WO1995022614A1 - Production de proteines recombinees ancrees par glycosylphosphatidylinositol - Google Patents

Production de proteines recombinees ancrees par glycosylphosphatidylinositol Download PDF

Info

Publication number
WO1995022614A1
WO1995022614A1 PCT/BR1995/000010 BR9500010W WO9522614A1 WO 1995022614 A1 WO1995022614 A1 WO 1995022614A1 BR 9500010 W BR9500010 W BR 9500010W WO 9522614 A1 WO9522614 A1 WO 9522614A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gpi
process according
precursor
treatment
Prior art date
Application number
PCT/BR1995/000010
Other languages
English (en)
Inventor
Maria Lucia Cardoso De Almeida
Beatriz Amaral De Castilho Valavicius
Antonio Gomes De Amorim Filho
Original Assignee
Finep-Financiadora De Estudos E Projetos
Escola Paulista De Medicina
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Finep-Financiadora De Estudos E Projetos, Escola Paulista De Medicina filed Critical Finep-Financiadora De Estudos E Projetos
Publication of WO1995022614A1 publication Critical patent/WO1995022614A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6481—Phosphoglycerides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/005—Glycopeptides, glycoproteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
    • C07K2319/91—Fusion polypeptide containing a motif for post-translational modification containing a motif for glycosylation
    • C07K2319/912—Fusion polypeptide containing a motif for post-translational modification containing a motif for glycosylation containing a GPI (phosphatidyl-inositol glycane) anchor

