in cells of different tissues at different levels.
  • the pp90rsk1 kinase is functionally downstream of the MAP kinase in the Ras-Raf-MEK-MAP kinase signaling path (Sturgill et al., Nature 334, 715-718, 1988; Blenis, Proc. Natl. Acad. Sci. USA 90, 5889-5892, 1993). It phosphorylates the factor l ⁇ B ⁇ and stimulates its breakdown (Ghoda et al., J. Biol. Chem.
  • nucleic acids oligonucleotides
  • CD30 and / or rsk3 expressing cells can be eliminated with the aid of these nucleic acids.
  • rsk3 + pp90rsk3 +
  • nucleic acids which inhibit the expression of the CD30 antigen or the ribosomal S6 kinase pp90rsk3 ("rsk3"), acids that bind specifically to the CD30 and / or pp90rsk3 mRNA, gene or promoter DNA are preferred;
  • compositions comprising one or more of the nucleic acids defined in (1);
  • Figure 1 shows the from the EMBL database accession no. M83554 known CD30 cDNA sequence. Preferred binding areas to the corresponding RNA or genomic DNA are highlighted.
  • Figure 2 shows the from the EMBL database accession no. X85106 known rsk3 cDNA sequence. Preferred binding areas to the corresponding RNA or genomic DNA are highlighted.
  • Nucleic acid derivatives for the purposes of the present invention are nucleic acids in which, based on the natural nucleic acids, at least one modification to the nucleic acid base, sugar component or phosphate linkage known to the person skilled in the art has been carried out. Such modifications are described in detail below.
  • Sequence-specific binding substances according to the present invention are understood to mean nucleic acids and other substances which are characterized in that they bind selectively to defined DNA and / or RNA sequences. These also include those nucleic acid derivatives in which two or more modifications have been made and therefore can no longer be correctly referred to as nucleic acids in the narrower sense.
  • Preferred nucleic acids for the purposes of the present invention are oligonucleotides and oligonucleotide derivatives, in particular those which specifically bind to the CD30 and / or rsk3 mRNA, gene or promoter DNA.
  • This can preferably be an oligonucleotide that
  • (d) is a CD30 DNA and / or rsk3 triple helix-forming nucleic acids
  • (e) is a ribozyme that binds to CD30 and / or pp90rsk3 mRNA.
  • the preferred length of the oligonucleotides is 8-20, in particular 9 to 15 bases.
  • Single-stranded oligonucleotides with an identical nucleotide sequence (sense orientation) and with a complementary nucleotide sequence (anti-sense orientation) to the CD30 mRNA are particularly preferred in the sense of the present invention. These are able to effectively inhibit the synthesis of the CD30 antigen (example 1).
  • Oligonucleotides which bind to the CD30 mRNA in the regions bp 140-170, bp 200-250, bp 265-300, bp 520-540, bp 600-940, bp 1200-1270, bp 1745-1790, bp 1885- are preferred.
  • Another preferred embodiment of the present invention are oligonucleotides that bind to the rsk3-specific mRNA, gene or promoter DNA. These oligonucleotides suppress the synthesis of the rsk3 protein. Oligonucleotides which bind to the rsk3 mRNA in the regions bp 100-160, bp 1085-1125 or bp 1540-1565 are preferred (numbering of the base pairs in accordance with EMBL database accession No. X85106; FIG. 2 and SEQ ID NO: 3). Examples of particularly effective oligonucleotides are given in Table 2.
  • Oligonucleotides in anti-sense orientation bind to the respective RNA and efficiently prevent CD30 or rsk3 mRNA translation. Oligonucleotides in sense orientation proved to be potent DNA triple helix formers and very efficient suppressors of CD30 and rsk3 RNA transcription.
  • the oligonucleotides mentioned in Table 1 bind to CD30-specific DNA or RNA sequences, the oligonucleotides mentioned in Table 2 to rsk3-specific DNA or RNA sequences.
  • the oligonucleotide AS1 binds to both the CD30 mRNA and the mRNA of the rsk3 kinase and inhibits the translation and function of both proteins, rsk3 and CD30.
  • the oligonucleotides S1 and S1-short bind to both the CD30 gene DNA and the rsk3 gene DNA and inhibit the transcription of both RNA species, the CD30 mRNA and the rsk3 mRNA.
  • the oligonucleotides AS1 and S1 or their derivatives are preferred for the suppression of rsk3 and CD30 and have an outstanding efficiency in the uses according to the invention described below. 7
