WO1997038703A1 - Chimeric isoprenoid synthases and uses thereof - Google Patents

Chimeric isoprenoid synthases and uses thereof Download PDF

Info

Publication number
WO1997038703A1
WO1997038703A1 PCT/US1997/005986 US9705986W WO9738703A1 WO 1997038703 A1 WO1997038703 A1 WO 1997038703A1 US 9705986 W US9705986 W US 9705986W WO 9738703 A1 WO9738703 A1 WO 9738703A1
Authority
WO
WIPO (PCT)
Prior art keywords
synthase
chimeric
isoprenoid synthase
isoprenoid
domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1997/005986
Other languages
English (en)
French (fr)
Other versions
WO1997038703A9 (en
Inventor
Joseph Chappell
Kyoungwhan Back
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Kentucky
Original Assignee
University of Kentucky
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to SI9730430T priority Critical patent/SI0904095T1/xx
Priority to DE69715192T priority patent/DE69715192T2/de
Priority to AU27264/97A priority patent/AU2726497A/en
Priority to EP97921142A priority patent/EP0904095B1/en
Priority to EA199800917A priority patent/EA001622B1/ru
Priority to JP9537218A priority patent/JP2000508899A/ja
Priority to HK99102647.5A priority patent/HK1017275B/en
Priority to AT97921142T priority patent/ATE223225T1/de
Priority to IL12648697A priority patent/IL126486A0/xx
Application filed by University of Kentucky filed Critical University of Kentucky
Priority to DE0904095T priority patent/DE904095T1/de
Priority to BR9708650A priority patent/BR9708650A/pt
Priority to CA002250712A priority patent/CA2250712C/en
Publication of WO1997038703A1 publication Critical patent/WO1997038703A1/en
Publication of WO1997038703A9 publication Critical patent/WO1997038703A9/en
Priority to IL126486A priority patent/IL126486A/en
Anticipated expiration legal-status Critical
Priority to GR990300025T priority patent/GR990300025T1/el
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • This invention relates to modified isoprenoid synthase enzymes, their encoding genes, and uses thereof.
  • isoprenoid is used to refer to a family of compounds derived from the isoprene building block.
  • plant isoprenoids comprise a structurally diverse group of compounds that can be divided into classes of primary and secondary metabolites (Fig. 1).
  • Isoprenoids that are primary metabolites include sterols, carotenoids, growth regulators, and the polyprenol substituents of dolichols, quinones, and proteins. These compounds are essential for membrane integrity, photoprotection, orchestration of developmental programs, and anchoring essential biochemical functions to specific membrane systems, respectively.
  • Isoprenoids that are classified as secondary metabolites include monoterpenes, sesquiterpenes, and diterpenes.
  • the common denominator for this diverse array of compounds is their universal five-carbon building block, isoprene.
  • the "biogenic isoprene rule” was employed to rationalize the biosynthetic origins of all terpenoids derived from isoprene (Ruzicka, Expe ⁇ entia 10:357, 1953).
  • the polymerization of two diphosphorylated isoprene building blocks e.g., IPP and dimethylallyl
  • GPP geranyl diphosphate
  • a linear CIO intermediate that can be converted to cyclic or linear end-products representing the monoterpenes, or used in another round of polymerization.
  • FPP farnesyl diphosphate
  • GGPP geranylgeranyl diphosphate
  • the enzymes responsible for the cyclization of GPP, FPP, and GGPP are referred to as monote ⁇ ene, sesquite ⁇ ene, and dite ⁇ ene synthases or synthases, and represent reactions committing carbon from the general isoprenoid pathway to end products in the monote ⁇ ene, sesquite ⁇ ene, and dite ⁇ ene classes, respectively.
  • Fig. 2 Two important biochemical distinctions between the prenyltransferase and synthase reactions are illustrated in Fig. 2.
  • the prenyltransferases catalyze carbon- carbon bond formation between two substrate molecules, whereas the synthases catalyze an intramolecular carbon-carbon bond formation.
  • the prenyltransferases also catalyze reactions with very little variance in the stereochemistry or length of the ensuing polymer.
  • Prenyltransferases differ in the length of the allylic substrates that can be accepted in initiating these reactions.
  • the synthases are also substrate specific. However, diverse sesquite ⁇ ene synthases, for example, can utilize the same substrate to produce different reaction products.
  • te ⁇ ene synthases The biosynthesis of isoprenoids such as cyclic te ⁇ enes is said to be determined by key branch point enzymes referred to as te ⁇ ene synthases.
  • the reactions catalyzed by te ⁇ ene synthases are complex, intramolecular cyclizations that may involve several partial reactions.
  • Fig. 3 the bioorganic rationale for the cyclization of FPP by two sesquite ⁇ ene synthases are shown in Fig. 3.
  • step 1 the initial ionization of FPP is followed by an intramolecular electrophillic attack between the carbon bearing the diphosphate moiety and the distal double bond to form germacene A, a macrocylic intermediate.
  • step 2 Internal ring closure and formation ofthe eudesmane carbonium ion constitutes step 2.
  • TEAS tobacco 5-epi-aristolochene synthase
  • the terminal step is a hydride shift, methyl migration, and deprotonation at C9 giving rise to 5-epi-aristolochene as depicted in step 3a.
  • Hyoscyamus muticus vetispiradiene synthase (HVS) shares a common mechanism at steps 1 and 2, but differs from TEAS in the third partial reaction in which a ring contraction would occur due to alternative migration of an electron pair.
  • HVS Hyoscyamus muticus vetispiradiene synthase
  • a monomeric protein of approximately 64 kD catalyzes the complete set of partial reactions and requires no cofactors other than Mg +2 .
  • the invention features a chimeric isoprenoid synthase polypeptide including a first domain from a first isoprenoid synthase joined to a second domain from a second, heterologous isoprenoid synthase, whereby the chimeric isoprenoid synthase is capable of catalyzing the production of isoprenoid reaction products that are not produced in the absence ofthe second domain ofthe second, heterologous isoprenoid synthase.
  • the chimeric isoprenoid synthase is capable of catalyzing at least two different isoprenoid reaction products; the isoprenoid reaction products are cyclic; the second domain of the second, heterologous isoprenoid synthase also determines the ratio ofthe isoprenoid reaction products of the chimeric isoprenoid synthase; the first domain from the first isoprenoid synthase is a plant isoprenoid synthase and the second domain from the second, heterologous isoprenoid synthase is also from a plant isoprenoid synthase.
  • the chimeric isoprenoid synthase is chosen from the group consisting of (a) the tobacco-Hyoscyamus CH4 chimeric isoprenoid synthase; (b) the tobacco-Hyo.scy ⁇ mw.s' CH10 chimeric isoprenoid synthase; (c) the tobacco- Hyoscyamus CHI 1 chimeric isoprenoid synthase; (d) the tobacco-Hy ⁇ scy ⁇ mws C ⁇ 12 chimeric isoprenoid synthase; (e) the tobacco-Hyoscyamus CHI 3 chimeric isoprenoid synthase; or (f) the tobacco-Hyoscyamus CHI 4 chimeric isoprenoid synthase, all as described herein.
  • the chimeric isoprenoid synthase catalyzes the production of an isoprenoid reaction product that is of agricultural, pharmaceutical, commercial, or industrial significance (e.g., an antifungal agent, antibacterial agent, or antitumor agent).
  • the invention features DNA, vectors, and cells (for example, E. coli, Saccharomyces cerevisiae, animal or plant cells) encoding or containing a chimeric isoprenoid synthase polypeptide.
  • the invention features a chimeric isoprenoid synthase polypeptide including an asymmetrically positioned homologous domain whereby the chimeric isoprenoid synthase is capable of catalyzing the production of isoprenoid reaction products (preferably, cyclic products) when the domain is positioned at its naturally-occurring site in the isoprenoid synthase polypeptide.
  • the invention features a method for producing a chimeric isoprenoid synthase polypeptide, the method involving: (a) providing a cell transformed with DNA encoding a chimeric isoprenoid synthase positioned for expression in the cell; (b) culturing the transformed cell under conditions for expressing the DNA; and (c) recovering the chimeric isoprenoid synthase.
  • isoprenoid synthase is meant a polypeptide that is capable of catalyzing a reaction involving the intramolecular carbon-carbon bond formation of an allylic diphosphate substrate (for example, a C )0 , C 15 , or C 20 allylic diphosphate substrate) to an isoprenoid product (for example, a monote ⁇ ene, dite ⁇ ene, sesquite ⁇ ene, or sterol product).
  • an allylic diphosphate substrate for example, a C )0 , C 15 , or C 20 allylic diphosphate substrate
  • an isoprenoid product for example, a monote ⁇ ene, dite ⁇ ene, sesquite ⁇ ene, or sterol product.
  • isoprenoid synthases include, without limitation, monote ⁇ ene synthases (for example, limonene synthase), dite ⁇ ene synthases (for example, casbene synthase), and sesquite ⁇ ene synthases (for example, 5-epi- aristolochene synthase, vetispiradiene synthase, and cadinene synthase) that are responsible for cyclization of geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl diphosphate (GGPP), respectively.
  • GPP geranyl diphosphate
  • FPP farnesyl diphosphate
  • GGPP geranylgeranyl diphosphate
  • te ⁇ ene synthases are soluble enzymes having a molecular weight of about 40 to 100 kD. Genes encoding a number of monote ⁇ ene, dite ⁇ ene, and sesquite ⁇ ene synthases have been described for a number of plant and microbial organisms (see, for example, Hohn and Beremand,
  • polypeptide or “protein” is meant any chain of amino acids, regardless of length or post-translational modification (for example, glycosylation or phosphorylation).
  • domains covalently bonded either directly or indirectly (i.e., the domains are separated by an intervening amino acid sequence). Such domains may be bonded by any means, including, without limitation, a peptide bond or chemical linkage.
  • domain is meant a contiguous stretch of amino acids within a polypeptide or protein.
  • isoprenoid is meant a compound that is derived from an isoprene building block.
  • isoprenoid compounds include, without limitation, monote ⁇ enes, dite ⁇ enes, sesquite ⁇ enes, and sterols.