Definitions

  • the present invention relates to a process for ex ⁇ pressing recombinant proteins, such as human insulin or Mycobacterium leprae 18kDa antigen, in genetically modified eukariotic microorganisms, especially in Saccharomyces cerevisiae yeast, in a form anchored to the plasma membrane by means of a glycosylphosphatidylinositol (GPI) anchor, and for selectively releasing them by methods making use of intrinsic properties provided by the presence of GPI, e.g. by treatment with GPI-specific phospholipase.
  • GPI glycosylphosphatidylinositol
  • the purification of proteins of medical interest for use in diagnosis or treatment initially involves the large- scale obtention of the material from which the protein will be isolated. In many cases, this has become unfeasible for se ⁇ veral reasons, such as costs and availability of the raw mate ⁇ rials, these being in many cases human organs, which implies potential problems of contamination of the material with virus that cannot be totally eliminated during the purification process. For these reasons, in producing these proteins empha ⁇ sis has been placed on the obtention of modified microorganisms that can express the products of interest. For instance, bacteria such as E.coli can be modified in such a manner that they become capable of synthesizing human proteins in large amounts.
  • Yeasts such as S.cerevisiae and cells of mammals maintained in culture can also be altered in order to produce the peptides of interest.
  • the • advantages in these cases are the low cost of the raw material, the reproducibility in the obtention of large amounts of the prod ⁇ uct and the harmlessness of the systems employed.
  • Another great advantage of these systems is the possibility of alter ⁇ ing the sequence of the proteins being expressed, in order to adapt them to the needs of the product; these alterations, in ⁇ volving residues of certain amino acids, in theory can result in the obtention of products that are more specific, have a higher activity or exhibit additional functions not presented by the original product.
  • the usually employed insulin is obtained from the pancreas of oxen or pigs.
  • the yeast Saccharomyces cerevisiae has become an im ⁇ portant tool in the production of recombinant proteins and is often preferred to E.coli since the latter has toxic sub ⁇ stances associated with its wall, which implies extensive pu ⁇ rification processes and tests of the products synthesized in this bacterium.
  • the yeast on the other hand, has been used for centuries in the manufacture of foodstuff and is harmless to human beings.
  • the recombinant proteins can be produced by these hosts and remain inside the cells. Alternatively, these prote- ins can be secreted into the culture medium. Each method has its advantage and, depending on the type of protein to be ex ⁇ pressed, one or the other is chosen. In general, for proteins which are usually secreted by the cells that express them na ⁇ turally, the secretion way is chosen for their production on a large scale. Naturally intracellular proteins are usually produced in these organisms also in the intracellular form. However, although mimicking the native location, in many cases and for reasons which cannot be determined beforehand, one cannot succeed in producing them on a large-scale and it is necessary to test several forms of biosynthesis.
  • prote ⁇ ins when expressed intracellularly in large amounts, form inclusion bodies constituted by proteins aggregated in an in ⁇ active manner. Although the purification of these proteins is facilitated by their being in an insoluble form, their use is limited because this requires steps of denaturation and renaturation in vitro, which do not always allow the obtention of proteins with their natural and active conformation and, besides, result in low yields of the correctly folded product.
  • the process of purifying the recombinant product also defines the type of expression of the protein. Thus, for instance, secreted proteins will be in a diluted form in the culture medium, which should be processed after elimination of the cells by centrifugation or filtration.
  • the present invention provides an alternative way of expressing recombinant proteins in S.cerevisiae, by which the recombinant product will be associated with the plasma mem ⁇ brane by means of a GPI anchor.
  • GPI glycosylphosphatidylinositol
  • This structure is co-translationally added at the level of the endoplasmic reticulum in a process of which the rapidity suggests that the nascent protein receives the al ⁇ ready preformed GPI anchor by means of enzymatic steps not yet totally characterized (Doering et al., 1989, J. Biol. Chem. 265:611).
  • the precursors of the GPI-anchored proteins contain a hydrophobic sequence of from 15 to 30 amino acids at the C-terminal, which is eliminated during the processing, gener ⁇ ating a new C-terminus, to which the GPI structure is added.
  • both transmembranic and secreted proteins can be con- verted into their respective GPI-anchored variants by adding this signal sequence to their respective biosynthetic precur ⁇ sors (Caras et al, 1987, Science 238:1280; Crise et al., 1989, J. Virol. 63 :5328; Tykocinsky et al., 1988, Proc. Natl. Acad. Sci. USA 85 :3555).
  • the GPI-anchored proteins are usually released from the membrane when treated with inositol-specific phospholipase, which treatment, upon hydrolysing phosphatidylinositol, breaks the domain of interaction with the membrane (Low, 1990, op.cit.).
  • PLC phospholipase C
  • D capable of solubilizing GPI-containing molecules in vitro have been described. Some of these types, such as the phospholipases C of bacterial origin, have a broad specificity and hydrolyse phosphatidylinositol and GPI, while others, from mammals or trypanosomes, seem to be highly specific for GPI (Low, 1990, op. cit.).
  • GPI-containing glycoproteins exhibit an amphiphilic character and, after solubilization by PLC, ac ⁇ quire a hydrophilic character (Ferguson & Williams, op. cit.).
  • ac ⁇ quire a hydrophilic character
  • the re ⁇ lease of GPI-anchored proteins can also be mediated in vivo by means of the co-expression of phospholipases (Scallon et al., 1992, Bio/Technology 10:500).
  • the genes coding for some phospholipases, including GPI-specific phospholipase C, have already been cloned and sequenced; the expression of these ac ⁇ tivities in cells of interest is, therefore, possible.
  • the re ⁇ leased protein Concomitantly with the solubilization by PLC the re ⁇ leased protein exposes inositol 1,2-cyclic phosphate in the structure of its hydrolysed GPI, which is a structural marker known as "cross-reacting determinant" (CRD), and an epitope classically recognized as an antibody (anti-CRD).
  • CCD cross-reacting determinant
  • anti-CRD anti-CRD
  • This polyclonal antibody has the property of discriminating the en ⁇ tire structure of GPI from the structure hydrolysed by phospholipases C and further allows the selective purification of GPI-containing molecules by immunoaffinity.
  • GPI moiety of an anchored protein can also be obtained by chemical or enzymatic treatments, and free GPI's can be purified by selective extraction with or ⁇ ganic solvents (Orlean et al, 1994, Brazilian J. Med. Biol. Res . Vol . 27 , page 145 ) .
  • any protein can receive a GPI-anchor and consequently remain linked to the plasma mem ⁇ brane, if the appropriate signal sequence is added to its carboxyl terminus.
  • the recombinant product containing the GPI-anchor will practically be the only protein to be recognized and cleaved by phospholipase. Therefore, this method represents a unique ad ⁇ vantage of releasing the product in a highly specific and se ⁇ lective manner.
  • the recombinant product will contain an epitope (CRD) which can be used in its final pu- rification by immunoaffinity.
  • CCD epitope
  • Human insulin commercially available for the treat ⁇ ment of insulin-dependent diabetes is derived, at present, from three alternative sources, namely: a) chemically modified animal insulin (Markussen, J., 1980, US Patent 3,433,898); b) recombinant human insulin, produced in Saccharomyces cerevisiae in secreted form (Thim et al., 1987, FEBS Letters 212 :307), and c) recombinant human insulin produced in E.
  • chemically modified animal insulin Markussen, J., 1980, US Patent 3,433,898
  • recombinant human insulin produced in Saccharomyces cerevisiae in secreted form
  • coli in the form of intracellular pro-insulin, which after pu ⁇ rification is enzymatically cleaved with tripsin and carboxypeptidase B, providing human insulin (Williams et al., 1982, Science 215:687; Sung et al., 1986, Proc. Natl. Acad. Sci., 83:561).
  • the present invention is exemplified in this alternative form of expressing human insulin in the yeast S.cerevisiae, in which the insulin molecule will be originally anchored via GPI to the cellular membrane, which allows the facilitated purification of the product by means of the treat ⁇ ment of the cells with GPI-specific phospholipase C.
  • the Mycobacterium leprae 18kDa protein is one of the main targets of the cellular immune response in individuals infected by this bacillus (Booth et al., 1988, J. Immunol. 140:597). M.leprae is at present a problem of underdeveloped and developing countries, causing leprosy in approximately 15 million people (WHO Bulletin, 1988, World Health Organization/Switzerland) . Due to the difficulty in cultivat ⁇ ing it, little is known about the biology, biochemistry or immunology of this disease. It was suggested that the 18kDa protein might represent a potential vaccine against this dis ⁇ ease (Young et al., 1988, Proc. Natl. Acad. Sci. USA 85:4267).
