WO1999029870A1 - Porphorymonas gingivalis polypeptides and nucleotides - Google Patents
Porphorymonas gingivalis polypeptides and nucleotides Download PDFInfo
- Publication number
- WO1999029870A1 WO1999029870A1 PCT/AU1998/001023 AU9801023W WO9929870A1 WO 1999029870 A1 WO1999029870 A1 WO 1999029870A1 AU 9801023 W AU9801023 W AU 9801023W WO 9929870 A1 WO9929870 A1 WO 9929870A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- residue
- polypeptide
- studies
- oligonucleotide primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Definitions
- Porphorymonas gingivalis polypeptides and nucleotides
- the present invention relates to P. gingivalis nucleotide sequences
- P. gingivalis polypeptides and probes for detection of P. gingivalis The P. gingivalis polypeptides and nucleotides can be used in compositions for use in raising an immune response in a subject against P. gingivalis and treating or preventing or reducing the severity of the condition known as periodontitis.
- Periodontal diseases are bacterial-associated inflammatory diseases of the supporting tissues of the teeth and range from the relatively mild form of gingivitis, the non-specific, reversible inflammation of gingival tissue to the more aggressive forms of periodontitis which are characterised by the destruction of the tooth's supporting structures.
- Periodontitis is associated with a subgingival infection of a consortium of specific Gram-negative bacteria that leads to the destruction of the periodontium and is a major public health problem.
- P. gingivalis As the recovery of this microorganism from adult periodontitis lesions can be up to 50% of the subgingival anaerobically cultivable flora, whereas P. gingivalis is rarely recovered, and then in low numbers, from healthy sites.
- P. gingivalis in subgingival plaque has been associated with an increased severity of periodontitis and eradication of the microorganism from the cultivable subgingival micr ⁇ bial population is accompanied by resolution of the disease.
- the progression of periodontitis lesions in non-human primates has been demonstrated with the subgingival implantation of P. gingivalis.
- P. gingivalis is a black-pigmented, anaerobic, asaccharolytic, proteolytic Gram-negative rod that obtains energy from the metabolism of specific amino acids.
- the microorganism has an absolute growth requirement for iron, preferentially in the form of haeme or its Fe(III) oxidation product haemin and when grown under conditions of excess haemin is highly virulent in experimental animals.
- a number of virulence factors have been implicated in the pathogenicity of P. gingivalis including the capsule, adhesins, cytotoxins and extracellular hydrolytic enzymes. In order to develop an efficacious and safe vaccine to prevent, eliminate or reduce P.
- gingivalis colonisation it is necessary to identify and produce antigens that are involved in virulence that have utility as immunogens possibly through the generation of specific antibodies. Whilst it is possible to attempt to isolate antigens directly from cultures of P. gingivalis this is often difficult. For example as mentioned above, P. gingivalis is a strict anaerobe and can be difficult to isolate and grow. It is also known that, for a number of organisms, when cultured in vitro that many virulence genes are down regulated and the encoded proteins are no longer expressed. If conventional chemistry techniques were applied to purify vaccine candidates potentially important (protective) molecules may not be identified.
- DNA sequencing As the gene is present (but not transcribed) even when the organism is grown in vitro it can be identified, cloned and produced as a recombinant DNA protein. Similarly, a protective antigen or therapeutic target may be transiently expressed by the organism in vitro or produced in low levels making the identification of these molecules extremely difficult by conventional methods.
- the present inventors have attempted to isolate P. gingivalis nucleotide sequences which can be used for recombinant production of P. gingivalis polypeptides and to develop nucleotide probes specific for P. gingivalis.
- the DNA sequences listed below have been selected from a large number of P. gingivalis sequences according to their indicative potential as vaccine candidates. This intuitive step involved comparison of the deduced protein sequence from the P. gingivalis DNA sequences to the known protein sequence databases.
- Some of the characteristics used to select useful vaccine candidates include; the expected cellular location, such as outer membrane proteins or secreted proteins, particular functional activities of similar proteins such as those with an enzymatic or proteolytic activity, proteins involved in essential metabolic pathways that when inactivated or blocked may be deleterious or lethal to the organism, proteins that might be expected to play a role in the pathogenesis of the organism eg. red cell lysis, cell agglutination or cell receptors and proteins which are paralogues to proteins with proven vaccine efficacy.
- the present invention consists an isolated antigenic Porphorymonas gingivalis polypeptide, the polypeptide comprising; an amino acid sequence selected from the group consisting of SEQ. ID. NO. 265 to SEQ. ID. NO. 528, SEQ. ID. NO. 531 and SEQ. ID. NO. 532; or an amino acid sequence at least 85%, preferably at least 95%, identical to an amino acid sequence selected from the group consisting of SEQ. ID. NO. 265 to SEQ. ID. NO. 528, SEQ. ID. NO. 531 and SEQ. ID. NO. 532; or at least 40 amino acids having a contiguous sequence of at least 40 amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ. ID. NO. 265 to SEQ. ID. NO. 528,
- the polypeptide comprises; an amino acid sequence selected from the group consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532; or an amino acid sequence at least 85%, preferably at least 95%, identical to an amino acid sequence selected from the group consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532; or at least 40 amino acids having a contiguous sequence of at least 40 amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532.
- % identity for polypeptides is to be calculated using the alignment algorithm of Needleman and Munsch (9) using a standard protein scoring matrix (Blosum 50).
- SEQ. ID. NO. 400 SEQ. ID. NO. 411, SEQ. ID. NO. 419, SEQ. ID. NO. 420,
- SEQ. ID. NO. 438 SEQ. ID. NO. 443, SEQ. ID. NO. 444, SEQ. ID. NO. 448, SEQ. ID. NO. 449, SEQ. ID. NO. 452, SEQ. ID. NO. 455, SEQ. ID. NO. 457,
- SEQ. ID. NO. 459 SEQ. ID. NO. 461, SEQ. ID. NO. 462, SEQ. ID. NO. 463,
- SEQ. ID. NO. 467 SEQ. ID. NO. 468, SEQ. ID. NO. 469, SEQ. ID. NO. 482,
- SEQ. ID. NO. 509 SEQ. ID. NO. 510, SEQ. ID. NO. 520, SEQ. ID. NO. 521, SEQ. ID. NO. 522, SEQ. ID. NO. 525, SEQ. ID. NO. 526, SEQ. ID. NO. 528,
- SEQ. ID. NO. 389 SEQ. ID. NO. 390 and SEQ. ID. NO. 391.
- the polypeptide comprises an amino acid sequence selected from the group consisting of residue 422 to residue 531 of SEQ. ID. NO. 303, residue 534 to residue 582 of SEQ. ID. NO. 303, residue 127 to residue 232 of SEQ. ID. NO. 301, residue 240 to residue 259 of SEQ. ID. NO. 301, residue 139 to residue 156 of SEQ. ID. NO. 295, residue 160 to residue 178 of SEQ. ID. NO. 295, residue 180 to residue 207 of SEQ. ID. NO. 295, residue 221 to residue 257 of SEQ. ID. NO. 295, residue 259 to residue 323 of SEQ. ID. NO.
- the present invention consists in a n isolated antigenic Porphorymonas gingivalis polypeptide, the polypeptide comprising an amino acid sequence selected from the group consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532 less the leader sequence set out in Table 3.
- the present invention consists in an isolated DNA molecule, the DNA molecule comprising a nucleotide sequence which encodes the polypeptide of the first aspect the present invention or a sequence which hybridises thereto under stringent conditions.
- the isolated DNA molecule comprises a nucleotide sequence selected from the group consisting of SEQ. ID. NO. 1 to SEQ. ID. NO. 264, SEQ. ID. NO. 529 and SEQ. ID. NO. 530.
- the present invention consists in a recombinant expression vector comprising the DNA molecule of the second aspect of the present invention operably linked to a transcription regulatory element.
- the present invention also provides a cell comprising this recombinant expression vector.
- the present invention consists in a method for producing a P. gingivalis polypeptide comprising culturing the cell under conditions that permit expression of the polypeptide.
- the present invention provides a composition for use in raising an immune response directed against P. gingivalis in a subject, the composition comprising an effective amount of at least one polypeptide of the first aspect of the present invention, or at least one DNA molecule of the second aspect of the present invention, or both,and a pharmaceutically acceptable carrier. It is preferred that the pharmaceutically acceptable carrier is an adjuvant.
- the present invention provides methods of treating P. gingivalis infection in subject comprising the administration of the composition to the subject such that treatment of P. gingivalis infection occurs. The treatment may be prophylactic or therapeutic.
- the present invention provides an antibody raised against a polypeptide of the first aspect the invention.
- the antibody may be polyclonal or monoclonal.
- the present invention also provides compositions including these antibodies. It is preferred that these compositions are adapted for oral use and may be, for example, dentrifices, mouthwashes, etc.
- the present invention provides a nucleotide probe comprising at least 18 nucleotides and having a contiguous sequence of at least 18 nucleotides identical to a contiguous nucleotide sequence selected from the group consisting of SEQ. ID. NO. 1 to SEQ. ID. NO. 121, SEQ. ID. NO. 529, and sequences complementary thereto. It is preferred that the probe further comprises a detectable label.