  • isoprenoids are found in a variety of organisms, for example, animal, fungal, or bacterial sources.
  • asymmetrically positioned is meant located within the chimeric polypeptide at a site which differs from its position in the naturally-occuring polypeptide.
  • heterologous is meant derived from different sources (in this case, different polypeptides).
  • homologous is meant derived from the same source (in this case, the same polypeptide).
  • Fig. 1 is a schematic illustration showing the isoprenoid biosynthetic pathway with respect to the type of end products and their respective physiological functions. Broken arrows indicate multiple steps or reactions.
  • Fig. 2 is a schematic illustration showing the various reactions that are catalyzed by prenyltransferases and te ⁇ ene synthases.
  • Fig. 3 is a schematic illustration showing a reaction mechanism for the synthesis of eremophilane (tobacco 5-epi-aristolochene synthase, TEAS) and vetispiradiene (Hyoscyamus vetispiradiene synthase, HVS) type sesquite ⁇ ene synthases.
  • Partial reactions 1 and 2 are considered common to both types of synthases.
  • Mechanistic differences in partial reactions 3a and 3b are sufficient to account for the different reaction products shown.
  • Fig. 4A is a schematic illustration showing the chimeric constructs used to map catalytic domains within sesquite ⁇ ene synthases.
  • Line drawings depict composite diagrams for wildtype (i.e., TEAS and HVS) and chimeric (CHI -CHI 4) sesquite ⁇ ene synthase genes that were engineered into the bacterial expression vector pGBT-T19.
  • Gene constructs were prepared using a combination ofthe available restriction endonuclease sites and amplification of select regions using PCR and PCR primers harboring convenient restriction endonuclease sites. Correspondence between unique restriction endonuclease sites and amino acid positions are noted.
  • Fig. 4B is a photograph of a TLC experiment showing synthase enzyme activities in sonicated lysates of E. coli TB1 cells expressing the TEAS, HVS, and chimeric synthase constructs (CHI -CHI 4) and measured using 3 H-FPP. Reaction products were separated by argentation-TLC and detected by autoradiography. The radioactivity in 0.5 mm segments of each lane of an argentation-TLC plate was determined in a scintillation counter, and radioactivity associated with the zones for the TEAS and HVS specific products was set to 100%.
  • Fig. 5 is a schematic illustration showing the corcespondence between exons and functional domains within isoprenoid synthases.
  • the upper diagram represents the organization of exons within the TEAS gene, which is nearly identical to that of the HVS and casbene synthase genes.
  • the lower diagram shows the alignment of functional domains to the exonic organization ofthe TEAS and HVS genes. Exon numbers are shown within the upper diagram, and all other numbers refer to amino acid positions, some of which correspond to the noted restriction endonuclease sites.
  • Fig. 6 is a schematic diagram showing a domain switching strategy used to generate a quiescent synthase (QH1). Substituting the inactive HVS domain corresponding to exon 4 into CH3 results in a synthase having an altered enzyme activity.
  • QH1 quiescent synthase
  • Fig. 7 is a schematic diagram of a domain switching strategy used for producing a chimeric quiescent-casbene synthase, and possible reaction products.
  • Fig. 8 is a schematic illustration of a domain switching strategy for producing a chimeric quiescent-cadinene synthase, and possible reaction products.
  • Piasmids designed for expressing a chimeric synthase were generated by substituting a portion of a gene encoding a domain from tobacco 5-epi-aristolochene synthase with a portion of a gene encoding a domain from Hyoscyamus vetispiradiene synthase. These piasmids were expressed in bacteria, and bacterial lysates were prepared and assayed for sesquite ⁇ ene synthase activity.
  • the sesquite ⁇ ene synthase assays included an argentation-thin layer chromatography (TLC) analysis which distinguished the aristocholene and vetispiradiene reaction products (Back and
  • CHI Chimeric synthases CHI, CH2, CH5, and CH7 were constructed by utilizing the conserved HindlU and Ndel restriction sites found between the tobacco and Hyoscyamus genes.
  • CHI was prepared by ligating the 5' terminal portion ofthe TEAS gene (corresponding to the EcoRI to HindlU fragment) with the 3' terminal portion of HVS gene (corresponding to the HindlU to Kpnl fragment) into the bacterial expression vector pGBT-Tl 9 (Gold Biotechnology) predigested with EcoRI and Kpnl.
  • CH2 was prepared by ligating the 5' terminal portion ofthe TEAS gene (corresponding to the EcoRI to Ndel fragment) with the 3' terminal portion of HVS gene (conesponding to the Ndel to Kpnl fragment) into pGBT-T19.
  • CH5 was prepared by ligating the 5' terminal portion ofthe HVS gene
  • CH7 was prepared by ligating the 5' terminal portion of the HVS gene (conesponding to the EcoRI to Ndel fragment) with the 3' terminal portion of TEAS gene (corresponding to the Ndel to Kpnl fragment) into pGBT-T19.
  • CH3, CH4, CH12, and CH13 were constructed using conventional polymerase chain reaction (PCR) methodologies, with primers designed for the amplification of particular segments ofthe HVS gene. To facilitate directional cloning and maintenance of reading frame, primers were also designed to contain convenient restriction sites.
  • CH3 was constructed as follows. An EcoRI/Clal restriction fragment ofthe TEAS gene was isolated and ligated to the Clal/Kpnl fragment ofthe HVS gene. The HVS Clal/Kpnl fragment was prepared by PCR methodology using 5'-d(GGGAT£G ⁇ TGACATAGCCACGTATGAGGTT; SEQ ID NO: l)-3' (Clal restriction site underlined) as the forward primer and
  • CHI 2 was prepared by ligating a PCR fragment conesponding to the first
  • CH4 nucleotides of CH4 with the Clal/Kpnl fragment of the TEAS gene into the EcoRI Kpnl sites of the pGBT-T19 vector.
  • the CH4 fragment was prepared using forward amplification primer 5'-d(GGGAGCTCG ⁇ ATT£CATGGCCTCAGCAGCAGTTGCAAACTAT; SEQ ID NO:5)-3' (EcoRI restriction site underlined and translation start codon in bold) and reverse primer 5'-d(GGG ⁇ lCC I AlAACTCTGCATAATGTAGCATT; SEQ ID NO: 6)-3' (Clal restriction site underlined).
  • Chimeric synthases CH6, CH8, CH9, CH 10, CHI 1, and CHI 4 were constructed as follows. Ligation ofthe EcoRI/Hindlll fragment of the HVS gene with the Hindlll/Kpnl fragment of CH3 generated CH6. CH8 was created by ligating the
  • Chimeric synthases were expressed in E. coli TB1 cells. Procedures for growth ofthe bacterial cells, induction of gene expression, measurement of sesquite ⁇ ene synthase enzyme activity, and the determination of total protein in the bacterial lysates were performed according to the methods described by Back and Chappell (Arch. Biochem. Biophys. 315:527, 1994; J. Biol. Chem. 270:7375, 1995). Reaction products were separated by developing G60 silica TLC plates impregnated with 15% silver nitrate in benzene:hexane:diethyl ether (50:50:1).
  • the dominant reaction product resulting from the expression ofthe tobacco TEAS gene expressed was 5-epi-aristolochene, and vetispiradiene was found to be the dominant reaction product resulting from the expression of the HVS gene.
  • the predominant reaction products generated by the expression of CHI and CH2 were also HVS-specific (i.e., vetispiradiene), with enzyme specific activities similar to those found for HVS that was expressed from the pBSK-HVS plasmid.
  • CH7 having an HVS amino terminus and a TEAS carboxy terminus, is the converse construct of CH2, and the resulting synthase activity was expected to result in expression of a TEAS-specific product (i.e., 5-epi-aristolochene).
  • Immunodetection assays revealed that synthase protein produced upon expression of CH7 was found to be ofthe conect size and expected abundance; however, no enzyme activity was detected. The lack of enzyme activity indicated that interactions between the carboxy and amino terminal portions of the protein contributed to enzyme activity. This inte ⁇ retation is further supported by comparing the specific activity ofthe enzymes generated by the expression ofthe CH5 and CH6 constructs.
  • CH5 resulted in the expression of a product having a 10- fold lower specific activity of synthase enzyme activity than the other chimeric synthases, even though the absolute level of expressed protein was similar to the other constructs (as determined by immunodetection, data not shown). Substituting an HVS carboxy-terminal region was found to restore the specific activity to the synthase enzyme that was generated by CH6. Comparison of CH2 and CH3 chimeric synthases provided evidence for specificity of end-product formation residing within a domain of approximately 181 amino acids, conesponding to the Ndel and Clal restriction sites within the TEAS and HVS genes.
  • CHI 1 represented the substitution of the Ndel to Hin i fragment ofthe Hyoscyamus gene with the conesponding tobacco gene fragment, and resulted in the production of an enzyme having HVS- and TEAS-specificity.
  • CH12 represented a substitution ofthe Hindi to Clal fragment ofthe tobacco gene with the conesponding Hyoscyamus gene fragment, and resulted in the production of an enzyme having HVS- and TEAS-specificity. Comparing CHI 1 to CHI 3 provided a further refinement in the domain characterization ofthe tobacco enzyme responsible for the TEAS-specific products.
  • CHI 3 was found to be a multifunctional enzyme indicated that the 81 amino acids encoded by the DNA fragment residing between the Ndel to Xbal restriction sites ofthe tobacco cDNA were sufficient for formation ofthe predominant TEAS specific products. This inte ⁇ retation was confirmed by substituting the domain contained within the Ndel/Xbal HVS cDNA restriction fragment of CH14 with that ofthe TEAS gene (Fig. 4A).
  • the predominant HVS reaction product was vetispiradiene (>90%) ([M] + ion at m/z of 204 with a base peak at m/z 41 and a series of predictable ions at m/z 175, 108, 94, and 68), and the predominant reaction products of CH4 were 5-epi-aristolochene (18%), a bicyclic sesquite ⁇ ene (43%), and vetispiradiene (32%).