  • the oligonucleotides can be linear unmodified DNA or RNA molecules or DNA or RNA molecules modified by known methods (Agrawal and Iyer, Pharmakol. Ther. 76, 151-160, 1997). Examples are cyclic oligonucleotides (Kool, J. Am. Chem. Soc. 113, 6265-6266, 1991), phosphorothioate derivatives, 2 ' O-methyl RNA, morpholino-modified oligomers, methyl phosphonates, PNA ("peptide nucleic acids” ), N3 ' -> P5 ' phosphoramidates, or so-called "clamp oligonucleotides” (overview: Cohen, Adv. Pharmakol.
  • oligonucleotides can also be transcribed from viral or non-viral expression vectors, ie the nucleic acids according to the invention can also be present as components of such vectors.
  • nucleic acids according to the invention are present as components of ribozymes or other enzymatically active nucleic acids with specific binding to the CD30 and / or rsk3 mRNA or DNA.
  • Ribozymes are preferred whose specific binding region contains one of the nucleotide sequences mentioned in Table 1 or Table 2.
  • the nucleic acids, oligonucleotides and ribozymes according to the invention do not have the exact sequence of the CD30 and rsk3 mRNAs shown in SEQ ID NO: 1 and NO: 3.
  • the pharmaceutical composition according to the present invention can also contain a pharmaceutically acceptable carrier and / or pharmaceutical adjuvants.
  • Pharmaceutical carriers for nucleic acids are preferably lipids, for example cationic or anionic liposomes or lipids such as DOPE (dioleoylphosphatidylethanolamine), DC-chol (3 ⁇ [N- (N ' , N ' -dimethylaminoethane) carbamoyl] cholesterol or DOTAP (1, 2-dioloyloxy-3- (trimethylammonio) propane).
  • DOPE dioleoylphosphatidylethanolamine
  • DC-chol 3 ⁇ [N- (N ' , N ' -dimethylaminoethane) carbamoyl] cholesterol or DOTAP (1, 2-dioloyloxy-3- (trimethylammonio) propane.
  • Lipid DNA particles are also suitable for coupling with a suitable ligand for tissue-specific nucleic acid transfer.
  • nucleic acids for example adenoviral, particles or artificial particles that bind nucleic acids can also be used (
  • the nucleic acids according to the invention can also be transferred without pharmacological carriers, for example by nucleic acid precipitation, electroporation, injection, particle bombardment ("gene gun").
  • CD30 + and / or rsk3 + cells adjust or modulate their specific cellular functions and synthesis functions which are associated with cellular activation (eg cytokine synthesis) (Example 2), CD30-rsk3 - Cells are not impaired in their function.
  • the induced and constitutive cellular activation characterized for example by NFKB activation, is specifically suppressed in the presence of the nucleic acids according to the invention (example 3). It is irrelevant whether the cellular activation took place after chemical or physical effects or after contact with bacteria or viruses or their components or on the basis of unknown stimuli.
  • the cell changes its functions in such a way that the cell type-specific cellular activation is suppressed, which e.g. characterized by suppression of the expression of endothelial cell adhesion molecule or A20, mitochondrial dehydrogenase (or manganese superoxide dismutase in CD30 + cells.
  • nucleic acids according to the invention are therefore the functional suppression of cellular activation of CD30 + and / or rsk3 + cells without the functional activity of others
  • CD30 + and / or rsk3 + (tumor) cells can be converted into a status which makes the cells sensitive to chemotherapeutic, cytokine or radiation-induced cell death.
  • CD30 + and / or rsk3 + cells stop their proliferation in the presence of the oligonucleotides according to the invention (Example 4) and are subject to cell death (Example 5).
  • One use of the nucleic acids according to the invention is therefore the suppression and the prevention of the growth of malignant and benign CD30 + and / or pp90rsk3 + cells, of tumors and of Tissue infiltration, micro-colonization and metastasis of these cells and the prevention of recurrence of tumors of these cells.
  • tumors are Hodgkin's lymphoma, anaplastic large cell lymphoma, T-cell leukemia, germ cell tumors and embryonic carcinomas.
  • CD30 + and / or rsk3 + cells for example from transplants, bone marrow biopsies, etc. during purging or from the blood (Example 7), for example from atopics or pollen allergy sufferers.
  • nucleic acids according to the invention cannot be stimulated to develop CD30 + and / or pp90rsk3 + cells (Example 6). Hyperstimulation of the cells cannot be induced either. It has been shown that a sustained, high secretion of IL-10, as can be observed after repeated stimulation of lymphocytes with antigen, is suppressed in the presence of the nucleic acids according to the invention, while that of IFN-gamma remains unaffected (Example 2).