- the present invention also provides a method for detecting the presence of P. gingivalis nucleic acid in a sample comprising:
- step (b) detecting the hybrid formed in step (a), wherein detection of a hybrid indicates the presence of a P. gingivalis nucleic acid in the sample.
- a purified or isolated polypeptide or a substantially pure preparation of a polypeptide are used interchangeably herein and, as used herein, mean a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it naturally occurs.
- the polypeptide is also 99/29870
- the polypeptide constitutes at least 10, 20, 50 70, 80 or 95% dry weight of the purified preparation.
- the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 mg of the polypeptide.
- a purified preparation of cells refers to, in the case of plant or animal cells, an in vitro preparation of cells and not an entire intact plant or animal. In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells.
- a purified or isolated or a substantially pure nucleic acid is a nucleic acid which is one or both of the following: not immediately contiguous with both of the coding sequences with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid with which it occurs in the organism from which the nucleic acid is derived.
- the term includes, for example, a recombinant DNA which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaiyote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences.
- Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional P. gingivalis DNA sequence.
- a "contig” as used herein is a nucleic acid representing a continuous stretch of genomic sequence of an organism.
- ORF an "open reading frame”, also referred to herein as ORF, is a region of nucleic acid which encodes a polypeptide. This region may represent a portion of a coding sequence or a total sequence and can be determined from a stop to stop codon or from a start to stop codon.
- a "coding sequence” is a nucleic acid which is transcribed into messenger RNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined' by a translation start codon at the five prime terminus and a translation stop code at the three prime terminus.
- a coding sequence can include but is not limited to messenger RNA synthetic DNA, and recombinant nucleic acid sequences.
- a "complement" of a nucleic acid as used herein refers to an anti- parallel or antisense sequence that participates in Watson-Crick base-pairing with the original sequence.
- a “gene product” is a protein or structural RNA which is specifically encoded by a gene.
- probe refers to a nucleic acid, peptide or other chemical entity which specifically binds to a molecule of interest. Probes are often associated with or capable of associating with a label.
- a label is a chemical moiety capable of detection. Typical labels comprise dyes, radioisotopes, luminescent and chemiluminescent moieties, fluorophores, enzymes, precipitating agents, amplification sequences, and the like.
- a nucleic acid, peptide or other chemical entity which specifically binds to a molecule of interest and immobilizes such molecule is referred herein as a "capture ligand".
- Capture ligands are typically associated with or capable of associating with a support such as nitro-cellulose, glass, nylon membranes, beads, particles and the like.
- the specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides, and the temperature and salt concentration of the reaction. These conditions are readily discernible to one of ordinary skill in the art using routine experimentation.
- Homologous refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position.
- the percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared x 100.
- the terms peptides, proteins, and polypeptides are used interchangeably herein.
- an "immunogenic component” as used herein is a moiety, such as an P. gingivalis polypeptide, analog or fragment thereof, that is capable of eliciting a humoral and/or cellular immune response in a host animal.
- An "antigenic component” as used herein is a moiety, such as P. gingivalis polypeptide, analog or fragment thereof, that is capable of binding to a specific antibody with sufficiently high affinity to form a detectable antigen-antibody complex.
- the term "cell-specific promoter” means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue.
- control sequence refers to a nucleic acid having a base sequence which is recognized by the host organism to effect the expression of encoded sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include a promoter, ribosomal binding site, terminators, and in some cases operators; in eukaryotes, generally such control sequences include promoters, terminators and in some instances, enhancers.
- control sequence is intended to include at a minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, for example, leader sequences.
- operably linked refers to sequences joined or ligated to function in their intended manner.
- a control sequence is operably linked to coding sequence by ligation in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence and host cell.
- sample refers to a biological sample, such as, for example, tissue or fluid isolated from an individual (including without limitation plasma, serum, cerebrospinal fluid, lymph, tears, saliva and tissue sections) or from in vitro cell culture constituents, as well as samples from the environment.
- tissue or fluid isolated from an individual (including without limitation plasma, serum, cerebrospinal fluid, lymph, tears, saliva and tissue sections) or from in vitro cell culture constituents, as well as samples from the environment.
- compositions which include a carrier or diluent.
- compositions include pharmaceutical compositions where the carrier or diluent will be pharmaceutically acceptable.
- Pharmaceutically acceptable carriers or diluents include those used in compositions suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal, parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural) administration. They are non-toxic to recipients at the dosages and concentrations employed.
- compositions include, but are not limited to; water, isotonic solutions which are preferably buffered at a physiological pH (such as phosphate-buffered saline or Tris-buffered saline) and can also contain one or more of, mannitol, lactose, trehalose, dextrose, glycerol, ethanol or polypeptides (such as human serum albumin).
- a physiological pH such as phosphate-buffered saline or Tris-buffered saline
- mannitol lactose
- trehalose dextrose
- glycerol glycerol
- polypeptides such as human serum albumin
- alterations may be made to the amino acid sequences set out in the Sequence Listings. These alterations may be deletions, insertions, or substitutions of amino acid residues.
- the altered polypeptides can be either naturally occurring (that is to say, purified or isolated from a natural source) or synthetic (for example, by performing site-directed metagenesis on the encoding DNA). It is intended that such altered polypeptides which have at least 85%, preferably at least 95% identity with the sequences set out in the Sequence Listing are within the scope of the present invention. Antibodies raised against these altered polypeptides will also bind to the polypeptides having one of the sequences set out in the Sequence Listings.
- % identity is to be calculated as set out above. Protein sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the protein will be the equivalent protein which occurs naturally in another species. Within any one species a homologue may exist as numerous allelic variants, and these will be considered homologues of the protein. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art.
- allelic variant will be a variant that is naturally occurring within an individual organism.
- Mutant polynucleotides will possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed metagenesis on the DNA). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques).
- allelic variant will be a variant that is naturally occurring within an individual organism. Nucleotide sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the polynucleotide will be the equivalent polynucleotide which occurs naturally in another species. Within any one species a homologue may exist as numerous allelic variants, and these will be considered homologues of the polynucleotide. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art.
- Antibodies either polyclonal o ⁇ monoclonal, which are specific for a polypeptide of the present invention can be produced by a person skilled in the art using standard techniques such as, but not limited to, those described by Harlow et al. Antibodies: A Laboratory Manual, Cold Springs Harbor Laboratory Press (1988), and D. Catty (editor), Antibodies: A Practical Approach, IRL Press (1988).
- polyclonal antibodies to epitopes of a protein.
- a number of host animals are acceptable for the generation of antibodies by immunization with one or more injections of a polypeptide preparation, including but not limited to rabbits, mice, rats, etc.
- adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitr ⁇ phenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
- BCG Bacille Calmette-Guerin
- Corynebacterium parvum bacille Calmette-Guerin
- a monoclonal antibody to an epitope of a protein may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 493-497), and the more recent human B-cell hybridoma technique (Kesber et al. 1983, Immunology Today 4:72) and EBV- hybridoma technique (Cole et al. 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96).
- Humanized antibodies may be preparefd according to procedures in the literature (e.g. Jones et al. 1986, Nature 321:522-25; Reichman et al. 1988 Nature 332:323-27; Verhoeyen et al. 1988, Science 239:1534-36).
- the recently described "gene conversion metagenesis" strategy for the production of humanized monoclonal antibody may also be employed in the production of humanized antibodies (Carter et al. 1992 Proc. Natl. Acad. Sci. U.S.A. 89:4285-89).
- techniques for generating the recombinant phase library of random combinations of heavy and light regions may be used to prepare recombinant antibodies (e.g. Huse et al. 1989 Science 246:1275-81).
- Antibody fragments which contain the idiotype of the molecule such as Fu F(abl) and F(ab2) may be generated by known techniques.
- fragments include but are not limited to: the F(ab) E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
- Fab expression libraries may be constructed (Huse et al. 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragment with the desired specificity to a protein.
- Adjuvant means a composition comprised of one or more substances that enhances the immunogenicity and efficacy of a vaccine composition.
- suitable adjuvants include squalane and squalene (or other oils of animal origin); block copolymers; detergents such as Tween®-80; Quil® A, mineral oils such as Drakeol or Marcol, vegetable oils such as peanut oil; Corynebacterium-derived adjuvants such as Corynebacterium parvum; Propionibacterium-derived adjuvants such as Propionibacterium acne; Mycobacterium bovis (Bacillus Calmetic and Guerinn or BCG); interleukins such as interleukin 2 and interleukin-12; monokines such as interleukin 1; tumour necrosis factor; interferons such as gamma interferon; combinations such as saponin-aluminium hydroxide or Quil-A aluminium hydroxide; liposomes; ISCOM adj
- stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodS ⁇ 4 at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS
- formamide for example
- DNA vaccination includes within its scope DNA vaccination. Further information regarding DNA vaccination may be found in Donnelly et al, Journal of Immunological Methods 176(1994) 145- 152, the disclosure of which is incorporated herein by reference. Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer, or group of elements or integers.