  • Ratio-Determinant Domain Another domain ofthe synthase proteins was identified by comparing the relative ratio ofthe predominant reaction products produced by the multifunctional chimeric synthase enzymes (Fig. 4A). For example, the reaction products resulting from expression of constructs CH4, CH10, CHI 1, and CHI 2 were generated in a ratio of 60-70% TEAS-specific to 30-40% HVS-specific. In contrast, an inverse ratio of reaction products resulted from expression of constructs CH13 and CH14. This result indicated that the region encompassed by the Xbal to Hindi domain influenced the relative ratio of reaction products generated by the multifunctional chimeric synthase enzymes. These results indicated that two separate and distinct domains within the synthase peptide contributed directly to the types of reaction products generated, and are interrupted by another domain which we refer to as the ratio-determinant domain
  • DDXXD motif found within the aristolochene specific domain, is a conserved sequence that is found in a variety of te ⁇ ene biosynthetic enzymes including TEAS and HVS. This acidic amino acid cluster is said to coordinate a metal cofactor that is necessary to neutralize the diphosphate moiety of FPP in an otherwise lipophilic pocket.
  • Substrate binding domain (Ndel/Xbal region)
  • Ratio determinant domain (Xbal/HincII region)
  • Hyoscyamus specific domain HincII/Clal region
  • the sites for directed substitutions within the ratio-determinant domain were infened by an analysis of reports that hypothesized the importance of charged amino acid residues (e.g., histidine or lysine) in synthase enzymology, and these sites represented those amino acids which displayed the greatest charge differences in comparisons between the TEAS and HVS primary sequences. None ofthe three mutations analyzed had any effect on overall catalytic activity or the ratio of products formed.
  • the inactive domain conesponding to exon 4 of HVS is substituted with the conesponding active domain of CH3, as outlined in Fig. 6.
  • CH3 contains an inactive domain conesponding to exon 6 of TEAS, has convenient Ndel and Xbal restriction sites for the desired substitution, and can be overexpressed in bacteria to high levels. Domain switching is accomplished using standard molecular techniques, as described herein.
  • a PCR amplification product of HVS cDNA conesponding to exon 4 encompassing amino acids 261 to 342 and containing appropriate Ndel and Xbal sites within the primers, is substituted for the conesponding region of CH3.
  • reaction product(s) are extracted into hexane, and the products are purified by HPLC methods. Additional evaluation o the quiescent enzyme reaction products is carried out using TLC, and comparing the R r values ofthe experimental sample to those generated by the TEAS and HVS enzymes. Retention times ofthe reaction products (e.g., germacrene or germacrene-like reaction product) are also monitored using GC, GC-MS, and NMR according to standard methods.
  • the quiescent synthase is useful for providing sufficient amounts ofthe germacrene reaction intermediate(s) (or derivatives thereof) for confirming the chemical rationalization for the EAS and VS reactions, and produces a template chimeric synthase that may be used for the introduction of novel terminal steps in the overall synthase reaction scheme.
  • Chimeric isoprenoid synthases are also useful for generating novel macrocyclic isoprenoids or isoprenoids having altered stereochemical properties.
  • isoprenoid synthases such as casbene synthase, a dite ⁇ ene synthase which catalyzes the synthesis of a macrocyclic dite ⁇ ene harboring a cyclopropyl side group, and cadinene synthase, a sesquite ⁇ ene synthase that catalyzes the synthesis of a bicyclic sesquite ⁇ ene, provide domains useful for engineering enzymes capable of producing macrocylic isoprenoids or isoprenoid reaction products having altered stereochemical properties.
  • a general scheme for producing such chimeric synthases is presented in Figs. 7 and 8.
  • reaction products Constructs supporting high levels of synthase activity in bacteria and/or activity generating reaction products which migrate with R s different from aristolochene and vetispiradiene standards are considered useful in the invention.
  • Reaction products are also analyzed for their retention times by GC and subjected to GC-MS and NMR, as necessary.
  • Those domains of casbene synthase and cadinene synthase which contribute to the synthesis of unique reaction products may also be subjected to fine detail mapping using a strategy analogous to that depicted in Fig. 4A.
  • chimeric synthases may be readily generated which include domains from known or newly isolated synthase enzymes. Such chimeric synthases may be tested for activity using, for example, any appropriate enzyme assays known to those in the art (for example, those described herein), or by standard immunodetection techniques. The isolation of additional synthase coding sequences is also possible using standard cloning strategies and techniques that are well known in the art.
  • synthase-specific oligonucleotide probes including synthase degenerate oligonucleotide probes (i.e., a mixture of all possible coding sequences for a given amino acid sequence).
  • synthase degenerate oligonucleotide probes i.e., a mixture of all possible coding sequences for a given amino acid sequence.
  • These oligonucleotides may be based upon the sequence of either DNA strand and any appropriate portion of synthase nucleotide sequence.
  • General methods for designing and preparing such probes are provided, for example, in Ausubel et al., 1996, Current Protocols in Molecular Biology, Wiley Interscience, New York, and Berger and Kimmel, Guide to Molecular Cloning Techniques, 1987,
  • oligonucleotides are useful for synthase gene isolation, either through their use as probes capable of hybridizing to a synthase complementary sequences or as primers for various amplification techniques, for example, polymerase chain reaction (PCR) cloning strategies.
  • Hybridization techniques and screening procedures are well known to those skilled in the art and are described, for example, in Ausubel et al. (supra); Berger and Kimmel (supra); Chen at al. Arch. Biochem. Biophys. 324:255, 1995; and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
  • oligonucleotide probes may be used for the screening of a recombinant DNA library.
  • the oligonucleotides may be detectably-labeled using methods known in the art and used to probe filter replicas from a recombinant DNA library.
  • Recombinant DNA libraries are prepared according to methods well known in the art, for example, as described in Ausubel et al. (supra), or they may be obtained from commercial sources.
  • synthase oligonucleotides may also be used as primers in amplification cloning strategies, for example, using PCR.
  • PCR methods are well known in the art and are described, for example, in PCR Technology, Erlich, ed., Stockton Press, London, 1989; PCR Protocols: A Guide to Methods and Applications, Innis et al., eds., Academic Press, Inc., New York, 1990; and Ausubel et al. (supra).
  • Primers are optionally designed to allow cloning of the amplified product into a suitable vector, for example, by including appropriate restriction sites at the 5' and 3' ends ofthe amplified fragment (as described herein).
  • a synthase gene may be isolated using the PCR "RACE” technique, or Rapid Amplification of cDNA Ends (see, e.g., Innis et al. (supra)).
  • RACE Rapid Amplification of cDNA Ends
  • oligonucleotide primers based on a synthase sequence are oriented in the 3' and 5' directions and are used to generate overlapping PCR fragments. These overlapping 3'- and 5'-end RACE products are combined to produce an intact full-length cDNA.
  • This method is described in Innis et al. (supra); and Frohman et al., Proc. Natl. Acad. Sci. USA 85:8998, (1988).
  • Useful synthase sequences may be isolated from any appropriate organism.
  • Confirmation of a sequence's relatedness to the synthase polypeptide family may be accomplished by a variety of conventional methods, for example, sequence comparison.
  • sequence comparison the activity of any synthase protein may be evaluated according to any of the techniques described herein.
  • Chimeric synthase polypeptides may be produced by transformation of a suitable host cell with all or part of a chimeric synthase DNA (for example, the chimeric synthase cDNAs described above) in a suitable expression vehicle or with a plasmid construct engineered for increasing the expression of a chimeric synthase polypeptide in vivo.
  • a suitable host cell for example, E. coli TB 1
  • a eukaryotic host for example, Saccharomyces cerevisiae, mammalian cells
  • COS 1 or NIH 3T3 cells for example, COS 1 or NIH 3T3 cells
  • plant cells including, without limitation, algae, tree species, ornamental species, temperate fruit species, tropical fruit species, vegetable species, legume species, monocots, dicots, or in any plant of commercial or agricultural significance.
  • suitable plant hosts include, but are not limited to, Conifers, Petunia,
  • Tomato Potato, Tobacco, Arabidopsis, Lettuce, Sunflower, Oilseed rape, Flax, Cotton, Sugarbeet, Celery, Soybean, Alfalfa, Medicago, Lotus, Vigna, Cucumber, Canot, Eggplant, Cauliflower, Horseradish, Morning Glory, Poplar, Walnut, Apple, Asparagus, Rice, Maize, Millet, Onion, Barley, Orchard grass, Oat, Rye, and Wheat.
  • Such cells are available from a wide range of sources including: the American Type Culture Collection (Rockland, MD); or from any of a number seed companies, for example, W. Atlee Bu ⁇ ee Seed Co. (Warminster, PA), Park Seed Co. (Greenwood, SC), Johnny Seed Co. (Albion, ME), or Northrup King Seeds (Harstville, SC). Descriptions and sources of useful host cells are also found in
  • Vasil I.K. Cell Culture and Somatic Cell Genetics of Plants, Vol I, II, III Laboratory Procedures and Their Applications Academic Press, New York, 1984; Dixon, R.A., Plant Cell Culture-A Practical Approach, IRL Press, Oxford University, 1985; Green et al., Plant Tissue and Cell Culture, Academic Press, New York, 1987; and Gasser and Fraley, Science 244:1293, (1989).
  • DNA encoding a chimeric synthase polypeptide is carried on a vector operably linked to control signals capable of effecting expression in the prokaryotic host.