  • leprae 18kDa protein in membrane-anchored form in S. cerevisiae can offer advantages over the soluble forms of this protein, or of other antigens, for vaccination using, for instance, liposomes covered with this GPI-anchored protein.
  • this anchored protein can be used in agglutination assays, which are admittedly the most economical serological test for infectious diseases, especially in less developed countries.
  • a GPI-containing immunogen can elicit an immune response modulated by parameters that, although not yet well-known, can favour the protection (Schofield & Harckett, 1993, J. Exp. Medicine 177 :145).
  • the present invention represents an alterna ⁇ tive in the way of expressing recombinant proteins in Saccharomyces cerevisiae, with many practical possibilities, comprising: a) the protein will contain a carboxy-terminal moiety capable of locating it in the cytoplasma membrane; b) said localization will be due to the presence of a structure called glycosylphosphatidylinositol (GPI) anchor, the addition of which to the protein is mediated by the carboxy-terminal sequence referred to under a); c) the carboxy-terminal sequence will be derived from the S.cerevisiae Gasl protein; d) the expressed protein can be any protein compo ⁇ nent usually found in eurokaryotic or prokaryotic organisms, such as hormones, surface antigens, secreted peptides, cytoplasmatic proteins etc; e) the expressed protein can be human insulin, or the Mycobacterium leprae 18kDa antigen; f) the S.cerevis
  • the present invention also comprises a method of ob ⁇ taining yeast strains expressing human insulin or the Mycobacterium leprae 18kDa antigen in membrane-anchored form, which method comprises: al) chemical synthesis of the insulin gene, coding only for chains B and A, these chains being linked by dibasic residues; or a2) enzymatic synthesis of the sequence coding for the Mycobacterium leprae 18kDa antigen; b) construction of vectors suitable for expressing
  • GPI-anchored proteins in S.cerevisiae c) insertion of the sequences coding for insulin or for the 18kDa antigen in these vectors; and d) introduction of the plasmids obtained in c) in yeast strains lacking the endogenous protein Gasl.
  • This invention also comprises detecting the pro ⁇ duction of insulin or of the 18kDa antigen in the cells trans ⁇ formed with the plasmids, by means of immuno-blots from SDS-PAGE or directly from colonies.
  • This invention further comprises detecting the pres ⁇ ence of GPI anchor in the proteins insulin and 18kD, by means of immuno-blots with antibody anti-CRD after treatment of the filters with PLC.
  • Gasl being pratically the only GPI-anchored protein present in the yeast cell which is sensitive to hydrolysis by GPI-specific phospholipase C, the present invention provides a highly selective method of purifying proteins.
  • an object of the present invention is to pro- vide a process for producing a recombinant protein, or a pre ⁇ cursor thereof, in cells of genetically modified eukariotic microorganisms, characterized by comprising the steps of: a) biosynthesizing said protein or a precursor thereof by the cell of said microorganism and linking the endogenous glycosylphosphatidylinositol (GPI) to the C- terminal amino acid of the obtained protein or its precursor, with the consequent anchoring of said protein or precursor to membranes of said microorganism by means of GPI; and b) selectively releasing the protein or its precur- sor obtained in step a) by methods making use of intrinsic properties provided by the presence of GPI.
  • GPI glycosylphosphatidylinositol
  • a specific embodiment of this process is character ⁇ ized in that said eukaryotic microorganism is a genetically modified Saccharomyces cerevisiae.
  • Other eukaryotic microorganisms that are also con ⁇ templated herein are Dictyostelium discoideum, trypanosomes and other yeasts such as Pichia pastoris and Hansenula polymorpha.
  • Another specific embodiment of this process is char- acterized in that said eukaryotic microorganism is Saccharomyces cerevisiae genetically modified so as not to produce endogenous GPI-anchored proteins.
  • Another specific embodiment of this process is char ⁇ acterized in that said eukaryotic microorganism is Saccharomyces cerevisiae genetically modified so as not to produce the Gasl endogenous protein.
  • Another specific embodiment of this process is char ⁇ acterized in that said recombinant protein is human insulin.
  • Another specific embodiment of this process is char- acterized in that said recombinant protein is Mycobacterium leprae 18kDa antigen.
  • Another specific embodiment of this process is char ⁇ acterized in that the selective release of the protein or its precursor obtained in step a) is carried out by enzymatic treatment.
  • Another specific embodiment of this process is char ⁇ acterized in that the enzymatic treatment is carried out with PI- or GPI-specific phospholipase.
  • Another specific embodiment of this process is char ⁇ acterized in that the enzymatic treatment is carried out with PI- or GPI-specific phospholipase of C or D specificity.
  • epipe CRD inositol 1,2-cyclic phosphate
  • Another specific embodiment of this process is char- acterized in that the enzymatic treatment is carried out with proteases.
  • Another specific embodiment of this process is char ⁇ acterized in that the selective release of the protein or its precursor obtained in step a) is carried out by chemical treatment.
  • Another specific embodiment of this process is char ⁇ acterized in that the chemical treatment is carried out by nitrous deamination.
  • Another specific embodiment is characterized in that the chemical treatment is carried out with a base.
  • Another specific embodiment of this process is char ⁇ acterized in that the selective release of the protein or its precursor obtained in step a) is carried out by treatment with neutral detergents. In another specific embodiment of this process, this treatment is carried out with neutral detergents of the n- octylglucopyranoside type.
  • Another specific embodiment of this process is char ⁇ acterized in that the selective release of the protein or its precursor obtained in step a) is carried out by co-expression of a PI- or GPI-specific phospholipase in the cell of said microorganism.
  • said eukaryotic microorganism is a genetically modified Sacchar
  • Dictyostelium discoideum Dictyostelium discoideum
  • trypanosomes yeasts
  • other yeasts such as Pichia pastoris and Hanse ⁇ ula polymorpha.
  • said eukariotic microorganism is a Saccharomyces cerevisiae genet ⁇ ically modified so as not to produce GPI-anchored endogenous proteins.
  • said eukaryotic microorganism is a Saccharomyces cerevisiae genet ⁇ ically modified so as not to produce the endogenous Gasl pro ⁇ tein.
  • said recombinant protein is human insulin.
  • said recombinant protein is Mycobacterium leprae 18kDa antigen.
  • the selec- tive release of a protein or its precursor or GPI or its pre ⁇ cursor obtained in step a) is obtained by enzymatic treatment.
  • This treatment can make use of phospholipases with PI- or GPI-specificity, and specially with PI- or GPI-specific phospholipases of C or D specificity.
  • the resulting particulate fraction containing the membranes is resuspended in a minimum volume of 0.1% Triton X-114 in 50 mM Tris.HCl pH 7.4 with 150 mM NaCl.
  • the phospholipase C either from Trypanosoma brucei (GPI-specific) or from Bacillus thuringiensis (Pl-specific) is added and the mixture, after gentle mixing, is incubated for 1 hour at 30°C.
  • the yeast membranes containing the GPI-anchored recombinant protein can be resuspended in 50 mM Tris.acetate pH 5.4 and 4000 U/ml of GPI-specific phospholipase D from hu- man or rat is added and the reaction mixture incubated for 1 hour at 30°C.
  • the supernatant after centrifugation or the whole incubation mix ⁇ ture will contain the target protein or the precursor in its hydrolysed form which presents in its structure the inositol 1,2-cyclic phosphate (anti-CRD epitope), which can be selec ⁇ tively purified by immunoaffinity with anti-CRD antibodies.
  • Antibody with this specificity can be obtained from rabbits immunized with ILTat 1.21 mf VSG from T.brucei after its con ⁇ version to its soluble form ILTat 1.21 sVSG by the action of 1600 U/ml of T.
  • the elution of the antibody is followed by following optical density at 280 nm, and all the fractions with ODs above 0.1 are pooled and applied to a column where MITat 1.6 mf VSG has been immobilized on Sepharose-CL-4B (Pharmacia) using standard protocols.
  • the fraction of antibody which does not bind to the column is the so called anti-CRD antibody which will react with GPI-anchored proteins hydrolysed by phospholipase C but not by phospholipase D.
  • This antibody is then immobilized on Sepharose CL-4B and this resin can be used several times to purify, by affinity, phospholipase C-solubilized GPI compo ⁇ nents.
  • the enzymatic treatment for release of GPI-anchored proteins can also be performed by specific proteases provided that an unique site for its action is carefully planned at the design of the recombinant protein.
  • a trypsin site was inserted exactly at the fusion sites. Accessibility of the protease to the site might depend on folding of each recombinant protein. In this case the released products will not contain the CRD epitope since the GPI is left inserted in the plasma membrane.
  • the selective release of the protein or its precursor or GPI or its precur- sor obtained in step C is obtained by chemical treatment with 100 mM NaOH for 1 hour at 37°C in the case of di-acylglycerol- based anchors or alternatively by addition of 48% hydrofluoric acid.
  • Solvent extraction can be performed by treating each ml of membranes with 6.9 ml of a mixture of chloroform and methanol (1:1), this being an extraction in chloroform : methanol : water (10:10:3 v/v/v).