- genomic DNA was isolated from P. gingivalis strain W50 (ATCC 53978) essentially by the method described by Mamur J. ( J. Mol. Biol. 3, 208-218, 1961). Cloning of DNA fragments was performed essentially as described by Fleischmann et al., (Science; 269, 496-512, 1995) (2). Briefly, purified genomic DNA from P. gingivalis was nebulized to fragment the DNA and was treated with Bal31 nuclease to create blunt ends then run twice through preparative 1% agarose gels. DNA fragments of 1.6-2.0 kb were excised from the gel and the DNA recovered.
- This DNA was then ligated to the vector pUCl ⁇ [Smol digested and dephosphorylated; Pharmacia) and electrophoresed through a 1% preparative agarose gel. The fragment comprising linear vector plus one insert was excised, purified and this process repeated to reduce any vector without insert contamination. The recovered vector plus insert DNA was blunt-ended with T4 DNA polymerase, then a final ligation to produce circular DNA was performed. Aliquots of Epicurian Coli Electroporation- Competent Cells (Stratagene) were transformed with the ligated DNA and plated out on SOB agar antibiotic diffusion plates containing X-gal and incubated at 37°C overnight. Colonies with inserts appeared white and those without inserts (vector alone) appeared blue. Plates were stored at 4°C until the white clones were picked and expanded for the extraction of plasmid DNA for sequencing.
- Plasmid DNA was prepared by picking bacterial colonies into 1.5ml of LB, TB or SOB broth supplemented with 50-100ug/ml Ampicillin in 96 deep well plates. Plasmid DNA was isolated using the QIAprep Spin or QIAprep 96 Turbo miniprep kits (QIAGEN GmbH, Germany). DNA was eluted into a 96 well gridded array and stored at -20C.
- Sequencing reactions were performed using ABI PRISM Dye Terminator and ABI PRISM BIGDye Terminator Cycle Sequencing Ready Reaction kits with AmpliTaq DNA polymerase FS (PE Applied Biosystems, Foster City, CA) using the Ml 3 Universal forward and reverse sequencing primers. Sequence reactions were conducted on either a Perkin-Elmer GeneAmp 9700 (PE Applied Biosystems) or Hybaid PCR Express (Hybaid, UK) thermal cyclers. Sequencing reactions were analysed on ABI PRISM 377 DNA sequencers (PE Applied Biosystems).
- sequences obtained are set out below. The relationship between these sequences is set out in Table 1.
- the initiation codon was calculated using a combination of sequence homology alignment (FASTA), signal sequence prediction (PSORT, SignalP) or ORF prediction (GeneMark). 18
- Table 1 Reference table indicating the relationships of each sequence ID to the selected proteins.
- DNA files in FASTA format were converted to GCG format files and imported into a database.
- the DNA files were translated into amino acid files using the program Flip obtained from ANGIS (Australian Genomic Information Service, University of Sydney, Australia).
- a series of bioinformatic analyses were performed on the proteins in order to select potential vaccine candidates.
- the programs used were FASTA homology searching (1), PSORT (2,3), SignalP (4), TopPred (5), and GeneMark (6).
- the proteins and their bioinformatic results were stored in the custom written database for search and retrieval of proteins with the desired characteristics
- the FASTA homology results for these proteins were then examined for any alignment with a protein suggesting surface location or vaccine efficacy.
- a second signal sequence detection program SignalP was also performed and, in certain instances, this program detected signals not identified with PSORT. All proteins identified by other methods were also analysed by PSORT and SignalP.
- the C-terminal amino acid of bacterial outer membrane proteins has been shown to be important for the assembly of the protein on the outer membrane (7).
- a typical structure definition for outer membrane proteins has been determined as the presence of a signal sequence at the N-terminus and a tyrosine or phenylalanine at the C-terminus. A number of the selected proteins exhibit this characteristic structure.
- the program TopPred was used to determine the presence and number of membrane spanning domains (MSDs) and the presence of such sequences indicates a preference to be attached to membranes such as the outer membrane.
- the TonBIII box is a 30 amino acid motif present within TonB outer membrane receptors in a wide variety of bacteria.
- the TonBIII box of P. gingivalis (8) was used to search the protein data set for homology by FASTA as described above. Those proteins demonstrating significant homology are listed in Table 5.
- Table 2 FASTA protein homology results of complete ORFs against a non-redundant protein database.
- IPG113 IHeat shock protein (dnak), Treponema pallidum IAE001203 ;635aa ;640aa 162
- IPG116 Heat shock protein (HTPGJ, Escherichia coli [P10413 l624aa [684aa ⁇ 32 l627aa U.60E-48 1
- JPG119 [ATP-dependent protease, Aquifex aeolicus J066827 [444aa [461aa [46 [458aa [ 1.60E-77 j
- IPG124 Heat shock protein (dnaj), eptospira interrogans ⁇ AF007813 ⁇ 369aa l383aa 146 ⁇ 356aa ⁇ 2.30E-57 i
- Table 3 Results of PSORT, SignalP and TopPred analysis of the proteins.
- the signal present column indicates the presence of a signal sequence detected with either PSORT or SignalP.
- the terms in parentheses indicates the type of signal sequence as determined by PSORT.
- the cell location & probability values are generated by PSORT and represent the probability of the protein being in the cell compartments outer membrane (OM), inner membrane (IM), periplasmic space (PC) or cytoplasm (C).
- OM outer membrane
- IM inner membrane
- PC periplasmic space
- C cytoplasm
- the number of transmembrane domains (TMDs) was determined by TopPred and does not include uncleavable signal sequences.
- Table 4 Percentage identity and percentage similarity of various proteins with the 70 amino acids from the C-terminal of the P. gingivalis arginine protease 1 (RGPl), arginine protease 2 (RGP2), and the cysteine protease/hemagglutinin (prtT).
- Table 5 Percentage identity and percentage similarity of various proteins with the TonBIII box of P. gingivalis.
- PG1 Oligonucleotides to the 5' and 3' regions of the deduced protein were used to amplify the gene of interest from a preparation of P. gingivalis W50 genomic DNA using the TaqPlus Precision PCR System ( Stratagene) and a PTC-100 (MJ Research) thermal cycler or similar device.
- the 5' oligonucleotide primer sequence was GCGCCATATGCTGGCCGAACCGGCC
- the 3' oligonucleotide primer sequence was
- the PCR fragment was purified, digested with Nde I, Xho I restriction enzymes (Promega) and ligated into the corresponding sites of the plasmid pProEx-1 (Gibco-BRL) and transformed into E. coli ⁇ R1793 cells (a gift from Elizabeth Raleigh, New England Biolabs). A resulting clone expressing the correct insert was selected and induced with or without O.lmM IPTG (Promega) for expression of the recombinant protein.
- PGl was purified by disruption of the E. coli cells by sonication in binding buffer (Novagen) and solubilisation by the addition of sarkosyl (N-Lauroyl sarcosine) to a 1% final concentration.
- the methods used for PG2 were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGGTATACATGAAAAGAATGACGC, the 3' oligonucleotide primer sequence was CGCGAGATCTGAAAGACAACTGAATACC and the PCR product was cloned into pGex-stop RBS(IN) (Patent application W ⁇ 9619496, JC Cox, SE Edwards, I Frazer and EA Webb. Variants of human papilloma virus antigens) using the BstZ 171 and Bgl II restriction sites.
- the methods used for PG3 were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGTATACATGAAGAAATCAAGTGTAG
- the 3' oligonucleotide primer sequence was GCGCAGATCTCTTCAGCGTACCTTGCTGTG
- D ⁇ A was amplified with Pfu D ⁇ A polymerase (Stratagene).
- the PCR product was cloned directly into pCR-Blunt and transformed into E. coli ToplOF'(InVitrogen) before subcloning into the expression plasmid pGex- stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E.
- Urea (or guanidine hydrochloride when it was substituted) was removed from the purified protein by sequential dialysis against reducing levels of urea (3M then 1.5M then 0.5M then 0M urea all in 50mM Tris, 500mM ⁇ aCl, 8% glycerol, pH7.4). Purified protein was stored frozen at -80°C until required. Protein concentration was determined by the Coomassie Plus protein assay (Pierce). PG4
- the methods used for PG4 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CTTCTGTATACTTACAGCGGACATCATAAAATC
- the 3' oligonucleotide primer sequence was TTCCAGGAGGGTACCACGCAACTCTTCTTCGAT
- DNA was amplified with the Tth XL PCR kit (Perkin Elmer).
- the PCR product was cloned into the expression plasmid pGex-stop RBS(IN) using the Bst Z171 and Kpn I restriction sites and transformed into E. coli ⁇ R1793.
- the methods used for PG5 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was TTGCAACATATGATCAGAACGATACTTTCA
- the 3' oligonucleotide primer sequence was AGCAATCTCGAGCGGTTCATGAGCCAAAGC
- D ⁇ A was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24 (Novagen) using the Nde I and Xho I restriction sites and transformed into E. coli BL21 (Pharmacia Biotech). Removal of urea was not proceeded past IM urea as the protein was insoluble at lower concentrations of urea. Purified protein was stored at 4°C until required.
