WO1995017198A1 - A novel tumor suppressor gene - Google Patents
A novel tumor suppressor gene Download PDFInfo
- Publication number
- WO1995017198A1 WO1995017198A1 PCT/US1994/014813 US9414813W WO9517198A1 WO 1995017198 A1 WO1995017198 A1 WO 1995017198A1 US 9414813 W US9414813 W US 9414813W WO 9517198 A1 WO9517198 A1 WO 9517198A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- nuc
- vector
- cells
- cell
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4736—Retinoblastoma protein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention is in the field of tumor suppressor genes (anti-oncogenes) and relates in general to products and methods for practicing broad-spectrum tumor suppressor gene therapy of various human cancers.
- the invention relates to methods for treating tumor cells (1) administering vectors comprising a nucleic acid sequence coding for the novel protein referred to herein as H-NUC or (2) administering an effective amount of a protein coded for by the nucleic acid sequence.
- Cancers and tumors are the second most prevalent cause of death in the United States, causing 450,000 deaths per year. One in three Americans will develop cancer, and one in five will die of cancer (Scientific American Medicine, part 12, I, 1, section dated 1987) . While substantial progress has been made in identifying some of the likely environmental and hereditary causes of cancer, the statistics for the cancer death rate indicates a need for substantial improvement in the therapy for cancer and related diseases and disorder.
- cancer genes i.e., genes that have been implicated in the etiology of cancer, have been identified in connection with hereditary forms of cancer and in a large number of well-studied tumor cells. Study of cancer genes has helped provide some understanding of the process of tumorigenesis. While a great deal more remains to be learned about cancer genes, the presently known cancer genes serve as useful models for understanding tumorigenesis .
- Cancer genes are broadly classified into “oncogenes” which, when activated, promote tumorigenesis, and “tumor suppressor genes” which, when damaged, fail to suppress tumorigenesis. While these classifications provide a useful method for conceptualizing tumorigenesis, it is also possible that a particular gene may play differing roles depending upon the particular allelic form of that gene, its regulatory elements, the genetic background and the tissue environment in which it is operating.
- the first class consists of mutated or otherwise aberrant alleles of normal cellular genes that are involved in the control of cellular growth or replication. These genes are the cellular protooncogenes. When mutated, they can encode new cellular functions that disrupt normal cellular growth and replication. The consequence of these changes is the production of dominantly expressed tumor phenotypes.
- tumor-suppressor genes sometimes referred to as antioncogenes, growth-suppressor, or cancer-suppressor genes.
- antioncogenes growth-suppressor
- cancer-suppressor genes have been identified in several human cancers.
- The-tumor- suppressor genes involved in the pathogenesis of retinoblastoma (rb) , breast, colonic, and other carcinomas (p53) , Wilm's tumors (wt) and colonic carcinoma (dec) have been identified and cloned.
- RB retinoblastoma gene
- the retinoblastoma gene is the prototype tumor suppressor. Mutation of the gene has been found in a variety of human tumors (Bookstein and Lee, Crit. Rev. Onco ⁇ .. 2:211-227 (1991); Goodrich and Lee, Biochim. Biophys. Acta.. 1155:43-61 (1993); Riley et al.. Annu. Rev. Cell Biol. , 10:1-29 (1994)) . Reintroduction of a single copy of normal RB into tumor cells suppresses their ability to form tumors in nude mice (Huang et al . , Science. 242:1563-1566 (1988) ; Sumegi et al.. Cell Growth Differ..
- the RB gene encodes a nuclear protein which is phosphorylated on both serine and threonine residues in a cell cycle dependent manner (Lee et al . f Nature , 329:642- 645 (1987) ; Buchkovich et al .. Call, 58:1097-105 (1989) ; Chen et al.. Cell. 58:1193-1198 (1989); DeCaprio et al. r Cell. 58:1085-1095 (1989)) .
- Rb exists in a hypophosphorylated state ( Goodrich et al .. Cell.
- Hypophosphorylated Rb also exists in the GO phase. It appears to play a critical role in maintaining cells in this quiescent phase, where they wait to respond to external signals and make decisions to enter the cell cycle or to differentiate
- Rb is hyperphosphorylated, probably by members of the CDK family of kinases (Lees et al .. EMBO J.. 10:4279-4290 (1991); Lin et al.. EMBO J.. 10:857-864 (1991) ; Hu et al , , M ⁇ l . Cell, Biol .. 12:971-980 (1992)) . Phosphorylation of certain residues of Rb seems to allow commitment of the cell to proliferation.
- the phosphorylation pattern of Rb protein is correlated with its function in growth inhibition, and therefore a hypothesis currently accepted is that phosphorylation negatively regulates the growth suppressing function of the protein (Hollingsworth et al .. Cuur. Opin. Genet. Dev.. 3:55-62 (1993) ; Sherr, C. J. , Trend Cell Biol.. 4:15-18 (1994)) .
- Dephosphorylation of the Rb protein occurs in mid-M phase, and results in reactivation of the protein prior to the next cell cycle.
- Rb The molecular mechanisms by which Rb participates in these cellular activities has not been completely elucidated. A current model holds that Rb interacts with many different cellular proteins and may execute its functions through these complexes. If the function of Rb protein is to maintain cells at G0/G1 stage, Rb must "corral" and inactivate other proteins which are active and essential for entering Gl progression (Lee et al .. CSHSOB. LVI -211-217 (1991)) . This "corral" hypothesis is consistent with recent observations that an important growth-enhancing transcriptional factor, E2F-1, is tightly regulated by Rb in a negative fashion (Helin et al.. Cell. 70:337-350 (1992) ; Kaelin Cell.
- H-NUC The instantly disclosed protein, H-NUC, binds to the Rb protein and thus participation in the regulation of mitosis.
- the familial breast cancer gene, BRCA-1 has been mapped at chromosome 17 q21-22 by linkage analysis. It is not clear whether this gene would behave as a tumor suppressor or dominant oncogene.
- the gene involved in human familial cancer syndrome such as Li- Fraumeni syndrome, p53, apparently acts as the classical tumor suppressor; similarly, the loss of RB gene is associated with hereditary retinoblastoma (Knudson, 1993, supra) •
- This invention is based on the discovery of a nucleic acid molecule encoding a novel protein (H-NUC) having tumor suppression capability.
- the nucleic acid molecule has been mapped to the q21-22 region of chromosome 17.
- the properties of H-NUC (amino acid sequence derived from the full length cDNA; ability to bind DNA and activate transcription; rearrangement or loss of the coding sequence in some breast tumor cell lines) are all consistent with the identity of H-NUC as a nuclear protein and tumor suppressor protein.
- the newly disclosed full length cDNA encodes a novel 824 amino acid protein.
- the novel protein contains ten 34-amino acid repeats characteristic of the TPR (tetratrico peptide) protein family.
- the present invention is also directed to the administration of wild-type H-NUC tumor suppressor gene or protein to suppress, eradicate or reverse the neoplastic phenotype in established cancer cells having no endogenous wild-type H-NUC protein.
- This invention demonstrated for the first time administration of wild-type H-NUC gene to established cancer cells to suppress or reverse the neoplastic phenotype or properties of established human cancer cells lacking wild-type H-NUC protein.
- This suppression of the neoplastic phenotype in turn suppressed or eradicated the abnormal mass of such cancer cells, i.e. tumors, which in turn can reduce the burden of such tumors on the animal which in turn can increase the survival of the treated animals.
- neoplastic properties which are monitored and reversed included the morphology, growth, and most significantly, the tumorigenicity of cancer cells lacking the normal H-NUC protein.
- the "reduction of the burden of tumor cells” in an animal is a consequence of the “suppression of the neoplastic phenotype” following the administration of wild-type H-NUC tumor suppressor gene.
- “Neoplastic phenotype” is understood to refer to the phenotypic changes in cellular characteristics such as morphology, growth rate
- the invention provides H-NUC encoding vectors and H-NUC proteins for use in treatment of tumors or cancers, and methods of preparing H-NUC proteins and vectors suitable for use in methods of treatment.
- the invention also provides methods of treatment for mammals such as humans, as well as methods of treating abnormally proliferating cells, such as cancer or tumor cells or suppressing the neoplastic phenotype.
- abnormally proliferating cells such as cancer or tumor cells or suppressing the neoplastic phenotype.
- the invention contemplates treating abnormally proliferating cells, or mammals having a disease characterized by abnormally proliferating cells by any suitable method known to permit a host cells compatible-H- NUC encoding vector or a H-NUC protein to enter the cells to be treated so that suppression of proliferation is achieved.