  • the insoluble ma ⁇ terial is centrifuged at 4,000 g for 10 minutes and the supernatant dried under a 2 stream. This material is then re- suspended in 100 microlitres of water-saturated 1-butanol and the salts removed by addition of 50 microlitres of water. The aqueous phase is again re-extracted with 100 microlitres of water-saturated 1-butanol. The same procedure is still re ⁇ peated for a third time and the pooled organic phases washed twice with 50 microlitres of water-saturated 1-butanol and then dried under N 2 .
  • a further specific embodiment of this process of re ⁇ leasing protein or its precursor obtained in the step c) re ⁇ quires treatment with neutral detergents such as n-octylglucopyranoside.
  • neutral detergents such as n-octylglucopyranoside.
  • the mem ⁇ branes containing the product are extracted with 0.5% of the detergent in PBS and centrifuged at 100,000 g for 1 hour at 4°C.
  • Still another specific embodiment of this process of releasing the protein or its precursor obtained in step c) consists of co-expressing a PI- or GPI- specific phospholipase in the same microorganism.
  • GPI glycosylphosphatidylinositol
  • said eukaryotic microorganism is genetically modified Saccharomyces cerevisiae.
  • Other eukaryotic microorganisms that are also contemplated here are Dictyostelium discoideum, trypanosomes and other yeasts, such as Pichia pastoris and Hansenula polymorpha.
  • said eukaryotic microorganism is Saccharomyces cerevisiae genet ⁇ ically modified so as not to produce GPI-anchored endogenous proteins.
  • said eukaryotic microorganism is a Saccharomyces cerevisiae genet ⁇ ically modified so as not to produce the Gasl endogenous pro ⁇ tein.
  • said recombinant protein is human insulin.
  • said recombinant protein is Mycobacterium leprae 18kDa.
  • Saccharomyces cerevisiae cell used lacks the capacity of producing the Gasl endogenous protein.
  • yeast cell characterized by being genetically modified so as to express a GPI-anchored recombinant protein.
  • this yeast cell is Saccharomyces cerevisiae. In still a more specific embod ⁇ iment, this yeast cell is characterized by not expressing the Gasl endogenous protein.
  • this yeast cell is characterized by the capacity of raising the levels of GPI biosynthesis or of producing GPI with determined proper ⁇ ties.
  • this yeast cell can be characterized by the fact that said recombinant protein is human insulin or Mycobacterium leprae 18kDa antigen.
  • nucleotide sequence characterized by coding for a recombinant protein or its precursor susceptible of being anchored by GPI.
  • an object of this invention is to provide a nucleotide sequence characterized by coding for: (i) the C-terminal moiety of the Gasl protein of
  • this nucleotide sequence can be characterized in that said protein is human insulin or in that such a protein is Mycobacterium leprae 18kDa antigen.
  • Compositions containing recombinant human insulin or Mycobacterium leprae 18kDa antigen are specifically contemplated here.
  • Coding sequence A sequence of DNA which, when transcribed and translated, results in the formation of a polypeptide.
  • Gene A region of the genome comprising the coding sequence and sequences responsible for the control of its ex ⁇ pression, that is to say, transcription and translation.
  • Secretion signal sequence A sequence of hydrophobic amino acids present in the amino-terminal moiety of a polypeptide, which has the function of directing this polypeptide to the endoplasmic reticulum and, consequently, in the absence of any other signal, to the outer environment.
  • a Sequence Signalizing the Addition of a GPI Anchor - A sequence of hydrophobic amino acids present in the carboxy-terminal moiety of a polypeptide signalizing the proteolytic cleavage in a given residue, to which the GPI an ⁇ chor will be added.
  • GPI Anchor - A glycolipid linked to the C-terminal amino acid of proteins intended for being anchored to the cel ⁇ lular lipidic membrane.
  • DNA coding for the C-terminal 30-50 residues of a protein that usually contains this anchor is ligated to DNA coding for the polypeptide in question. This fusion is made in the C-terminal moiety of said polypeptide.
  • the C-terminal 10 - 20 hydrophobic residues will be processed after translation and eliminated from the mature protein.
  • the construction of this fusion is accomplished by those skilled in the art by means of routine techniques. For instance, DNA coding for the region signalizing the addition of an anchor can be synthesized in vitro or isolated from a genomic DNA or cDNA.
  • the host for the expression of these anchored prote- ins is S. cerevisiae especially modified, non-coding for Gasl.
  • Gasl is the main or the only GPI-anchored protein which is susceptible to the action of GPI-specific phospholipase C.
  • the DNA coding for the product is introduced in these hosts by several techniques, for instance, transformation, electroporation, transfection etc.
  • the mere introduc ⁇ tion of the DNA coding for the product in these cells is not enough for them to start synthesizing it.
  • the DNA has to be coupled to a promoter sequence, which is a deoxynucleotide sequence specif ⁇ ically recognized by the transcription machinery of the cell in question. Once this sequence is recognized, the RNA polymerase starts to synthesize the messenger RNA using the DNA molecule in question as a template.
  • the promoter sequences are specific for each organism.
  • the coder DNA should be pre ⁇ ceded by a promoter sequence which is recognized by the S. cerevisiae RNA polymerase. Once the messenger RNA is synthe ⁇ sized, it can be translated into a protein molecule. It is also important for the translation signals to be present in the sequence introduced in the cell.
  • sequence coding for the protein that is to be obtained can be obtained by several cloning methods known to those versed in the art.
  • a DNA segment can be obtained di ⁇ rectly from the chromosomal DNA, can be synthesized from the messenger RNA or can be chemically synthesized.
  • This DNA should then be inserted downstream of a promoter sequence.
  • promoters can be used for ex ⁇ pression in S. cerevisiae and are in the public domain.
  • the promoter pGALl derived from the gene GAL1 or the promoter ADH2, derived from the gene coding for alcoholic dehydrogenase gene can be used.
  • the type of promoter is chosen depending on the sys ⁇ tem to be employed or on the process or on the product. There are constitutive promoters and, therefore, in these cases, the cell will produce the protein in question continuously, which can be favourable in cases of co-expression of GPI-specific phospholipase.
  • the cell produces the protein in question only when it is programmed for this purpose, and in such cases the so-called inducible promoters are used, that is to say, promoters that are specif ⁇ ically activated when their functioning is required, usually at the end of the fermentation process.
  • plasmids are generally circular DNA molecules, maintained independently in ⁇ side the cells.
  • plasmids are known and in the public domain. General characteristics of plasmids used as vectors are: a) being capable of autonomously replicating within the host; b) having a selectable marker, that is to say, a gene that is essential for the survival of the host.
  • Typical selectable genes are: a) for selection in bacteria, they should preferably impart resistance to antibiotics, for instance ampicillin or tetracycline; b) for selection in S. cerevisiae, they should complement auxotrophic defficiencies of the host, that is to say, they should contain genes which allow the synthesis of essential components absent from the culture medium.
  • Plasmids are designated by a “p” followed by capi- tal letters and/or numbers.
  • the starting plasmids described herein are commercially available, are publicly available without restrictions, or can be constructed from such avail ⁇ able plasmids in accordance with published procedures. In ad ⁇ dition, other equivalent plasmids are known to those skilled in the art.
  • “Digestion” of DNA refers to the catalytic cleavage of the DNA with an enzyme that only acts at certain locations of the DNA. These enzymes are called restriction enzymes, and the specificity sites are called restriction sites.
  • restriction enzymes are commercially available, and their re ⁇ action conditions, co-factors and other requirements are those supplied by the manufacturers. Restriction enzymes are desig ⁇ nated by three letters followed by a number. In general, about 1 microgram of plasmidial DNA or DNA fragment is used with about 2 units of the enzyme, in about 20 microliters of buffer solution, as specified by the manufacturer. Incubation pro ⁇ ceeds for about 1 hour at 37°C, or as specified by the man ⁇ ufacturer.
  • the digested DNA is recovered from the aqueous phase by precipitation with ethanol.
  • the plasmidial DNA can be dephosphorylated by treatment with the bacterial alkaline phosphatase enzyme, which removes the ter ⁇ minal 5' phosphates, preventing the circularization of the plasmid during the reaction with the enzyme ligase T4, which would prevent the insertion of another DNA fragment in that restriction site. ⁇ .
  • “Filling” or “blunting” refers to the procedure by which the cohesive termini left by a restriction enzyme are filled with deoxynucleotides by the action of the DNA polymerase I enzyme (Klenow fragment), becoming blunt. The filling of the termini allows the linking of any fragment thus treated with another blunt-ended DNA.