- the methods used for PG6 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was TAAACATATGTGCCTCGAACCCATAATTGCTCCG
- the 3' oligonucleotide primer sequence was CGTCCGCGGAAGCTTTGATCGGCCATTGCTACT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Nde I and Hind III restriction sites and transformed into E. coli BL21.
- the methods used for PG8 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGGTATACATGGAGTTCAAGATTGTG
- the 3' oligonucleotide primer sequence was CGCGAGATCTGTTTTCTGAAAGCTTTTC
- DNA was amplified with the TaqPlus Precision PCR System.
- the PCR product was cloned into the expression plasmid pProEx-1 using the Nde I and Xho I restriction sites and transformed into E. coli ⁇ R1793.
- PG8A PG8A is a shortened version of PG8 and has the first 173 amino acids removed.
- the methods used for PG8A were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGGTATACATGGAAAACTTAAAGAAC
- the 3' oligonucleotide primer sequence was CGCGAGATCTGTTTTCTGAAAGCTTTTC
- DNA was amplified with the TaqPlus Precision PCR System.
- the PCR product was cloned into the expression plasmid pGex-stop RBS(IN) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli ⁇ R1793. Prior to dialysis of the purified protein EDTA (Sigma) was added to a final concentration of lOmM.
- the methods used for PG10 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGGATATCATGGATAAAGTGAGCTATGC, the 3' oligonucleotide primer sequence was CGCGAGATCTTTTGTTGATACTCAATAATTC and D ⁇ A was amplified with the TaqPlus Precision PCR System.
- the PCR product was digested with Eco RV and Bgl II and ligated into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli ⁇ R1793.
- the methods used for PGll were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGTATACATGAGAGCAAACATTTGGCAGATACTTTCCG, the 3' oligonucleotide primer sequence was
- GCGCAGATCTGCGCAAGCGCAGTATATCGCC and D ⁇ A was amplified with Tli D ⁇ A polymerase (Promega).
- the PCR product was cloned into pCR-Blunt and transformed into E. coli Top lOF'before subcloning into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli ⁇ R1793.
- PGll was purified by solubilisation of E.
- PG12 The methods used for PG12 were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGTATACATGAATAGCAGACATCTGACAATCACAATCATTGCCGG
- the 3' oligonucleotide primer sequence was GCGCAGATCTGCTGTTCTGTGAGTGCAGTTGTTTAAGTG and DNA was amplified with Tli DNA polymerase.
- the PCR product was cloned into pCR- Blunt and transformed into E. coli ToplOF'cells before subcloning into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E.
- coli BL21 Purification of the recombinant protein was essentially the same as PGll except 0.5% DHPC (l,2-Diheptanoyl-sn-glycero-3-phosphocholine; Avanti) in 50mM Tris, 50mM NaCl, pH ⁇ .O was used to solubilise the inclusion bodies instead of sarkosyl and the DHPC was diluted to 0.1% before addition to the Ni-NTA and 0.1% DHPC was added to all buffers.
- DHPC l,2-Diheptanoyl-sn-glycero-3-phosphocholine
- the methods used for PG13 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCCATATGCGGACAAAAACTATCTTTTTTGCG
- the 3' oligonucleotide primer sequence was GCGCCTCGAGGTTGTTGAATCGAATCGCTATTTGAGC and DNA was amplified with Tli DNA polymerase.
- the PCR product was cloned the expression plasmid p ⁇ T24b using the Nde I and Xho I restriction sites and transformed into E. coli BL21.
- Purification of the recombinant protein was essentially the same as PG3 using 6M urea and 1% NOG (n-octyl glucoside; Sigma) was added to the dialysis buffer. Removal of urea was not proceeded past 2M urea as the protein was insoluble at lower concentrations of urea. Purified protein was stored at 4°C until required.
- PG14 The methods used for PG12 were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGGCGCCATGACGGACAACAAACAACGTAATATCG, the 3' oligonucleotide primer sequence was
- the methods used for PG15 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CAAAAGTATACTAATAAATATCATTCTCAA
- the 3' oligonucleotide primer sequence was GCTTATGGTACCTTTGGTCTTATCTATTAT
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Kpn I restriction sites and transformed into E. coli ER1793.
- PG22 The methods used for PG22 were essentially the same as for PGl with the following exceptions.
- the 5' oligonucleotide primer sequence was CCCCGGATCCGATGCGACTGATCAAGGC
- the 3' oligonucleotide primer sequence was CCCCCTCGAGCGGAACGGGGTCATAGCC
- DNA was amplified with the TaqPlus Precision PCR System.
- the PCR product was cloned into the expression plasmid pET24b using the Bam HI and Xho I restriction sites and transformed into E. coli BL21DE3. Once PG22 was purified dialysis was performed in the same manner as for PGl but in the presence of IM imidazole.
- PG24 The 5' oligonucleotide primer sequence was CCCCGGATCCGATGCGACTGATCAAGGC
- the 3' oligonucleotide primer sequence was CCCCCTCGAGCGGAACGGGGTCATAGCC
- DNA
- the methods used for PG24 were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGGTATACATGAATTACCTGTACATAC
- the 3' oligonucleotide primer sequence was CGCGGGATCCGTTCGATTGGTCGTCGATGG
- DNA was amplified with the TaqPlus Precision PCR System.
- the PCR product was digested with Bst Z171 and Bam HI and ligated into the expression plasmid pGex-stop RBS(IN) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli ⁇ R1793. Due to the low level of expression of PG24 purification was not proceeded with except on small scale.
- PG24A is the same as PG24 with the predicted ⁇ -terminal sequence removed.
- the methods used for PG24A were essentially the same as for PG3 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGCGCATATGGAGATTGCTTTCCTTTCTTCG
- the 3' oligonucleotide primer sequence was CGCGCTCGAGTTAGTTCGATTGGTCGTCG
- D ⁇ A was amplified with the TaqPlus Precision PCR System.
- the PCR product was cloned into the expression plasmid pProEx-1 using the ⁇ de I and Xho I restriction sites and transformed into E. coli ER1793.
- Purification of the recombinant protein was essentially the same as PG3 except 8M urea was used to solubilise the inclusion bodies and in the buffers used for the ⁇ i- ⁇ TA column purification. Urea was removed by sequential dialysis (4M then 2M, then IM then 0.5M then OM urea all in 50mM Tris, 500mM ⁇ aCl, 8% glycerol, pH7.4). Purified protein was stored frozen at -80°C until required.
- PG30 The methods used for PG30 were essentially the same as for PG3 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TACGGAATTCGTGACCCCCGTCAGAAATGTGCGC.
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTTGATCCTCAAGGCTTTGCCCGG and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E.
- PG31 The methods used for PG31 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was CGGGGAATTCGCAAAAATCAATTTCTATGCTGAA
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCTGTATGCAATAGGGAAAGCTCCGA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E.coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG32 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGCAGAATTCCAGGAGAATACTGTACCGGCAACG, the 3' oligonucleotide primer sequence was
- PG33 The methods used for PG33 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTCCGCTGCAGTCATTACTACAA and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG35 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGAATTCATGAAACAACTAAACATTATCAGC
- the 3' oligonucleotide primer sequence was GCGTGCGGCCGCGAAATTGATCTTTGTACCGACGA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG36 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was AAAGGAATTCTACAAAAAGATTATTGCCGTAGCA
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAACTCCTGTCCGAGCACAAAGT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using theEco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG37 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was TGGCGAATTCAAACGGTTTTTGATTTTGATCGGC
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTGCTAAAGCCCATCTTGCTCAG and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG38 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CCTCGAATTCCAAAAGGTGGCAGTGGTAAACACT, the 3' oligonucleotide primer sequence was
- the methods used for PG39 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was AGCTGGATCCCAAGGCGTCAGGGTATCGGGCTAT, the 3' oligonucleotide primer sequence was
- the methods used for PG40 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCTGAATTCAAGACGGACAACGTCCCGACAGAT, the 3' oligonucleotide primer sequence was
- the methods used for PG41 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GACTGAATTCCAAAACGCCTCCGAAACGACGGTA, the 3' oligonucleotide primer sequence was
- the methods used for PG42 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was GTTTGAATTCGCAAATAATACTCTTTTGGCGAAG, the 3' oligonucleotide primer sequence was
- PG43 The methods used for PG43 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was GCGCGAATTCAAAAAAGAAAAACTTTGGATTGCG
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTCAAAGCGAAAGAAGCCTTAAC
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG44 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was AGCCGAATTCTGTAAGAAAAATGCTGACACTACC, the 3' oligonucleotide primer sequence was
- the methods used for PG45 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GACAGGATCCTGCTCCACCACAAAGAATCTGCCG, the 3' oligonucleotide primer sequence was
- the methods used for PG46 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CTCGGAATTCCGTTATGTGCCGGACGGTAGCAGA, the 3' oligonucleotide primer sequence was
- PG47 The methods used for PG47 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAAGTTTACACGAATACCGGTAGACCAAGTGCGGCC and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies. PG48
- the methods used for PG48 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAAAAATCCAAGCAGGTACAGCGA, the 3' oligonucleotide primer sequence was
- PG49 The methods used for PG49 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GAACGGATCCAACGAGCCGGTGGAAGACAGATCC
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTAATCTCGACTTCATACTTGTACCA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG50 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GCTGGGATCCGCGACAGACACTGAGTTCAAGTAC, the 3' oligonucleotide primer sequence was
- CTATGCGGCCGCGAACTTCACTACCAAGCCCATGT DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- PG51 The methods used for PG51 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TCTTGAATTCGCGCAAAGTCTTTTCAGCACCGAA
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCACTTTTTCGTGGGATCACTCTCTT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG52 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was AGAAGAATTCAAACGGACAATCCTCCTGACGGCA
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAAGTCTTTGCCCTGATAGAAATC
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG53 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCTGAATTCGCGAATCCCCTTACGGGCCAATCG, the 3' oligonucleotide primer sequence was
- the methods used for PG54 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGCTGAATTCCAGATTTCGTTCGGAGGGGAACCC, the 3' oligonucleotide primer sequence was
- the methods used for PG55 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGAGGGATCCGAGCTCTCTATTTGCGATGGCGAG
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCTTACCTGACTTCTTGTCACGAAT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG56 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was AAATGGATCCCGAAAAATTTTGAGCTTTTTGATG
- the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTTGATTCGTAATTTTTCCGTATC
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG57 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGGATCCCAAGAGATCTCAGGCATGAATGCA, the 3' oligonucleotide primer sequence was
- PG58 The methods used for PG58 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGGTGAATTCCAAACCCCACGAAATACAGAAACC
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAAGTCCAGCTAAAACCGGCGAA and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG59 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5 1 oligonucleotide primer sequence was TGCTGAATTCCAACAAGAGAAGCAGGTGTTTCAT, the 3' oligonucleotide primer sequence was
- PG60 The methods used for PG60 were essentially the same as for PG30 with the following exceptions.