  • the nucleic acids according to the invention can therefore be used for the specific prevention of an immune hyperstimulation which is associated with the development of CD30 + and / or rsk3 + cells, while other immune stimulations remain unaffected. This form of use is extraordinarily diverse, examples being the use for preventing the accumulation of CD30 + lymphocytes in the blood in at ⁇ pikers or in patients with pollen allergy and associated suppression of the acute symptoms of the disease.
  • ren preferably the nucleic acids mentioned in Table 1 and Table 2
  • rsk3-specific oligonucleotides inhibit the pseudomonas aeruginosa-induced mucin overproduction, preferably of MUC2, in epithelial cells.
  • Preferred applications of the nucleic acids according to the invention are in diseases with overproduction of musk by respiratory epithelial cells, e.g. in patients with cystic fibrosis.
  • the present invention thus relates to the use of the nucleic acids according to the invention or their derivatives for the production of medicaments which are suitable, for example, for modulating the functional activity of CD30 + and / or pp90rsk + cells and for the functional suppression and elimination of CD30 + and / or pp90rsk + cells.
  • “Modulation of the functional activity” and “functional suppression and elimination” of CD30 + and / or 90rsk + cells according to the present invention mean the following parameters (diseases):
  • nucleic acids according to the invention can be used, for example, for the following purposes: for the suppression and prevention of cellular activation and its dysregulation, immune dysregulation, chronic inflammation, colitis, atopic reactions,
  • Neurodermatitis autoimmune reactions, graft rejection, systemic sclerosis; to reduce the virus production and / or viral load of CD30 + and / or rsk3 + cells; to suppress the development, proliferation, tumor formation and tissue penetration of CD30 + and / or rsk3 + cells; to suppress the production of cellular substances which is associated with the cellular activation of CD30 + and / or rsk3 + cells; to change the tissue balance of activated CD30 + and / or rsk3 + cells on the one hand and other activated or resting cells on the other hand, influencing the Th1 / Th2 balance of the immune cells; for the elimination of CD30 + and / or rsk3 + cells in tissues, body fluids, biopsies or transplants in vivo and in vitro; to suppress cellular activation in CD30 + and / or rsk3 + cells; , to suppress the overproduction of cellular substances in CD30 + and / or rsk3 + cells; to change the
  • the present invention also relates to methods for the treatment of the aforementioned diseases, comprising the administration of the nucleic acids according to the invention.
  • the invention relates to methods for the treatment and prevention of the abovementioned diseases or symptoms, comprising the local or systemic administration of the nucleic acids according to the invention or their derivatives, preferably with suitable pharmacological carriers.
  • ointments or lotions containing preferably 10 mM to 1 M of one or more of the oligonucleotides according to the invention, preferably oligonucleotide AS1, applied once to three times a day with a treatment period until the acute symptoms have ended , or preventive ointments or lotions containing 0.1 mM to 100 mM of one or more of the nucleic acids according to the invention, preferably oligonucleotide AS1, applied locally once a day.
  • injections can be administered in or near the efflorescences, preferably in the form of injection infiltrations with solutions which contain the nucleic acids according to the invention in combination with suitable pharmacological carriers.
  • the systemic treatment for example of intestinal chronic inflammatory diseases, comprises the administration of the nucleic acids according to the invention with suitable pharmacological carriers, preferably in doses of 100 ⁇ g to 10 g per dose at 1-6 parenteral or oral doses per day and one Treatment duration until suppression of the current symptoms.
  • suitable pharmacological carriers preferably in doses of 100 ⁇ g to 10 g per dose at 1-6 parenteral or oral doses per day and one Treatment duration until suppression of the current symptoms.
  • treatment with the nucleic acids according to the invention in one or two doses per day is preferred.
  • other dosage schemes are also possible depending on the course of the disease.