  • the reaction consists of the incubation of the target DNA with a buffer ac- cording to the specification of the manufacturer, in the pres ⁇ ence of 8 units of DNA polymerase I (Klenow) and 250 microM of each of the four deoxinucleotides. The incubation proceeds for 30 minutes at 37°C, and is followed by extraction with phenol and chloroform, and precipitation with ethanol.
  • Isolation of DNA fragment refers to the separation of the products of a digestion with a restriction enzyme by electrophoresis in agarose gel, identification of the fragment of interest by comparing its migration with standards of known molecular weights, removal of the gel portion containing the fragment of interest and separation of the DNA from the gel, according to well-known techniques. For instance, see Sambrook et al., 1989) .
  • Ligation refers to the process of forming a phosphodiester bonds between two double-stranded DNA fragments (Sambrook).
  • the ligation reaction consists of the incubation of 0.5 microgram of the two DNA fragments in approximately equimolar amounts, in the presence of 10 units of the DNA T4 ligase enzyme, in the presence of a buffer as specified by the manufacturers.
  • Transformation refers to the method of introducing
  • the method of transforming E. coli is the one described by Mandel et al., 1970, J.Mol.Biol. 53,154.
  • the method of transforming S. cerevisiae is the one described by Ito et al., 1983, J. Bacteriol. 153; 163.
  • Preparation of DNA of the transformants refers to the method of isolating plasmidial DNA from microbial cul ⁇ tures.
  • the method employed for bacteria can be that of alkaline lysis in the presence of SDS, as described in Sambrook et al., 1989, Molecular Cloning, Laboratory Manual.
  • Olionucleotides are short polymers of deoxynucleotides, which are chemically synthesized by well-known methods.
  • “Western blots” or “immuno-blots” refer to the method of identifying proteins separated in SDS-acrylamide gel by the use of specific antibodies.
  • the cellular extracts or fractions thereof are applied to polyacrylamide denaturating gel (Laemmli, 1970, Nature 227:680) and subjected to electrophoresis.
  • the separated proteins are transferred to nitrocellulose filters and subsequently subjected to reaction with antiserum or specific monoclonal antibodies.
  • PCR Reaction refers to the enzymatic amplification of a double-stranded DNA chain starting from two oligonucleotides complementary to the two 5' ends of the tem ⁇ plate molecule.
  • the DNA to be amplified can be genomic DNA or DNA present in a plasmid.
  • the reaction uses the enzyme Taq polymerase and is carried out as specified by the manufac- turer, in a thermal cycle apparatus, for approximately 40 cy ⁇ cles.
  • Sequenase the DNA chain generated by the enzymatic method with the enzyme Sequenase, as specified by the manufacturer, and the DNA chains generated are sepa ⁇ rated in polyacrylamide-urea denaturating gel and visualized by autoradiography, as described in Sambrook et al., op.cit..
  • Nucleotides are designated by the standard letters, A being adenine, T thymine, C cytosine and G guanine.
  • Aminoacids are represented by the designations of a letter, wherein A is alanine, R is arginine, N is asparagine, D is aspartate, C is cysteine, Q is glutamine, E is glutamate, G is glycine, H is histidine, I is isoleucine, L is leucine, K is lysine, M is methionine, F is phenylalanine, P is proline, S is serine, T is treonine, W is tryptophan, Y is tyrosine, V is valine.
  • GPI extraction means the recovery of this glycoinositolphospholipid by using a series of organic solvent/aqueous extractions which selectively separate it from proteins, DNA, lipids and phospholipids.
  • the products of this extraction can be analysed using standard processes of thin layer chromatography or reversed phase thin layer chromatography. Occasionally it is also appropriate to fractionate the products on an Octyl-Sepharose column (Pharmacia), using appropriate gradients of 5-80% of 1-propanol.
  • FIG. 1 Scheme of the Precursor and of the GPI-anchored Final Product in S. cerevisiae, and of its Re ⁇ lease by Phospholipase.
  • Any protein "X" can be coupled to the N-terminal region of Gasl and to the C-terminal region of Gasl.
  • the post-translational processing during transport to the endoplasmic reticulum will allow the elimination of the N-terminal sequences of Gasl, through signal peptidase and the endopeptidase Kex2, which recognizes and cleaves in dibasic residues, and the coupling of the GPI anchor.
  • This polypeptide will remain anchored to the membrane. Through the action of phospholipase C, the anchor will be hydrolysed, and the polypeptide can be released from the membrane, with the simultaneous creation of the CRD epitope.
  • FIGS. 2A and 2B Strategy of Construction of Vec- tors for Expression of GPI-anchored Insulin (2A) and GPI-anchored 18kDa Protein (2B) in S. cerevisiae.
  • the plasmids of the series pBY constructed here are derived from YEp352, and are bifunctional, that is to say, they replicate and can be selected in both E.coli and S.cerevisiae.
  • the other plasmids are replicable only in E. coli and have served only for the initial obtention, through PCR or from oligonucleotides, of the several fragments of DNA that consti ⁇ tute the examples.
  • the scheme is self-explanatory, the arrows refer to the steps of cleavage by restriction enzyme, iso- lation of DNA fragment and its insertion in another plasmid.
  • FIG. 3 Sequence of the DNA fragment encoding a GPI-anchored insulin (Seq. ID No. 1). The complete nucleotide sequence of the construct present on plasmid pBY40, derived from GAS1 and insulin is shown, along with the amino acid se- quence of the expected product. In the 5' end, the GAS1- de ⁇ rived sequences start at nucleotide 16 and end at nucleotide 380, and in the 3' end, start at nucleotide 560 and end at nucleotide 1058.
  • the insulin-coding sequence starts at nucleotide 393, with a phenylalanine codon, of the B chain, and ends at nucleotide 551, with an asparagine codon of the A chain. Between the B and A chains of insulin, two basic resi ⁇ dues were included. The anchor attachment site is at the asparagine residue coded at nucletotide position 649.
  • Figure 4 Sequence of the DNA fragment encoding a
  • GPI-anchored 18kDa protein (Seq. ID No. 2).
  • the GAS1 5' sequence is identical to that present on plasmid pBY40, shown in Figure 3.
  • the remaining sequence is derived from the 3' end of the GAS1 gene and is identical to that shown in Figure 3.
  • FIG. 5 Expression of GPI-anchored Human Insulin in Yeast.
  • Colonies of yeast bearing the plasmid pBY40, which codes for GPI-anchored insulin were grown in a solid medium and transferred, in duplicate, to nitrocellulose filters.
  • colonies of yeast bearing only the vector YEP352 (here called empty RH273-1A) and colonies bearing a plasmid coding for nomally anchored protein Gasl were also included.
  • the filters were treated with sodium hydroxide in order to permeabilize the wall of the yeast.
  • A) the filter was treated with T. brucei phospholipase C.
  • B) the filter was not treated. This was followed by incubation with anti-CRD antibody and visualization of the reaction with protein A marked with iodine-125 after autoradiography.
  • FIG. 6 Expression of the 18kDa Protein in An ⁇ chored Form. Extracts of yeast cells bearing the plasmid pBY48 were prepared by stirring with glass beads. The total extract was subjected to electrophoresis in polyacrylamide gel, in duplicate, and then to immuno-blot. The filter shown in A) was incubated with monoclonal antibody against the 18kDa protein. In B), the filter was treated with T. brucei phospholipase C and incubated with anti-CRD antibody.
  • line 1 purified 18kDa protein was applied; in line 2, cellular extract treated with endoglycosidase H; in line 3, extracts of cells lacking the plasmid, treated with endoglycosidase H; in lines 4 and 5, extracts as in 2 and 3 but without the treatment with endoglycosidase H.
  • line 1 contains T. brucei mfVSG; line 2, extract of empty strain; line 3, extract of strain bearing plasmid with the gene GAS1; line 4, extract of empty strain; line 5, extract of strain expressing anchored 18kDa protein (arrow).
  • Figure 7 Solubilization of Anchored Protein by
  • TX-114 Treatment with phospholipase C.
  • the solubilization can be monitored by phase separation in Triton X-114, followed by the detection of the product with anti-CRD.
  • a sample of extract of wild type S. cerevisiae was treated with B. thuringiensis PLC (lanes 1) or T. brucei PLC (lanes 2) at 30°C for 30 min ⁇ utes.
  • the concentration of TX-114 was increased to 2% and phase separation was induced by rais ⁇ ing the temperature.
  • Duplicates of each phase were subjected to SDS-PAGE, one of them being treated with anti-Gasl serum (Panel A) and the other with anti-CRD (Panel B).
  • the detection of the bound antibody was made with protein A marked with iodine-125, followed by autoradiography.
  • the detergent and aqueous phases are indicated by D and A, respectively.
  • E. coli strains used for the propagation and amplification of the plasmids de- scribed herein were DH5 (Hanahan, 1983, J. Mol. Biol. 166:557).
  • the S. cerevisiae strain can be RH273-1A, as de ⁇ scribed in Nuoffer et al; 1991, Mol. Cell. Biol.
  • Example 1 Construction of the Vector for Ex ⁇ pression of Anchored Proteins.
  • Any plasmid capable of being maintained stable in S. cerevisiae cells and having a marker for selection in these cells can be used as a basic vector, as for instance, those containing the gene LEU2 or URA3 for complementation of auxotrophic markers, and containing se ⁇ quences capable of mediating their replication, as derived from "ars" (autonomous replicating sequences) or from the endogenous plasmid 2 micron. They can still contain centromeric sequences that allow the plasmid to be maintained in a low number of copies, in a relatively stable manner.