- the predicted N-te ⁇ ninal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCGGAATTCCAGATGCTCAATACTCCTTTCGAG
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAGAGGTAGGAGATATTGCAGAT
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG61 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was AGCAGAATTCCCCGTCTCCAACAGCGAGATAGAT, the 3' oligonucleotide primer sequence was
- the methods used for PG62 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAGCGGTTTCCGATGGTGCAGGGA, the 3' oligonucleotide primer sequence was
- PG63 The methods used for PG63 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCAGAATTCCAAGAAGCAAACACTGCATCTGAC
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAAGTGTACGCAACACCCACGCC
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG64 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAGAGTCGTCCTGCTCTTAGACTG, the 3' oligonucleotide primer sequence was
- PG65 The methods used for PG65 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGGATCCATCGGACAAAGCCGCCCGGCACTT
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTAAAGCGGTAACCTATGCCCACGAA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG66 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GTTTGAATTCCAAGACGTTATCAGACCATGGTCA, the 3' oligonucleotide primer sequence was
- the methods used for PG67 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GAACGAGCTCGCGGAACGTCCTATGGCCGGAGCA, the 3' oligonucleotide primer sequence was
- the methods used for PG68 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GCTTGCGGCCGCCCTTATGAAAGATTTGCAGAT, the 3' oligonucleotide primer sequence was
- the methods used for PG69 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAGGAAGGGGAGGGGAGTGCCCGA, the 3' oligonucleotide primer sequence was
- the methods used for PG70 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGGTGGATCCTCGCAAATGCTCTTCTCAGAGAAT, the 3' oligonucleotide primer sequence was
- the methods used for PG71 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAGAACAATACCCTCGATGTACAC, the 3' oligonucleotide primer sequence was
- the methods used for PG72 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCGGAGAGCGACTGGAGACGGACAGC, the 3' oligonucleotide primer sequence was
- the methods used for PG73 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGGTGAATTCCAACAGACAGGACCGGCCGAACGC, the 3' oligonucleotide primer sequence was
- PG74 The methods used for PG74 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAAGAAAATAATACAGAAAAGTCA.
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAGGTTTAATCCTATGCCAATACT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG75 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCGGGATCCGCTCAGGAGCAACTGAATGTGGTA, the 3' oligonucleotide primer sequence was
- PG76 The methods used for PG76 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5 1 oligonucleotide primer sequence was AGCAGAATTCGGAAACGCACAGAGCTTTTGGGAA
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTACCTGCACCTTATGACTGAATAC
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG77 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAAGAGAAAAAGGATAGTCTCTCT, the 3' oligonucleotide primer sequence was
- the methods used for PG78 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCAGAATTCCAGGATTCTTCCCACGGTAGCAAT, the 3' oligonucleotide primer sequence was
- the methods used for PG79 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was TGCTGAATTCGTAGTGACGCTGCTCGTAATTGTC
- the 3' oligonucleotide primer sequence was
- PG80 The methods used for PG80 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAATTCCAAAACGTGCAGTTGCACTACGAT
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTTGAAAGTCCATTTGACCGCAAG
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG81 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GTTTGAATTCCAGGATTTTCTCTATGAAATAGGA, the 3' oligonucleotide primer sequence was
- PG82 The methods used for PG82 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GAACGAATTCCAGAACAACAACTTTACCGAGTCG
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTTCAGTTTCAGCTTTTTAAACCA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21D ⁇ 3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG84 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGGATCCCAGAATGATGACATCTTCGAAGAT, the 3' oligonucleotide primer sequence was
- the methods used for PG85 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was CGGTGAATTCGTACCAACGGACAGCACGGAATCG, the 3' oligonucleotide primer sequence was
- PG86 The methods used for PG86 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGGATCCCAAACGCATGATCATCTCATCGAA
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTGGTTCAGGCCGTGGGCAAATCT
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG87 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCGGAATTCCAGAGCTATGTGGACTACGTCGAT, the 3' oligonucleotide primer sequence was
- PG88 The methods used for PG88 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was AGCAGAATTCGCCGAATCGAAGTCTGTCTCTTTC
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCGGCAAGTAACGCTTTAGTGGGGA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG89 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAATCGAAGTTAAAGATCAAGAGC, the 3' oligonucleotide primer sequence was
- the methods used for PG90 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCAGAATTCCAAACAACGACGAACAGTAGCCGG, the 3' oligonucleotide primer sequence was
- the methods used for PG91 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCCAGACGATGGGAGGAGATGATGTC, the 3' oligonucleotide primer sequence was
- the methods used for PG92 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAATTCGCCGATGCACAAAGCTCTGTCTCT, the 3' oligonucleotide primer sequence was
- the methods used for PG93 we're essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAGCTCCAAGAGGAAGGTATTTGGAATACC, the 3' oligonucleotide primer sequence was
- the methods used for PG94 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAGCTCCAAGAGGAAGGTATTTGGAATACC, the 3' oligonucleotide primer sequence was
- the methods used for PG95 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAGCTCTGTGGAAAAAAAGAAAAACACTCT, the 3' oligonucleotide primer sequence was
- the methods used for PG96 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAGCTCCAAACGCAAATGCAAGCAGACCGA, the 3' oligonucleotide primer sequence was
- PG97 The methods used for PG97 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCGGGATCCCAGTTTGTTCCGGCTCCCACCACA
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCTGTTTGATGAGCTTAGTGGTATA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG98 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was AGCAGAATTCCAAGAAAGAGTCGATGAAAAAGTA, the 3' oligonucleotide primer sequence was
- PG99 The methods used for PG99 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was TGCTGAATTCAAGGACAATTCTTCTTACAAACCT
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCGAATCACGACTTTTCTCACAAA
- DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid p ⁇ T24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG100 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCAGAATTCCAGTCTTTGAGCACAATCAAAGTA, the 3' oligonucleotide primer sequence was
- the methods used for PG101 were essentially the same as for PG30 with the following exceptions.
- the 5' oligonucleotide primer sequence was TGCTGAATTCAAAGGCAAGGGCGATCTGGTCGGG
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCTCTTCTCGAACTTGGCCGAGTA and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- the methods used for PG102 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GGCCGAATTCCAGATGGATATTGGTGGAGACGAT, the 3' oligonucleotide primer sequence was
- PG104 The methods used for PG104 were essentially the same as for PG30 with the following exceptions.
- the predicted N-terminal signal sequence was removed from the recombinant protein.
- the 5' oligonucleotide primer sequence was GAACGGATCCAACGTGTCTGCTCAGTCACCCCGA
- the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCTGAGCGATACTTTTGCACGTAT and DNA was amplified with the Tth XL PCR kit.
- the PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.
- Various antisera were raised for detecting the expression and refolding of the recombinant P. gingivalis proteins.
- a whole cell antisera was raised by injecting New Zealand White rabbits with 3 doses of sonicated P. gingivalis (strain W50) containing approximately 2mg of protein. The first dose was given in Freunds complete adjuvant (FCA) and the second and third doses were given in Freunds incomplete adjuvant (IF A) at 3 week intervals.