  • the coding sequence may contain, at its 5' end, a sequence encoding any ofthe known signal sequences capable of effecting secretion ofthe expressed protein into the periplasmic space ofthe host cell, thereby facilitating recovery ofthe protein and subsequent purification.
  • Prokaryotes most frequently used are various strains of E. coli; however, other microbial strains may also be used.
  • Plasmid vectors are used which contain replication origins, selectable markers, and control sequences derived from a species compatible with the microbial host.
  • prokaryotic control sequences are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences. Promoters commonly used to direct protein expression include the beta-lactamase (penicillinase), the lactose (lac) (Chang et al., Nature 198:1056 (1977)), the tryptophan (Trp) (Goeddel et al.,
  • E. coli pET expression system Novagen
  • DNA encoding a chimeric synthase polypeptide is inserted into a pET vector in an orientation designed to allow expression. Since the chimeric synthase gene is under the control of the T7 regulatory signals, expression of chimeric synthase is induced by inducing the expression of T7 RNA polymerase in the host cell. This is typically achieved using host strains which express T7 RNA polymerase in response to IPTG induction. Once produced, recombinant chimeric synthase polypeptide is then isolated according to standard methods known in the art, for example, those described herein. Another bacterial expression system for chimeric synthase polypeptide production is the pGEX expression system (Pharmacia).
  • This system employs a GST gene fusion system that is designed for high-level expression of a gene or gene fragment as a fusion protein with rapid purification and recovery ofthe functional gene product.
  • the chimeric synthase protein of interest is fused to the carboxyl terminus ofthe glutathione S-transferase protein from Schistosoma japonicum and is readily purified from bacterial lysates by affinity chromatography using Glutathione Sepharose 4B. Fusion proteins can be recovered under mild conditions by elution with glutathione. Cleavage ofthe glutathione S-transferase domain from the fusion protein is facilitated by the presence of recognition sites for site-specific proteases upstream of this domain. For example, proteins expressed in pGEX-2T piasmids may be cleaved with thrombin; those expressed in pGEX-3X may be cleaved with factor Xa.
  • the method of transformation or transfection and the choice of vehicle for expression ofthe chimeric synthase polypeptide will depend on the host system selected. Transformation and transfection methods of numerous organisms, for example, the baker's yeast Saccharomyces cerevisiae, are described, e.g., in Ausubel et al. (supra); Weissbach and Weissbach, Methods or Plant Molecular Biology, Academic Press, 1989; Gelvin et al, Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990; Kindle, K., Proc. Natl. Acad. Sci. U.S.A. 87:1228 (1990); Potrykus, I., Annu. Rev. Plant Physiol. Plant Mol. Biology 42:205 (1991); and BioRad (Hercules, CA) Technical Bulletin
  • Expression vehicles may be chosen from those provided, e.g., in Cloning Vectors: A Laboratory Manual (P.H. Pouwels et al., 1985, Supp. 1987); Gasser and Fraley (supra : Clontech Molecular Biology Catalog (Catalog 1992/93 Tools for the Molecular Biologist, Palo Alto, CA); and the references cited above.
  • pMAMneo provides: an RSV-LTR enhancer linked to a dexamethasone-inducible MMTV- LTR promotor, an SV40 origin of replication which allows replication in mammalian systems, a selectable neomycin gene, and SV40 splicing and polyadenylation sites.
  • DNA encoding a chimeric synthase polypeptide is inserted into the pMAMneo vector in an orientation designed to allow expression. The recombinant chimeric synthase polypeptide is then isolated as described below.
  • Other preferable host cells which may be used in conjunction with the pMAMneo expression vehicle include COS cells and CHO cells (ATCC Accession Nos. CRL
  • a chimeric synthase polypeptide is produced by a stably-transfected mammalian cell line.
  • a number of vectors suitable for stable transfection of mammalian cells are available to the public, e.g., see Pou Stamm et al. (supra); methods for constructing such cell lines are also publicly available, e.g., in Ausubel et al. (supra).
  • cDNA encoding the chimeric synthase polypeptide is cloned into an expression vector which includes the dihydrofolate reductase (DHFR) gene.
  • DHFR dihydrofolate reductase
  • the chimeric synthase-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 ⁇ M methotrexate in the cell culture medium (as described in Ausubel et al., supra). This dominant selection can be accomplished in most cell types.
  • Recombinant protein expression can be increased by DHFR-mediated amplification ofthe transfected gene.
  • Methods for selecting cell lines bearing gene amplifications are described in Ausubel et al. (supra); such methods generally involve extended culture in medium containing gradually increasing levels of methotrexate.
  • DHFR-containing expression vectors commonly used for this pu ⁇ ose include pCVSEII-DHrF and pAdD26SV(A) (described in Ausubel et al., supra).
  • Any ofthe host cells described above or, preferably, a DHFR- deficient CHO cell line are among the host cells prefened for DHFR selection of a stably- transfected cell line or DHFR-mediated gene amplification.
  • a chimeric synthase polypeptide is preferably produced by a stably- transfected plant cell line or by a transgenic plant.
  • a number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants are available to the public; such vectors are described in Pou Stamm et al. (supra), Weissbach and Weissbach (supra), and Gelvin et al. (supra). Methods for constructing such cell lines are described in, e.g., Weissbach and Weissbach (supra), and Gelvin et al. (supra).
  • plant expression vectors include (1) a cloned chimeric synthase gene under the transcriptional control of 5' and 3' regulatory sequences and (2) a dominant selectable marker.
  • plant expression vectors may also contain, if desired, a promoter regulatory region (for example, one conferring inducible or constitutive expression, or environmentally- or developmentally-regulated, or pathogen- or wound-inducible, or cell- or tissue- specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • the chimeric synthase DNA sequence of the invention may, if desired, be combined with other DNA sequences in a variety of ways.
  • the chimeric synthase DNA sequence ofthe invention may be employed with all or part ofthe gene sequences normally associated with a synthase protein.
  • a DNA sequence encoding a chimeric synthase protein is combined in a DNA construct having a transcription initiation control region capable of promoting transcription and translation in a host cell.
  • the constructs will involve regulatory regions functional in plants which provide for production of a chimeric synthase protein as discussed herein.
  • the open reading frame coding for the chimeric synthase protein or functional fragment thereof will be joined at its 5' end to a transcription initiation regulatory region such as the sequence naturally found in the 5' upstream region of a synthase structural gene. Numerous other transcription initiation regions are available which provide for constitutive or inducible regulation.
  • appropriate 5' upstream non-coding regions are obtained from other genes; for example, from genes regulated during seed development, embryo development, leaf development, or in response to a pathogen.
  • Transcript termination regions may be provided by the DNA sequence encoding a synthase protein or any convenient transcription termination region derived from a different gene source.
  • the transcript termination region will contain preferably at least 1-3 kb of sequence 3' to the structural gene from which the termination region is derived.
  • Such genetically-engineered plants are useful for a variety of industrial and agricultural applications as discussed below. Importantly, this invention is applicable to gymnosperms and angiosperms, and will be readily applicable to any new or improved transformation or regeneration method.
  • CaMV cauliflower mosaic virus
  • CaMV cauliflower mosaic virus
  • CaMV is a source for both the 35S and 19S promoters. In most tissues of transgenic plants, the CaMV 35S promoter is a strong promoter (see, e.g., Odell et al., Nature 313:810 (1985)).
  • the CaMV promoter is also highly active in monocots (see, e.g., Dekeyser et al., Plant Cell 2:591 (1990); Terada and
  • activity of this promoter can be further increased (i.e., between 2-10 fold) by duplication ofthe CaMV 35S promoter (see e.g., Kay et al., Science 236:1299 (1987); Ow et al., Proc. Natl. Acad. Sci. U.S.A. 84:4870 (1987); and Fang et al., Plant Cell 1:141 (1989)).
  • chimeric synthase gene product in an appropriate tissue, at an appropriate level, or at an appropriate developmental time.
  • gene promoters each with its own distinct characteristics embodied in its regulatory sequences, shown to be regulated in response to the environment, hormones, and/or developmental cues. These include gene promoters that are responsible for heat-regulated gene expression (see, e.g., Callis et al., Plant Physiol. 88:965
  • hormone-regulated gene expression for example, the abscisic acid (ABA) responsive sequences from the Em gene of wheat described by Marcotte et al. (Plant Cell 1:969 (1989); the ABA-inducible HVA1 and HVA22, and the rd29A promoters described for barley and Arabidopsis by Straub et al. (Plant Cell 6:617 (1994), Shen et al. (Plant Cell 7:295 (1994)), and wound- induced gene expression (for example, of wunl described by Siebertz et al. (Plant
  • organ-specific gene expression for example, ofthe tuber- specific storage protein gene described by Roshal et al. (EMBOJ. 6:1155 (1987); the 23-kDa zein gene from maize described by Schernthaner et al. (EMBO J. 7: 1249 (1988); or the French bean ⁇ -phaseolin gene described by Bustos et al. (Plant Cell 1 :839 (1989)); and pathogen-inducible gene expression described by
  • Plant expression vectors may also optionally include RNA processing signals, for example, introns, which have been shown to be important for efficient RNA synthesis and accumulation (Callis et al., Genes and Dev. 1:1183 (1987)).