  • the nucleic acids according to the invention preferably as phosphorothioate oligonucleotides, can also be systemically administered as a continuous infusion in doses of 0.05-0.5 13
  • the invention also relates to methods for the ex vivo treatment of body fluids and biopsies, for example the purging of bone marrow transplants.
  • the graft is incubated in the presence of the nucleic acids according to the invention.
  • the nucleic acids are preferably incubated with doses of 10 ⁇ M to 10 mM over 1-2 days.
  • the preferred nucleic acid for this method is the oligonucleotide AS1.
  • Example 1 Specific suppression of CD30 and pp90rsk3 expression in Jurkat cells.
  • Jurkat cells (ATCC TIB-152) (CD30 +, pp90rsk3 +) were paralleled at a density of 5 x 10 4 cells per ml RPMI 1640 culture medium (Gibco-BRL), 10% (v / v) fetal calf serum (Gibco-BRL) Batches (batch AF) in the presence of the following oligonucleotides (40 ⁇ M each) incubated for 2 days at 37 ° C., 5% CO 2 .
  • Approach A Oligonucleotide SEQ ID NO: 5 5'GACGCGCATCCCCGG3 '
  • CD30 120 kD
  • pp90rsk1 90 kD
  • pp90rsk3 90 kD
  • actin 48 kD
  • anti-rsk3 antibody C-20 (1: 1,000) (Santa Cruz Biotechnology; Cat # sc-1431) anti-actin antibody (1: 2,000) (Calbiochem, Cat # CP01)
  • the oligonucleotides SEQ ID NO: 5, NrO: 9 and NO: 10 suppress CD30 protein expression.
  • Oligonucleotide SEQ ID NO: 15 suppresses pp90rsk3 expression without influencing CD30 expression.
  • Oligonucleotide SEQ ID NO: 9 suppresses CD30 expression without affecting pp90rsk3 expression.
  • Example 2 Lymphocytes secrete an altered spectrum of cytokines in the presence of oligonucleotide SEQ ID NO: 5.
  • Lymphocytes were isolated from the peripheral blood of healthy donors using density gradient centrifugation and at a density of 10 6 cells / ml RPMI 1640 culture medium (Gibco-BRL), 10% (v / v) fetal calf serum (Gibco-BRL) Incubation for 2 days with immobilized anti-CD3 antibody (OKT3, 1 ⁇ g / ml) and anti-CD28 antibody (15E6, 1 ⁇ g / ml) induced to CD30 + cells.
  • immobilized anti-CD3 antibody OKT3, 1 ⁇ g / ml
  • anti-CD28 antibody 15E6, 1 ⁇ g / ml
  • the cells were simultaneously incubated with the following oligonucleotides (40 ⁇ M each) at 37 ° C., 5% CO 2 .
  • IL-10 interleukin-10
  • IFN- ⁇ interferon gamma
  • Oligonucleotide SEQ ID NO: 5 suppresses the IL-10 secretion in stimulated, hyperactivated lymphocytes in vitro, while the secretion of IFN- ⁇ remains unaffected.
  • Example 3 Oligonucleotide SEQ ID NO: 5 suppresses the activation of NFKB in lymphocytes.
  • Lymphocytes were isolated from the peripheral blood of healthy donors as described in Example 2, 2 days with immobilized anti-CD28 antibody (15E6, 16
  • the DNA binding activity of NFKB in the cell extract was determined using the "electrophoretic mobility shift assay” (EMSA) using the NFkB-binding double-stranded DNA sequence 5 ⁇ GTTGAGGGGACTTTCCCAGGC3 ' (Santa Cruz Biotechnology, Cat. No. sc-2505; SEQ ID NO : 19) according to the described method (Naumann and Scheidereit, EMBO J. 13, 4597-4607, 1994).
  • the identity of the DNA-binding proteins was determined by "supershift” using the anti-p65 antibody C-20G (Santa Cruz Biotechnology, Cat. # Sc-372X) and the anti-p50 antibody C-19 (Santa Cruz Biotechnology, Cat. # sc-1190X) and detected by com- petition with blocking peptides (Santa Cruz Biotechnology, Cat. # sc-372P, sc-1190P).
  • the activated, DNA-binding form of p65 and p50 NFKB is suppressed in the presence of the oligonucleotide SEQ ID NO: 5 and the oligonucleotide SEQ ID NO: 10.
  • Example 4 Suppression of proliferation selectively from CD30 + and / or pp90rsk3 + cells.
  • Human normal fibroblasts were obtained from a skin biospy and cultured in DME medium (Gibco-BRL), 10% fetal calf serum (Gibco-BRL).
  • the Jurkat, Molt-4 and Raji lines were cultured in RPMI 1640 medium (Gico-BRL), 10% fetal calf serum.
  • the cells were incubated at a density of 5x10 4 cells / ml in parallel batches (A - E) with the following oligonucleotides (40 ⁇ M each) for 4 days at 37 ° C., 5% CO 2 :
  • the CD30 expression of the cells examined was determined using the FACS analysis
  • Pp90rsk3 is expressed in Jurkat, Molt-4 and Raji cells, but not in skin fibroblasts.
  • Oligonucleotide SEQ ID NO: 5 suppresses the proliferation of CD30 + and / or pp90rsk3 + cells, but not the proliferation of CD30 and pp90rsk3 cells. Double positive cells are suppressed better than single positive cells.
  • Oligonucleotide SEQ ID NO: 9 suppresses the proliferation of CD30 + cells only, but not of CD30 cells. This suppression is independent of whether pp90rsk3 is expressed.