- FCA Freunds complete adjuvant
- IF A Freunds incomplete adjuvant
- a second rabbit antisera was produced in a similar manner but using a sarkosyl insoluble fraction (each dose was 0.69mg of protein) derived from P. gingivalis W50 according to the method of Doidg and Trust T. et al 1994 as the immunogen.
- a third rabbit antisera was produced in a similar manner to the first only the sarkosyl soluble fraction (lmg of protein per dose) derived from P. gingivalis W50 cells according to the method of Doidg P. and Trust TJ. (1994 Infect Immun 62:4526-33) was used as the immunogen.
- a "protected rat serum” pool was also used in these studies and was obtained from rats immunised with formalin killed whole P. gingivalis cells in FIA (strain ATCC 33277; 2 doses of 2xl0 9 cells, 3 weeks apart). Rats were then challenged 2 weeks after their last dose with live P. gingivalis cells (strain 33277) given orally as previously described (Klaussen B. et al. 1991, Oral Microbiol Immunol 6:193-201) and the serum obtained from these rats 6 weeks after the final challenge inoculation at the time of sacrifice.
- mice abscess model was used to assess the efficacy of immunising mice with recombinant P. gingivalis proteins in protecting mice from formation of a subcutaneous abscess.
- This model has been used by others as a predictor of potential vaccines against periodontal disease (Bird PS, et al. 1995 J. Periodontol. 66:351-362.
- BALB/c mice 6-8 weeks old were immunised by subcutaneously injecting them with 0.1 ml containing either 10 or 20 ⁇ g of recombinant P. gingivalis protein, 20 ⁇ g of E. coli lysate protein, 2 x 10 formalin killed cells of P.
- gingivalis strain 33277 emulsified in incomplete Freund's adjuvant (IFA; Sigma) on day 0.
- IFA incomplete Freund's adjuvant
- mice At day 21 mice were re-injected with the same dose and then bled 1 week later and evaluated for antibody levels.
- mice all mice were challenged with approximately 2 x IO 9 cells of live P. gingivalis (ATCC 33277) by subcutaneous injection in the abdomen. Following challenge mice were monitored daily for weight loss and the size of the lesion measured for the next 10 days. Lesion sizes were measured by length and width and expressed as mm . Groups were statistically analysed using a Kruskal-Wallis one-way ANOVA and were also individually examined using the unpaired t test or Mann- Whitney rank sum test using the Instat statistical package.
- Figure 1 shows the results of one experiment at day 4 after challenge (lesions were at maximum size at this time point).
- Control mice immunised with E. coli lysate showed large lesions while mice immunised with killed cells of P. gingivalis strain 33277 were fully protected. This indicates that whole cells provide protection against P. gingivalis while E. coli protein immunised mice were not protected.
- Figure 2 shows the results of a separate experiment using combinations of recombinant proteins. Mice given PGl + PG2 showed a significant level of protection compared to control mice give E. coli lysate (p ⁇ 0.026 unpaired t test).
- Cloned candidates were cultured in 15ml of Terrific broth, induced with IPTG and sampled at 4h post-induction. One ml of culture was removed, pelleted and the cells resuspended in a volume of PBS determined by dividing the OD Aso onm °f tne culture by 8. An aliquot of lysate (lOO ⁇ l) was added to lOO ⁇ l of 2x sample reducing buffer (125mM Tris pH 6.8, 20% glycerol, 4% SDS, 80rnM DTT, 0.03% bromophenol blue) and boiled for lOmin. SDS-PAG ⁇ was performed according to the method of Laemmli UK.
- the rabbit, rat and human sera were diluted 1/5000, 1/1000 and 1/500 respectively in 5% skim milk in TTBS and absorbed with lOO ⁇ l (for the rabbit serum) or 250 ⁇ l (for the rat and human sera) E. coli extract (20mg/ml; Promega) for 6h at RT.
- Membranes were incubated overnight at RT with the absorbed antisera, or for 1 hr at RT with 1/5000 diluted anti-T7-Teg conjugate. Following 3xl0min washes with TTBS, HRP-conjugated anti-rabbit (Silenus), anti-mouse (Silenus) or anti-human (KPL) antibody, diluted 1/5000 in 5% skim milk in TTBS, was added for lh at RT. Membranes were washed as before, prior to addition of TMB membrane peroxidase substrate (KPL) for detection of immunoreactive proteins. Results of reactivity for the recombinant P. gingivalis proteins is shown in Table 7.
- PCR Polymerase Chain Reaction
- RTase Reverse Transcriptase
- RT-PCR results are shown in Table 6 using the oligonucleotide primers as used in "Cloning, expression and purification of recombinant P. gingivalis genes" section described above,except for the following changes.
- the 3' reverse primer used was GCGCCTCGAGATTCATTTCCTTATAGAG
- the 5' forward primer was CTTCTTGTCGACTACAGCGGACATCATAAAATC
- the 3' reverse primer was TTCCACCTCGAGTTAACGCAACTCTTCTTCGAT
- PG6 the 5' forward primer was TAAAGAATTCTGCCTCGAACCCATAATTGCTCCG
- PG10 the 5' forward primer was CGCGCATATGGATAAAGTGAGCTATGC and the 3' reverse primer was CGCGCTCGAGTTTGTTGATACTCAATAATTC
- PG13 the 5' forward forward primer was CGCATATGGATAAAGTGAGCTATGC and the 3' reverse primer was CGCGCTCGAGTTTGTTGATACTCAATAATTC, for
- RNA for a specific candidate is present and that the protein is produced. However, where there is no amplification achieved this does not indicate that this gene is never transcribed and may be the result of the culture conditions or the state of the cells when harvested.
- Table 7 Immunoblot results of proteins expressed in E. coli against rabbit, rat and human antisera. Deduced MW was calculated from amino acid sequence of the P. gingivalis proteins, some of which had their N-terminal signal sequences removed. Apparent MW was determined from SDS-PAGE gels. The N- and C-terminal tags add approximately 2.5 KDa to the deduced MW of the recombinant proteins. The symbols are + positive, - negative, +/- weak positive, ND not done.
- the Tla receptor protein of Porphyromonas gingivalis W50 a homolog of the RI precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin. J. Bacteriol. 179:4778-4788.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Communicable Diseases (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2000524441A JP2001526035A (ja) | 1997-12-10 | 1998-12-10 | Porphorymonasgingivalisポリペプチドおよびヌクレオチド |
| KR1020007006386A KR100603552B1 (ko) | 1997-12-10 | 1998-12-10 | 포피로모나스 긴기발리스 폴리펩티드 및 뉴클레오티드 |
| EP98960880A EP1037999A4 (en) | 1997-12-10 | 1998-12-10 | POLYPEPTIDES AND NUCLEOTIDES PORPHYROMONAS GINGIVALIS |
| AU16487/99A AU1648799A (en) | 1997-12-10 | 1998-12-10 | (porphorymonas gingivalis) polypeptides and nucleotides |
| NZ504811A NZ504811A (en) | 1997-12-10 | 1998-12-10 | Porphorymonas gingivalis polypeptides and nucleotides |
| CA002313823A CA2313823A1 (en) | 1997-12-10 | 1998-12-10 | Porphorymonas gingivalis polypeptides and nucleotides |
| US09/221,017 US6444799B1 (en) | 1997-12-31 | 1998-12-23 | P. gingivalis polynucleotides and uses thereof |
| US10/194,163 US20020172976A1 (en) | 1997-12-31 | 2002-07-11 | P. gingivalis polynucleotides and uses thereof |
| US11/589,261 US7544777B2 (en) | 1997-12-10 | 2006-10-30 | Porphorymonas gingivalis polypeptides and nucleotides |
| US12/382,845 US8129500B2 (en) | 1997-12-10 | 2009-03-25 | Porphyromonas gingivalis polypeptides and nucleotides |
| US13/400,987 US8642731B2 (en) | 1997-12-10 | 2012-02-21 | Porphyromonas gingivalis polypeptides and nucleotides |
| US14/161,961 US20140302083A1 (en) | 1997-12-10 | 2014-01-23 | Porphyromonas gingivalis polypeptides and nucleotides |