- the invention comprises a method of treating a disease characterized by abnormally proliferating cells, in a mammal, by administering an expression vector coding for H-NUC to the mammal having a disease characterized by abnormally proliferating cells, inserting the expression vector into the abnormally proliferating cells, and expressing H-NUC in the abnormally proliferating cells in an amount effective to suppress proliferation of those cells,
- the expression vector is inserted into the abnormally proliferating cells by viral infection or transduction, liposome-mediated transfection, polybrene-mediated transfection, CaP0 4 mediated transfection and electroporation. The treatment is repeated as needed.
- the invention comprises a method of treating abnormally proliferating cells of a mammal by inserting a H-NUC encoding expression vector into the abnormally proliferating cells and expressing H-NUC therein in amounts effective to suppress proliferation of those cells. The treatment is repeated as needed.
- the invention provides a DNA molecule able to suppress growth of an abnormally proliferating cell.
- the DNA molecule encodes an Rb binding protein comprising a subsequence having at least 60% homology with nine tetratricopeptide repeats at the-C- terminal end, provided that the DNA molecule does not also code for S. pombe yeast NUC 2, Aspergillas nidulans bimA and CDC27.
- An example of such an Rb binding protein is H- NUC protein having an amino acid sequence substantially according to SEQ ID NO. .
- the DNA molecule has the DNA sequence of SEQ ID NO. 1, and is expressed by an expression vector.
- the expression vector may be any host cell-compatible vector.
- the vector is preferably selected form the group consisting of a retroviral vector, an adenoviral vector and a herpesviral vector.
- the invention provides a H-NUC protein having an amino acid sequence substantially according to SEQ ID NO. and biologically active fragments thereof.
- the invention provides a method of producing a H-NUC protein by the steps of: inserting a compatible expression vector comprising a H-NUC encoding gene into a host cell and causing the host cell to express H-NUC protein.
- the invention comprises a method of treating abnormally proliferating cells of a mammal ex vivo by the steps of: removing a tissue sample in need of treatment from a mammal, the tissue sample comprising abnormally proliferating cells; contacting the tissue sample in need of treatment with an effective dose of an H-NUC encoding expression vector; expressing the H-NUC in the abnormally proliferating cells in amounts effective to suppress proliferation of the abnormally proliferating cells.
- the treatment is repeated as necessary; and the treated tissue sample is returned to the original or another mammal.
- the tissue treated ex vivo is blood or bone marrow tissue.
- the invention comprises a method of treating a disease characterized by abnormal cellular proliferation in a mammal by a process comprising the steps of administering H-NUC protein to a mammal having a disease characterized by abnormally proliferating cells, such that the H-NUC protein is inserted into the abnormally proliferating cells in amounts effective to suppress abnormal proliferation of the cells.
- the H-NUC protein is liposome encapsulated for insertion into cells to be treated. The treatment is repeated as necessary.
- oligonucleotide fragments capable of hybridizing with the
- oligonucleotides can contain as few as 5 nucleotides, while those consisting of about 20 to about 30 oligonucleotides being preferred.
- These oligonucleotides may optionally be labelled with radioisotopes (such as tritium, 32 phosphorus and 35 sulfur) , enzymes (e.g., alkaline phosphatase and horse radish peroxidase) , fluorescent compounds (for example, fluorescein, Ethidium, terbium chelate) or chemiluminescent compounds (such as the acridinium esters, isoluminol, and the like) .
- radioisotopes such as tritium, 32 phosphorus and 35 sulfur
- enzymes e.g., alkaline phosphatase and horse radish peroxidase
- fluorescent compounds for example, fluorescein, Ethidium, terbium chelate
- chemiluminescent compounds such as the acri
- oligonucleotides can be used with the instant oligonucleotides. They may be used in DNA probe assays in conventional formats, such as Southern and northern blotting. Descriptions of such conventional formats can be found, for example, in “Nucleic Acid Hybridisation - A Practical Approach", B. D. Hames and S. J. Higgins, Eds., IRL Press, Washington, D. C.,1985, herein incorporated by reference. Preferably these probes capable of hybridizing with the H-NUC gene under stringent conditions.
- the oligonucleotides can also be used as primers in polymerase chain reaction techniques, as those techniques are described in, for example, "PCR Technology", H.A. Ehrlich, Ed., Stockton Press, New York, 1989, and similar references.
- Figures IA and IB show that similar regions of RB are required for binding H-NUC and T antigen.
- Figure IA is a schematic of Gal4-RB fusions used to determine binding domains.
- the Gal4 DNA-binding domain (amino acids 1-147) is fused to various RB mutants.
- the T/ElA-binding domains of RB are shown as hatched boxes. Domains affected by mutation are depicted as spotted boxes.
- Figure IB shows detection of interactions between H-NUC and RB mutants in vivo. Y153 was cotransformed with the indicated panel of Gal4-RB mutants and with either the Gal4- (H-NUC) -expression clone (Gal4- (C-49) ) or YIpPTGlO.
- Chlorophenyl-red- ⁇ -D- galactopyranoside colorimetric assay quantitation of ⁇ -galactosidase activity was done in triplicate for each transformation as described by Durfee et al. , Genes Devel . 7:555-569 (1993) , incorporated herein by reference.
- Figures 2A and 2B show that H-NUC binds to unphosphorylated RB.
- Figure 2A shows GST and inframe GST fusions with cDNA encoding H-NUC (GST-491) and the amino- terminal 273 amino acids of SV40 T antigen (GST-T) were expressed in E. coli. GST and GST-fusions were bound to glutathione-sepharose beads and washed extensively. Samples were quantitated by Coomassie blue staining of-SDS- polyacrylamide gels, and equivalent protein amounts were used in each lane. Shown in Figure 2B are extracts made from WR2E3 cells that were mixed with bound samples for 30 minutes at room temperature.
- Figure 3 is the nucleotide (SEQ. I.D. NO.: 1) and predicted amino acid (SEQ. I.D. NO.: 2) sequences of the full length H-NUC cDNA and protein.
- Figures 4A and 4B show that the full length H-NUC encodes a member of the tetratricopeptide repeat (TPR) family of proteins.
- Figure 4A shows the location of the ten 34-residue polypeptide unit repeats in H-NUC,
- FIG. 4B is an alignment of the amino acid sequences of the 9 TPR unit repeats (1-9) in nuc2+,-H- NUC and bimA proteins. conserveed residues are boxed. TPR unit repeat 6 of all three proteins contains a glycine in position 6. Gly6 in repeat 6 of nuc2 is thought to be essential.
- Figures 5A and 5B show that C-terminal TPR repeats of H-NUC bind to the RB protein.
- Figure 5A is a schematic of Gal4-H-NUC fusions used to determine binding domains. The Gal4 transactivation domain is fused to various H-NUC deletion mutants.
- TPR unit repeats of-H- NUC are shown as cross-hatched boxes.
- Figure 5B shows detection of interactions between RB and H-NUC deletion mutants in vivo.
- Y153 was cotransformed with the indicated panel of Gal4-H-NUC mutants and with either the Gal4-RB2 or Gal4-H209.
- CPRG quantitation of b-galactosidase activity was done in triplicate for each transformation.
- Figures 6A and 6B show mutation at the essential glycine of amino acid residue 640 creates a temperature- sensitive H-NUC mutant that diminishes binding to RB at nonpermissive temperatures.
- Figure 6A details the amino acid substitution in the H-NUC (640D) .
- the essential glycine (G) (amino acid 540) of nuc2 was substituted with aspartic acid (D) in the temperature sensitive mutant.
- the glycine at 640 amino acid residue of H-NUC was changed into aspartic acid (D) .
- Figure 6B shows interactions between RB and H-NUC(640D) mutant at 37°C.
- Y153 was cotransformed with the Gal4-RB2 and with either Gal4-H-NUC or Gal4-H-NUC(640D) .
- the transformants were grown in liquid culture at 28°C for 24 hours.
- the overnight yeast cultures were diluted with fresh medium and grown at 37°C. Aliquots of yeast culture were removed at various time points to determine the yeast growth (OD660) and ⁇ - galactosidase activity. CPRG quantitation of ⁇ - galactosidase activity was done in triplicate for each transformation.
- Figures 7A and 7B show the production of antiserum against H-NUC and detection of H-NUC in human cell lines.
- Gst-491 fusion proteins were used to immunize mice.
- the preimmune serum (lane 1) , immune serum (lane 2) , immune serum preincubated with Gst protein (lane 3) and immune serum preincubated with Gst-491 protein (lane 4) were used for immunoprecipitation.
- S 35 - labelled cell lysate were prepared from K-562 cells. Equal amounts of cell lysate were used for immunoprecipitation. The resulting immunoprecipitates were separated on SDS- polyacrylamide gel electrophoresis.