  • RNA processing signals for example, introns, which have been shown to be important for efficient RNA synthesis and accumulation (Callis et al., Genes and Dev. 1:1183 (1987)).
  • the expression vectors may also include regulatory control regions which are generally present in the 3' regions of plant genes (Thornburg et al., Proc. Natl. Acad. Sci. U.S.A. 84:744 (1987); An et al., Plant Cell 1 :1 15 (1989)).
  • the 3' terminator region may be included in the expression vector to increase stability ofthe mRNA.
  • One such terminator region may be derived from the PI-II terminator region of potato.
  • other commonly used terminators are derived from the octopine or nopaline synthase signals.
  • the plant expression vector also typically contains a dominant selectable marker gene used to identify those cells that have become transformed.
  • Useful selectable genes for plant systems include genes encoding antibiotic resistance genes, for example, those encoding resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin, or spectinomycin. Genes required for photosynthesis may also be used as selectable markers in photosynthetic-deficient strains. Alternatively, the green-fluorescent protein from the jellyfish Aequorea victoria may be used as a selectable marker (Sheen et al., Plant J. 8:777, 1995; Chiu et al., Current Biology 6:325 (1996)).
  • genes encoding herbicide resistance may be used as selectable markers; useful herbicide resistance genes include the bar gene encoding the enzyme phosphinothricin acetyltransferase and conferring resistance to the broad spectrum herbicide Basta® (Hoechst AG, Frankfurt, Germany). Efficient use of selectable markers is facilitated by a determination ofthe susceptibility of a plant cell to a particular selectable agent and a determination of the concentration of this agent which effectively kills most, if not all, ofthe transformed cells. Some useful concentrations of antibiotics for tobacco transformation include, e.g., 75-100 ⁇ g/ml (kanamycin), 20-50 ⁇ g/ml (hygromycin), or 5-10 ⁇ g/ml (bleomycin). A useful strategy for selection of transformants for herbicide resistance is described, e.g., by Vasil et al., supra.
  • Agrobacterium-mediated transformation (A. tumefaciens or A. rhizogenes) (see, e.g., Lichtenstein and Fuller In: Genetic Engineering, vol 6, PWJ Rigby, ed, London, Academic Press, 1987; and Lichtenstein, C.P., and Draper, J,. In: DNA Cloning, Vol II, D.M. Glover, ed, Oxford, IRI Press, 1985)
  • the particle delivery system see, e.g., Gordon-
  • the following is an example outlining one particular technique, an Agrobacterium-mediatcd plant transformation.
  • the general process for manipulating genes to be transfened into the genome of plant cells is carried out in two phases.
  • First, cloning and DNA modification steps are carried out in E. coli, and the plasmid containing the gene construct of interest is transfened by conjugation or electroporation into Agrobacterium.
  • Second, the resulting Agrobacterium strain is used to transform plant cells.
  • the plasmid contains an origin of replication that allows it to replicate in Agrobacterium and a high copy number origin of replication functional in E. coli. This permits facile production and testing of transgenes in E.
  • Resistance genes can be carried on the vector, one for selection in bacteria, for example, streptomycin, and another that will function in plants, for example, a gene encoding kanamycin resistance or herbicide resistance.
  • plant cells may be transformed by shooting into the cell tungsten microprojectiles on which cloned DNA is precipitated.
  • a gunpowder charge 22 caliber Power Piston Tool Charge
  • an air-driven blast drives a plastic macroprojectile through a gun banel.
  • An aliquot of a suspension of tungsten particles on which DNA has been precipitated is placed on the front ofthe plastic macroprojectile.
  • the target can be any plant cell, tissue, seed, or embryo.
  • the DNA introduced into the cell on the microprojectiles becomes integrated into either the nucleus or the chloroplast.
  • Plants cells transformed with plant expression vectors can be regenerated, for example, from single cells, callus tissue, or leaf discs according to standard plant tissue culture techniques. It is well known in the art that various cells, tissues, and organs from almost any plant can be successfully cultured to regenerate an entire plant; such techniques are described, e.g., in Vasil supra; Green et al., supra; Weissbach and Weissbach, supra; and Gelvin et al., supra. In one particular example, a cloned chimeric synthase polypeptide under the control ofthe EAS4 promoter and the nopaline synthase terminator and carrying a selectable marker (for example, kanamycin resistance) is transformed into Agrobacterium.
  • a selectable marker for example, kanamycin resistance
  • Transformation of leaf discs (for example, of tobacco leaf discs), with vector-containing Agrobacterium is carried out as described by Horsch et al. (Science 227:1229 (1985)). Putative transformants are selected after a few weeks (for example, 3 to 5 weeks) on plant tissue culture media containing kanamycin (e.g., 100 ⁇ g/ml). Kanamycin-resistant shoots are then placed on plant tissue culture media without hormones for root initiation. Kanamycin-resistant plants are then selected for greenhouse growth. If desired, seeds from self- fertilized transgenic plants can then be sowed in soil-less medium and grown in a greenhouse. Kanamycin-resistant progeny are selected by sowing surfaced sterilized seeds on hormone-free kanamycin-containing media. Analysis for the integration ofthe transgene is accomplished by standard techniques (see, for example, Ausubel et al. supra; Gelvin et al. supra).
  • Transgenic plants expressing the selectable marker are then screened for transmission of the transgene DNA by standard immunoblot and DNA detection techniques.
  • Each positive transgenic plant and its transgenic progeny are unique in comparison to other transgenic plants established with the same transgene. Integration ofthe transgene DNA into the plant genomic DNA is in most cases random, and the site of integration can profoundly effect the levels and the tissue and developmental patterns of transgene expression. Consequently, a number of transgenic lines are usually screened for each transgene to identify and select plants with the most appropriate expression profiles.
  • Transgenic lines are generally evaluated for levels of transgene expression. Expression at the RNA level is determined initially to identify and quantitate expression-positive plants. Standard techniques for RNA analysis are employed and include PCR amplification assays using oligonucleotide primers designed to amplify only transgene RNA templates and solution hybridization assays using transgene-specific probes (see, e.g., Ausubel et al., supra). The RNA-positive plants are then analyzed for protein expression by Western immunoblot analysis using specific antibodies to the chimeric synthase (see, e.g., Ausubel et al., supra). In addition, in situ hybridization and immunocytochemistry according to standard protocols can be done using transgene-specific nucleotide probes and antibodies, respectively, to localize sites of expression within transgenic tissue.
  • the recombinant chimeric synthase protein may be expressed in any cell or in a transgenic plant (for example, as described above), it may be isolated, e.g., using affinity chromatography.
  • an anti-chimeric synthase antibody e.g., produced as described in Ausubel et al., supra, or by any standard technique
  • Lysis and fractionation of chimeric synthase-producing cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al, supra).
  • the recombinant protein can, if desired, be further purified, for example, by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, eds., Work and Burdon, Elsevier, 1980).
  • the invention described herein is useful for a variety of agricultural, pharmaceutical, industrial, and commercial pu ⁇ oses.
  • the methods, DNA constructs, proteins, and transgenic organisms, including the bacteria, yeast, and plants described herein, are useful for improving isoprenoid synthesis, manufacturing, and production.
  • a number of chimeric isoprenoid synthases may be engineered that are useful, for example, for the production of compounds having anti-fungal, anti ⁇ bacterial, anti-malarial, and anti-tumor properties.
  • the C-terminal domain of casbene synthase (Mau and West, Proc. Natl. Acad. Sci. 91:8497, 1994) is joined to the N-terminal domain of TEAS, HVS, or CH9.
  • a chimeric synthase capable of catalyzing the production of anti-bacterial compounds
  • the C-terminal domain of cyclofarnesenone synthase (Habtermariam et al., J. Nat. Prod. 56:140, 1993) is joined to the ⁇ -terminal domain of TEAS, HVS, or CH9.
  • Production of anti- malarial compounds is achieved using chimeric synthases having a C-terminal domain from artemisian synthase (El-Feraly et al., J. Nat. Prod. 52:196, 1989) and an ⁇ -terminal domain from TEAS, HVS, or CH9.
  • Synthases capable of producing anti -tumor compounds are produced by joining the C-terminal domain of taxadiene synthase (Koepp et al., J. Biol. Chem. 270:8686, 1995) or helenalin synthase (Lee et al., Science 196: 533, 1977) with the ⁇ -terminal domain of TEAS, HVS, or CH9.
  • the invention is also useful for the production of chimeric synthases which are capable of generating insecticides.
  • Such chimeric synthases are engineered by joining the C-terminal domain of cadinene synthase (Chen et al., Arch. Biochem. Biophys.
  • chimeric synthases are also useful for generating novel flavorings and perfumes.
  • a chimeric synthase is engineered by joining the C-terminal domain of limonene synthase (Colby et al., J. Biol. Chem. 268: 23016, 1993) to the C- terminal domain of TEAS, HVS, or CH9. All publications and patents mentioned in this specification are herein inco ⁇ orated by reference to the same extent as if each individual publication or patent was specifically and individually indicated to be inco ⁇ orated by reference.
  • MOLECULE TYPE DNA (oligonucleotide)
  • MOLECULE TYPE DNA (oligonucleotide)
  • SEQUENCE DESCRIPTION SEQ ID NO:6. GGGATCGATA ACTCTGCATA ATGTAGCATT 30