Applications Claiming Priority (22)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPP0839A AUPP083997A0 (en) | 1997-12-10 | 1997-12-10 | Porphyromonas gingivalis nucleotides |
| AUPP0839 | 1997-12-10 | ||
| AUPP1182A AUPP118297A0 (en) | 1997-12-31 | 1997-12-31 | P. gingivalis sequences |
| AUPP1182 | 1997-12-31 | ||
| AUPP1546 | 1998-01-30 | ||
| AUPP1546A AUPP154698A0 (en) | 1998-01-30 | 1998-01-30 | P. gingivalis sequences |
| AUPP2264A AUPP226498A0 (en) | 1998-03-10 | 1998-03-10 | Porphyromonas gingivalis probes and polypeptides |
| AUPP2264 | 1998-03-10 | ||
| AUPP2911A AUPP291198A0 (en) | 1998-04-09 | 1998-04-09 | P. gingivalis sequences |
| AUPP2911 | 1998-04-09 | ||
| AUPP3128A AUPP312898A0 (en) | 1998-04-23 | 1998-04-23 | Porphyromonas gingivalis antigens and probes |
| AUPP3128 | 1998-04-23 | ||
| AUPP3338A AUPP333898A0 (en) | 1998-05-05 | 1998-05-05 | P. gingivalis sequences |
| AUPP3338 | 1998-05-05 | ||
| AUPP3654 | 1998-05-22 | ||
| AUPP3654A AUPP365498A0 (en) | 1998-05-22 | 1998-05-22 | P. gingivalis sequences |
| AUPP4917 | 1998-07-29 | ||
| AUPP4917A AUPP491798A0 (en) | 1998-07-29 | 1998-07-29 | P.gingivalis nucleotides and polypeptides |
| AUPP4963 | 1998-07-30 | ||
| AUPP4963A AUPP496398A0 (en) | 1998-07-30 | 1998-07-30 | P.gingivalis polypeptides |
| AUPP5028 | 1998-08-04 | ||
| AUPP5028A AUPP502898A0 (en) | 1998-08-04 | 1998-08-04 | P.gingivalis antigens |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09581286 A-371-Of-International | 1998-12-10 | ||
| US09/221,017 Continuation-In-Part US6444799B1 (en) | 1997-12-31 | 1998-12-23 | P. gingivalis polynucleotides and uses thereof |
| US11/589,261 Continuation US7544777B2 (en) | 1997-12-10 | 2006-10-30 | Porphorymonas gingivalis polypeptides and nucleotides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1999029870A1 true WO1999029870A1 (en) | 1999-06-17 |
Family
ID=27581380
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU1998/001023 Ceased WO1999029870A1 (en) | 1997-12-10 | 1998-12-10 | Porphorymonas gingivalis polypeptides and nucleotides |
Country Status (10)
| Country | Link |
|---|---|
| EP (10) | EP1681350A3 (https=) |
| JP (2) | JP2001526035A (https=) |
| KR (1) | KR100603552B1 (https=) |
| AT (1) | ATE534742T1 (https=) |
| AU (1) | AU1648799A (https=) |
| CA (1) | CA2313823A1 (https=) |
| DK (2) | DK2256205T3 (https=) |
| ES (2) | ES2377751T3 (https=) |
| NZ (1) | NZ504811A (https=) |
| WO (1) | WO1999029870A1 (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000063394A3 (en) * | 1999-04-21 | 2001-02-22 | Univ Georgia Res Found | A polypeptide having amidolytic activity for a serpin |
| WO2001083530A1 (en) * | 2000-04-28 | 2001-11-08 | Csl Limited | Porphyromonas gingivalis recombinant proteins and truncations |
| JP2003518932A (ja) * | 1999-12-24 | 2003-06-17 | シーエスエル、リミテッド | P.gingivalis抗原組成物 |
| WO2003055529A1 (fr) * | 2001-12-27 | 2003-07-10 | Nihon University School Juridical Person | Vaccin a base d'adn contre les maladies du parodonte |
| US6833262B1 (en) | 1999-04-21 | 2004-12-21 | University Of Georgia Research Foundation, Inc. | Polypeptide having amidolytic activity for a serpin |
| WO2005112992A1 (en) * | 2004-05-19 | 2005-12-01 | Queen Mary & Westfield College | P. gingivalis vaccine |
| AU2001252042B2 (en) * | 2000-04-28 | 2005-12-01 | Csl Limited | Porphyromonas gingivalis recombinant proteins and truncations |
| WO2008000028A1 (en) * | 2006-06-27 | 2008-01-03 | Oral Health Australia Pty Ltd | Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease |
| WO2009006700A1 (en) * | 2007-07-12 | 2009-01-15 | Oral Health Australia Pty Ltd | Immunology treatment for biofilms |
| WO2009006699A1 (en) * | 2007-07-12 | 2009-01-15 | Oral Health Australia Pty Ltd | Biofilm treatment |
| US8703436B2 (en) * | 2003-08-15 | 2014-04-22 | University Of Florida Research Foundation | Identification of Porphyromonas gingivalis virulence polynucleotides for diagnosis, treatment, and monitoring of periodontal diseases |
| AU2013203250B2 (en) * | 2007-07-12 | 2014-11-13 | Oral Health Australia Pty Ltd | Immunology treatment for biofilms |
| US8975032B2 (en) | 2010-12-15 | 2015-03-10 | Sunstar Inc. | Test kit for plasma or serum antibody titer against periodontal disease-causing bacteria |
| CN110167955A (zh) * | 2016-09-29 | 2019-08-23 | 梅哈里医学院 | 细菌抑制剂 |
| US12552841B2 (en) | 2019-07-30 | 2026-02-17 | Zhenjiang Yangtze Green Biotechnology Co., Ltd. | CRA4S1 gene, encoded CRA4S1 protein, and application |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2012107993A (ru) * | 2009-08-02 | 2013-09-10 | Санофи Пастер Лимитид | Полипептиды porhyromonas gingivalis |
| JP6310631B2 (ja) * | 2011-10-18 | 2018-04-11 | サンスター株式会社 | 歯周病原菌血漿または血清抗体価検査キット |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5047238A (en) | 1983-06-15 | 1991-09-10 | American Home Products Corporation | Adjuvants for vaccines |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5830710A (en) * | 1988-09-08 | 1998-11-03 | University Of Florida | Cloned porphyromonas gingivalis genes and probes for the detection of periodontal disease |
| US5798224A (en) * | 1992-12-29 | 1998-08-25 | Doheny Eye Institute | Nucleic acids encoding protocadherin |
| US5643781A (en) * | 1992-12-29 | 1997-07-01 | Doheny Eye Institute | DNA encoding protocadherin-42 |
| US5475097A (en) | 1993-10-21 | 1995-12-12 | University Of Georgia Research Foundation, Inc. | Lysine-specific Porphyromonas gingivalis proteinase |
| US5523390A (en) * | 1993-09-10 | 1996-06-04 | University Of Georgia Research Foundation, Inc. | Porphyromonas gingivalis arginine-specific proteinase |
| WO1995010612A1 (en) * | 1993-10-08 | 1995-04-20 | Lion Corporation | FIMBRILLIN PROTEIN OF $i(PORPHYROMONAS GINGIVALIS) |
| AUPN015794A0 (en) | 1994-12-20 | 1995-01-19 | Csl Limited | Variants of human papilloma virus antigens |
| AUPN627595A0 (en) * | 1995-10-30 | 1995-11-23 | University Of Melbourne, The | Diagnostics and treatments of periodontal disease |
| EP0888124A4 (en) * | 1996-03-22 | 2001-04-11 | Univ Georgia Res Found | Immunogenic assemblies of Porphyromonas Gingivalis peptides and their methods |
| AUPN901296A0 (en) * | 1996-03-29 | 1996-04-26 | University Of Melbourne, The | Porphyromonas gingivalis antigens for the diagnosis and treatment of periodontitis |
| AUPO652897A0 (en) * | 1997-04-30 | 1997-05-29 | University Of Melbourne, The | Synthetic peptide constructs for the diagnosis and treatment of periodontitis |
-
1998
- 1998-12-10 JP JP2000524441A patent/JP2001526035A/ja active Pending
- 1998-12-10 KR KR1020007006386A patent/KR100603552B1/ko not_active Expired - Fee Related
- 1998-12-10 EP EP06008722A patent/EP1681350A3/en not_active Withdrawn
- 1998-12-10 AU AU16487/99A patent/AU1648799A/en not_active Abandoned
- 1998-12-10 DK DK10177457.8T patent/DK2256205T3/da active
- 1998-12-10 NZ NZ504811A patent/NZ504811A/en not_active IP Right Cessation
- 1998-12-10 EP EP10185466A patent/EP2283852A3/en not_active Withdrawn
- 1998-12-10 EP EP10177423A patent/EP2264176A1/en not_active Withdrawn
- 1998-12-10 ES ES08100586T patent/ES2377751T3/es not_active Expired - Lifetime
- 1998-12-10 ES ES10177457T patent/ES2419664T3/es not_active Expired - Lifetime
- 1998-12-10 CA CA002313823A patent/CA2313823A1/en not_active Abandoned
- 1998-12-10 EP EP98960880A patent/EP1037999A4/en not_active Withdrawn
- 1998-12-10 EP EP10185564A patent/EP2283854A3/en not_active Withdrawn
- 1998-12-10 EP EP10177457A patent/EP2256205B1/en not_active Expired - Lifetime
- 1998-12-10 DK DK08100586.0T patent/DK1908772T3/da active
- 1998-12-10 EP EP08100586A patent/EP1908772B1/en not_active Expired - Lifetime