- S 35 - labelled cell lysate were prepared from CV-1 cells. Equal amounts of cell lysate were used for immunoprecipitation by preimmune serum (lane 1) , or immune serum (lane 2 and 3) . The resulting immunoprecipitates were denatured by boiling in 200 ⁇ l of 2% SDS containing solution (lane 3) and diluted with 200 ⁇ l of NETN buffer. The immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis. A 90 KD protein as indicated by the arrow was specifically recognized by the immune serum.
- Figure 8 shows that H-NUC protein has DNA-binding activity.
- Protein lysate of K562 metabolically labelled with S 35 -methionine were passed through double-stranded calf thymus DNA-cellulose column and eluted with increasing concentrations of NaCl. The elutes were immunoprecipitated with either (A) mAb 11D7 to locate the RB protein or (B) with immune serum recognizes H-NUC to locate H-NUC. (C) Aliquots of elutes were also used to incubate with glutathione sepharose beads.
- Figure 9 shows that the gene encoding H-NUC is located on chromosome 17q21-22.
- Figures 10A and 10B are the results of Southern blotting analysis of breast tumor cell DNA with H-NUC as probe. DNA was extracted from cell lines and digested with EcoRI. The blots from the cell lines probed in Figure 10A are all normal. In Figure 10B, a homozygous deletion of the H-NUC gene was apparent in cell lines T47D and MB157. A heterozygous deletion of the gene appeared in cell lines MB231, BT0578-7 and BT549 is suggested by decreased hybridization to the 14 kbp EcoRI fragment.
- FIG 11 shows AC-H-NUC inhibits cell growth in T-47D breast tumor cells in vitro.
- the upper left shows MDA-MB-231 cells infected with ACN (MOI 10) for 3 days and stained with crystal violet.
- the upper right shows T-47D cells infected with ACN (MOI 10) .
- the lower left shows MDA-MB-231 cells infected with AC-H-NUC (MOI 10) .
- the lower right shows T-47D cells infected with AC-H-NUC.
- (+/-) indicates MDA-MB-231 cells are heterozygous for H- NUC.
- (-/-) indicates T-47D cells contain a homozygous deletion of H-NUC (ref. Lee, W.H.) .
- AC-H-NUC is a recombinant human adenovirus containing the H-NUC tumor suppressor gene under control of the human CMV promoter.
- ACN is the same recombinant human adenovirus vector without the H-NUC tumor suppressor gene.
- FIG. 12 shows AC-H-NUC suppresses T-47D tumor cell growth in vitro.
- T47-D (deleted for H-NUC) and MDA- MB-231 (heterozygous for H-NUC) breast cancer cells were plated in 96-well plates and treated with AC-H-NUC or ACN at infection multiplicities of 10 and 100 (quadruplicate) . Cells were permitted to grow for 5 days and 3 H-thymidine incorporated into cellular nucleic acid was used as a measure of proliferation. Data (mean+SD) for AC-H-NUC are plotted as a percent of the average proliferation of ACN control at the corresponding MOI .
- FIG. 13 shows AC-H-NUC suppresses T-47D tumor growth in nude mice.
- Approximately 10 7 cells were injected subcutaneously into the flanks of nude mice, each animal receiving ACN treated cells on one flank and AC-H-NUC cells on the contralateral flank. Tumor sizes were measured with calipers, and estimates of tumor volume were calculated assuming a spherical geometry. Average ( ⁇ SD) tumor volumes are plotted for tumors resulting from ACN and AC-cBTSG cells. Average ( ⁇ SD) volumes of bilateral tumors from untreated cells are plotted for comparison.
- H-NUC is composed of 824 amino acids ( Figure 3) and has a molecular weight of about 95 kD and has been found to interact with unphosphorylated, full length retinoblastoma (RB) protein. It has also been discovered that H-NUC derivatives, such as a truncated version of the H-NUC protein, containing the last six "TPR" regions ("tetratricopeptide, 34-amino acid repeats) in the C-terminal region, in other words, containing amino acids numbers 559 through 770, bind the wild-type Rb protein. Mutations to the protein which destroy its-retinoblastoma- binding function may contribute to the hyperproliterative pathology which is characteristic of RB negative cells, e.g., breast cancer cells.
- TPR tetratricopeptide, 34-amino acid repeats
- H-NUC protein is a human protein and can therefore be purified from human tissue.
- Purified when used to describe the state of H-NUC protein or nucleic acid sequence, denotes the protein or DNA encoding H-NUC free of the other proteins and molecules normally associated with or occurring with H-NUC protein or DNA encoding H-NUC in its native environment.
- native refers to the form of a DNA, protein, polypeptide, antibody or a fragment thereof that is isolated from nature or that which is without an intentional amino acid alteration e.g., a substitution, deletion or addition.
- 95 kd H-NUC protein from SDS gels can be accomplished using methods known to the ordinarily skilled artisans, for example, first react a cell extract containing H-NUC with anti-H-NUC antibody to precipitate as described in more detail below. Separate the protein antibody complex and recover the 95 kd H-NUC protein by elution from the SDS gel as described in Fischer et al. , Techniques in Protein Chemistry, ed. T. E. Hugli, Academic Press, Inc., pp. 36-41 (1989), incorporated herein by reference.
- hyperproliterative cells includes but is not limited to cells having the capacity for autonomous growth, i.e., existing and reproducing independently of normal regulatory mechanisms. Hyperproliterative diseases may be categorized as pathologic, i.e., deviating from normal cells, characterizing or constituting disease, or may be categorized as non-pathologic, i.e., deviation from normal but not associated with a disease state.
- Pathologic hyperproliterative cells are characteristic of the following disease states, thyroid hyperplasia - Grave's Disease, psoriasis, benign prostatic hypertrophy, Li- Fraumeni syndrome, cancers including breast cancer, sarcomas and other neoplasms, bladder cancer, colon cancer, lung cancer, various leukemias and lymphomas.
- non-pathologic hyperproliterative cells are found, for instance, in mammary ductal epithelial cells during development of lactation and also in cells associated with wound repair.
- Pathologic hyperproliterative cells characteristically exhibit loss of contact inhibition and a decline in their ability to selectively adhere which implies a change in the surface properties of the cell and a further breakdown in intercellular communication.
- proteins means a linear polymer of amino acids joined in a specific sequence by peptide bonds.
- amino acid refers to either the D or L stereoisomer form of the amino acid, unless otherwise specifically designated.
- H-NUC derivatives or equivalents such as H-NUC truncated protein, polypeptide or H-NUC peptides, having the biological activity of purified H-NUC protein.
- H-NUC derivatives refers to compounds that depart from the linear sequence of the naturally occurring proteins or polypeptides, but which have amino acid alterations, i.e., substitutions, deletions or insertions such that the resulting H-NUC derivative retains H-NUC biological activity.
- Biological activity or “biologically active” shall mean in one aspect having the ability to bind to the unphosphorylated retinoblastoma protein pllO 1 ⁇ .
- H-NUC binding to Rb is lost at 37 degrees Celsius if, for example, the highly conserved glycine (amino acid 640) is changed to aspartic acid.
- H-NUC derivatives can differ from the native sequences by the deletion, substitution or insertion of one or more amino acids with related amino acids, for example, similarly charged amino acids, or the substitution or modification of side chains or functional groups.
- H-NUC derivative is the protein comprising the last 6 TPR regions at the C-terminal end of H-NUC and the fusion protein-Gal4-C49, each of which is described below.
- the Gall4-C49 derivative has the sequence shown in Figure 3 from amino acid 559 to the end . of the sequence.
- the TPR containing derivative has a sequence shown in Figure 3 from amino acid 559 through 770.
- fragments of the amino acid sequence shown in Figure 3, in addition to the previously described Gal4-C49 fusion protein or the TPR derivative, which retain the function of the entire protein are included within the definition of H-NUC derivative.
- H-NUC derivatives can be generated by restriction enzyme digestion of the nucleic acid molecule of Figure 3 and recombinant expression of the resulting fragments. It is understood that minor modifications of primary amino acid sequence can result in proteins which have substantially equivalent or enhanced function as compared to the sequence set forth in Figure 3. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental such as through mutation in hosts which are H-NUC producers. All of these modifications are included as long as H-NUC biological function is retained.
- “Inhibitively active” also shall mean fragments and mutants of the H-NUC protein (“muteins”) that act in a dominant negative fashion thereby inhibiting normal function of the protein, thereby inhibiting the biological role of H-NUC which is to mediate host cell division and/or host cell proliferation.
- muteins fragments and mutants of the H-NUC protein
- These proteins and fragments can be made by chemical means well known to those of skill in the art.