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US1997/005986 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof Ceased WO1997038703A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
IL12648697A IL126486A0 (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
AU27264/97A AU2726497A (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
DE0904095T DE904095T1 (de) 1996-04-12 1997-04-11 Chimäre isoprenoidsynthasen und deren verwendungen
EA199800917A EA001622B1 (ru) 1996-04-12 1997-04-11 Химерная изопреноидсинтаза, последовательность днк, экспрессирующий вектор, линия клеток и способ получения химерной изопреноидсинтазы
JP9537218A JP2000508899A (ja) 1996-04-12 1997-04-11 キメライソプレノイド合成酵素およびその使用
HK99102647.5A HK1017275B (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
AT97921142T ATE223225T1 (de) 1996-04-12 1997-04-11 Chimäre isoprenoidsynthasen und deren verwendungen
SI9730430T SI0904095T1 (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
EP97921142A EP0904095B1 (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
DE69715192T DE69715192T2 (de) 1996-04-12 1997-04-11 Chimäre isoprenoidsynthasen und deren verwendungen
BR9708650A BR9708650A (pt) 1996-04-12 1997-04-11 Isoprenóide sintases quiméricas e seus usos
CA002250712A CA2250712C (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof
IL126486A IL126486A (en) 1996-04-12 1998-10-08 Syntheses of chimeric isopranoid and method of preparation
GR990300025T GR990300025T1 (en) 1996-04-12 1999-01-01 Chimeric isoprenoid synthases and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/631,341 US5824774A (en) 1996-04-12 1996-04-12 Chimeric isoprenoid synthases and uses thereof
US08/631,341 1996-04-12