- 1998-12-10 EP EP10185525A patent/EP2283853A3/en not_active Withdrawn
- 1998-12-10 EP EP10177405A patent/EP2256204A1/en not_active Withdrawn
- 1998-12-10 AT AT08100586T patent/ATE534742T1/de active
- 1998-12-10 EP EP10185620A patent/EP2283855A3/en not_active Withdrawn
- 1998-12-10 WO PCT/AU1998/001023 patent/WO1999029870A1/en not_active Ceased
-
2009
- 2009-02-12 JP JP2009029661A patent/JP5349070B2/ja not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| DERWENT ABSTRACT, Acc. No. 95-147309/19; & WO 9509181 A (KYOWA HAKKO KOGYO KK) 6 April 1995. * |
| DERWENT ABSTRACT, Acc. No. 95-3513214/45; & WO 9526404 A (MEITO SANGYO KK) 5 October 1995. * |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000063394A3 (en) * | 1999-04-21 | 2001-02-22 | Univ Georgia Res Found | A polypeptide having amidolytic activity for a serpin |
| US6833262B1 (en) | 1999-04-21 | 2004-12-21 | University Of Georgia Research Foundation, Inc. | Polypeptide having amidolytic activity for a serpin |
| JP2011120581A (ja) * | 1999-12-24 | 2011-06-23 | Csl Ltd | P.gingivalis抗原組成物 |
| JP2003518932A (ja) * | 1999-12-24 | 2003-06-17 | シーエスエル、リミテッド | P.gingivalis抗原組成物 |
| EP1985626A1 (en) * | 1999-12-24 | 2008-10-29 | CSL Limited | P. gingivalis antigenic composition |
| EP2243789A1 (en) * | 1999-12-24 | 2010-10-27 | CSL Limited | P.gingivalis antigenic composition |
| US8282933B2 (en) | 1999-12-24 | 2012-10-09 | Csl Limited | P. gingivalis antigenic composition |
| US7204991B2 (en) | 2000-04-28 | 2007-04-17 | Csl Limited | Porphyromonas gingivalis recombinant proteins and truncations |
| AU2001252042B2 (en) * | 2000-04-28 | 2005-12-01 | Csl Limited | Porphyromonas gingivalis recombinant proteins and truncations |
| JP2003531634A (ja) * | 2000-04-28 | 2003-10-28 | シーエスエル、リミテッド | ポルフィロモナス・ジンジバリス(Porphyromonasgingivalis)リコンビナントタンパク質と末端切断物 |
| WO2001083530A1 (en) * | 2000-04-28 | 2001-11-08 | Csl Limited | Porphyromonas gingivalis recombinant proteins and truncations |
| WO2003055529A1 (fr) * | 2001-12-27 | 2003-07-10 | Nihon University School Juridical Person | Vaccin a base d'adn contre les maladies du parodonte |
| US8703436B2 (en) * | 2003-08-15 | 2014-04-22 | University Of Florida Research Foundation | Identification of Porphyromonas gingivalis virulence polynucleotides for diagnosis, treatment, and monitoring of periodontal diseases |
| GB2428042A (en) * | 2004-05-19 | 2007-01-17 | Xiaoju Shi | P gingivalis vaccine |
| GB2428042B (en) * | 2004-05-19 | 2008-12-31 | Xiaoju Shi | P gingivalis vaccine |
| WO2005112992A1 (en) * | 2004-05-19 | 2005-12-01 | Queen Mary & Westfield College | P. gingivalis vaccine |
| WO2008000028A1 (en) * | 2006-06-27 | 2008-01-03 | Oral Health Australia Pty Ltd | Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease |
| AU2007264402B2 (en) * | 2006-06-27 | 2012-09-20 | Oral Health Australia Pty Ltd | Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease |
| WO2009006699A1 (en) * | 2007-07-12 | 2009-01-15 | Oral Health Australia Pty Ltd | Biofilm treatment |
| US8241611B2 (en) | 2007-07-12 | 2012-08-14 | Oral Health Austrailia Pty. Ltd. | Biofilm treatment |
| EP2176413A4 (en) * | 2007-07-12 | 2012-08-01 | Oral Health Australia Pty Ltd | IMMUNOLOGY TREATMENT FOR BIOFILMS |
| AU2008274906B2 (en) * | 2007-07-12 | 2013-11-07 | Oral Health Australia Pty Ltd | Biofilm treatment |
| WO2009006700A1 (en) * | 2007-07-12 | 2009-01-15 | Oral Health Australia Pty Ltd | Immunology treatment for biofilms |
| AU2013203250B2 (en) * | 2007-07-12 | 2014-11-13 | Oral Health Australia Pty Ltd | Immunology treatment for biofilms |
| AU2008274907B2 (en) * | 2007-07-12 | 2014-11-13 | Oral Health Australia Pty Ltd | Immunology treatment for biofilms |
| US8975032B2 (en) | 2010-12-15 | 2015-03-10 | Sunstar Inc. | Test kit for plasma or serum antibody titer against periodontal disease-causing bacteria |
| CN110167955A (zh) * | 2016-09-29 | 2019-08-23 | 梅哈里医学院 | 细菌抑制剂 |
| CN110167955B (zh) * | 2016-09-29 | 2024-04-02 | 梅哈里医学院 | 细菌抑制剂 |
| US12552841B2 (en) | 2019-07-30 | 2026-02-17 | Zhenjiang Yangtze Green Biotechnology Co., Ltd. | CRA4S1 gene, encoded CRA4S1 protein, and application |
Also Published As
| Publication number | Publication date |
|---|---|
| DK1908772T3 (da) | 2012-03-19 |
| EP1681350A2 (en) | 2006-07-19 |
| EP2256204A1 (en) | 2010-12-01 |
| EP2283853A3 (en) | 2011-05-11 |
| EP2283854A3 (en) | 2011-04-06 |
| EP2256205B1 (en) | 2013-04-03 |
| AU1648799A (en) | 1999-06-28 |
| EP1908772A3 (en) | 2008-12-03 |
| EP1908772B1 (en) | 2011-11-23 |
| EP1908772A2 (en) | 2008-04-09 |
| EP2283852A2 (en) | 2011-02-16 |
| ATE534742T1 (de) | 2011-12-15 |
| EP2256205A1 (en) | 2010-12-01 |
| EP1681350A3 (en) | 2007-07-18 |
| ES2377751T3 (es) | 2012-03-30 |
| KR20010033030A (ko) | 2001-04-25 |
| EP2283855A3 (en) | 2011-05-04 |
| ES2419664T3 (es) | 2013-08-21 |
| EP1037999A1 (en) | 2000-09-27 |
| EP2264176A1 (en) | 2010-12-22 |
| KR100603552B1 (ko) | 2006-07-20 |
| CA2313823A1 (en) | 1999-06-17 |
| DK2256205T3 (da) | 2013-07-08 |
| EP2283852A3 (en) | 2011-05-04 |
| EP2283854A2 (en) | 2011-02-16 |
| JP2001526035A (ja) | 2001-12-18 |
| EP2283853A2 (en) | 2011-02-16 |
| NZ504811A (en) | 2003-10-31 |
| JP5349070B2 (ja) | 2013-11-20 |
| JP2009136300A (ja) | 2009-06-25 |
| EP1037999A4 (en) | 2005-03-23 |
| EP2283855A2 (en) | 2011-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5349070B2 (ja) | Porphorymonasgingivalisポリペプチドおよびヌクレオチド | |
| US8642731B2 (en) | Porphyromonas gingivalis polypeptides and nucleotides | |
| US20090136548A1 (en) | Multiple antigenic peptides immunogenic against streptococcus pneumonia | |
| JPH08510120A (ja) | ヘリコバクター感染に対する免疫性組成物、該組成物に用いられるポリペプチドおよび該ポリペプチドをコードする核酸配列 | |
| US6444799B1 (en) | P. gingivalis polynucleotides and uses thereof | |
| US7544777B2 (en) | Porphorymonas gingivalis polypeptides and nucleotides | |
| US6669940B2 (en) | Recombinant fusobacterium necrophorum leukotoxin vaccine and preparation thereof | |
| AU766093B2 (en) | Tuberculosis vaccine and diagnostic reagents based on antigens from the mycobacterium tuberculosis cell | |
| EP2069394A1 (en) | Identification of candidate vaccine antigens from dichelobacter nodosus | |
| US20040047871A1 (en) | Recombinant fusobacterium necrophorum leukotoxin vaccine and prepaation thereof | |
| AU2007231821B8 (en) | Porphyromonas gingivalis polypeptides and nucleotides | |
| Slakeski et al. | Characterization and expression of a novel Porphyromonas gingivalis outer membrane protein, Omp28 | |
| HK1110603A (en) | Porphorymonas gingivalis polypeptides and polynucleotides | |
| Barr et al. | Ross et a1. | |
| JP2006025659A (ja) | エリシペロトリックス属のその他の菌種である血清型18由来の豚丹毒菌感染防御活性を有する新規ポリペプチドとその遺伝子および製法 | |
| Beachey et al. | Prospects for group A streptococcal vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) |
Free format text: (EXCEPT GD) |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 16487/99 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 504811 Country of ref document: NZ |
|
| ENP | Entry into the national phase |
Kind code of ref document: A Ref document number: 2313823 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020007006386 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1998960880 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09581286 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 1998960880 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020007006386 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1020007006386 Country of ref document: KR |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1998960880 Country of ref document: EP |