  • plasmid YEP352 (Hill et al., 1986, Yeast 2:163), which contains the gene URA3, and a replication sequence derived from 2 micron so as to mantain it in a high number of copies and, thus, to increase the amount of the recombinant product.
  • a fragment of DNA was inserted which was obtained by a PCR reaction from the cloned GAS1 gene (Nuoffer et al., 1991, Mol. Cell. Biol. 11:27). This fragment will contain the promoter as well as the amino- terminal sequence of GAS1, which will allow the transfer of the recombinant polypeptide to the endoplasmic reticulum.
  • This fragment can be obtained through PCR by using, as prim ⁇ ers, oligonucleotides complementary, for example, to the re ⁇ gion located around the position -250 with respect to the first codon, and to the region located around the position +100 with respect to the GAS1 first codon.
  • prim ⁇ ers oligonucleotides complementary, for example, to the re ⁇ gion located around the position -250 with respect to the first codon, and to the region located around the position +100 with respect to the GAS1 first codon.
  • 5'-ACGGGATCCGTTGGAGTAGAAAAACT-3' were used to obtain a frag ⁇ ment containing the promotor and amino-terminal sequence of the GAS1 gene, by PCR-amplification of the chromosomal DNA.
  • the 365 nucleotide fragment obtained contain sequences from 248 nucleotides upstream of the start site of translation of the GAS1 gene up to nucleotide +117 from the starting ATG.
  • the PCR product was blunt-ended cloned into M13, and one clone was chosen for sequencing to determine the correctness of the se- quence and for further use.
  • this fragment can be inserted in the vector YEp352 so as to contain, downstream of the GAS1 sequence, a polylinker in order to allow the easy cloning of genes coding for proteins the expression of which is desired. It is convenient to sequence the obtained clone obtained in order to be sure that the sequence is correct.
  • this plasmid one can still insert a DNA fragment derived from the GAS1 gene by amplification through PCR, coding for the Gasl protein C terminal sequence and further containing the signal of termination of transcription of the same gene.
  • This fragment can be obtained, for instance, by using a pair of primers complementary to the region close to nucleotide -180 with respect to the GASl-terminating codon, and to the region close to nucleotide +300 with respect to the GASl-terminating codon. In this way, the presence, in this fragment, of the sequence which determines the anchor addition, as well as of sequences of transcription termination and of poly-A tail ad ⁇ dition in the message, is ensured.
  • the carboxyl sequence of the GAS1 gene containing the anchor ad ⁇ dition site, was obtained by PCR amplification with the oligonucleotides 5'-ACGGTCGACTCTTCTTCCAAGTCTAA-3' and 5'-CCCCAAGCTTGCTGATATTATGGAGAA-3' .
  • the product was blunt-ended cloned initially into BlueScript, for sequencing.
  • the ampli ⁇ fied 495 nucleotide fragment encodes the last 61 amino acids of GAS1, plus 313 nucleotides of the 3' non-coding region of GASl.
  • the insulin-encoding sequence which can be easily derived according to the codon usage fre ⁇ quency for yeast, starting from the known amino acid sequence, can be obtained in several ways, as for instance, through the synthesis of two oligonucleotides so that the nucleotides in the 3' region of one will be complementary to the 3' sequence of the other, in an approximate extent, for instance, of about 20 residues.
  • the treatment is effected with a DNA polymerase in order to obtain a double-stranded DNA, which can then be ligated to the previously described vector, in a site suitable for obtaining a fusion with the amino- and carboxy-terminal moieties of Gasl.
  • the insulin-coding se ⁇ quence was obtained by the use of two oligonucleotides with the following sequences: 5*-ACGGGATCCAAGAGATTTGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCCC TGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCGAAG-3' and
  • the resulting plasmid, pBY40 contains the necessary information for the synthesis of a GPI-anchored insulin, in yeast.
  • the DNA sequence of this fusion and the amino acid sequence of the resulting protein are given in Fig ⁇ ure 3 (Seq. ID N° 1).
  • leprae 18 kDa antigen can be obtained by amplification through PCR having as template the cloned gene (Booth et al., 1988, J. Immunol. 140 : 597).
  • the optically synthesized frag- ment will contain restriction sites for ligation to the vector constructed as described in Example 1 ( Figure 2B), so as to allow the correct phase fusion of this sequence to the se ⁇ quences derived from GASl.
  • sequence encoding the 18kDa protein of M. leprae was obtained by PCR amplifi ⁇ cation using as primers the oligonucleotides 5'-TGCTCTAGACGTACTGACCCGTTCCG-3' and
  • a Sall-Hindlll fragment containing the GASl C-terminal fragment, present on plasmid pC(Bl) was ligated to the Sall-Hindlll sites of plasmid pBY43, forming plasmid pBY48, which is capable of encoding a GPI-anchored 18kD pro ⁇ tein in yeast.
  • the DNA sequence of this construct and the cor ⁇ responding amino acid sequence of the fusion are given in Figure 4 (Seq.
  • Example 4 Obtention of Yeast Transformed with the above Plasmids.
  • the plasmids obtained in Examples 2 and 3 can be introduced in strains of yeast by conventional methods, such as transformation by lithium acetate or transformation of spheroplasts (Guide to Yeast Genetics and Molecular Biology, Guthrie & Fink, Eds., 1991, Academic Press, Inc.).
  • the strain to be used can be preferably RH273-1A, since it lacks the Gasl protein.
  • Transformants should be selected in a minimum medium through selection by complementation of auxotrophic markers, in this case growth in the absence of uracil.
  • the strain constructed to express GPI-anchored insulin is called RH273-lA/pBY40, and the strain constructed to express GPI-anchored 18kDa protein is called RH273-lA/pBY48.
  • Strain RH273-lA/pBY40 constructed as described in Example 4, can be grown in isolated colonies, in ⁇ itially in a selective medium, and thereafter replicated to a rich medium. The cells can be transferred to nitrocellulose membranes, lysed, treated with phospholipase C obtained from Trypanosoma brucei, and with anti-CRD antiibody. The presence of CRD epitope can be visualized through the incubation of this filter with protein A coupled to iodine-125, as described in Cardoso de Almeida & Turner, 1983, op.cit. (figure 5).
  • GPI-Anchored 18kDa protein Similarly as described in Example 5, the expression of anchored 18 kDa protein in RH273-lA/pBY48 cells can be detected by using the anti-CRD antibody. Alterna ⁇ tively, the anchored 18 kDa protein can be easily visualized in immuno-blots from SDA-PAGE of cellular extracts (figure 6). Both monoclonal L5 and anti-CRD antibodies recognize the recombinant product, which is highly glycosylated, as shown by the high molecular weight of the product. The glycosylation occurs in residues derived from Gasl, and can be eliminated by the construction of a fusion wherein the residues susceptible of glycosylation are removed.
  • Example 7 Release with GPI-specific phospholipase.
  • the GPI-anchored proteins can be solubilized by treating the cells or cellular extracts with phospholipase specific for GPI structures, as shown in figure 7.
  • Example 8 utilization of GPI as a vaccine or immune system modulator.
  • the GPI moieties produced by engineered organism can be purified and analysed according to standard procedures such as solvent selective extraction and fractionation by thin layer chromatography or reverse phase thin layer chromatography or by cromatography on Octyl- Sepharose. These glycolipids, or part of them, chemically or enzymatically treated, are then prepared with appropriate adjuvants and administered as vaccines or immune system modulators. Their effects can be followed by classical methods of humoral and cellular immunology such as titrating levels of antibodies with certain specificities or by analysing the pro ⁇ file of lymphocytes which can be stimulated by the injected antigen.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention se rapporte, entre autres, à un procédé de production d'une protéine recombinée ou de son précurseur dans les cellules de micro-organismes eucaryotes modifiés génétiquement, et notamment de Saccharomyces cerevisiae, consistant à réaliser la biosynthèse de ladite protéine ou dudit précurseur à l'aide desdites cellules, et à lier le glycosylphosphatidylinositol (GPI) endogène à l'acide aminé C-terminal de la protéine ou du précurseur ainsi obtenu(e), ce qui provoque l'ancrage par GPI de ladite protéine ou dudit précurseur aux membranes dudit micro-organisme; puis à libérer de manière sélective ladite protéine ou ledit précurseur selon des procédés exploitant les propriétés intrinsèques apportées par la présence du GPI. On peut également récupérer le GPI produit par ce procédé. Les protéines recombinées que l'on peut obtenir selon ce procédé sont notamment l'insuline humaine et l'antigène de 18kDa de Mycobacterium leprae.
PCT/BR1995/000010 1994-02-17 1995-02-16 Production de proteines recombinees ancrees par glycosylphosphatidylinositol WO1995022614A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
BRPI9400600-8 1994-02-17
BR9400600A BR9400600A (pt) 1994-02-17 1994-02-17 Processos para produção de uma protéina recombinante e/ou de glicosilfosfatidilinositol (GPI) em células de microorganismos eucariontes e para a obtenção de leveduras de S. cerevisae; célula de levedura sequência de nucleotídios; meio de cultura; medicamento ou vacina; e produto dos ditos processos