Publications (2)

Publication Number Publication Date
WO1997038703A1 true WO1997038703A1 (en) 1997-10-23
WO1997038703A9 WO1997038703A9 (en) 1998-05-22

Family

ID=24530791

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/005986 Ceased WO1997038703A1 (en) 1996-04-12 1997-04-11 Chimeric isoprenoid synthases and uses thereof

Country Status (25)

Country Link
US (2) US5824774A (https=)
EP (2) EP1229122A3 (https=)
JP (4) JP2000508899A (https=)
KR (1) KR20000005385A (https=)
AP (1) AP808A (https=)
AR (1) AR006638A1 (https=)
AT (1) ATE223225T1 (https=)
AU (1) AU2726497A (https=)
BR (1) BR9708650A (https=)
CA (1) CA2250712C (https=)
CZ (1) CZ294613B6 (https=)
DE (2) DE69715192T2 (https=)
EA (1) EA001622B1 (https=)
ES (1) ES2132046T3 (https=)
GR (1) GR990300025T1 (https=)
ID (1) ID19769A (https=)
IL (2) IL126486A0 (https=)
IN (1) IN186316B (https=)
OA (1) OA10895A (https=)
PL (1) PL329404A1 (https=)
PT (1) PT904095E (https=)
TR (1) TR199802043T2 (https=)
TW (1) TW509724B (https=)
WO (1) WO1997038703A1 (https=)
ZA (1) ZA973108B (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000017327A3 (en) * 1998-09-18 2001-05-31 Univ Kentucky Res Dept Terpene synthases
US8124811B2 (en) 2007-03-20 2012-02-28 Allylix, Inc. Fragrance and methods for production of 5-epi-β-vetivone, 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-2,6-dien-8-one, and 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-1,6-dien-8-one
US8192950B2 (en) 2003-07-24 2012-06-05 The University Of Kentucky Research Foundation Sesquiterpene synthase gene and protein
US8263362B2 (en) 2001-03-09 2012-09-11 University Of Kentucky Research Foundation Cytochrome P450S and uses thereof
US8354504B2 (en) 1996-04-12 2013-01-15 The Board Of Trustees Of The University Of Kentucky Chimeric isoprenoid synthases and uses thereof
US8481286B2 (en) 2008-08-12 2013-07-09 Allylix, Inc. Method for production of isoprenoid compounds
US9353385B2 (en) 2012-07-30 2016-05-31 Evolva, Inc. Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7186891B1 (en) * 1996-04-12 2007-03-06 University Of Kentucky, Research Foundation Plant cells and plants expressing chimeric isoprenoid synthases
US5824774A (en) * 1996-04-12 1998-10-20 Board Of Trustees Of The University Of Kentucky Chimeric isoprenoid synthases and uses thereof
US5945726A (en) * 1996-12-16 1999-08-31 Micron Technology, Inc. Lateral bipolar transistor
US6358712B1 (en) 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US20040005673A1 (en) * 2001-06-29 2004-01-08 Kevin Jarrell System for manipulating nucleic acids
CA2360011A1 (en) * 1999-01-05 2000-07-13 Trustees Of Boston University Ordered gene assembly
AU2001278098A1 (en) 2000-07-31 2002-02-13 Frederick M. Hahn Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms
AU2012202780B2 (en) * 2001-03-09 2014-07-03 University Of Kentucky Research Foundation Cytochrome P450s and Uses Thereof
AU2013204829B2 (en) * 2001-03-09 2013-07-04 University Of Kentucky Research Foundation Cytochrome P450s and uses thereof
US7192751B2 (en) * 2001-12-06 2007-03-20 The Regents Of The University Of California Biosynthesis of amorpha-4,11-diene
US7172886B2 (en) * 2001-12-06 2007-02-06 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
EP2171085A4 (en) 2007-06-01 2010-07-14 Sapphire Energy SCREENING OF GENETICALLY MODIFIED PHOTOSYNTHETIC ORGANISMS WITH HIGH THROUGHPUT
CA2698289A1 (en) 2007-09-11 2009-03-19 Sapphire Energy, Inc. Methods of producing organic products with photosynthetic organisms and products and compositions thereof
AU2008299020A1 (en) * 2007-09-11 2009-03-19 Sapphire Energy, Inc. Molecule production by photosynthetic organisms
AU2008334945C1 (en) * 2007-12-13 2013-09-05 Danisco Us Inc. Compositions and methods for producing isoprene
US8034992B2 (en) * 2008-06-16 2011-10-11 Academia Sinica Gibberellin 2-oxidase genes and uses thereof
CN103282492A (zh) 2010-10-29 2013-09-04 奥利里克斯股份有限公司 修饰的瓦伦烯合酶多肽、编码核酸分子及其用途
US9550815B2 (en) 2012-01-23 2017-01-24 University Of British Columbia ABC terpenoid transporters and methods of using the same
JP5950253B2 (ja) * 2012-02-13 2016-07-13 住友ゴム工業株式会社 イソプレノイドの製造方法、及びイソプレノイド
BR112015009774A2 (pt) 2012-11-01 2017-12-05 Univ British Columbia polipeptídeos citocromo p450 e citocromo p450 redutase, codificando moléculas de ácido nucléicos e usos das mesmas
EP2970934B1 (en) 2013-03-14 2017-08-16 Evolva, Inc. Valencene synthase polypeptides, encoding nucleic acid molecules and uses thereof
CN111621508B (zh) * 2020-06-11 2022-07-01 云南中烟工业有限责任公司 烟草萜类合成酶NtTPS7基因及其载体与应用