- the muteins and inhibitively active fragments are useful therapeutically to promote hyperproliteration of cells and to generate diagnostic reagents such as antibodies. These agents are useful to promote or inhibit the growth or proliferation of a cell by contacting the cell, in vitro or in vivo with the agent by methods described below.
- this invention also provides a method to inhibit the growth or proliferation of a cell, such as a hyperproliterative cell like a breast cancer cell, by contacting the cell with the agent. Also provided are methods of treating pathologies characterized by hyperproliferative cell growth, such as breast cancer, by administering to a suitable subject these agents in an effective concentration such that cell proliferation is inhibited.
- a suitable subject for this method includes but is not limited to vertebrates, simians, murines, and human patients.
- compositions comprising any of the compositions of matter described above and one or more pharmaceutically acceptable carriers.
- Pharmaceutically acceptable carriers are well known in the art and include aqueous solutions such as physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, vegetable oils (eg., olive oil) or injectable organic esters.
- a pharmaceutically acceptable carrier can be used to administer H-NUC or its derivatives to a cell in vi tro or to a subject in vivo.
- a pharmaceutically acceptable carrier can contain a physiologically acceptable compound that acts, for example, to stabilize the protein or polypeptide or to increase or decrease the absorption of the agent.
- a physiologically acceptable compound can include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients.
- Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives, which are particularly useful for preventing the growth or action of microorganisms.
- Various preservatives are well known and include, for example, phenol and ascorbic acid.
- a pharmaceutically acceptable carrier including a physiologically acceptable compound
- a physiologically acceptable compound such as aluminum monosterate or gelatin is particularly useful as a delaying agent, which prolongs the rate of absorption of a pharmaceutical composition administered to a subject.
- carriers, stabilizers or adjuvants can be found in Martin, Remington's Pharm. Sci.. 15th Ed. (Mack Publ. Co., Easton, 1975), incorporated herein by reference.
- the pharmaceutical composition also can be incorporated, if desired, into liposomes, microspheres or other polymer matrices (Gregoriadis, Liposome Technology, Vol. 1 (CRC Press, Boca Raton, Florida 1984) , which is incorporated herein by reference) .
- Liposomes for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.
- Purified H-NUC (protein) or H-NUC (nucleic acid) pharmaceutical compositions are useful to inhibit the growth of a cell, such as a breast cancer cell, by contacting the cell with the purified H-NUC or an active fragment or composition, containing these polypeptides or proteins.
- the contacting can be effected in vitro, ex vivo or in vivo.
- the contacting is effected by mixing the composition of nucleic acid or protein of this invention with the cell culture medium and then feeding the cells or by directly adding the nucleic acid composition or protein to the culture medium.
- This method also is useful to treat or prevent pathologies associated with abnormally proliferative cells in a subject in vivo.
- an effective amount of the composition of this invention is administered to the subject in an amount effective to inhibit the proliferation of the cells in the subject.
- subject means any vertebrate, such as an animal, mammal, human, or rat. This method is especially useful to treat or prevent breast cancer in a patient having non-functional H-NUC protein production.
- Methods of administering a pharmaceutical include but are not limited to administration orally, intravenously, intramuscularly or intraperitoneal. Administration can be effected continuously or intermittently and will vary with the subject as is the case with other therapeutic recombinant proteins (Landmann et al. , J. Interferon Res. 12 (2) :103-111
- nucleic acid molecules which encode amino acid sequences corresponding to the purified mammalian H-NUC protein, H-NUC derivatives, mutein, active fragments thereof, and anti-H-NUC antibody are further provided by this invention.
- nucleic acid shall mean single and double stranded DNA, cDNA and mRNA.
- this nucleic acid molecule encoding H- NUC protein and fragments has the sequence or parts thereof shown in Figure 3.
- nucleic acid molecules that hybridize under stringent conditions to the nucleic acid molecule or its complement for example, the sequence of which is shown in Figure 3.
- hybridizing nucleic acid molecules or probes can by prepared, for example, by nick translation of the nucleic acid molecule of Figure 3, in which case the hybridizing nucleic acid molecules can be random fragments of the molecule, the sequence of which is shown in Figure 3.
- nick translation of the nucleic acid molecule of Figure 3
- the hybridizing nucleic acid molecules can be random fragments of the molecule, the sequence of which is shown in Figure 3.
- nucleic acid fragments of at least 10 nucleotides are useful as hybridization probes. Isolated nucleic acid fragments also are useful to generate novel peptides. These peptides, in turn, are useful as immunogens for the generation of polyclonal and monoclonal antibodies. Methods of preparing and using the probes and immunogens are well known in the art.
- the nucleic acid sequences also are useful to inhibit cell division and proliferation of a cell.
- the nucleic acid molecule is inserted into the cell, the cell is grown under conditions such that the nucleic acid is encoded to H-NUC protein in an effective concentration so that the growth of the cell is inhibited.
- the nucleic acid can be inserted by liposomes or lipidated DNA or by other gene carriers such as viral vectors as disclosed in Sambrook et al. , supra. incorporated herein by reference.
- a breast cancer cell having mutant H-NUC protein production is a cell that is benefited by this method.
- the treatment of human disease by gene transfer has now moved from the theoretical to the practical realm.
- the first human gene therapy trial was begun in September 1990 and involved transfer of the adenosine deaminase (ADA) gene into lymphocytes of a patient having an otherwise lethal defect in this enzyme, which produces immune deficiency.
- ADA adenosine deaminase
- the results of this initial trial have been very encouraging and have helped to stimulate further clinical trials (Culver, K.W. , Anderson, W.F., Blaese, R.M., Hum. Gene. Ther.. 1991 2:107).
- Retroviral vectors in this context are retroviruses from which all viral genes have been removed or altered so that no viral proteins are made in cells infected with the vector. Viral replication functions are provided by the use of retrovirus 'packaging' cells that produce all of the viral proteins but that do not produce infectious virus. Introduction of the retroviral vector DNA into packaging cells results in production of virions that carry vector RNA and can infect target cells, but no further virus spread occurs after infection. To distinguish this process from a natural virus infection where the virus continues to replicate and spread, the term transduction rather than infection is often used.
- a delivery system for insertion of a nucleic acid is a replication- incompetent retroviral vector.
- retroviral includes, but is not limited to, a vector or delivery vehicle having the ability to selectively target and introduce the nucleic acid into dividing cells.
- replication-incompetent is defined as the inability to produce viral proteins, precluding spread of the vector in the infected host cell.
- LNL6 Miller, A.D. et al .
- retroviral vectors for gene therapy are the high efficiency of gene transfer into replicating cells, the precise integration of the transferred genes into cellular DNA, and the lack of further spread of the sequences after gene transduction (Miller, A.D., Nature. 1992, 357:455-460) .
- cell lines designed for separating different retroviral coding regions onto different plasmids should reduce the possibility of helper virus production by recombination.
- Vectors produced by such packaging cell lines may also provide an efficient system for human gene therapy (Miller, A.D. , 1992 Nature. -357:455- 460) .
- Non-retroviral vectors have been considered for use in genetic therapy.
- One such alternative is the adenovirus (Rosenfeld, M.A. , et al . , 1992, Call, 68:143- 155; Jaffe, H.A. et al . , 1992, Proc. Natl . Acad. Sci. USA. 89:6482-6486) .
- Major advantages of adenovirus vectors are their potential to carry large segments of DNA (36 kb genome) , a very high titre (10 11 ml "1 ) , ability to infecting tissues in situ, especially in the lung.
- Plasmid DNA should be easy to certify for use in human gene therapy because, unlike retroviral vectors, it can be purified to homogeneity.
- liposome-mediated DNA transfer several other physical DNA transfer methods such as those targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins have shown promise in human gene therapy (Wu, G.Y. , et al, 1991 J. Biol. Chem.. 266:14338-14342; Curiel, D.T., et al . , 1991, Proc. Natl. Acad. Sci. USA. 88:8850-8854) .
- the H-NUC encoding gene of the present invention may be placed by methods well known to the art into an expression vector such as a plasmid or viral expression vector.
- a plasmid expression vector may be introduced into a tumor cell by calcium phosphate transfection, liposome (for example, LIPOFECTIN) -mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation and any other method of introducing DNA into a cell.
- a viral expression vector may be introduced into a target cell in an expressible form by infection or transduction.
- a viral vector includes, but is not limited to: a retrovirus, an adenovirus, a herpes virus and an avipox virus.
- H-NUC When H-NUC is expressed in any abnormally proliferating cell, the cell replication cycle is arrested, thereby resulting in senescence and cell death and ultimately, reduction in the mass of the abnormal tissue, i.e., the tumor or cancer.
- a vector able to introduce the gene construct into a target cell and able to express H-NUC therein in cell proliferation-suppressing amounts can be administered by any effective method.
- a physiologically appropriate solution containing an effective concentration of active vectors can be administered topically, intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously or by any other effective means.
- the vector may be directly injected into a target cancer or tumor tissue by a needle in amounts effective to treat the tumor cells of the target tissue.
- a cancer or tumor present in a body cavity such as in the eyes, gastrointestinal tract, genitourinary tract (e.g., the urinary bladder) , pulmonary and bronchial system and the like can receive a physiologically appropriate composition (e.g., a solution such as a saline or phosphate buffer, a suspension, or an emulsion, which is sterile except for the vector) containing an effective concentration of active vectors via direct injection with a needle or via a catheter or other delivery tube placed into the cancer or tumor afflicted hollow organ.
- a physiologically appropriate composition e.g., a solution such as a saline or phosphate buffer, a suspension, or an emulsion, which is sterile except for the vector
- Any effective imaging device such as X-ray, sonogram, or fiberoptic visualization system may be used to locate the target tissue and guide the needle or catheter tube.
- a physiologically appropriate solution containing an effective concentration of active vectors can be administered systemically into the blood circulation to treat a cancer or tumor which cannot be directly reached or anatomically isolated.
- target tumor or cancer cells can be treated by introducing H-NUC protein into the cells by any known method.
- liposomes are artificial membrane vesicles that are available to deliver drugs, proteins and plasmid vectors both in vitro or in vivo (Mannino, R.J., et al. , 1988, Biotechniques. 6:682-690) into target cells (Newton, A.C. and Huestis, W.H., Biochemistry. 1988, 27:4655-4659; Tanswell, A.K. et al., 1990, Biochmica et Biophysica Acta. 1044:269-274; and Ceccoll, J.
- H-NUC protein can be encapsulated at high efficiency with liposome vesicles and delivered into mammalian cells in vitro or in vivo.
- Liposome-encapsulated H-NUC protein may be administered topically, intraocularly, parenterally, intranasally, intratracheally, intrabronchially, intramuscularly, subcutaneously or by any other effective means at a dose efficacious to treat the abnormally proliferating cells of the target tissue.
- the liposomes may be administered in any physiologically appropriate composition containing an effective concentration of encapsulated H-NUC protein.
- Other vectors are suitable for use in this invention and will be selected for efficient delivery of the nucleic acid encoding the H-NUC gene.
- the nucleic acid can be DNA, cDNA or RNA.
- an isolated nucleic acid molecule of this invention is operatively linked to a promoter of RNA transcription.
- These nucleic acid molecules are useful for the recombinant production of H- NUC proteins and polypeptides or as vectors for use in gene therapy.
- a vector having inserted therein an isolated nucleic acid molecule described above can be, but are not limited to a plasmid, a cosmid, or a viral vector.
- suitable vectors see Sambrook et al . , supra. and Zhu et al . , Science 261:209-211 (1993) , each incorporated herein by reference.
- H-NUC can be recombinantly produced.
- suitable host cells can include mammalian cells, insect cells, yeast cells, and bacterial cells. See Sambrook et al. , supra. incorporated herein by reference.
- a method of producing recombinant H-NUC or its derivatives by growing the host cells described above under suitable conditions such that the nucleic acid encoding-H- NUC or its fragment, is expressed, is provided by this invention.
- suitable conditions can be determined using methods well known to those of skill in the art, see for example, Sambrook et al. , supra. incorporated herein by reference. Proteins and polypeptides produced in this manner also are provided by this invention.
- antibody capable of specifically forming a complex with H-NUC protein or a fragment thereof.
- antibody includes polyclonal antibodies and monoclonal antibodies. The antibodies include, but are not limited to mouse, rat, rabbit or human monoclonal antibodies.
- an antibody or polyclonal antibody means a protein that is produced in response to immunization with an antigen or receptor.
- monoclonal antibody means an immunoglobulin derived from a single clone of cells. All monoclonal antibodies derived from the clone are chemically and structurally identical, and specific for a single antigenic determinant.
- the monoclonal antibodies of this invention can be biologically produced by introducing H-NUC or a fragment thereof into an animal, e.g., a mouse or a rabbit .
- the antibody producing cells in the animal are isolated and fused with myeloma cells or heteromyeloma cells to produce hybrid cells or hybridomas. Accordingly, the hybridoma cells producing the monoclonal antibodies of this invention also are provided.
- Monoclonal antibodies produced in this manner include, but are not limited to the monoclonal antibodies described below.
- H-NUC protein or derivative thereof can produce and screen the hybridoma cells and antibodies of this invention for antibodies having the ability to bind H-NUC.
- antibody fragments retain some ability to selectively bind with its antigen or immunogen.
- antibody fragments can include, but are not limited to:
- Fab the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion with the enzyme papain to yield an intact light chain and a portion of one heavy chain;
- Fv defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
- SCA defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
- biologically active antibody fragment include the CDR regions of the antibodies.
- Anti-idiotypic peptides specifically reactive with the antibodies or biologically active fragments thereof also are provided by this invention.
- anti-idiotypic peptides are purified antibodies from one species that are injected into a distant species and recognized as foreign antigens and elicit a strong humoral immune response. For a discussion of general methodology, see Harlow and Lane, supra. incorporated herein by reference.
- proteins or polypeptides that have been recombinantly produced, biochemically synthesized, chemically synthesized or chemically modified, that retain the ability to bind H-NUC or a fragment thereof, as the corresponding native polyclonal or monoclonal antibody.
- the ability to bind with an antigen or immunogen is determined by antigen- binding assays known in the art such as antibody capture assays. See for example, Harlow and Lane, supra , incorporated herein by reference.
- an antibody or nucleic acid is linked to a detectable agent, useful to detect the H-NUC protein and fragments in a sample using standard immunochemical techniques such as immunohistochemistry as described by Harlow and Lane, supr , incorporated herein by reference or as discussed in "Principles and Practice of Immunoassays” , eds. CJ. Price and D.J. Newman, Stockton Press, New York, (1991) , herein incorporated by reference.
- the antibody is administered to bind to H-NUC and alter its function within the cell.
- the antibody is administered by methods well known to those of skill in the art and in an effective concentration such that H-NUC function is restored.
- the antibody also can be used therapeutically to inhibit cell growth or proliferation by binding to H-NUC which has lost its ability to bind to retinoblastoma protein. This antibody binds to H-NUC causing it to refold into an active configuration. In other words, the agent restores the native biological activity of H-NUC.
- the antibodies and nucleic acid molecules of this invention are useful to detect and determine the presence or absence of H-NUC protein or alternatively, an altered-H- NUC gene in a cell or a sample taken from a patient. In this way, breast cancer or susceptibility to breast cancer can be diagnosed.
- RB C-terminal region of RB
- p56-RB C-terminal region of RB
- RB C-terminal region of RB
- the C-terminal portion of RB protein has two noncontiguous domains required for binding to the oncoproteins of several DNA tumor viruses and a C-terminal region associated with DNA- binding activity.
- one of the RB-associated proteins has been characterized which has primary sequences and biochemical properties similar to those of the nuc2 protein of S. pombe yeast and bimA of the Aspergillus genus of fungi .
- TRP motifs novel, repeating amino acids in motifs of 34 residues.
- the function of these repeats is not known, but it has been postulated that they form amphipathic alpha-helices that could, in principle, direct protein- protein interactions.
- the protein reported here is the first human TRP protein isolated and reported.
- H-NUC cDNAs For isolation of full length H-NUC cDNAs, a 1.5 Kb Bglll fragment of C-49, isolated as described above using the method of Durfee et al. id., was labeled by nick translation and used to screen a human fibroblast cDNA library by plaque hybridization.
- the cDNA inserts were subcloned into EcoRI site of the pBSK+ vector (Stratagene, San Diego, Ca.) to facilitate DNA sequencing. Sequencing was performed by using dideoxy-NTPs and Sequenase 2.0 according to the manufacturer's specifications (US Biochemicals) . Sequence analysis and homology searches were performed using DNASTAR software (DNASTAR, Inc., Madison, WI) .
- GST-491 the plasmid C-49 was digested with Bglll and the 1.3 Kb insert fragment subcloned into the BamHI site of pGEX-3X (Pharmacia, Piscataway, N.J.) .
- GST-T was made by cutting Y62-25-2 with Hindlll, blunt ending with Klenow, and subcloning the 823bp fragment into pGEX-3X cut with Smal. Expression of GST fusion proteins in E. coli (Smith and Johnson, Gene. 67:31- 40 (1988)) was induced with 0.1 mM IPTG.
- Lysis 250 buffer 250 mM NaCl, 5 mM EDTA, 50 mM Tris (pH 8.0) , 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF) , 8 ⁇ g leupeptin, 8 ⁇ g antipain
- 4 mg lysozyme was added, and the cells held at 4°C for 30 minutes and the cells lysed by sonication. Cell debris was removed by centrifugation (10 K for 30 minutes) and the supernatant added to glutathione coated beads.
- the in vitro binding assay was performed as follows. Extracts made from 2xl0 6 2E3 cells (Chen et al . , 1992, infra. incorporated herein by reference) were incubated with beads containing 2-3 ⁇ g of GST or GST fusion proteins in Lysis 150 buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM PMSF, 1 ⁇ g leupeptin per ml, 1 ⁇ g antipain per ml) for 30 minutes at room temperature. Complexes were washed extensively with lysis 150 buffer, boiled in loading buffer, and run on 7.5% SDS-PAGE gels.
- Lysis 150 buffer 50 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM PMSF, 1 ⁇ g leupeptin per
- anti-H-NUC antibodies were produced. Harlow and Lane, Antibodies: A Laboratory Manual. Cold Spring Harbor
- the beads were boiled in SDS sample buffer and the immunoprecipitates were separated with 7.5% SDS-PAGE.
- the resulting immune complexes were boiled in 200 ⁇ l dissociation buffer I (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% SDS and 5 mM DTT) to denature the proteins.
- the denatured proteins were diluted with 200 ⁇ l dissociation buffer II (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% NP40 and 1% Na-deoxycholate) and re-immunoprecipitated with antibodies.
- H-NUC The DNA fragments derived from H-NUC cDNA were subcloned into pSE1107 (Durfee et al .. 1993 supra) : Clone 491 is the original one isolated by the yeast two-hybrid screening. H-NUC was constructed by insertion of 3.3kb Xhol fragment into a modified pSE1107 to create an in-frame fusion protein. RV contains the N-terminal XhoI-EcoRV fragment. BR208, BR207, B5 and B6 are the Sau3A partial digestion products.
- the Gal4 fusion protein derived from these constructs will contain aa: 1-824 for H-NUC, aa: 559-824 for 491, aa: -1-663 for RV, aa: 699-824 for BR2-8, aa: 797-824 for BR2-7, aa: 559-796 for B5, and aa: 597- 796 for B6, respectively.
- the ts mutant was generated by replacing the Nsil fragment of H-NUC with the annealed primers.
- the primers were as follows:
- Primer 1 TGGTATGACCTAGGAATGATTTATTACAAGCAAGAAAAATTCAGCCTTGCAGAAATGCA
- Yeast transformation was carried out by using the LiOAC method as described previously (Durfee et al . , 1993, supra) . incorporated herein by reference. After transformation, cells were plated on synthetic dropout medium lacking tryptophan and leucine to select for the presence of plasmids. Following 2 to 3 days of growth at 30°C, single colonies from each transformation were inoculated into the appropriate selecting media. 2.5 ml cultures were grown in the appropriate selecting media to OD 600 1.0-1.2. Cells were then prepared and permeabilized as described (Guarente, L., Methods Enzymol . 101:181-191 (1983)) incorporated herein by reference. For quantitation using chlorophenyl-red- ⁇ -D-galactopyranoside (CPRG; Boehringer Mannheim) standard conditions were used (Durfee, 1993, supra) . incorporated herein by reference.
- CPRG chlorophenyl-red- ⁇ -D-galactopyranoside
- H-NUC binds to unphosphorylated RB in a region similar to the SV40 T-antigen binding region.
- a panel of deletion mutants of RB protein were constructed. These mutants had originally been used to delineate the T-binding domain, and were subcloned into plasmids containing a Gal-4 DNA-binding domain, pASl, as described previously (Durfee et al. , 1993, supra) . incorporated herein by reference. Two of these DNA constructs, a Gal-4 activation domain-C-49 fusion expressing plasmid (the original cloned C-49) and YI pPTGlO, an indicator plasmid containing beta-galactosidase, were used to co-transform yeast strain Y153 (Durfee et al .. 1993, supra) .
- each of the RB fusion proteins was measured by Western blot analysis using the methods of Sambrook et al. , Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989) , incorporated herein by reference, and did not vary more than 2 to 3-fold.
- the resulting transformants were then assayed for beta-galactosidase activity as described above.
- binding of the C-49 fusion protein to Gal-4-RB is diminished by many of the same mutations of the RB protein, including the amino acid 706 Cys to Phe point mutation which eliminates SV 40 T-antigen binding.
- C-49 is unable to bind the Ssp mutant, which lacks the C-terminal 160 amino acids of the RB protein, whereas T-antigen can bind, albeit with reduced affinity.
- the Ml deletion (amino acids 612-632) , which deletes part of the linker region between the two binding subdomains, is the only mutant able to bind both H-NUC and T-antigen.
- a similar but not identical region of the RB protein is required for binding both T-antigen and C-49.
- H-NUC was able to bind only unphosphorylated pllO 13 with an affinity similar to that of Gst-T, which served as a positive control.
- GST alone does not bind to any Rb protein (see Figure IA, lanes 2-4) .
- the 1.3 kb cDNA was used as a probe to screen a human fibroblast cDNA library. From the dozen clones isolated, the longest cDNA clone, some 3.3 kb, was completely sequenced. The open reading frame encodes a protein of 824 amino acids (Figure 3) .
- the protein has 35% overall homology to two known proteins, S. pombe yeast nuc2 and Aspergillus nidulano bimA. Both lower eucaryotic proteins are known to be involved in mitosis, since temperature- sensitive mutants of these two genes arrest cells in metaphase.
- the Nuc2 and bimA proteins contain ten 34-amino acid repeats organized such that one is at the N-terminal region and nine are clustered at the C-terminal region, as shown in Figure 4. Similar repeat arrangement also is found in the novel RB-associated protein. If only the nine repeat regions of the three proteins are compared, the sequence identity is 60% ( Figure 4B) .
- the sequences between the first and second repeats of nuc2 and bimA have very low homology. This poor homology also holds true for the protein from clone C-49. Based on the sequence homology, the isolated clone is likely the human homolog of yeast Nuc2 and Aspergillus bimA. Therefore, the C-49 clone was designated H-NUC. C-terminal repeats of H-NUC bind to RB protein.
- This H-NUC protein contains neither the known-L- X-C-X-E motif, which T-antigen and adenovirus EIA use to bind RB, nor the 18-amino acid sequence of E2F that has been shown to be important for binding RB. This finding suggests that the H-NUC protein may use a different motif to bind RB.
- serial deletion mutants were constructed, each containing different regions of the H-NUC cDNA, and expressed Gal-4 fusion proteins, as shown in Figure 5.
- mice antibodies to it were prepared.
- Gst-C-49 was expressed in E. coli. (Smith and Johnson, 1988, supra. and Shan et al . , 1992, supra, each incorporated herein by reference) purified using glutathione beads, and used as an antigen to induce an antibody response in mice.
- Serum containing polyclonal anti-H-NUC antibody was then harvested. After the antibody was available, an erythroleukemia cell line (K562) metabolically labeled with 35 S-methionine was used to prepare cell lysates, which were immunoprecipitated with polyclonal antibody, as described previously.
- H-NUC protein has DNA-binding activity.
- Lysis 250 buffer 250mM NaCl, 5mM EDTA, 50mM Tris (pH 8.0) , 0.1% NP40, ImM phenylmethylsulfonyl fluoride (PMSF) , 8 ug/ml of leupeptin and 8 ug/ml of antipain
- Lysates were clarified by centrigugation and diluted with 2 volumes of loading buffer (lOmM KH 2 P0 4 , pH6.2, ImM MgCl 2 , 0.5% NP40, ImM DTT, 10% glycerol) .
- the diluted extract was then applied to a DNA- cellulose column (native calf thymus DNA, Pharmacia, Poscatawas, NJ) as previously described, and the mixture was incubated for 1 hour at 4 degrees C with gentle shaking.
- the column was washed with 5 bed volumes of loading buffer and then eluted with the same buffer containing increasing concentrations of NaCl.
- NUC cDNA probe to human chromosomes showed specific labeling at the q21-22 region of chromosome 17, as shown in Figure 9. Of the 320 grains from 150 cells scored, 42
- H-NUC to chromosome 17.
- the location of H-NUC is interesting because the familial breast cancer gene has been mapped to the same region and
- the tumor suppressor activity of H-NUC was assessed in both in vitro cell culture conditions and in nude mouse animal models.
- the cells lines used to assess H-NUC tumor suppressor activity were MDA-MB-231 which contains one functional allele of H-NUC and T-47D which is a homozygous mutant of the H-NUC locus.
- H-NUC adenoviral expression vector
- ACN is a control adenoviral vector lacking a cDNA insert
- AC-H-NUC is an adenoviral vector expressing H-NUC under the control of the human CMV promoter.
- 2520 base pair fragment containing the full length cDNA for H-NUC was amplified by PCR from Quick Clone double-stranded placental cDNA (Clontech) .
- the primers used for amplification of H-NUC added a Kpn I restriction site at the 5 ' end of the fragment and a Xho I site at the 3 ' end to allow for directional cloning into the multiple cloning site of pBluescript II KS+ (5 prime oligo 5 ' CGCGGTACCATGACGGTGCTGCAGGAA3 ' ; 3 prime oligo 5 'ATCGGCTCGAGCAGAAGTTAAAATTCATC3 ' ) .
- PCR cycles were as follows: 1 cycle at 94 degrees Celsius 1 min; 30 cycles at 94 degrees Celsius 1 min, 53 degrees Celsius 11/2 min, 72 degrees Celsius 2 min; and 1 cycle at 72 degrees Celsius 7 min. Clones were screened for the ability to produce a 95
- the T3 promoter in the Bluescript vector allows for transcription and translation of the H-NUC coding sequence by rabbit reticulocytes .
- Ten microliters of the reaction was mixed with loading buffer and run on a 10% polyacrylamide gel (Novex) for 1 1/2 hour at 165 V. The gel was dried down and exposed to film overnight. Four clones making full-length protein were sequenced.
- the H-NUC insert was recovered from the vector following digestion with Kpn I and Hind II and subcloned into the Kpnl-Bglll sites of pAdCMVb-vector (Bglll was filled-in to create a blunt end) . All four clones contained some mutations therefore, a clone containing the correct wild-type sequence was created by ligating fragments from two clones.
- adenovirus To construct recombinant adenovirus, the above plasmids were linearized with Nru I and co-transfected with the large fragment of a Cla I digested dl309 mutants (Jones and Shenk, Cell. 17:683-689 (1979)) which is incorporated herein by reference, using CaPO 4 transfectior kit (Stratagene) . Viral plaques were isolated and recomb passnants identified by both restriction digest analysis and PCR using primers against H-NUC cDNA sequence. Recombinant virus was further purified by limiting dilution, and virus particles were purified and titered by standard methods
- T-47 D cells are infected with either the control or the H-NUC containing recombinant adenoviruses for a period of 24 hours at increasing multiplicities of infection (MOI) of plaque forming units of virus/cell.
- MOI multiplicities of infection
- Cells are then washed once with PBS and harvested in lysis buffer (50mM Tris-Hcl Ph 7.5, 250 Mm NaCl, 0.1% NP40, 50mM NaF, 5mM EDTA, lOug/ml aprotinin, 10 ug/ml leupeptin, and ImM PMSF) .
- lysis buffer 50mM Tris-Hcl Ph 7.5, 250 Mm NaCl, 0.1% NP40, 50mM NaF, 5mM EDTA, lOug/ml aprotinin, 10 ug/ml leupeptin, and ImM PMSF.
- Cellular proteins are separated by 10% SDS-P
- Membranes are incubated with an anti-H-NUC antibody followed by sheep anti-mouse IgG conjugated with horseradish peroxidase. Accurate expression of H-NUC protein is visualized by chemiluminescence (ECL kit, Amersham) on Kodak XAR-5 film.
- Thymidine incorporation was also used to assess the effects of H-NUC on cell proliferation. Briefly, approximately 3xl0 3 MDA-MB-231 and T-47D cells were plated in each well of a 96-well plate (Costar) and allowed to incubate overnight (37°C, 7% C0 2 ) . Serial dilutions of ACN or AC-H-NUC were made in DME:F12/15% FBS/l% glutamine, and cells were infected at multiplicity of infection (MOI) of 10 and 100 (4 replicate wells at each MOI) with each adenovirus. One-half of the cell medium volume was changed
- Tumor dimensions length, width, height
- body weights were then measured twice per week. Tumor volumes were estimated for each animal assuming a spherical geometry with radius equal to one-half the average of the measured tumor dimensions.
- Human breast cancer cell line T-47D cells are injected subcutaneously into female BALB/c athymic nude mice. Tumors are allowed to develop for 32 days. At this point, a single injection of either ACN (control) or AC-H- NUC (containing H-NUC gene) adenovirus vector is injected into the peritumoral space surrounding the tumor. Tumors are then excised at either Day 2 or Day 7 following the adenovirus injection, and poly-A+ RNA is isolated from each tumor. Reverse transcriptase-PCR using H-NUC specific primers, are then used to detect H-NUC RNA in the treated tumors.
- ACN control
- AC-H- NUC containing H-NUC gene
- Amplification with actin primers serves as a control for the RT-PCR reaction while a plasmid containing the recombinant- (H-NUC) sequence serves as a positive control of the recombinant- (H-NUC) specific band.
- T-47D cells are injected into the subcutaneous space on the right flank of mice, and tumors are allowed to grow for 2 weeks. Mice receive peritumoral injections of buffer or recombinant virus twice weekly for a total of 8 doses. Tumor growth is monitored throughout treatment in the control animals receiving ACN and buffer and those animals receiving AC-H- NUC. Body weight and survival time is also monitored. Expression of exogeneous H-NUC in breast cancer cell line T-47D cells.
- T-47D Breast cancer cells from breast cancer cell line T-47D which contains no endogeneous H-NUC, because of homozygous mutation of its gene, provides a clean background for functional studies of H-NUC.
- T-47D cells are infected with comparable titers of either AC-H-NUC or control ACN vector. Most colonies are individually propagated into mass cultures.
- Infected cells were metabolically labeled with 35 S and used to prepare cell lysates to evaluate the amount of protein produced.
- AC-AH-NUC infected cultures are compared to control cells in terms of morphology, growth rate (e.g., doubling time) , saturation density, soft-agar colony formation and tumorigenicity in nude mice are determined.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BR9408357A BR9408357A (pt) | 1993-12-20 | 1994-12-20 | Sequência isolada e purificada de dna vetor de recombinação vetor de expressão sistema de vetor-hospedeiro composição farmacêutica teste de dna proteína de mamífero isolada e purificada e processo para produzir a mesma processo de suprimir fenótico neoplástico anticorpo hibridoma e processo parta detectar a ausência da proteina h-nuc em células tumorais |
EP95906694A EP0735889A4 (de) | 1993-12-20 | 1994-12-20 | Neues tumor-suppressor-gen |
PL94315172A PL315172A1 (en) | 1993-12-20 | 1994-12-20 | Novel gene inhibiting growth of neoplasms |
JP7517608A JPH09510343A (ja) | 1993-12-20 | 1994-12-20 | 新規な腫瘍抑制遺伝子 |
SK768-96A SK76896A3 (en) | 1993-12-20 | 1994-12-20 | A novel tumor suppressor gene |
AU15174/95A AU1517495A (en) | 1993-12-20 | 1994-12-20 | A novel tumor suppressor gene |
FI962558A FI962558A0 (fi) | 1993-12-20 | 1996-06-19 | Uusi kasvainsuppressorigeeni |
NO962596A NO962596L (no) | 1993-12-20 | 1996-06-19 | Nytt tumorsupressorgen |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17058693A | 1993-12-20 | 1993-12-20 | |
US08/170,586 | 1993-12-20 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1995017198A1 true WO1995017198A1 (en) | 1995-06-29 |
Family
ID=22620468
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1994/014813 WO1995017198A1 (en) | 1993-12-20 | 1994-12-20 | A novel tumor suppressor gene |
Country Status (14)
Country | Link |
---|---|
EP (1) | EP0735889A4 (de) |
JP (1) | JPH09510343A (de) |
CN (1) | CN1138295A (de) |
AU (1) | AU1517495A (de) |
BR (1) | BR9408357A (de) |
CA (1) | CA2178745A1 (de) |
CZ (1) | CZ178396A3 (de) |
FI (1) | FI962558A0 (de) |
HU (1) | HUT74413A (de) |
NO (1) | NO962596L (de) |
NZ (1) | NZ278745A (de) |
PL (1) | PL315172A1 (de) |
SK (1) | SK76896A3 (de) |
WO (1) | WO1995017198A1 (de) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6162897A (en) * | 1994-08-12 | 2000-12-19 | Myriad Genetics, Inc. | 17q-linked breast and ovarian cancer susceptibility gene |
WO2001029229A1 (fr) * | 1999-10-18 | 2001-04-26 | Shanghai Bio Road Gene Development Ltd. | Nouveau polypeptide, proteine humaine 20 de liaison de retinoblastome et polynucleotide le codant |
WO2002020589A1 (fr) * | 2000-07-07 | 2002-03-14 | Biowindow Gene Development Inc. Shanghai | Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide |
JP2003506015A (ja) * | 1999-07-05 | 2003-02-18 | クロップデザイン エン.ヴェー. | シロイヌナズナcdc7およびcdc27ホモログ |
US7432367B2 (en) | 1998-06-30 | 2008-10-07 | Serono Genetics Institute, S.A. | Nucleic acid encoding a retinoblastoma binding protein (RBP-7) and polymorphic markers associated with said nucleic acid |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1054399C (zh) * | 1997-11-07 | 2000-07-12 | 中国科学院上海生物化学研究所 | 一个与抗癌基因p53相作用的人类新基因p53bp3 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4358535A (en) * | 1980-12-08 | 1982-11-09 | Board Of Regents Of The University Of Washington | Specific DNA probes in diagnostic microbiology |
-
1994
- 1994-12-20 AU AU15174/95A patent/AU1517495A/en not_active Abandoned
- 1994-12-20 WO PCT/US1994/014813 patent/WO1995017198A1/en not_active Application Discontinuation
- 1994-12-20 CN CN94194569A patent/CN1138295A/zh active Pending
- 1994-12-20 EP EP95906694A patent/EP0735889A4/de not_active Withdrawn
- 1994-12-20 BR BR9408357A patent/BR9408357A/pt not_active Application Discontinuation
- 1994-12-20 HU HU9601686A patent/HUT74413A/hu unknown
- 1994-12-20 CA CA002178745A patent/CA2178745A1/en not_active Abandoned
- 1994-12-20 CZ CZ961783A patent/CZ178396A3/cs unknown
- 1994-12-20 NZ NZ278745A patent/NZ278745A/en not_active IP Right Cessation
- 1994-12-20 PL PL94315172A patent/PL315172A1/xx unknown
- 1994-12-20 JP JP7517608A patent/JPH09510343A/ja active Pending
- 1994-12-20 SK SK768-96A patent/SK76896A3/sk unknown
-
1996
- 1996-06-19 NO NO962596A patent/NO962596L/no not_active Application Discontinuation
- 1996-06-19 FI FI962558A patent/FI962558A0/fi unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4358535A (en) * | 1980-12-08 | 1982-11-09 | Board Of Regents Of The University Of Washington | Specific DNA probes in diagnostic microbiology |
US4358535B1 (de) * | 1980-12-08 | 1986-05-13 |
Non-Patent Citations (8)
Title |
---|
E. HARLOW AND D. LANE, "Antibodies, A Laboratory Manual", published 1988, by COLD SPRING HARBOR LABORATORY (NEW YORK), pages 141-157 and 574-577. * |
GenBank Loci HSCDC27, Q59610, M78440, T03211, FASTDB Search Against SEQ ID NO:1. * |
GenBank Loci HSRSPAC and HSU13369 from FASTDB Search of Complement of SEQ ID NO:1. * |
GENOMICS, Volume 18, issued 1993, I.L. GONZALEZ et al., "Fixation Times of Retroposons in the Ribosomal DNA Spacer of Human and other Primates", pages 29-36. * |
J. SAMBROOK et al., "Molecular Cloning, A Laboratory Manual", published 1989, by COLD SPRING HARBOR LABORATORY PRESS (NEW YORK), pages 7.52, 9.31, and 16.18-16.22. * |
NUCLEIC ACIDS RESEARCH, Volume 20, No. 21, issued 1992, I.L. GONZALEZ et al., "Human Ribosomal RNA Intergenic Spacer Sequence", page 5846. * |
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES U.S.A., Volume 90, issued November 1993, S. TUGENDREICH et al., "Linking Yeast Genetics to Mammalian Genomes: Identification and Mapping of the Human Homolog of CDC27 via the Expressed Sequence Tag (EST) Data Base", pages 10031-10035. * |
See also references of EP0735889A4 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6162897A (en) * | 1994-08-12 | 2000-12-19 | Myriad Genetics, Inc. | 17q-linked breast and ovarian cancer susceptibility gene |
US7432367B2 (en) | 1998-06-30 | 2008-10-07 | Serono Genetics Institute, S.A. | Nucleic acid encoding a retinoblastoma binding protein (RBP-7) and polymorphic markers associated with said nucleic acid |
JP2003506015A (ja) * | 1999-07-05 | 2003-02-18 | クロップデザイン エン.ヴェー. | シロイヌナズナcdc7およびcdc27ホモログ |
WO2001029229A1 (fr) * | 1999-10-18 | 2001-04-26 | Shanghai Bio Road Gene Development Ltd. | Nouveau polypeptide, proteine humaine 20 de liaison de retinoblastome et polynucleotide le codant |
WO2002020589A1 (fr) * | 2000-07-07 | 2002-03-14 | Biowindow Gene Development Inc. Shanghai | Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide |
Also Published As
Publication number | Publication date |
---|---|
NZ278745A (en) | 1997-09-22 |
FI962558A (fi) | 1996-06-19 |
CZ178396A3 (en) | 1997-03-12 |
SK76896A3 (en) | 1997-02-05 |
JPH09510343A (ja) | 1997-10-21 |
AU1517495A (en) | 1995-07-10 |
CN1138295A (zh) | 1996-12-18 |
FI962558A0 (fi) | 1996-06-19 |
CA2178745A1 (en) | 1995-06-29 |
PL315172A1 (en) | 1996-10-14 |
HU9601686D0 (en) | 1996-08-28 |
NO962596L (no) | 1996-08-19 |
HUT74413A (en) | 1996-12-30 |
EP0735889A1 (de) | 1996-10-09 |
EP0735889A4 (de) | 1999-04-14 |
NO962596D0 (no) | 1996-06-19 |
BR9408357A (pt) | 1997-08-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5891857A (en) | Characterized BRCA1 and BRCA2 proteins and screening and therapeutic methods based on characterized BRCA1 and BRCA2 proteins | |
US5831008A (en) | Retinoblastoma protein-interacting zinc finger proteins | |
US5710022A (en) | Nuclear mitotic phosphoprotein | |
US8183339B1 (en) | Cell-permeable peptide inhibitors of the JNK signal transduction pathway | |
US20060228365A1 (en) | Protein and gene involved in myocyte differentiation | |
WO1995017198A1 (en) | A novel tumor suppressor gene | |
US7105649B2 (en) | Gasci gene | |
AU686815B2 (en) | A novel prostate/colon tumor suppressor gene located on human chromosome 8 | |
JP2001510684A (ja) | アッセイ、治療法及び治療手段 | |
JP4201712B2 (ja) | Gip、グッドパスチャー抗原結合タンパク質と相互作用する転写因子活性を備えたポリペプチドのファミリー | |
AU736210B2 (en) | Brca1 compositions and methods for the diagnosis and treatment of breast cancer | |
JP2002503466A (ja) | 網膜芽細胞腫タンパク質複合体および網膜芽細胞腫相互作用タンパク質 | |
US6335169B1 (en) | Nucleic acids encoding hBub1, a cell cycle checkpoint gene | |
US20030165506A1 (en) | Novel alpha-catenin expressed in heart and testis | |
US20040006210A1 (en) | Human polyhomeotic 2 (hph2) acts as an oncogene | |
AU2002304971B2 (en) | Bcl-2-modifying factor (Bmf) sequences and their use in modulating apoptosis | |
EP1049795A1 (de) | Mmsc1, ein mit mmac1 interagierendes protein | |
WO2004037857A1 (en) | Bfk protein as therapeutic molecules | |
WO2001040286A1 (fr) | Proteine humaine du cerveau associee au chromosome x et polynucleotide codant pour ce polypeptide | |
JP2003024069A (ja) | TdT結合性新規タンパク質および当該タンパク質をコードする遺伝子 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 94194569.3 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AM AU BB BG BR BY CA CN CZ FI GE HU JP KE KG KP KR KZ LK LT LV MD MG MN MW NO NZ PL RO RU SD SI SK TJ TT UA UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE MW SD SZ AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 278745 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2178745 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 76896 Country of ref document: SK |
|
WWE | Wipo information: entry into national phase |
Ref document number: PV1996-1783 Country of ref document: CZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 962558 Country of ref document: FI |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1995906694 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1995906694 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: PV1996-1783 Country of ref document: CZ |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1995906694 Country of ref document: EP |
|
WWR | Wipo information: refused in national office |
Ref document number: PV1996-1783 Country of ref document: CZ |