  • Oligonucleotide SEQ ID NO: 15 suppresses the proliferation of pp90rsk3 + cells, but not pp90rsk- cells, regardless of whether CD30 is expressed.
  • Jurkat cells (10 5 cells / ml) were incubated in RPMI 1640 medium, 10% fetal calf serum in parallel batches (A - D) in the presence of the following oligonucleotides (40 ⁇ M each) at 37 ° C., 5% CO 2 : Approach A oligonucleotide SEQ ID NO: 5 6 ' GACGCGCATCCCCGG3 ' Approach B oligonucleotide SEQ ID NO: 10 5OCGGGGATGCGCGTC3 ' Approach C oligonucleotide NS SEQ ID NO: 18 5 ⁇ ATGGGGGCCCCCCC3 ' Approach D buffer without oligonucleotide
  • Annexin V-binding cells One of the earliest recognizable features of apoptotic cells is the presentation of phosphatidylserine on the cell surface, which creates a high binding affinity for Annexin V.
  • the number of Annexin V-binding cells was determined on day 3 by incubation with FITC-conjugated Annexin V (Coulter-Immunotech, Cat. No. 2375) and subsequent FACS analysis (FACScan, Becton Dickinson). Dead cells were marked by incubation with propidium iodide and excluded from the measurement.
  • Oligonucleotide SEQ ID NO: 5 and NO: 10 induce cell death by apoptosis in Jurkat cells. NS oligonucleotide does not show this property. 20th
  • Example 6 Oligonucleotide SEQ ID NO: 5 selectively suppresses the formation of CD30 + cells in a lymphocyte preparation.
  • oligonucleotide SEQ ID NO: 5 5OACGCGCATCCCCGG3 '
  • Batch C buffer without oligonucleotide Batch D contains lymphocytes without antibody stimulation and oligonucleotides.
  • the number of CD30 + cells was then determined using the anti-CD30 antibody HRS4 (Coulter-Immunotech, Cat. No. 0705), the number of CD69 + cells using the FITC-anti-CD69 antibody (Coulter-Immunotech, Cat. No. 1943) , the number of CD4 + cells using the FITC-anti-CD4 antibody (Coulter-Immunotech, Cat. No. 6602393), the number of CD8 + cells using the PE-anti-CD8 antibody (Coulter-Immunotech, Cat. No. 0452) determined in the FACS analysis (FACScan, Becton Dickinson).
  • the proliferation and cellular activation were determined using the "Cell Proliferation Kit II" (XTT Test) (Boehringer Mannheim, Cat. No. 1 465 015).
  • the measured values (absorption A492 nm - 690 nm) of batch D were set equivalent to 1 and the measured values of batches A - C were standardized accordingly (stimulation index).
  • the oligonucleotide SEQ ID NO: 5 specifically suppresses cellular proliferation and cellular activation and prevents the formation of CD30 + cells when stimulated by anti-CD3 plus anti-CD28 antibodies.
  • Cells with the early activation marker CD69 accumulate in the presence of SEQ ID NO: 5, but do not differentiate into CD30 + cells. The number of CD4 + and CD8 + cells remains unchanged.
  • Example 7 Oligonucleotide SEQ ID NO: 5 selectively eliminates CD30 + cells in activated lymphocyte populations.
  • Lymphocytes from the peripheral blood of healthy donors were stimulated as described in Example 2 in parallel batches at a density of 106 cells / ml culture medium with immobilized anti-CD3 and anti-CD28 antibodies for 2 days to induce CD30 + lymphocytes (batch B - D) . After CD30 + cells had formed in these batches, the batches were additionally incubated on day 3-5 in the presence of oligonucleotides (40 ⁇ M each).
  • the number of CD30 + cells was determined using the anti-CD30 antibody HRS4 (Coulter-Immunotech, Cat. No. 0705) and the FACS analysis (FACScan, Becton-Dickinson).
  • Oligonucleotide SEQ ID NO: 5 reduces the number of activated CD30 + lymphocytes in an activated lymphocyte population.
  • CD30 + The specific elimination of CD30 + also occurs if the stimulation to differentiate into CD30 + cells continues.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des acides nucléiques, leurs dérivés et des substances de fixation spécifiques de séquences, qui inhibent l'expression de l'antigène CD30 et/ou de la S6 kinase ribosomale pp90rsk3. L'invention concerne également des compositions pharmaceutiques contenant de tels acides nucléiques, et l'utilisation de ces derniers pour la modulation de l'activation cellulaire, la suppression et la prévention des immunodysrégulations, la réduction de la charge virale, et l'éradication des cellules CD30+ et/ou pp90rsk3+ et de leurs tumeurs.
PCT/EP1999/000759 1998-02-06 1999-02-05 Acides nucleiques pour la modulation de l'activation cellulaire WO1999040187A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP99906220A EP1053316A1 (fr) 1998-02-06 1999-02-05 Acides nucleiques pour la modulation de l'activation cellulaire
JP2000530601A JP2002517181A (ja) 1998-02-06 1999-02-05 細胞の活性化を調節するために提供される核酸