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994022304A1 (en) * 1993-04-02 1994-10-13 Pioneer Hi-Bred International, Inc. Southern corn rootworm control with limonene
CA2118071C (en) * 1993-10-28 2004-09-14 Rodney B. Croteau Dna encoding limonene synthase from mentha spicata
US5824774A (en) * 1996-04-12 1998-10-20 Board Of Trustees Of The University Of Kentucky Chimeric isoprenoid synthases and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., 31 March 1995, Vol. 270, No. 13, BACK K. et al., "Cloning and Bacterial Expression of a Sesquiterpene Cyclase from Hyocyamus Muticus and Its Molecular Comparison to Related Terpene Cyclases", pages 7375-7381. *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8354504B2 (en) 1996-04-12 2013-01-15 The Board Of Trustees Of The University Of Kentucky Chimeric isoprenoid synthases and uses thereof
US8741651B2 (en) 1996-04-12 2014-06-03 The Board Of Trustees Of The University Of Kentucky Chimeric isoprenoid synthases and uses thereof
US6468772B1 (en) 1998-09-18 2002-10-22 The Salk Institute For Biological Studies Methods of making modified polypeptides
US6495354B2 (en) 1998-09-18 2002-12-17 University Of Kentucky Research Foundation Synthases
US6559297B2 (en) 1998-09-18 2003-05-06 The Salk Institute For Biological Studies Synthases
US6569656B2 (en) 1998-09-18 2003-05-27 The University Of Kentucky Research Foundation Synthases
US6890752B2 (en) 1998-09-18 2005-05-10 The University Of Kentucky Research Foundation Synthases
EP2322605A3 (en) * 1998-09-18 2011-09-14 University of Kentucky Research Department Terpene synthases
EP2363458A3 (en) * 1998-09-18 2011-12-14 University of Kentucky Research Department Terpene synthases
WO2000017327A3 (en) * 1998-09-18 2001-05-31 Univ Kentucky Res Dept Terpene synthases
JP2014000082A (ja) * 1998-09-18 2014-01-09 University Of Kentucky Research Foundation シンターゼ
US8722363B2 (en) 2001-03-09 2014-05-13 University Of Kentucky Research Foundation Cytochrome P450S and uses thereof
US8263362B2 (en) 2001-03-09 2012-09-11 University Of Kentucky Research Foundation Cytochrome P450S and uses thereof
US8445231B2 (en) 2001-03-09 2013-05-21 University Of Kentucky Research Foundation Cytochrome P450s and uses thereof
US10184118B2 (en) 2001-03-09 2019-01-22 The University Of Kentucky Research Foundation Cytochrome P450S and uses thereof
US10184119B2 (en) 2001-03-09 2019-01-22 The University Of Kentucky Research Foundation Cytochrome P450s and uses thereof
US8835131B2 (en) 2003-07-24 2014-09-16 University Of Kentucky Research Foundation Sesquiterpene synthase gene and protein
US8192950B2 (en) 2003-07-24 2012-06-05 The University Of Kentucky Research Foundation Sesquiterpene synthase gene and protein
US9534237B2 (en) 2003-07-24 2017-01-03 University Of Kentucky Research Foundation Sesquiterpene synthase gene and protein
US8642815B2 (en) 2007-03-20 2014-02-04 Allylix, Inc. Fragrance and methods for production of 5-epi-β-vetivone, 2-isopropyl-6, 10-dimethyl-spiro[4.5]deca-2,6-dien-8-one, and 2-isopropyl-6, 10-dimethyl-spiro[4.5]deca-1, 6-dien-8-one
US8124811B2 (en) 2007-03-20 2012-02-28 Allylix, Inc. Fragrance and methods for production of 5-epi-β-vetivone, 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-2,6-dien-8-one, and 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-1,6-dien-8-one
US8362309B2 (en) 2007-03-20 2013-01-29 Allylix, Inc. Fragrance and methods for production of 5-epi-β-vetivone, 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-2,6-dien-8-one, and 2-isopropyl-6,10-dimethyl-spiro[4.5]deca-1,6-dien-8-one
US8753842B2 (en) 2008-08-12 2014-06-17 Allylix, Inc. Method for production of isoprenoid compounds
US8609371B2 (en) 2008-08-12 2013-12-17 Allylix, Inc. Isoprenoid compounds
US8481286B2 (en) 2008-08-12 2013-07-09 Allylix, Inc. Method for production of isoprenoid compounds
US9353385B2 (en) 2012-07-30 2016-05-31 Evolva, Inc. Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof
US9725740B2 (en) 2012-07-30 2017-08-08 Evolva, Inc. Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof

Also Published As

Publication number Publication date
EA199800917A1 (ru) 1999-04-29
PL329404A1 (en) 1999-03-29
EP0904095B1 (en) 2002-09-04
EP0904095A1 (en) 1999-03-31
IN186316B (https=) 2001-08-04
JP2015171387A (ja) 2015-10-01
AP808A (en) 2000-02-29
JP2000508899A (ja) 2000-07-18
CA2250712A1 (en) 1997-10-23
BR9708650A (pt) 1999-08-03
ZA973108B (en) 1997-11-04
ES2132046T3 (es) 2003-03-16
JP2015057074A (ja) 2015-03-26
ATE223225T1 (de) 2002-09-15
AU2726497A (en) 1997-11-07
JP2012005499A (ja) 2012-01-12
EP1229122A3 (en) 2002-10-09
ID19769A (id) 1998-07-30
OA10895A (en) 2001-10-11
CZ294613B6 (cs) 2005-02-16
CA2250712C (en) 2008-07-08
TW509724B (en) 2002-11-11
IL126486A (en) 2006-04-10
DE904095T1 (de) 1999-10-07
CZ317998A3 (cs) 1999-02-17
DE69715192T2 (de) 2003-04-30
AR006638A1 (es) 1999-09-08
AP9700971A0 (en) 1997-07-31
US6072045A (en) 2000-06-06
HK1017275A1 (en) 1999-11-19
IL126486A0 (en) 1999-08-17
DE69715192D1 (de) 2002-10-10
TR199802043T2 (xx) 1999-01-18
US5824774A (en) 1998-10-20
PT904095E (pt) 2002-12-31
EP0904095A4 (en) 1999-07-07
EA001622B1 (ru) 2001-06-25
EP1229122A2 (en) 2002-08-07
ES2132046T1 (es) 1999-08-16
KR20000005385A (ko) 2000-01-25
GR990300025T1 (en) 1999-07-30

Similar Documents

Publication Publication Date Title
EP0904095B1 (en) Chimeric isoprenoid synthases and uses thereof
US8354504B2 (en) Chimeric isoprenoid synthases and uses thereof
US7186891B1 (en) Plant cells and plants expressing chimeric isoprenoid synthases
WO1997038703A9 (en) Chimeric isoprenoid synthases and uses thereof
AU2002244262B2 (en) Cytochrome P450s and uses thereof
AU2002244262A1 (en) Cytochrome P450s and uses thereof
JP2002529077A (ja) イチイのゲラニルゲラニル二リン酸シンターゼをコードする核酸、及び使用方法。
US5959180A (en) DNA sequences from potato encoding solanidine UDP-glucose glucosyltransferase and use to reduce glycoalkaloids in solanaceous plants
AU722002B2 (en) Plant sugar sensors and uses thereof
CN101208434B (zh) 积聚单萜和/或倍半萜的转化的植物
HK1017275B (en) Chimeric isoprenoid synthases and uses thereof
Chappell et al. Chimeric Isoprenoid Synthases and Uses Thereof
AU2013204829B2 (en) Cytochrome P450s and uses thereof
CH OH y—CHACONINE
HK1142096B (en) Optimized non-canonical zinc finger proteins

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN YU AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
COP Corrected version of pamphlet

Free format text: PAGES 1/8-8/8, DRAWINGS, REPLACED BY NEW PAGES 1/9-9/9

WWE Wipo information: entry into national phase

Ref document number: PV1998-3179

Country of ref document: CZ

ENP Entry into the national phase

Ref document number: 2250712

Country of ref document: CA

Ref document number: 2250712

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1019980708111

Country of ref document: KR

Ref document number: 1998/02043

Country of ref document: TR

WWE Wipo information: entry into national phase

Ref document number: 199800917

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 1997921142

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV1998-3179

Country of ref document: CZ

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1997921142

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019980708111

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 1997921142

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1019980708111

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: PV1998-3179

Country of ref document: CZ