Publications (1)

Publication Number Publication Date
WO1995022614A1 true WO1995022614A1 (fr) 1995-08-24

Family

ID=4058332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/BR1995/000010 WO1995022614A1 (fr) 1994-02-17 1995-02-16 Production de proteines recombinees ancrees par glycosylphosphatidylinositol

Country Status (2)

Country Link
BR (1) BR9400600A (fr)
WO (1) WO1995022614A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0704527A2 (fr) * 1994-08-05 1996-04-03 PLIVA, farmaceutska, kemijska, prehrambena i kozmeticka industrija dionicko drustvo Séquences d'ADN codants les précurseurs d'insuline et procédé pour la préparation d'insuline
NL1001348C2 (en) * 1995-04-25 1996-10-28 Rmf Dictagene Sa Polypeptide comprising glycosyl-phosphatidyl:inositol structure
WO2005093074A1 (fr) * 2004-03-24 2005-10-06 Domantis Limited Sequence de tete universelle gas1
US7268112B2 (en) 2000-03-24 2007-09-11 Genetech, Inc. Use of insulin for the treatment of cartilaginous disorders
WO2007128766A1 (fr) * 2006-05-10 2007-11-15 Novozymes A/S Procedes d'extraction de composants d'une culture de cellules de levure
US7312062B2 (en) 1998-11-27 2007-12-25 Novozymes A/S Lipolytic enzyme variants
EP2068914A2 (fr) * 2007-02-09 2009-06-17 MedImmune, LLC Presentation d'un banque d'anticorps par des membranes plasmatiques de cellules de levure
US8323917B2 (en) * 2002-11-22 2012-12-04 National Institute Of Advanced Industrial Science And Technology Method of screening for compounds that inhibit the enzymatic activity of GWT1 gene product

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0055885A2 (fr) * 1980-12-29 1982-07-14 Eli Lilly And Company Préparations insuliniques
WO1989001041A1 (fr) * 1987-08-06 1989-02-09 Genentech, Inc. Acide nucleique et procedes de synthese de nouveaux polypeptides de fusion ayant un domaine d'ancrage phospholipidique
WO1989005825A1 (fr) * 1987-12-22 1989-06-29 Immunex Corporation EXPRESSION D'ANTIGENES DE PROTEINES 18/16,6 et 15,2 kD RECOMBINANTES DE MYCOBACTERIUM LEPRAE
WO1990012099A1 (fr) * 1989-04-10 1990-10-18 Biogen, Inc. Liaison de proteines par phosphatidylinositole
WO1992001715A1 (fr) * 1990-07-19 1992-02-06 The Board Of Trustees Of The Leland Stanford Junior University Proteines dimeres solubles de surface cellulaire
EP0477739A2 (fr) * 1990-09-27 1992-04-01 F. Hoffmann-La Roche Ag Phospholipase D spécifique pour la glycosyl-phosphatidylinositol
WO1993020801A1 (fr) * 1992-04-10 1993-10-28 Hisamitsu Pharmaceutical Co., Inc. Composition de liposomes
WO1994001463A1 (fr) * 1992-07-10 1994-01-20 University Of British Columbia UTILISATION DE p97 ET DES PROTEINES LIANT LE FER COMME AGENTS DIAGNOSTIQUES ET THERAPEUTIQUES