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE1998138967 DE19838967A1 (de) 1998-02-06 1998-02-06 Verfahren zur Hemmung der unbegrenzten Proliferation, Tumorbildung oder Metastasierung CD30 Antigen exprimierender Zellen
DE19838967.1 1998-12-22
DE1998159056 DE19859056A1 (de) 1998-12-22 1998-12-22 Nukleinsäuren zur Modulation zellulärer Aktivierung
DE19859056.3 1998-12-22

Publications (1)

Publication Number Publication Date
WO1999040187A1 true WO1999040187A1 (fr) 1999-08-12

Family

ID=26048423

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1999/000759 WO1999040187A1 (fr) 1998-02-06 1999-02-05 Acides nucleiques pour la modulation de l'activation cellulaire

Country Status (3)

Country Link
EP (1) EP1053316A1 (fr)
JP (1) JP2002517181A (fr)
WO (1) WO1999040187A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002011767A2 (fr) 2000-08-08 2002-02-14 Immunex Corporation Methodes de traitement des troubles inflammatoires auto-immuns et chroniques au moyen d'antagonistes de cd30 ou cd30l
US7387776B2 (en) 2002-01-09 2008-06-17 Medarex, Inc. Human monoclonal antibodies against CD30
US7790160B2 (en) 2004-10-01 2010-09-07 Medarex, Inc. Method of treating CD30 positive lymphomas
US8207303B2 (en) 2005-02-18 2012-06-26 Medarex, Inc. Monoclonal antibodies against CD30 lacking in fucosyl residues
US9926373B2 (en) 2012-04-27 2018-03-27 Novo Nordisk A/S Human CD30 ligand antigen binding proteins

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007437A2 (fr) * 1989-11-20 1991-05-30 Parker, David, L. Anticorps cd-30 ameliores et fragments de ces derniers
DE4200043A1 (de) * 1991-11-11 1993-05-13 Stein Harald Prof Dr Lymphoides cd30-antigen (ki-1), dessen protein- und die zugehoerige nucleotidsequenz, seine herstellung sowie mittel zur diagnose und untersuchung von tumoren
WO1993024135A1 (fr) * 1992-05-26 1993-12-09 Immunex Corporation Nouvelle cytokine de fixation sur cd30
EP0718402A2 (fr) * 1994-12-23 1996-06-26 Bristol-Myers Squibb Company Gène de l'amidohydrolase de penicilline V provenant de fusarium oxysporum
DE19640733A1 (de) * 1996-10-02 1998-04-09 Abken Hinrich Verfahren zur Hemmung der unbegrenzten Profileration, Tumorbildung oder Metastasierung CD30 Antigen exprimierender Zellen

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007437A2 (fr) * 1989-11-20 1991-05-30 Parker, David, L. Anticorps cd-30 ameliores et fragments de ces derniers
DE4200043A1 (de) * 1991-11-11 1993-05-13 Stein Harald Prof Dr Lymphoides cd30-antigen (ki-1), dessen protein- und die zugehoerige nucleotidsequenz, seine herstellung sowie mittel zur diagnose und untersuchung von tumoren
WO1993024135A1 (fr) * 1992-05-26 1993-12-09 Immunex Corporation Nouvelle cytokine de fixation sur cd30
EP0718402A2 (fr) * 1994-12-23 1996-06-26 Bristol-Myers Squibb Company Gène de l'amidohydrolase de penicilline V provenant de fusarium oxysporum
DE19640733A1 (de) * 1996-10-02 1998-04-09 Abken Hinrich Verfahren zur Hemmung der unbegrenzten Profileration, Tumorbildung oder Metastasierung CD30 Antigen exprimierender Zellen

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BJORBAEK C ET AL: "Divergent functional roles for p90rsk kinase domains", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 32, 11 August 1995 (1995-08-11), pages 18848 - 18852, XP002108280 *
ZHAO Y ET AL: "Regulation and interaction of pp90rsk isoforms with mitogen -activated protein kinases", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 47, 22 November 1996 (1996-11-22), pages 29773 - 29779, XP002105224 *
ZHAO Y ET AL: "RSK3 encodes a novel pp90rsk isoform with a unique N-terminal sequence: growth factor-stimulated kinase function and nuclear translocation", MOL. CELL. BIOL., vol. 15, no. 8, August 1995 (1995-08-01), ASM WASHINGTON, DC,US, pages 4353 - 4363, XP002105222 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002011767A2 (fr) 2000-08-08 2002-02-14 Immunex Corporation Methodes de traitement des troubles inflammatoires auto-immuns et chroniques au moyen d'antagonistes de cd30 ou cd30l
WO2002011767A3 (fr) * 2000-08-08 2002-12-19 Immunex Corp Methodes de traitement des troubles inflammatoires auto-immuns et chroniques au moyen d'antagonistes de cd30 ou cd30l
JP2005503319A (ja) * 2000-08-08 2005-02-03 イミュネックス・コーポレーション Ｃｄ３０またはｃｄ３０ｌのアンタゴニストを使用する自己免疫および慢性炎症性状態の処置法
US7122183B2 (en) 2000-08-08 2006-10-17 Immunex Corporation Methods for treating autoimmune and chronic inflammatory conditions using antagonists of CD30 or CD30L
US7273609B2 (en) 2000-08-08 2007-09-25 Immunex Corporation Methods for treating autoimmune and chronic inflammatory conditions using antagonists of CD30 or CD30L
JP4938957B2 (ja) * 2000-08-08 2012-05-23 イミュネックス・コーポレーション Ｃｄ３０またはｃｄ３０ｌのアンタゴニストを使用する自己免疫および慢性炎症性状態の処置法
US7387776B2 (en) 2002-01-09 2008-06-17 Medarex, Inc. Human monoclonal antibodies against CD30
US8088377B2 (en) 2002-01-09 2012-01-03 Medarex, Inc. Human monoclonal antibodies against CD30
US7790160B2 (en) 2004-10-01 2010-09-07 Medarex, Inc. Method of treating CD30 positive lymphomas
US8207303B2 (en) 2005-02-18 2012-06-26 Medarex, Inc. Monoclonal antibodies against CD30 lacking in fucosyl residues
US8491898B2 (en) 2005-02-18 2013-07-23 Medarex, L.L.C. Monoclonal antibodies against CD30 lacking in fucosyl residues
US9926373B2 (en) 2012-04-27 2018-03-27 Novo Nordisk A/S Human CD30 ligand antigen binding proteins

Also Published As

Publication number Publication date
EP1053316A1 (fr) 2000-11-22
JP2002517181A (ja) 2002-06-18

Similar Documents

Publication Publication Date Title
DE69233117T2 (de) In sich geschlossende "sens-" und "antisense"-oligonukleotide und deren verwendungen
DE69636339T2 (de) Wachstumsinhibitor gegen leukämische zellen, der antisense-oligonukleotidderivate gegen das wilms-tumorgen enthält
AT392081B (de) Verfahren zur herstellung eines arzneimittels zur behandlung von virusinfektionen
EP1196178B1 (fr) Molecule d'acide nucleique fermee par covalence pour l'immunostimulation
DE60036019T2 (de) Synthetische oligonukleotide die therapeutisch nützlich sind
EP1499721B1 (fr) OLIGODESOXYNUCLEOTIDES CIRCULAIRES EN FORME D'HALTÈRES LEURRES (CDODN) RENFERMANT DES SITES DE LIAISON DE L'ADN POUR LE FACTEUR DE TRANSCRIPTION NF-kappa B
KR102329796B1 (ko) 종양세포 치사활성 및 항균성 조성물 및 방법
EP2365075A1 (fr) Procédé d'inhibition de l'expression d'un gène cible et médicament destiné au traitement d'une maladie tumorale
WO1991017773A2 (fr) Nouveaux conjugues de proteines et de polycations
EP2220214A2 (fr) Procédé d'augmentation de la réactivité immunitaire
JP2003531166A (ja) 細胞傷害剤
DE69333550T2 (de) TNF-alpha RIBOZYME UND ABBAU-RESISTENTE mRNA DERIVATIVE GEBUNDEN AN TNF-alpha Ribozyme
DE69921609T2 (de) Ribozymale nukleinsäure die ccr5 oder cxcr4 schneiden
WO1999040187A1 (fr) Acides nucleiques pour la modulation de l'activation cellulaire
DE69534197T2 (de) Doppelsträngiges oligonukleotid und karzinostatisches mittel das dieses als aktiven inhaltsstoff enthält
WO2003035082A1 (fr) Medicament destine a inhiber l'expression d'un gene cible
DE602004008085T2 (de) Antisense-oligonukleotid zur hemmung der melanom-inhibierenden aktivität (mia)
DE69936141T2 (de) Verwendung von dna-pk
Maus et al. Cationic lipids employed for antisense oligodeoxynucleotide transport may inhibit vascular cell adhesion molecule-1 expression in human endothelial cells: a word of caution
DE69738459T2 (de) Hemmung des Wachstums der chronischen Myelogenen leukämischen Zellen durch antisens-Oligonukleotide die an Crkl zielgerichtet sind
JP2938916B2 (ja) ヘルペスウィルスの増殖阻害および潜伏感染後の再発阻止剤
DE19859056A1 (de) Nukleinsäuren zur Modulation zellulärer Aktivierung
DE69936632T2 (de) Hemmung der cytokin-herstellung
DE69533804T2 (de) Mimetika von aus alternden Zellen abgeleiteten Hemmern der DNA-Synthese
EP2113509A2 (fr) Modulation de l'expression de gènes dépendants de STAT-1

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1999906220

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWP Wipo information: published in national office

Ref document number: 1999906220

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09601488

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 1999906220

Country of ref document: EP