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0055885A2 (fr) * 1980-12-29 1982-07-14 Eli Lilly And Company Préparations insuliniques
WO1989001041A1 (fr) * 1987-08-06 1989-02-09 Genentech, Inc. Acide nucleique et procedes de synthese de nouveaux polypeptides de fusion ayant un domaine d'ancrage phospholipidique
WO1989005825A1 (fr) * 1987-12-22 1989-06-29 Immunex Corporation EXPRESSION D'ANTIGENES DE PROTEINES 18/16,6 et 15,2 kD RECOMBINANTES DE MYCOBACTERIUM LEPRAE
WO1990012099A1 (fr) * 1989-04-10 1990-10-18 Biogen, Inc. Liaison de proteines par phosphatidylinositole
WO1992001715A1 (fr) * 1990-07-19 1992-02-06 The Board Of Trustees Of The Leland Stanford Junior University Proteines dimeres solubles de surface cellulaire
EP0477739A2 (fr) * 1990-09-27 1992-04-01 F. Hoffmann-La Roche Ag Phospholipase D spécifique pour la glycosyl-phosphatidylinositol
WO1993020801A1 (fr) * 1992-04-10 1993-10-28 Hisamitsu Pharmaceutical Co., Inc. Composition de liposomes
WO1994001463A1 (fr) * 1992-07-10 1994-01-20 University Of British Columbia UTILISATION DE p97 ET DES PROTEINES LIANT LE FER COMME AGENTS DIAGNOSTIQUES ET THERAPEUTIQUES

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
AMORIM, A. G. ET AL: "Expression of Mycobacterium leprae 18-kDa antigen in yeast in a GPI -anchored form", BRAZ. J. MED. BIOL. RES. (1994), 27(3), 623-6 CODEN: BJMRDK;ISSN: 0100-879X, vol. 27, no. 3, pages 623 - 626 *
DATABASE WPI Section Ch Week 9344, Derwent World Patents Index; Class B05, AN 93-351329, BOOTH, ROGER, J. ET AL.: "Liposome composition containing phosphatidyl inositol and optionally phosphatidyl serine." *
SUSANNE E. ZAMZE ET AL.: "Characterization of thr cross-reacting determinant (CRD) of the glycosyl-phosphatidylinositol membrane anchor of Trypanosoma brucei variant surface glycoprotein", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 176, no. 3, pages 527 - 534 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0704527A2 (fr) * 1994-08-05 1996-04-03 PLIVA, farmaceutska, kemijska, prehrambena i kozmeticka industrija dionicko drustvo Séquences d'ADN codants les précurseurs d'insuline et procédé pour la préparation d'insuline
EP0704527A3 (fr) * 1994-08-05 1997-08-27 Pliva Pharm & Chem Works Séquences d'ADN codants les précurseurs d'insuline et procédé pour la préparation d'insuline
NL1001348C2 (en) * 1995-04-25 1996-10-28 Rmf Dictagene Sa Polypeptide comprising glycosyl-phosphatidyl:inositol structure
WO1996034105A1 (fr) * 1995-04-25 1996-10-31 Rmf Dictagene S.A. Polypeptides modifies pour une immunogenicite accrue
US6113917A (en) * 1995-04-25 2000-09-05 Rmf Dictagene S.A. Modified polypeptides for enhanced immunogenicity
US7312062B2 (en) 1998-11-27 2007-12-25 Novozymes A/S Lipolytic enzyme variants
US8679774B2 (en) 1998-11-27 2014-03-25 Novozymes A/S Lipolytic enzyme variants
US7851176B2 (en) 1998-11-27 2010-12-14 Novozymes A/S Lipolytic enzyme variants
US7632669B2 (en) 1998-11-27 2009-12-15 Novozymes A/S Lipolytic enzyme variants
US7268112B2 (en) 2000-03-24 2007-09-11 Genetech, Inc. Use of insulin for the treatment of cartilaginous disorders
US8323917B2 (en) * 2002-11-22 2012-12-04 National Institute Of Advanced Industrial Science And Technology Method of screening for compounds that inhibit the enzymatic activity of GWT1 gene product
US7846721B2 (en) 2004-03-24 2010-12-07 Domantis Limited GAS1 universal leader
EP2172553A1 (fr) * 2004-03-24 2010-04-07 Domantis Limited Sequence de tete universelle gas1
WO2005093074A1 (fr) * 2004-03-24 2005-10-06 Domantis Limited Sequence de tete universelle gas1
AU2007247146B2 (en) * 2006-05-10 2013-01-31 Novozymes A/S Method for extracting components from a yeast cell culture
WO2007128766A1 (fr) * 2006-05-10 2007-11-15 Novozymes A/S Procedes d'extraction de composants d'une culture de cellules de levure
US9309549B2 (en) 2006-05-10 2016-04-12 Novozymes A/S Method for extracting components from a yeast cell culture
EP2068914A2 (fr) * 2007-02-09 2009-06-17 MedImmune, LLC Presentation d'un banque d'anticorps par des membranes plasmatiques de cellules de levure
EP2068914A4 (fr) * 2007-02-09 2011-07-20 Medimmune Llc Presentation d'un banque d'anticorps par des membranes plasmatiques de cellules de levure

Also Published As

Publication number Publication date
BR9400600A (pt) 1995-10-24

Similar Documents

Publication Publication Date Title
JP2686090B2 (ja) 新規融合蛋白質およびその精製方法
Garcia et al. Targeting of the hepatitis B virus precore protein to the endoplasmic reticulum membrane: after signal peptide cleavage translocation can be aborted and the product released into the cytoplasm.
EP0196056B1 (fr) Expression de gènes fusionnés pour la production de protéines
EP0511747A1 (fr) Polypeptide hybride contenant une polypeptide de liaison avec avidin
JPH02500876A (ja) 組換えポリペプチドの製品およびその製造、単離および精製方法
IE53311B1 (en) Deoxynucleotide linkers to be attached to a cloned dna coding sequence
JPH09504166A (ja) リーダー配列なしに細胞質外に輸送される融合ポリペプチドの発現
EP0848756A1 (fr) Materiels et procedes relatifs a la fixation et a la presentation de substances sur des surfaces cellulaires
EP1220933B1 (fr) Purification de proteines recombinees fixees sur des epitopes multiples
US20020123108A1 (en) Fusion proteins between antigenic amino acid sequences and beta-2- microglobulin
JPS61500662A (ja) ネコ科白血病ウイルスワクチン
Pohlner et al. Sequence–specific cleave of protein fusion using a recombinant Neisseria type 2 IgA protease
EP0510018A1 (fr) Peptide a signal lipoproteique fusionne avec des polypeptides antigeniques
WO1995022614A1 (fr) Production de proteines recombinees ancrees par glycosylphosphatidylinositol
US6770631B1 (en) Non-identical genes and their application in improved molecular adjuvants
JP4180112B2 (ja) 酵母細胞におけるｎ末端を伸長されたタンパクの発現のためのベクター
JPH0515380A (ja) ベクター
Luschnig et al. The gag homologue of retrotransposon Ty1 assembles into spherical particles in Escherichia coli
JPH10508479A (ja) 天然疎水性ペプチドアナログとしての組換えペプチドの産生
KR0161656B1 (ko) 글루카곤의 생산방법
AU779939B2 (en) Compartmentalization of recombinant polypeptides in host cells
Bell et al. The N-terminus of PE2 in Sindbis virus-infected cells
Moulard et al. Kex2p: a model for cellular endoprotease processing human immunodeficiency virus type 1 envelope glycoprotein precursor
JPS62187495A (ja) 新規ｄｎａおよびポリペプチド
JPH01503514A (ja) 免疫原性ポリペプチドとその精製法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): BR CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA