CA2178745A1 - A novel tumor suppressor gene - Google Patents

Abstract

This invention is an isolated and purified DNA sequence encoding an Rb binding protein comprising a subsequence having at least 60% homology with nine tetratricopeptide repeats at the C-terminal end, with the proviso that the sequence encodes for neither S. pombe yeast protein nuc2, Aspergillus nidulans protein bimA, nor S. cerevisiae yeast protein CDC27, vectors containing said DNA, DNA probes based on said DNA, and methods of therapy utilizing said DNA and vectors. This invention is also directed to proteins encoded by said DNA, methods of therapy utilizing said proteins, and methods of expressing said proteins. Finally, this invention is directed to antibodies to said proteins, hybridomas producing said monoclonal antibodies, and diagnostic methods utilizing said antibodies.

Description

Wo 95/17198 2 1 7 8 7 ~5 PCT/US94/14813 A NOVET. TTT~Tr)R SUPPP~SOR ~li!~TT.' This application is a continuation-in-part of U.S. Serial No. 08Jl7o, 586 filed December 20, l993, the contents of which are hereby incorporated by ref erence into 5 the present disclosure.
.

RA~'T ~'R~Tr--~ OF TT~TT" lNvb ~
This invention is in the f ield of tumor suppressor genes (anti-~n~-o~PnP~) and relates in general to products and methods for practicing broad-spectrum tumor suppressor gene therapy of various human cancers. In particular, the invention relatea to methods for treating tumor cells (l) administering vectors comprising a nucleic acid sequence coding for the novel protein referred to herein as H-NI~C or (2) administering an effective amount of l~ a protein coded for by the nucleic acid sequence.
Cancers and tumors are the second most prevalent cause of death in the United States, causing 450,000 deaths per year. One in three Americans will develop cancer, and one in five will die of cancer (Scientific American Medicine, part 12, I, l, section dated 1987) . While substantial progress has been made in identifying some of the likely enviL~ t~l and hereditary causes of cancer, the statistics for the cancer death rate indicates a need for substantial; ~ LUV~ t in the therapy for cancer and related disease~ and disorder.
A number of so-called cancer genes, i.e., genes that have been implicated in the etiology of cancer, have been ;rlPnti~;Prl in connection with hereditary forms of cancer and in a large number of well-studied tumor cells.
3 o Study of cancer genes ~as helped provide some understanding of the process of tumorigenesi~. While a great deal more remains to be learned about cancer genes, the presently WO95117198 21 78745 PCrlUSg~/14813 kAown cancer genes serve as uæe~ul models ~or uAderstanding tumorigenesis .
Cancer genes are broadly classified into "oncogenes~ which, when activated, promote tumorigenesis, 5 and "tumor suppressor genes" which, when damaged, fail to suppress tumorigenesis. While these classifications provide a useul method for concept~ ;7;n~ tumorigenesis, it i8 also possible that a particular gene may play differing roles depending upon the particular allelic orm 10 of that gene, its regulatory ~ , the genetic background and the tisaue environment in which it is operating .
One widely considered working hypothesis of cancer is as follows: (l) Most o all human cancers are 15 genetic diseases and (2) they result rom the expression and/or failure of expression of speciic genes (i.e. mutant versions of normal cellular growth regulatory genes or viral or other Eoreign genes in mammalian cells that cause inappropriate, untimely, or ectopic expression o other 20 classes of vital growth-regulatory genes.
A simplistic view of the biologic basis for neoplasia is that there are two major classes of oncogenes.
The first class conE;ists of mutated or otherwise aberrant alleles of normal cellular genes that are involved in the 2~ control of cellular growth or replication. These genes are the cellular proto- nroq-onP~. When mutated, they can encode new cellular fuIlctions that disrupt normal cellular growth and replicatioA. The consequence of these changes is the production o~ ;n~nt-y expressed tumor phenotypes. In 30 this model of dr~m;n~ntly expressed oncogenes, a view that ha3 ~LI 'C i n~ted since the emergence of the concept of the genetic and mutational basis for neoplasia, it is ;r-~in~fl that the persistence of a single wild-type allele is not s11ff;-;~nt to prevent neoplastic changes in the 17198 ~ J1~ a PCT/USg4/14813 devf~ l program or the growth properties o~ the cell.
The genetic events responsible for the activation of these oncogenes thereore might be envisioned as "single-hit"
events, The activation of tumorigenic activities of the 5 mye oncogene in Burkitt lymphoma, the expression of bcr-abl rhi ' r~ gene product in patients with chronic myelogenous leukemia, the activation of the H-ras and K-ras oncogenes in other tumors represent some of the evidence for the involvement of such transforming oncogenes in l ;n;t~l lO human cancer. An approach to genetic-based therapy for ~, ;n~ntly expregged neoplastic disease presumably would require specif ic shutdown or inactivation of expression of the responsible gene.
Tumor suppre~EIor gene2~
A more recently discovered family of cancer-related genes are the so-called tumor-suppressor genes, sometimes referred to as antioncogenes, growth-suppressor, or cancer-6uppressor genes. Recent research suggests strongly that it is losa-of-function rn~lt~t;~nR in this 2 0 class of genes that is likely to be involved in the devel ~ of a high percentage o human cancers; more than a dozen good candidate human tumor-suppressor genes have been identif ied in several human cancers . The - tumor-suppressor genes involved in the pathogenesis of 25 rF~;nr~hl;~toma (rb), breast, colonic, and other carcinomas (p53), Wilm' 8 tumors (wt) and colonic carcinoma (dcc) have been ;~l~ntif;ed and cloned. Some aspects of their role in human tumorigenesis have been ~l ue; rl~ted .
The retinoblastoma gene (RB) is the prototype 30 tumor suppressor. Mutation of the gene has been found in a variety of human tumors (Bookstein and Lee, ~'~it. Rev.
Qn~QSL., 2:211-227 (l991); Goodrich and Lee, Bio--~;m.
BiQ~hys. ~tim, 1155:43-61 (1993); Riley et al., Arnll. Rev.
Cell Biol., 10:1-29 (1994) ) . Reintroduction o a single Wo 95117198 2 1 7 8 7 4 5 PCTNSg~/14813 copy of normal RB into tumor cells suppresses their ability to form tumors in nude ~mice (Huang et al., Sci~-nre, 242:1563-1566 ~(1988); Sumegi et al., Cell Growth Differ., 1:247-250 (1990); Bookstein ~, Sci~nce, 247:712-715 (1990); Chen ~L., C.oll rrowth Differ.. 3:119-125 (1992);
Goodrich et al . Csln . Res . . 52 :1968-1973 (1992); T~k~hF-~h;
~, Proc. Natl. ~r~ Sci. US~, 88:5257-5261 (1991)).
In addition, microinjection o~ unphosphorylated Rb protein into cells early in the Gl phase of the cell cycle blocks 10 progression into S phase, suggesting that Rb protein participates fundamentally in the regulatory processes of cell growth (Goodrich ~, ~11, 67:293-3D2 (1991) ) .
These results were further corroborated by recent observations in lines of ~nr;in,o~red mice Overexpression 15 of Rb protein from a human RB transgene result3 in growth retardation at the level of the organism (Bignon 5~, Gen~ Dev. . 7:1654-1662 (1993) ) . Moreover, in mouse embryos with complete ablation of functional Rb expression by homozygous inactivation of the RB gene, dev~ is 20 halted 1- tllrely and the embryos die in utero (~ee i~, 359:288-294 (1992); Jacks ~, ~, 359:295-300 (1992~; Clarke 8~ al., ~, 359:328-330 (1992) ) .
These experiments provide essential data es~ ~hl i FIh;n~ the importance of Rb protein in cell growth and differentiation 2 5 in vivo .
The RB gene encodes a nuclear protein which is phosphorylated on both serine and threonine residues in a cell cycle ~9~r~nrl~-nt manner (Lee ~Ll.., ~, 329: 642-645 (1987); Bu~hkovich ~LL., ~11, 58:1097-105 (1989);
Chen ~, S~ll, 58:1193-1198 (1989); DeCaprio et al., .1, 58:1085-1095 (1989) ) . During the G1 phase of the cell cycle when, ~ccor-iinr to microinjection experiments, the protein is active, Rb exists in a hypophosphorylated state (Goodrich ~, ~11, 67:293-302 (1991); Goodrich and ~ee, ~, 360 :177-179 (1992) ) . Hypo~hrsphr,rylated Rb also exists in the G0 phase. It appears to play a Wo 95/17198 PCT/USs4ll48l3 critical role in maintaining cells in this quiescent phase, where they wait to respond to G~rtPrn;7l signals and make decisions to enter the cell cycle or to differentiate ~Goodrich and Lee, Biorh;m. Bio7~hys. ArtA.. 1155:43-61 (1993); Pardee, A.B., Sci--nr~, 246:603-608 ~1989) ) .
During later G1, S, and M phases, .~b is hyperphosphorylated, probably by members of the CDK family of kinases (Lees ~LL,, T~7-1RO J.. 10:4279-4290 (1991); Lin et al., E7~1RO J.. 10:857-864 (1991); .~u ~, Mol. Cell.
10 ~i~L, 12:971-980 (1992) ) . Phosphorylation of certain residues of .~b seems to allow commitment of the cell to proliferation. The phosphorylation pattern of 7.~b protein is correlated with its function in growth inhibition, and therefore a hypothesis currently accepted is that 15 phosphorylation negatively regulates the growth suppressing function of the protein (.:~ollingsworth ~Ll ., Cul-r . o~; n .
Genet. Dev., 3 :55-62 (1993); Sherr, C. J., Tr~n,7 ~
Biol ., 4:15-18 (1994) ) . Dephosphorylation of the .~b protein occurs in mid-M phase, and results in reactivation 20 of the protein prior to the next cell cycle. Evidence strongly suggests that type 1 protein phosphatase is critical for this r7~Fh~srhnrylation (Alberts ~LL., Proc Natl. Ar;7-7. Sci. TT.q~, 90:388-392 (1993); Durfee rt al., Gen~7 Dev., 7 :555-569 (1993) ) .
The, ler7l1 ;7r ^h.7n;, by which ~b participates in these cellular activities has not been completely elucidated. A current model holds that .~b interacts with many different cellular proteins and may execute its functions through these complexes. If the function of .~b protein is to -~;nt;7;n cells at G0/Gl stage, .~b must ~corral" and inactivate other proteins which are active and essential for entering G1 progression (Lee ~, ~Q~, LVI:211-217 (1991) ) . This "corral" hypothesis is consistent with recent observations that an important growth-onh;7nr;n~ transcriptional factor, E2F-l, is tightly wo 95/17198 PCTIUS94/14813 regulated by Rb in a negative fashion (Helin ~L, ~11, 70:337-350 (1992); Kaelin et al., ~11, 70:351-364 (1992~;
Shan ~, Mol. Cell. Biol.. 12:5620-5631 (1992~; Helin et al., Mol. f~l1 . siol.. 13:6501-6508 (1993); Shan ~:L., 5 Mol . Cell . Biol . . 14 :229-309 (1994) ) . The instantly disclosed protein, H-NUC, binds to the Rb protein and thus participation in the regulation of mitosis.
The fi l; i91 breast cancer gene, BRCA-l, has been mapped at chromosome 17 q21-22 by linkage analysis. It iB
10 not clear whether this gene would behave as a tumor suppressor or ~l i nAn~ oncogene. However, the gene involved in human familial cancer ~y.~ such as Li-~raumeni syndrome, p53, apparently acta as the classical tumor suppressor; similarly, the 1088 of RB gene is 15 associated with hereditary retinoblastoma (Knudson, 1993, ~1~) .
Mult~ple Steps and Oncogenetic Cooperi3tlon setween these two extre~e pictures of transforming oncogenes and purely recessive tumor-20 suppressor genes lie a number of additional - -^hi~n; I
apparently involved in the dev.ol ~ t of neoplastic changes characteristic of many human tumors. It has been assumed for many years that most human cancer are likely to result from multiple interactive genetic de$ects, none of 25 which alone is sufficie~t but all of which are required for tumor development to occur. ~he true roles of both the cellular protooncogenes and the growth-regulating tumor-suppressor genes in neoplasia of I l; i~n cells are thought to represent a complex set of interactions between 30 these two kinds of genes.

Wo 95117198 2 1 7 8 7 4 5 PCT/US94/14813 STTMMA~Y OF TTT~ 1 N V ~ )N
This invention i8 based on the discovery of a nucleic acid molecule ~n~QAin~ a novel protein (H-NUC) 5 having tumor suppression capability. The nucleic acid molecule has been mapped to the q21-22 region of chromosome 17. The properties of H-NUC (amino acid sequence derived from the full length cDNA; ability to bind DNA and activate transcription; reaLld~ly or loss of the coding sequence 10 in some breast tumor cell lines) are all consistent with the identity of H-NUC as a nuclear protein and tumor suppressor protein. The newly disclosed full length cDNA
encodes a novel 824 amino acid protein The novel protein r~ntAinq ten 34-amino acid repeats characteristic of the 15 TPR (tetratrico peptide) protein amily.
Diagnostic methods u3ing the nucleic acid and protein H-NUC are disclosed. The present invention is also directed to the administration of wild-type H-NUC tumor suppressor gene or protein to suppress, eradicate or 20 reverse the neoplastic phenotype in established cancer cells having no endogenous wild-type H-NUC protein. This invention ~' ~trated for the first time administration of wild-type H-NUC gene to estAhl i ~hPd cancer cells to suppress or reverse the neoplastic ~helloLy~e or properties 25 of established human cancer cells lacking wild-type H-NUC
prote;n. This suppression of the neoplastic phenotype in turn suppressed or eradicated the abnormal mass of such cancer cells, i . e . tumors, which in turn can reduce the burden of such tumors on the animal which in turn can 30 increase the survival of the treated animals. The neoplastic properties which are monitored and reversed included the morphology, growth, and most significantly, the tumorigenicity of cancer cells lacking the normal H-NUC
protein. Thus, the "reduction of the burden of tumor 35 cells" in an animal is a conse~uence of the "suppression of the neopla~tic phenotype" following the administration of Wo gS/17198 2 1 7 8 7 ~ 5 PCT/US9V1~813 wild-type X-NUC tumor suppressor gene. "Neoplastic phenotypel~ i9 understood t~ refer to tlLe phenotypic changes in cellular characteristics such as morphology, growth rate (e.g., ~ hl ;n~ time), F~t--r~tir-n density, soft agar colony 5 formation, and tumoricity.
Therefore, the invention provideg H-~UC F.n~n~; n~
vectors and X-~C proteins for use in treatment of tumors or cancers, and methods of preparing H-NUC proteins and vectors suitabl~o for use ln methods of treatment.
The invention also provides methods of treatment for mammals such as humans, as well as methods of treating abnormally proliferating cells, such as cancer or tumor cells or suppressing the neoplastic phenotype. Broadly, the invention contemplates treating abnormally 15 proliferating cells, or mammals having a disease characterized by abnormally proliferating cells by any suitable method known to permit a host cells compatible-H-NUC ~n~-o~linS vector or a H-NUC protein to enter the cells to be treated so that suppression of proliferation is 2 0 achieved .
In one embodiment, the invention comprises a method of treating a disease characterized by abnormally proliferating cells, in a mammal, by administering an expression vector coding for H-NUC to the mammal having a 25 disease characterized by abnormally proliferating cells, inserting the expression vector into the :qhn~lrr-l 1 y proliferating cells, and expressing H-~UC in the abnormally proliferating cells in an amount effective to suppress proliferation of those cells, The expression vector is 30 inserted into the abnormally proliferating cells by viral infection or trlnRr~llctl~n~ liposome-mediated transfection, polybrene ~ t~-1 transfection, CaP0~ t-~l transfection and el~:LL.,~oLc~tion. The treatment is repeated as needed.

Wo sstl7lg8 ~ 1 7 ~ J 4 ~ PCT/VS94/14813 In another embodiment, the invention comprises a method of treating abnormally proliferating cells of a mammal by inserting a H-NUC onro~; n~ expression vector into the abnormally proliferating cells and expres6ing H-NUC
5 therein in amounts effective to suppress proliferation of those cells. The treatment ia repeated as needed.
In another alternative ~mho~l; t, the invention provides a DNA molecule able to suppress growth of an abnormally proliferating cell. The DNA molecule encodeR an lO Rb binding protein comprising a subsequence having at least 609~ homology with nine tetratricopeptide repeats at the-C-terminal end, provided that the DNA molecule does not also code for S. ~ '-^ yeast NUC 2, ~qDe~gill~R n1~ nq bimA
and CDC27. An example of such an Rb binding protein is H-15 NUC protein having an amino acid ser1uence substantiallyaccording to SEQ ID N0. _. In a more preferred ' - ~ , the DNA 1 1 ~rl71~ has the DNA sequence of SEQ ID
N0. l, and is expressed by an expression vector. The expression vector may be any host cell-compatible vector.
20 The vector i8 preferably selected form the group consisting of a retroviral vector, a~ adenoviral vector and a herpesvlral vector.
In another alternative embodiment, the invention provides a H-~C protein having an amino acid sequence 25 s~lhst~nt;~lly according to SEQ ID ~0. _ and biologically active f- _ ~R thereof.
In another alterative embodiment, the invention provides a method of producing a H-NUC protein by the steps of: inserting a compatible expression vector comprising a 30 H-NUC ~nrr~;n~ gene into a host cell and causing the host cell to express H-NUC protein.
In another alternative embodiment, the invention comprises a method of treating abnormally proliferating Wo 95/17198 2 ~ 7 $ 7 ~ ~ PCr/USs4114813 cells of a mam~al ex vivo by the steps of: removing a tissue sample in need of treatment from a mammal, the tisaue sample comprising abnormally proliferating cell3;
contacting the tissue sample in need of treatment with an 5 effective dose of an H-NUC Pn~ lin~ expression vector;
expressing the H-NUC in the abnormally proliferating cells in amounts effective to suppress proliferation of the abnormally proliferating cells. The treatment is repeated as nece3sary; and the treated tissue sample is returned to lO the original or another mammal. Preferably, the tissue treated P~ vivo is blood or bone marrow tissue.
In another alternative embodiment, the invention comprises a method of treating a disease characterized by abnormal ~-pll~ r pr~ l;fP~ti~n in a mammal by a process 15 comprising the steps of administering H-NUC protein to a mammal having a disease characterized by abnormally proliferating cells, such that the H-NUC protein is inserted into the ;~hnr~ l l y proliferating cells in amounts effective to suppress abnormal proliferation of the cells.
20 In a preferred embodiment, the H-NUC protein is liposome encapsulated fQr insertion into cells to be treated. The treatment is repeated as nPcP~s~y.
In another alternative embodiment, 25 oligonucleotide fragments capable of hybridizing with the H-NUC gene, and assays utilizing such fragments, are provided. These oli~n11c~Pt~tides can contain as few as 5 nucleotides, while those consisting of ahout 20 to about 30 oligonucleotides being preferred. These oligonucleotides 30 may optionally be 1 ~hPl 1 e~ with radioisotopes (such as tritium, 3'phosphorus and 35sulfur), enzymes (e.g., alkaline phosphatase and horse radish peroxidase), f luorescent compounds (for example, fluorescein, ~thidium, terbium chelate) or chemil1 ; n~Pnt compounds (such as the 35 acridinium esters, isoluminol, and the like). These and other labels, such as the ones discussed in "Non-isotopic Wo 95/17198 PCT/US94/14813 DNA Probe Techniques", L.J.Kricka, Ed., Academic Press, New York, 1992, (herein incorporated by reference,) can be used with the instant oligonucleotides. They may be u3ed in DNA
probe assays in conv~ntion~l formats, such as Southern and 5 northern blotting. Descriptions of such conventional formats can be found, for example, in "Nucleic Acid Hybridisation - A Practical Approach", B. D. Hames and S.
J. Higgin3, Bds., IRL Press, Wa3hington, D. C.,1985, herein incorporated by reference. Preferably these probes 10 capable of hybridizing with the H-NUC gene under stringent conditions. The oligonucleotides can also be used as primers in polymerase chain reaction techniques, as those tf~hn;~l--R are described in, for example, "PCR Technology", H.A. Ehrlich, Bd., Stockton Press, New York, 1989, and 15 similar references.
~ O~ OF 'I~T~! FI~'TT17T~C:
Figures lA and lB show that similar regions of RB
are required for binding H-NUC and T antigen. Figure lA is 20 a schematic of Gal4-RB fusions used to r~term;nl~ binding domains. The Gal4 DNA-binding domain (amino acids 1-147) is fused to various RB mutants. The T/ElA-binding domains of RB are shown as hatched boxes. Domains affected by mutation are depicted as spotted boxes. Figure lB 3hows 25 detection o~ interactions between H-NUC and RB mutants -v vo. Yl53 was cotransformed with the indicated panel of Gal4-RB mutants and with either the Gal4- (H-NUC) -expression clone (Gal4- (C-49) ) or YIpPTG10 . Chlorophenyl-red-i~-D-galactopyranoside colorimetric assay (CPRG) quantitation of 30 J3-galactosidase activity was done in triplicate for each transformation as described by Durfee et al. ".'~n~q Devel 7:555-569 ~1993), incorporated herein by reference. - - -_ _ Figures 2A and 2B show that H-NUC binds to nrhrlgrhr~rylated RB. Figure 2A shows GST and inframe GST

2 ~ 7~
WO 9S/1~198 PCT/US9~/14813 fusions with cDNA encoding H-NUC (GST-49l~ and the amino-terminal 273 amino acids o~ SV40 T antigen (GST-T) were expresaed in E.--coli. GST and GST-fusions were bound to glutathione-sepharose beads and washed extensively.
5 Samples were quantitated by rn~ RQ; ~ blue staining of -SDS-polyacrylamide gels, and equivalent protein amounts were used in each lane. Shown in Figure 2B are extracts made from WR2E3 cells that were mixed with bound samples for 30 minutes at room temperature. Followinr~ extengive w~4h;n~R, lO complexes were separated by SDS-pol~acrylamide gels and transferred for; Inrhl otting. The amount of RB E~rotein present and the extent of its phosphorylation in WR2E3 cells was determined by immunoprecipitation with anti-Rb mAh llD7 antibody (lane l). The blot was probed with anti-15 RB m~b llD7 and visualized by f luorography .
Figure 3 is the nucleotide (SEQ. I.D. NO.: l) andpredicted amino acid (SEQ. I.D. NO.: 2) sequences of the full length H-NUC cDNA and protein.
Figures 4A and 4B show that the full length H-NUC
20 encodes a member of the tetratricopeptide repeat (TPR) family of proteins. Figure 4A shows the location of the ten 34-residue polypeptide u~it repeats in H-NUC, S~h;7ns~crl~omyces S. ~ ' nuc2+ and ,~ergilluti n; ~ ;3n~
bimA proteins. Sketch showing location of the ten (0-9) 25 34-residue polypeptide unit repeats (TPR) in nuc2+, H-NUC
and bimA proteins. Unit repeat 3 of the three polypeptides (intl;rz~tPd by stippled box), termed 34v-repeat, lacks the conserved motif. Fir,ure 4B iB an alignment of the amino acid sequences of the 9 TPR unit repeats (l-9) in nuc2+,-H-3 0 NUC and bimA proteins . Conserved residues are boxed . TPRunit repeat 6 of all three protei~ls cnnt~;nR a glycine in poaition 6. Gly6 in repeat 6 of nuc2 is thought to be essential .

2~7~7 Wo 95/17198 4 5 PCTIU594114813 Figures 5A and 5B show that C-terminal TPR
repeats of H-NUC bind to the RB protein. Figure 5A is a schematic of Gal4-H-~UC fusions used to determine binding domains. The Gal4 tran3activation domain i~ fused to 5 various X-I~UC ~ t; r~n mutants . The TPR unit repeats of -H-NUC are shown as crosa-hatched boxes Figure 5B shows detection of interactions between RB and H-NtJC deletion mutants in vivo. Yl53 was cotransformed with the indicated panel of Gal4-H-NUC mutants and with either the Gal4-RB2 or l0 Gal4-HZ09. CPRG quantitation of b-galactosidase activity was done in triplicate for each transformation.
Figures 6A and 6B show mutation at the essential glycine of amino acid residue 640 creates a temperature-sensitive H-NUC mutant that r~;m;n;~h~ binding to RB at 15 nonpermissive temperatures. Figure 6A details the amino acid substitution in the H-~IJC (640D). The essential glycine (G) (amino acid 540) of nuc2 was substituted with aspartic acid (D) in the temperature sensitive mutant.
Thus, the glycine at 640 amino acid residue of H-NUC was 20 changed into aapartic acid (D) . Figure 6B shows interactions between RB and H-NUC (640D) mutant at 37C.
Yl53 was cotransformed with the Gal4-R32 and with either Gal4-H-~UC or Gal4-H-NUC(640D). The transformants were grown in liquid culture at 28C for 24 hour~. The overnight 25 yeast cultures were diluted with fresh medium and grown at 37C. Aliquots of yeast culture were removed at various time points to determine the yeast growth (OD660) and ~-galactosidase activity. CPRG quantitation of ~-galactosidase activity was done in triplicate for each 3 o trans~ormation .
Figures 7A and 7B 8how the production of antiserum against H-N~C and detection of H-NUC in human cell lines In Figure 7A, Gst-49l fusion proteins were used to immunize mice. The preimmune serum (lane l), 35 immune serum (lane Z), immune serum preincubated with Gst 2 1 78~45 Wo 95117198 PCTIUS9~/14813 protein (lane 3) and immune serum preincubated with Gst-49l protein (lane 4) were used for immunoprecipitation. S3s-l~hPllP-l cell lysate were ~L~ Jdl~ from K-562 cell3. Bqual amounts of cell lysate were u3ed for immunoprecipitation.
5 The resulting immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis. In Figure 7s, S3s-labelled cell lysate were prepared from CV-l cells. E~qual amounts of cell lysate were used for i ,~Lecipitation by preimmune serum (lane l), or immune aerum (lane 2 and 3).
10 The resulting immunoprecipitates were derlatured by boiling in 200 ,ul of 2% SDS ~-nn~;nin~ solution (lane 3~ and diluted with 20D Ill of NETN buffer. The immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis.
A 90 KD protein as indicated by the arrow was specifically 15 recognized by the immune serum.
Figure 8 shows that H-NUC protein has DNA-binding activity. Protein lysate o~ K562 metabolically labelled with S3s-methionine were pas3ed through double-stranded calf thymus DNA-cellulose column and eluted with increasing 20 concentrations of NaCl. The elutes were; 1nnprecipitated with either (A) mi~b llD7 to locate the RB protein or (s) with immune serum renn~ni 7PS H-NUC to locate H-NUC. (C) Aliquots of elutes were also used to incubate with glut ~ h i nnP sepharose beads .
Figure 9 shows that the gene erLcoding H-NUC is located on chromosome 17q21-22.
Figures lOA and lOB are the results of Southern blotting analysis of breast tumor cell DNA with ~-NUC as probe. DNA was extracted from cell lines and digested with ~coRI. The blots from the cell lines probed in Figure lOA
are all normal. In Figure lOB, a homozygous deletion of the ~-NUC gene was apparent in cell li~es T47D and MBl57.
A heterozygous deletion of the gene appeared in cell lines Wo 95/17198 2 ~ 7 8 7 ~ ~ PCr/llS94/14813 MB231, BT0578-7 and BT549 is suggested by decreased hybridization to the 14 kbp EcoRI fragment.
Figure 11 shows AC-H-NUC inhibits cell growth in T-47D breast tumor cells in vitro. The upper left shows 5 MDA-MB-231 cells infected with ACN (MOI 10) for 3 days and stained with crystal violet. The upper right shows T-47D
cells infected with ACN (MOI 10) . The lower left shows MDA-MB-231 cells infected with AC-H-NUC rMOI 10). The lower right shows T-47D cells infected with AC-H-NUC.
10 (+/-) indicates MDA-MB-231 cells are heterozygous for H-NUC. (-/-~ indicates T-47D cells contain a h~ ,zyy~us deletion of H-NUC (ref . Lee, W.H. ) . AC-H-NUC i8 a recombinant human adenovirus ~ntil;n;ng the H-NIJC tumor suppressor gene under -control of the human CMV promoter.
15 ACN is the same ,~ ~ inr7nt human adenovirus vector without the H-NUC tumor suppressor gene.
Figure 12 shows AC-H-NUC suppresses T-47D tumor cell growth in vitro. T47-D (deleted for ~-NUC) and MDA-MB-231 (heterozygous for H-NUC) breast cancer cells were 20 plated in 96-well plates and treated with AC-H-N~C or ACN
at infection multiplicities of 10 and 100 (guadruplicate).
Cells were permitted to grow for 5 days and 3H-thymidine incorporated into ~ nucleic acid was used as a measure of proliferation. Data (mean+SD) for AC-H-NUC are 25 plotted as a percent of the average proliferation of ACN
control at the corresponding MOI.
Figure 13 shows AC-H-NUC suppresses T-47D tumor growth in nude mice. T-47D human breast cancer cells were treated ex-vivo with ACN or AC-H-NUC at infection 30 multiplicity of 30 (N=4/group). Appr~Y;r-tely 107 cells were injected subcutaneously into the flanks of nude mice, each animal receiving ACN treated cells on one flank and AC-H-NUC cells on the contralateral flank. Tumor size3 were measured with calipers, and estimates of tumor volume WO95/17198 2 ~ 787~ PCT/USs~14813 were calculated assuming a spherical geometry. Average (:~SD) tumor volumes are plotted for tumors resulting from ACN and AC-c;3TSG cells. Average (iSD) volumeE3 of biiateral tumors from untreated cells are plotted or comparison.
DETATr~n L-~-( K~ lON OF Tr~r! ~ V~ lUrl This invention provides a novel mammalian protein designated R-NUC. H-NUC is composed of 824 amino acids ( Figure 3 ) and has a molecular weight of about 95 kD and has been ~ound to interact with unphosphorylated, full 10 length ret i nn~1 ~.ctoma (R~3) protein. It has also been discovered that H-NUC derivatives, such as a truncated version of the H-NUC protein, rnn~;n;ng the last 5iX "TPR"
regions ('~tetratricopeptide, 34-amino acid repeats) in the C-terminal region, in other words, rnnt~;ninr amino acids 15 numbers 559 through 770, bind the wild-type Rb protein.
t~;nnq to the protein which destroy its-retinnh1~ctoma-binding function may contribute to the hyperproliferative pathology which is characteristic of R~3 negative cells, e.g., breast cancer cells.
H-NUC protein is a human protein and can therefore be purified from human tissue. "Purified", when used to ll~qr~; h.o the state of H-NUC protein or nucleic acid secuence, denotes the protein or D~A encoding H-NUC free of the other proteins and molecules normally associated with or occurring with H-NUC protein or DNA encoding H-NUC in its native environment. As used herein the term "nativen refers to the form of a D~A, protein, polypeptide, antibody or a L- _ ~ thereof that is isolated from nature or that which is without an ;ntF.nt;nnAl amino acid alteration e.g., a substitution, ~ t;nn or ~;t;nn. Recovery of purified 95 kd H-~UC protein from SDS gels can be ~r~ ~1; ch~nl using methods known to the ordinarily skilled artisans, for example, first react a cell extract rnn~;n;ng H-NUC with Wo 95/17198 2 1 7 8 7 ~ 5 PCTNS94/14813 anti-H-NUC antibody to precipitate as described in more detail below. Separate the protein antibody complex and recover the 95 kd H-NUC protein by elution from the SDS gel as described in Fischer et al., Terhn;~ueg in Prot~in 5 Ch~mictry, ed. T. E. Hugli, Academic Press, Inc., pp. 36-41 (1989), incorporated herein by reference.
As used herein, the term "hyperproliferative cells" includes but is not limited to cells having the capacity for autonomous growth, i.e., existing and lO reproducing independently of normal regulatory merhiqni Pmq, Hyperproliferative diseases may be categorized as pathologic, i.e., deviating from normal cells, characterizing or constituting disea6e, or may be categorized as non-pathologic, i.e., deviation from normal 15 but not a3sociated with a disease state. Pathologic hyperproliferative cells are characteristic of the following di8ease states, thyroid hyperplasia - Grave's Disease, psoriasis, benign prostatic hypertrophy, Li-Fraumeni uy~ , cancers including breast cancer, 20 sarcomas and other n~opl~l , bladder cancer, colon cancer, lung cancer, various l.o~lkPm; ~qc and lymphomas . Examples of non-pathologic 1 y~e~Iuliferative cells are found, for instance, in mammary ductal epithelial cells during devrl t ~ of lactation and also in cells associated with 25 wound repair. Pathologic 1-y~èL~ uliferative cells characteristically exhibit loss of contact inhibition and a decline in their ability to selectively adhere which implies a change in the surface properties of the cell and a further breakdown in intercellular communication. These 30 changes include stimulation to divide and the ability to secrete proteolytic enzymes . I~O~ e~Ve~, reintroduction or supplementation of lost H-NUC function by introduction of the protein or nucleic acid encoding the protein into a cell can restore the cell to a non-hyperproliferative 35 state. Malignant proliferation of cells can then be halted .

wo 95/17198 2 1 7 ~ 7 ~ 5 PCTIUS94/14~13 As is known to those of skill in the art, the term ~protein~ means a linear polymer of amino acids joined in a specif ic sequence by peptide borLds . As used herein, the term "amino acid~ refers to ei~her the D or L
5 stereoisomer form of the amino acid, unless otherwise specifically designated. Also ~n( ~ ed within the scope of this invention are H-NUC derivatives or e~uivalents such as X-NHC truncated protein, polypeptide or H-~C peptides, having the biological activity of purif ied H-NUC protein .
10 "H-NUC derivatives" refers to compounds that depart from the linear sequence of the ~aturally occurring proteins or polypeptides, but which have amino acid alterations, i . e ., substitutions, deletions or insertions 6uch that the resulting H-N~C derivative retains H-~UC biological 15 activity. "siologicaL activity~ or "biologically active"
shall mean in one aspect having the ability to bind to the unphosphorylated rf tinnhl ~toma protein p110~. H-NUC
binding to Rb is lost at 37 degrees Celsius if, for example, the highly conserved glycine ~amino acid 640) is 20 changed to aspartic acid. These H-NUC derivatives can differ fro~ the native sequences by the deletion, substitution or insertion of one or more amino acids with related amino ~cids, for example, ~imilarly charged amino acids, or the substitution or modification of side chains 25 or functional groups.
It is further understood that limited modif ications may be made to the primary sequence of EI-NUC
without destroying its biological function, and that only a portion of the entire primary structure may be required 30 in order to e~fect activity, one aspect of which is the ability to bind pllO~. The nucleic acid sequence coding for pllOR~ has been r-hl;~h--~ in Lee, W.-H., et al., Science 235:1394-1399 (1987), incorporated herein by reference.
Another aspect of its hiolo~ l function is the ability of 35 H-NUC to bind DNA. The ability to bind DNA can be determined by one skilled in the art using the method Wo 95117198 2 1 7 8 7 ~ 5 PCr/USs4/14813 described in Lee, W -H., et al., 2~ (Ilondon) 329:642-6 4 5 ( 1 9 8 7 ), i ncorpora t ed herein by re f e rence . One biologically active H-NUC derivative is the protein comprising the last 6 TPR region3 at the C-terminal end of 5 H-NUC and the fusio~ protein-Gal4-C49, each of which is described below. The Gall4-C49 derivative has the sequence shown in Figure 3 from amino acid 559 to the end of the sequence. The TPR ~ nt~;nin~ derivative has a sequence shown in Figure 3 from amino acid 559 through 770.
l0 Moreover, fragments of the amino acid sequence shown in Figure 3, in addition to the previously described Gal4-C49 fusion protein or the TPR derivative, which retain the function of the entire protein are included within the definition of H-NUC derivative. These H-NUC derivatives 15 can be generated by restriction enzyme digestion of the nucleic acid molecule of Eigure 3 and recombinant expression of the resulting fragments. It is understood that minor modifications of primary amino acid sequence can result in proteins which have subst~nti~lly equivalent or 20 enhanced function as compared to the sequence set forth in Figure 3. These modifications may be deliberate, as through site-directed mutagenesis, or may be ;~-ciri~nt~l such as through mutation in hosts which are H-NUC
producers. All of these modifications are included as long 25 as H-~C biological function is retained.
~ Inhibitively active '~ also shall mean ~ragments and mutants of the H-NUC protein ("muteins") that act in a ~ ~n~nt negative fa3hion thereby inhibiting normal function of the protein, thereby inhibiting the biological 30 role oE H-NUC which i8 to mediate ho3t cell division and/or host cell proliferation. These proteins and fragments can be made by chemical means well known to tho3e of 3kill in the art. The mutein3 and inhibitively active ~ragment3 are useful therapeutically to promote hyperproliferation of 35 cells and to generate diagno3tic reagents such a3 Flnt i h~l; e3 .

WO 9S/17198 2 1 7 ~ 7 ~ 5 PCTNS9~/14813 These agents are useful to promote or inhibit the growth or proli~eration of a cell by contacting the cell, n vit~o or ~ vivo with ~the agent by methods described below. Accordingly, thi3 invention also provides a method 5 to inhibit the-yrowth or proliferation of a cell, such as a hyperproli~erative cell like a brea3t cancer cell, by contacting the cell with the agent. Also provided are methods of treating pathologies characterized by hyperproliferative cell growth, such as breast cancer, by 10 administering to a suitable subject these agents in an effective rnnrrntration such that cell proliferation is inhibited. A suitable subject for thi3 method includes but is not lilTIited to vertebrates, simians, murines, and human patients .
This invention also provides pharmaceutical composition3 comprising any of the compo3itions of matter described above and one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are well known in the art and include aqueous solutions such as 20 physiologically buf~ered saline or other solvents or vehicles such as glycols, glycerol, vegetable oils (eg., olive oil) or iniectable organic esters. A
pharmaceutically acceptable carrier _ can be used to administer ~-~ac or it3 derivatives to a cell in vitro or 25 to a subject in vivo.
A pharmaceutically acceptable carrier can contain a physiologically acceptable compound that acts, for example, to stabilize the protein or polypeptide or to increase or decrease the absorption o~ the agent. A
30 physiologically acceptable compound can include, for example, carbohydrates, such as glucose, sucrose or dextrans, ~ntir~ nt~l such as ascorbic acid or glutathione, rhi~1~t;nrJ agents, low molecular weight proteins or other stabilizers or excipients. Other 35 physirlor,;r~1ly acceptable ,,uu~-ds include wetting 21 7~7~5 Wo 95/17198 PCTrUSs4/l48l3 agents, emulsifying agents, dispersing agents or preservatives, which are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, 5 phenol and ascorbic acid. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the polypeptide and on the particular physio-chemical 10 characteristics of the specific polypeptide. For example, a physiologically acceptable c , ~ulld such as aluminum monosterate or gelatin is particularly useful as a delaying agent, which prolongs the rate of absorption of a pharmaceutical composition administered to a subj ect .
15 Further examples of carriers, stabilizer3 or adjuvants can be found in Martin, ~m;n~tnn~s ph~rm Sci.. 15th Ed. (Mack Publ. Co., Easton, 1975), incorporated herein by reference.
The pharmaceutical composition also can be incorporated, if desired, into liposomes, microspheres or other polymer 20 matrices (Gregoriadis, L;~os-~m~ Te~hn~logy, Vol. 1 (CRC
Press, Boca Raton, Florida 1934), which is incorporated herein by reference). T.;rn8, ~, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that 25 are relatively simple to make and administer.
Purified EI-NUC (protein) or El-N~C (nucleic acid) pharmaceutical compositions are useful to inhibit the growth of a cell, such as a breast cancer cell, by contacting the cell with the purif ied E~ JC or an active 30 fragment or composition, containing these polypeptides or proteins .
For the purposes of this invention, the contacting can be effected ~n vitro, ~x y~ or ;L~ ~Q.
When the cells are inhibited in }.~i~, the contacting is 35 effected by mixing the composition of nucleic acid or Wo 95/17198 2 ~ ~ 8 7 4 ~ PCrlUS94/14813 protein of this invention with the cell culture medium and then eeding the cells or by directly adding the nucleic acid composition or protein to the culture medium. Methods of ~lPtPrmln1n~ an effective amount are well known to those 5 of skill in the art.
This method also is useful to treat or prevent p~thnl ~; PC associatad with abnormally proliferative cells in a subject ~}~ ~i~- Thus, when the contacti~y is effected ~ m, an eective amount o the composition of lQ this invention is administered to the subj ect in an amount effective to i~hibit the proliferation of the cells in the subject. For the purpose of this invention, Usubject'' means any vertebrate, such as an animal, mammal, human, or rat. This method is especially useul to treat or prevent 15 breast cancer in a patient having non~ nl-tinn~l X-NUC
protein production.
Methods o administering a pharmaceutical are well k-nown in the art and include but are not limited to administration orally, intravenously, intr~m~c~ rly or 20 intraperitoneal. Administration can be effected cnnt; nllnusly or intermittently and will vary with the subject as is the case with other therapeutic recombinant proteins (T.~l ~ et al., ~T, IntPrferon Res. 12(2) :103-111 (1992); Aulitzky et al., El~r. J. ~n~er 27 (4) :462-467 (1991); Lantz et al., Cytok;nP 2(6) :402-406 (1990);
Su~eL~w et al., Ph~rm. Re~. 5 (8) :472-476 (1988); Demetri et al., J. flin Oncol. 7(10:1545-1553 (1989); and ~eMaistre et al., I,an~ 337:1124-1125 ~1991) ) .
Isolated nucleic acid molecules which encode 30 amino acid sequences correspondin~ to the purified mammalian H-NUC protein, H-NUC derivatives, mutein, active fragments thereo~, and anti-H-NUC antibody are further provided by this invention. As used herein, ~'nucleic acid"
shall mean single and double stranded DNA, cDNA and mRN~.

21 ~8745 WO 95/17198 PCT/Uss4/14813 In one embodiment, this nucleic acid molecule encoding H-NUC protein and fragments has the sequence or parts thereof shown in Figure 3. Also included within the scope o~ this invention are nucleic acid molecules that hybridize under 5 stringent conditions to the nucleic acid molecule or its complement, for example, the sequence of which is shown in Figure ~3. Such hybridizing nucleic acid molecules or probes, can by prepared, for example, by nick translation of the nucleic acid molecule of Figure 3, in which case the lO hybridizing nucleic acid molecules can be random fragments of the molecule, the sequence of which is shown in Figure 3. For methodology for the preparation of such fragments, see Sambrook et al., Molec~ r Cl-~n;ng A LF~hf~ratory ~nL~Ll Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
15 (1989), incorporated herein by reference. Nucleic acid f ragments of at least lO nucleotides are useful as hybridization probes. Isolated nucleic acid fragments also are useful to generate novel peptides. These peptides, in turn, are useful as immunogens for the generation of 20 polyclonal and monoclonal antibodies. Methods of preparing and using the probes and immunogens are well known in the art .
The nucleic acid sequences also are useful to inhibit cell division and proliferation of a cell. The 25 nucleic acid molecule i8 inserted into the cell, the cell is grown under conditions such that the nucleic acid is encoded to H-NUC protein in an effective r~nr~ntration 80 that the growth of the cell is inhibited. For the purposes o~ this invention, the nucleic acid can be 3 0 inserted by liposomes or lipidated DNA or by other gene carriers such as viral vectors as disclosed in Sambrook et al., ~, incorporated herein by reference. A breast cancer ce `~ ~ having mutant H-NtJC protein production is a cell that is benef ited by this method .

Wo 95/17198 2 ~ 7 8 7 4 5 PCr/USs4/14813 The treatment of human disease by gene transfer has now moved from the theoretical to the practical realm.
The f irst human gene therapy trial was begun in September 1990 and involved transfer of the adenosine ~lF.AminAqe (ADA) 5 gene into lymphocytes of a patient having an otherwise lethal defect in this enzyme, which produces immune de~iciency. The results of this initial trial have been very encouraging and have helped to s~ te further clinical trials (Culver, K.W., Anderson, W.F., slaese, R.M., Ml~m. Gen~. Ther., l99l 2:I07) .
So far most of the approved gene transfer trials in humans rely on retroviral vectors for gene transduction.
Retroviral vectors in this context are retroviruses from which all viral genes have been removed or altered so that 15 no viral proteins are made in cells infected with the vector Viral replication functions are provided by the use of retrovirus 'pA~kA~in~' cells that produce all of the viral proteins but that do not produce infectious viru3.
Introduction of the retroviral vector DNA into packaging 20 cells results in production of virions that carry vector RNA and can infect target cells, but no further virus spread occurs after infection. To distinguish this process from a natural virus infection where the virus c~ n~ to replicate and spread, the term transduction rather than 25 infection is often used.
For the purpose of illustration only, a delivery system for insertion of a nucleic acid is a replication-incompetent retroviral vector. As used herein, the term "retroviral" includes, but is not limited to, a vector or 30 delivery vehicle having the ability to selectively target and introduce ehe nucleic acid into dividing cells. As used herein, the terms "replication-incompetent" is de~ined as the inability to produce viral proteins, precluding spread of the vector in the infected host cell.

Wo 95/17198 PCT/US94114813 Another example of a replication - incompetent retroviral vector is LNL6 (Miller, A.D. et al., BioTe-~hn;~lues 7: saQ-sso (1989) ), incorporated herein by reference. The methodology of using replication-5 incompetent retroviruses for retroviral-mediated gene transfer of gene markers is well est~hl; ~h.od (Correll, P.II.
et al ., PN~.~ TT.~A 86: 8912 (1989); Bordignon, C . et al ., ~i ,~ 86:8912-52 (1989); Culver, K. et al., p~A.~ T~.CZ~ 88:3155 (1991); Rill, D.R. et al., 1L1QS~ 79 (10) :2694-700 (1991) ), 10 each incorporated herein by reference. Clinical investigations have shown that there are f ew or no adverAe effects associated with the viral vectors (Anderson, Science 256:808-13 (1992) ) .
The major advantages of retroviral vectors for 15 gene therapy are the high efficiency of gene transfer into replicating cells, the precise integration of the transferred genes into ~ 1 Ar DNA, and the lack of further spread of the sequences after gene transduction (Miller, A.D., 1~, 1992, 357:455-460).
The potential for production of replication-competent (helper) virus during the production of retroviral vectors remains a concern, although for practical purposes this problem has been solved. So far, all FDA-approved retroviral vectors have been made by using PA317 amphotropic retrovirus p~rkA~;n~ cells (Miller, A.D., and Buttimore, C., Mnlec. Cell Biol., 1986 6:2895-2902) .
Use of vectors having little or no overlap with viral sequences in the PA317 cells eliminates helper virus production even by stringent assays that allow for amplification of such events (Lynch, C.M., and Miller, A.D., J. Vir~ 1991, 65:3887-3890). other packaging cell lines are available. For example, cell lines designed for separating different retroviral coding regions onto different plasmids should reduce the possibility of helper 35 virus prn~illr~inn by le~ ' ;nAt;nn. Vectors produced by such Wo 95117198 2 1 7 ~ 7 ~ 5 PCTIIIS9~/14813 packaging cel~ lines may also provide an efficient system for human gene therapy (Miller, A.D., 1992 Nature,-357:455-4 6 0 ) .
Non-retroviral vectors have been considered or 5 use in genetic therapy. One such alternative is the adenovirus (Rosenfeld, M.A., et al., 1992, ~11, 68:143-155; Jaffe, H.A. et al., 1992, Proc. Natl. ~ 1. Sci. US~, 89:6482-6486). Major advantages of adenovirus vectors are their potential to carry large segments of DNA (36 kb lO genome), a very high titre (10l1 ml~l), ability to infecting tissuea i~Li~, ~r~ y in the lung. The most striking use of this vector so far is to deliver a human cystic fibrosig ~rAnl ' alle ,nnr~l"-tAn.e regulator (CFTR) gene by intratracheal instillation to airway epithelium in cotton 15 rat~ (Rosen~eld, M.A., et al., 5~11, 1992, 63:143-155) .
Similarly, herpes viruses may also prove valuable for human gene therapy (Wolfe, J.H., et al., 1992, Nature Genetics, 1:379-384). Of course, any other suitable viral vector may be used for genetic therapy with the present invention.
The other gene transfer method that has beerl approved by the FDA for use in humans i5 the transfer o plasmid DNA in liposomes directly to human cells in situ (Nabel, ~.G., et al., 1990 Sci~nee, 249:1285-1288).
Plasmid DNA should be easy to certify for use in human gene therapy because, unlike retroviral vectors, it can be purified to homogeneity. In A~;t;nn to l;rn --mediated DNA transfer, several other physical DNA transfer methods such as those targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins have shown promise iu human gene therapy (Wu, G.Y., et al, 1991 J. Biol.
~hem., 266:14338-~4342; Curiel, D.T., et al., 1991, Natl. ~e:~l Sci. USA, 88:8850-8854) .
The H-NUC encoding gene of the present invention may be placed by methods well known to the art into an Wo 95/17198 PCTiUS94/l48l3 expression vector such as a plasmid or viral expression vector. A plasmid expression vector may be introduced into a tumor cell by calcium phosphate transfection, liposome (for example, LIPOFECTIN)-mediated transfection, DEA33 5 Dextran-mediated transfection, polybrene-mediated transfection, electroporation and any other method of introducing DNA into a cell A viral expression vector may be introduced into a target cell in an expressible form by infection or 10 transduction. Such a viral vector ;n~ 7.~7, but is not limited to: a retrovirus, an adenovirus, a herpes virus and an avipox virus. 7ilhen H-NUC is expressed in any abnormally proliferating cell, the cell replication cycle is arrested, thereby resulting in senescence and cell death 15 and ultimately, reduction in the mass of the abnormal tissue, i . e ., the tumor or cancer. A vector able to introduce the gene construct into a target cell and able to express H-.~UC therein in cell proliferation-suppressing amounts can be administered by any effective method.
For example, a physiologically d~L~iate solution ~rmt,7in~n~ an effective c~n~nt~ation of active vectors can be administered topically, intraocularly, parenterally, orally, intrananally, intravenously, intramuscularly, subcut;7n~o7l~ly or by any other effective 2r7 means. In particular, the vector may be directly injected into a target cancer or tumor tis3ue by a needle in amounts ef fective to treat the tumor cells of the target tissue .
Alternatively, a cancer or tumor present in a body cavity such as in the eyes, gastrointestinal tract, genitourinary tract (e.g., the urinary bladder), p7l1r - ~r - and bronchial sy~tem and the like can receive a physiologically d~r ~ ate composition (e .g., a solution such as a saline or phosphate buf fer, a suspension, or an n, which ig gterile except for the vector) Wo95/17198 2~ 787~5 PCr~US94114813 rt~ntAinin~ an effective concentration of active vectors via direct inj ection with a needle or via a catheter or other delivery tube placed into the cancer or tumor afflicted hollow organ Any effective imaging device such a3 X-ray, ~ y~ or fiberoptic v;AIl:3l;7At;~n system may be used to locate the target ti~sue and guide the needle or catheter tube .
In another alternative, a physiologically appropriate solution containing an effective r~m~Pntration of active vectors can be administered syatemically into the blood circulation to treat a cancer or tumor which cannot be directly reached or anatomically isolated.
In yet another alternative, target tumor or cancer cella can be treated by introducing H-NUC protei~
into the cells by any known method. For example, liposomes are artif icial membrane vesicles that are available to deliver drugs, proteins and plasmid vectors both in vitro or in vivo (Mannino, R.J., et al., 1988, Biote~hni aues, 6:682-690) into target cells (Newton, A.C. and EIuestis, W.El., 3io--h~mi~try, 1988, 27:4655-4659; Tanswell, A.K. et al., 1990, Bio~~' ;ca et Bio~hysica Acta. 1044:269-274; and Ceccoll, J. et al, ~ollrnAl of Investigative r)err-toloqy.
1989, 93 :190-194) . Thus, ~-N[rC protein can be encapsulated at high ~ff;~ nry with liposome vesicles and delivered into mammalian cells in vitro or in vivo.
Liposome-~on~ra-ll Ated H-NUC protein may be administered topically, intraocularly, parenterally, intranasally, intratracheally, intrabronchially, intramuscularly, s~hr~ltAnPollYly or by any other effective means at a dose ~ff;~Arit~Us to treat the abnormally proliferating cells of the target tissue. The liposornes may be administered in any physiologically appropriate composition cr~t~;n;ng an effective c~n~ntration of encapsulated }~-NUC protein.

21 7~7~5 wo 95/17198 PCTIUS94114813 Other vectors are suitable for use in this invention and will be selectea for efficient delivery of the nucleic acid ~nr-~rl;n~ the ~I-NUC gene. The nucleic acid can be DNA, cDNA or RNA.
In a separate embodiment, an isolated nucleic acid molecule of this invention is operatively linked to a promoter of RNA transcription. These nucleic acid molecules are useful for the re, ' ;n~nt production of H-NUC proteins and polypeptides or as vectors for use in gene therapy .
This invention also provides a vector having inserted therein an isolated nucleic acid molecule described above. For example, suitable vectors can be, but are not limited to a plasmid, a cosmid, or a viral vector.
For examples of suitable vectors , see Sambrook et al ., ~:a, and Zhu et al., Scier~ 261:209-211 (1993~, each incoFporated herein by reference. When inserted into a suitable host cell , e . g ., a procaryotic or a eucaFyotic cell, H-NUC can be recombinantly produced. Suitable host cells can include ~ n cells, insect cells, yeast cells, and bacterial cells. See Sambrook et al., ~a, incoFporated herein by reference.
A method of producing recombinant H-NUC or its derivatives by growing the host cells described above undeF
suitable conditions such that the nucleic acid ~n~ ; n~
NUC or its fragment, is expressed, is provided by this invention. Suitable conditions can be determined using methods well known to those of skill in the art, see for example, Sambrook et al., ~a, incoFporated herein by reference. Proteins and polypeptides produced in this manner also are provided by this inventio~.
Also provided by this invention is an antibody capable of specifically foFming a complex with H-NUC

Wo 95/17198 2 l ~ 3 7 ~ ~ PCr/USs~/14813 protein or a fragment thereof. The term "antibody"
includes polyclonal antibodies and monoclonal antibodies.
The antibodies include, but are not limited to mouse, rat, rabbit or human monoclonal antibodies.
As used herein, a "antibody or polyclonal antibody" means a protein that is produced in response to Ini7~t;f~n with an antigen or receptor. The term "monoclonal antibody" means an immunoglobulin derived from a single clone of: cells. All monoclonal antibodies derived from the clone are chemically and structurally identical, and specific for a single antigenic determinant.
Laboratory methods for producing polyclonal An~;hn~l;es and monoclonal antibodies are known in the art, see Harlow and Lane, A~tihorl;es: A L~horatory Miln~ l, Cold Spring Harbor Laboratory, New York (1988), incorporated herein by reference. The monoclonal Ant ihr~ 'fl of this invention can be biologically producêd by introducing H-NUC
or a f ragment thereof into an animal , e . g ., a mouse or a rabbit. The antibody producing cells in the animal are isolated and fused with myeloma cells nr~ h-~t~ _ yeloma cells to produce hybrid cells or hybridomas. Accordingly, the hybridoma cells r~n~ ; n~ the monoclonal antibodies of this invention also are provided. Monoclonal ~nt;ho~;es produced in this manner include, but are not limited to the monoclonal antibodies described below.
Thus, using the H-NUC protein or derivative thereof, and well known methods, one of skill in the art can produce and screen the hybridoma cells and An~;ho~;es of this invention for Ant;hOrl;f~R having the ability to bind H-NUC.
This invention also provides biological active fragments of the polyclonal and monoclonal antibodies described above. These "antibody f~a~ ~11 retain some 217~74-Wo 95/17198 PCT/Uss4/l48l3 ability to 6electively bind with its antigen or; ln~ n.
Such antibody fragments can include, but are not limited to:
(1) Fab, the fragment which contains a 5 monovalent antigen-binding _ of an antibody molecule produced by digestion with the enzyme papain ~o yield an intact light chain and a portion of one heavy chain;
(2) Fab', the fragment of an antibody molecule obtained by treating with pepsin, followed by reduction, to 10 yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule;
(3) (Fab')z, the fr;~ ' of the antibody that is obtained by treating with the enzyme pepsin without 15 subsequent r~ ti~n; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds;
(4) Fv, defined as a genetically engineered ~ ~-nnt~in;n~ the variable region of the light chain and the variable region of the heavy chain expressed as two 2 0 chains; and (5) SC~, defined as a genetically ~n~;nf~ ed molecule c~n~in;n~ the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single 25 chain molecule.
Methods of making the3e fragments are known in the art, see fo3:~ example, EIarlow and Lane, ~, incorporat~d herein by reference.

WO 9~117198 2 1 7 ~ 7 4 5 PCTrUS94114813 Specific examples of ~biologically active antibody fragment~ include the CDR re~ion~3 of the ~nt;hnfl;~c~
Anti-idiotypic peptides specifically reactive with the antibodies or biologically active fragments 5 thereof also are provided by this invention. As used herein, ~anti-idiotypic peptides" are purified antibodies from one species that are i~jected into a distant species and recognized as foreign antigens and elicit a strong humoral immune response. For a -discussion of general 10 methodology, see Harlow and Lane, ~" incorporated herein by ref erence .
Also l~n ,-Rsed by this invention are proteins or polypeptides that have been recombinantly produced, biochemically synthesized, chemically synthesized or l~ chemically modified, that retain the ability to bind H-NUC
or a f ragment thereof, as the corresponding native polyclonal or mnnn~-l nn:~l antibody. The ability to ~ind with an antigen or; n~rl is determined by antigen-binding assays known in the art such as antibody capture 20 assays. See for example, Harlow and Lane, ~, incorporated herein by reference.
In one: ~ '; , an antibody or nucleic acid is linked to a detectable agent, useful to detect the H-NUC
protein and fragments in a sample using standard 25 immunochemical techniques such as; nh; ~tochemistry as ~ ;h~ by Harlow and Lane, ~_, incorporated herein by reference or as discussed in "Principles and Practice of T --f2,3~yg~, eds. C.~J. Price and D.J. Newman, Stockton Pre6s, New York, (l99l), herein incul~u, ~ted by reference.
In a separate embodiment, the antibody is administered to bind to H-NUC and alter its function within the cell. ~ The antibody is administered by methods well known to those of skill in the art and in an effective -2~ 45 Wo 95/17198 PCrlUS94/14813 concentration such that H-NUC function is restored The antibody also can be used therapeutically to inhibit cell growth or proliferation by binding to H-NUC which has lost its ability to bind to retinoblastoma protein. This 5 antibody binds to H-NUC causing it to refold into an active conf iguration . In other words, the agent restores the native biological activity of H-NUC.
The An~ihn~iP~ and nucleic acid molecules of this invention are useful to detect and determine the presence lO or absence o H-NUC protein or alternatively, an altered-H-NUC gene in a cell or a sample taken from a patient. In this way, breast cancer or susceptibility to breast cancer can be diagnosed.
The above-identified proteins, polypeptides, 15 nucleic acids, ~nt;hr~ and ~ thereof are useful for the preparation of medicaments for therapy, as outlined above .
The invention will now be described in greater detail by reference to the oIlowing examples. These 20 examples are ;nt-nr~ to illustrate but not limit the invention .
T. M~rm.c ~ ?T~cuI,Ts Using the yeast two-hybrid system, 25 clones have been isolated that interact with the C-terminal region of 25 RB (p56-R~3) . One of these is the clone C49. (Durfee :~
al ., ~en~ Dev~l ., 7: 555-569 (1993) ) . The C-terminal portion o RB protein has two n~c~n~;guous domains required for binding to the oncoproteins of several DNA
tumor viruses and a C-terminal region associated with DNA-30 binding activity. Here, one of the R~3-associated proteins has been characterized which has primary sequences and WO 95/17198 2 1 7 ~ ~ ~ 5 PCT/US94/14813 bio~AhPrn; rAl properties similar to t~iose o the nuc2 protein of S. A yeast and bimA of the AA,pergi~ R genus of f ungi . Mutation of these latter two genes in lower eucaryotic cells arrests the cell3 in metaphase, pointing 5 to an important role f or these proteins in the normal process of mitosis. These two proteins contain novel, repeating amino acids in motifs of 34 residues, so-called TRP motifs. The function of these repeats is not known, but it has been postulated that they form amphipathic lO alpha-helices that could, in principle, direct protein-protein interactions. The protein reported here is the firDt human TRP protein iDolated and reported.
Screening of cDNA libraries and so~luencing ~nalysis.
For isolation of iull length H-N[JC cDNAs, a 1.5 15 Kb BglII fragmènt of C-49, ;Aol-t~ as deccribed above using the method of Dur~ee S~LL. id., was labeled by nick translation and used to screen a human fibrobla3t cDNA
library by plaque hybridization. The cDNA inserts were 51lh~Al~n_~l intc ~coRI 5ite of the pBSK+ vector (Stratagene, 20 San Diego, Ca.) to fAr;l;tAte DNA sequencing. Sequencing was performed by using dideoxy-NlrPs and Seqn~-nAAe 2 . O
according to the manufacturer's specifications (US
Biochemicals) . Sequence analysis and homology searches were performed using DNASTAR software ~DNASTAR, Inc., 25 Madison, WI) .
Construction of GST fuaions, protein preplr~tion and ~n ~52 binding.
To construct GST-491, the plasmid C-49 was digested with BglII and the l. 3 Kb insert fragment 30 subcloned into the BamE~I site of pGEX-3X (Pharmacia, Piscataway, N.J. ) . GST-T was made by cutting Y62-25-2 with HindIII, blunt ending with Klenow, and subcloning the 823bp fragment into pGE:X-3X cut with SmaI. Expression of GST

2 1 7~7~5 fusion proteins in E. coli (Smith and Johnson, ~:n~, 67: 31-40 (1988) ) was induced with 0.1 mM IPTG. Cells were centrifuged at lOK for 5 minute~, Rnd the resultant pellet resuspended in Lysis 250 buffer (250 mM NaCl, 5 mM EDTA, 50 5 mM Tris (pH 8.0), 0.1~ NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 8 ~g leupeptin, 8 llg antipain) . 4 mg lysozyme was added, and the cells held at 4C for 30 minutes and the cells lysed by sonication. Cell debris waa removed by centrifugation (10 K for 30 minutes) and the supernatant 10 added to glutathione coated beads.
The in vi~o binding assay was performed as follows. Extracts made from 2X106 2E3 cells (Chen et al., 1992, in~a, incorporated herein by reference) were in~l1h~te-1 with beads cnntA;n;ng 2-3 llg of GST or GST fusion 15 protein~ in Lysis 150 buffer (50 mM Tris (pH 7.4), 150 mM
NaCl, 5 mM EDTA, O.lg~ NP-40, 50 mM NaF, 1 mM PMSF, l /lg leupeptin per ml, l ~g Ant;rA;n per ml) for 30 minute3 at room temperature. Complexes were washed extensively with ly5i8 150 buffer, boiled in loading buffer, and run on 7.5~
SDS-PAGE gels. Gels were tran3ferred to immobilon membranes and; f~hlotted with an anti-RB monoclonal antibody, llD7. Following addition of an i31kAl;n~_ rh~ h~t~e-conjugated 8e~ dr y antibody, bound RB protein was visualized with 5-bromo-4-chloro-3-indoly1rh~ sphAte 25 toll-;~;n;- and nitro blue t~trA~olium (BCIP, NBT; Promega, Madison, WI ) .
Antibody productlon and prot~in ~ nt~ f~ ~ ~tion.
Using methods well known to those of skill in the art, anti-H-NUC ~nt;hn~ were produced. Harlow and Lane, 30 ~ntihodies: A LAhorat~y MAn1~Al Cold Spring Harbor ~aboratory (1988), incorporated herein by reference.
Briefly, about 100 ~lg of GST-491 fusion protein was used to immunize mice and boost for three times. Sera were collected from the i ; ~d mice and used directly for the Wo95/17198 21 78745 PCrlUSs~l14813 immunoprecipitation experiment About lX107 cells from each cell line were metabolically labelled with (35S)-me~h;nn;n~
for 2 hours and subsequently lysed in ice-cold Lysis 250 buffer. The clarified lysate was incubated with various 5 ~nt;h ~ r at 4C for l hour, then protein A E~o~h~nse beads were added and incubated for another 30 minutes at 4C.
After washing extensively with lysis buffer, the beads were boiled in SDS sample buffer a7ld the immunoprecipitates were separated with 7 . 5% SDS-PAG~. For double lO immunoprecipitation, the resulting immune complexes were boiled in 200 ~l dissociation buffer I (20 mM Tris-Cl, pH

7 . 4, 50 mM NaCl, 1% SDS and 5 mM DTT) to denature the proteins. The denatured proteins were diluted with 200 ,ul dissociation buffer II (20 rnM Tris-Cl, pH 7.4, 50 mM NaCl, 15 l96 NP40 and l9r Na-deoxycholate) and re-immunoprecipitated with antibodies Cell frnctionatio~ ~LOCeil~ e8.
The procedures to separate r ' ~11e, nuclear, and cytoplasmic fractions were adapted from Lee, H.-W., et al , 20 Nat~re, (1987) ~:a, incorporated herein by reference.
All three fractions were then assayed for FB protein and-H-NUC content by immunoprecipitation as described above and aliquotes of each f7-A~t;~nq were also incubated with glutathione beads to verify the composition of each 2 5 f raction .
DNA binding Assay.
About lx107 K562 human chronic myelogenous leukemia cells (ATCC) were labeled with 3ss-meth;nninl~ then lysed in Lysis 250 buffer. Lysates were clarified by 30 centrifugation and diluted with 2 volumes of loading bu$fer (10 mM KH2PO~, pH 6.2, 1 mM MgCl~, 0.5~ NP40, l mM DTT, lO9 glycerol). The diluted extract was then applied to a DNA-c~ qf~ column (native calf thymus DNA, Pharmacia, ~7~7~
Wo 95/17198 PCTNS94/14813 Piscataway, NJ), which was inr~hAt.o~l for 1 hour at 40C withgentle shaking. The column was next washed with 5 bed volumes of loading buffer and then eluted with the same buffer cnntA;n;n~ increasing ~nnrl~ntrationS of NaCl.
5 Fractions were analyzed by immunoprecipitation with either anti-RB antibody or anti-H-NUC antibody as described above.
Aliquotes of each fractions also were incubated with glutathione beads to detect the glutathione transferase.
H-NUC Yeast Expression Pl~id; Deletion Mutants The DNA fragments derived from H-NUC cDNA were Al-h~lnnPrl into pSE1107 (Durfee ~, 1993 ~a): Clone 491 is the original one isolated by the yeast two-hybrid screening . H-NUC was constructed by insertion of 3 . 3kb XhoI Ll__ ' into a i ';f;~d pSE1107 to create an in-frame 15 fusion protein. RV (-nntA;n~ the N-terminal XhoI-EcoRV
fragment. BR208, BR207, B5 and B6 are the Sau3A partial digestion products. The Gal4 fusion protein derived from these constructs will contain aa: 1-824 for H-~UC, aa:
559-824 for 491, aa: -1-663 for RV, aa: 699-824 for BR2-8, 20 aa: 797-824 for BR2-7, aa: 559-796 for B5, and aa: 597-796 for B6, respectively. The ts mutant was generated by replacing the ~siI fragment of H-NUC with the annealed primers. The primero were as follows:
Primer 1:
25 TGGTAT~.A~'t'TA~.AATGATTTATTA~A--'rAA.'AAAAATTCAGCCTTG~At'.AAATGCA
Primer 2:
TTTCTGCAAGGCTGAAl l l L L ~ l l ~ , LAATA~ATCA l l ~ ~ATACCATGCA
All the constructs have been verified by DNA sequence 3 0 analysis .

21 787~5 Wo 95/17198 PCI'/US94114813 YeaEit tran~formation and Qua~titation Or 1~-gal~cto~:id ~e tivi ty .
Yeast transformation was carried out by using the LiOAC method as described E~reviously (Durfee et al., 1993, 5 ~), incorporated herein by reference After transformation, cells were plated on synthetic dropout medium lacking tryptophan and leucine to select f or the pre~ence of plasmids. Following 2 to 3 days of growth at 30C, single colonies from each transformation were 10 inoculated into the appropriate selecting media. 2 . 5 ml cultures were grown in the appropriate ~ rtin~ media to OD60~ 1. 0-1 2 ~ells were then prepared and permeabilized as described (Guarente, L., Meth~ F.n7.ymol. 101:181-191 (1983) ) incorporated herein by reference. For quantitation 15 using chlorophenyl-red-~-D-galactopyranoside (CP~G;
Boehringer r-nnh~;m) standard conditions were used (Durfee, 1993, ~), incorporated herein by reference.
I}-NUC bind~ to l-h~_~"h~- ylated Rs ln a region ~ ilar to thc SV40 T-llntigon binding region.
A panel o~ deletion mutants of R;3 protein were constructed. These mutants had originally been used to delineate the T-binding domain, and were subcloned into plasmids C~n~;n;n~ a Gal-4 D~A-binding domain, pAS1, as described previously (Durfee et al., 1993, ~), incorporated herein by re~erence. Two of these D~A
constructs, a Gal-4 activation domain-C-49 fusion expressing plasmid (the nr;g;n;~l cloned C-49) and YI
pPTGl0, an indicator plasmid r~n~zl;n;n~ beta-galactosidase, were used to co-transform yeast strain Yl53 (Durfee ~, 1993, ~a) . The expression level of each of the RB
fusion proteins was measured by Western blot analysis using the methods of Sambrook et al ., M- le~ r Clon;ng: A
T.~horatory M~n~ l, Cold Spring ~arbor Press , Cold Spring Harbor, N.Y. (1989), incorporated herein by reference, and 8 PCT/US94~14813 did not vary more than 2 to 3-fold. The resulting transformants were then assayed for beta-galactosidase activity as described above. A8 shown in Figure 1, binding of the C-~9 fusion protein to Gal-4-R~3 is ~i;m;n;~h~d by 5 many of the same mutations of the RB protein, including the amino acid 706 Cys to Phe point mutation which eliminates SV 4Q T-antigen binding. There is one exception; C-49 is unable to bind the Ssp mutant, which lacks the C-terminal 160 amino acids of the R3 protein, whereas T-antigen can 10 bind, albeit with reduced affinity. The M1 deletion (amino acids 612-632), which deletes part of the linker region between the two binding 311i-~ in~l, is the only mutant able to bind both H-NUC and T-antigen. Clearly, a similar but not identical region of the RB protein is required for 15 binding both T-antigen and C-49.
Next, the ability of the C-49 fusion protein to bind to pllO~ i n vitro was ~Y~mi n~d . The amino acid sequence of pllORB is disclosed in Lee, W.-H., et al., ~i~as~ 235:1394-1399 (1987), incorporated herein by 20 reference. The 1.3 kb cDNA clone (Figure 3) was expre3sed as a glutathione S-transferase (GST) fusion protein in ~
~21i (Smith and Johnson, 5i~n~ 67:31-40 (1988), incorporated herein by reference). Glutathione beads ~ t~;n;n~ equal amounts of GST-C-49 protein and two additional controls, 25 GST alone and GST-T antigen (Figure 2A) were incubated with whole cell extracts from a human retinoblastoma cell line (WERI RB27) that haa been reconstituted with the RB gene (Chen et al., C~ rowth D;ffer. 3:119-125 (1992)). In standard culture conditions, these WERI (RB+) cell3 express 30 different isoforms of RB protein, repr.o~ntin3 different phosphorylation states, as shown in Flgure 2B (lane 2).
Following extensive washing, proteins binding to the beads were analyzed by SDS-PAGE and Western blotting according to the methods disclosed in Sambrook et al, ~, 35 incorporated herein by reference. The blot shown was probed with an anti-RB antibody, llD7 (Shan et al., ~QL

217 ~5 Wo 95/17198 8 7 PCT/ITS94/14813 Cell. Biol. 12~5620-5631 (l992), incorporated herein by reference) . Under these coIlditions, H-NUC was able to bind only unphosphorylated pllO~ with an affinity similar to that o~ Gst-T, which served as a positive control. GST
5 alone does not bind to any Rb protein (see Figure lA, lanes 2 -4 ) . These results indicate that the E~-NUC protein is able to complex with only the unphosphorylated, native, full length Rs protein.
Full length cDNA and lt8 Eleqll~nC'6~.
To more thoroughly characterize the new protein, the 1. 3 kb cDNA was used as a probe to screen a human fibroblast cDNA library. From the dozen clones isolated, the longest cDNA clone, some 3.3 kb, was completely sequenced. The open reading ~rame encodes a protein o~ 824 15 amino acids (Figure 3) . The protein has 35% overall homology to two known proteins, S. ~o~e yeast nuc2 and ARr,-~illu~ n;~ bimA. Both lower eucaryotic proteins are known to be involved in mitosis, since temperature-sensitive mutants of these two genes arrest cells in 20 metaphase. The Nuc2 and bimA proteins contain ten 34-amino acid repeata organized such that one i8 at the N-terminal region and nine are cluatered at the C-terminal region, as shown in Figure 4. Similar repeat arrangement also is ~ound in the novel Rs-asaociated protein. If only the nine 25 repeat regions o~ the three proteins are compared, the sequence identity is 60% (Figure 4B) . The sequences between the first and second repeats o~ nuc2 and bimA, however, have very low homology. This poor homology also holds true for the protein from clone C-49. Based on the 30 sequence homology, the isolated clone is likely the human homolog of yeaat Nuc2 and Aspergillus bimA. Therefore, the C-49 clone was designated H-NUC.

2 ~ 7~745 Wo 95/17198 PCT/USs4/l4813 C-term;n~l repeatg 0~ H-NUC bind to RB protein.
This H-NUC protein r~r nt~linc~ neither the known-L-X- C-X-E motif, which T-antigen and adenoviru6 E:lA use to bind R3, nor- the 18-amino acid sequence of E:2F that has 5 been shown to be important for binding R~3. This finding suggests that the H-NUC protein may use a different motif to bind R;3. To help define such a binding motif, serial deletion mutants were constructed, each ~nnt~;n~nS
different regions of the H-N~C cDNA, and expressed Gal-4 lO fusion proteins, as shown in Figure 5. An in vivo binding assay, the yeast two-hybrid system previously described, (Durfee, 1993, ~), was used to determine the region of the protein ~r~nt~ining the binding motif. The full length protein and the original clone (cf~nt~inin~ six repeats) 15 bind to RB equally well. The N-terminal region r-~nt~inin~
the first repeat, however, fails to bind to RB. Deletion mutants derived from different portions of the original clone all fail to interact with RB. These data suggest that H-NUC can bind to RB in a novel manner, perhaps by 20 using a larger region of the protein with a specific secondary structure.
Changing amino acid 640 Gly to Asp creates a temperature-sen~itive II-NIJC mutant th~t r~min~ "~~~ bindlng to RB at n.. .l._, .; n~1ve temper~ture2~.
To help confirm that the binding of H-~C to R3 is physiologically significant, a single point mutation at amino acid 640 (Gly to Asp) was created by site-directed mutagenesis of the H-NUC p~otein. A similar change of Gly504 to Asp in nuc2 i9 responsible for the temperature-sensitive phenotype that arrests, t~ph~r~e progression of S.; ' - yeast (Hirano, T., Y- Hiraoka and M. Yanagida. ~;L
t'e11 Biol 106:1171-1183 (1988) ) . Since the residue Gly i5 conserved in the H-NUC protein, as well as the yeast homolog, creation of a Gly to Asp mutation would test Wo 9511~198 2 1 7 8 7 ~ 5 PCTIUS94114813 whether the H-~C protein i3 defective in binding to RB at nonpermi3sive ~emperatures. As shown in Figure 6, the H-NUC protein containing the Gly-640 mutation fails to interact with RB when yeast is growing at 37C
(nonpermissive temperature), but retai~s its ability to bind to R~3 when yeast is growing at 22C (permissive temperature) . ~ This data demonstrates a link between the temperature sensitive (ts) phenotype of presumed metaphase arrest to the Rb-binding property.
Preparation of El-NIJC antibody and id~nt-~f;~tion o~ El-NUC
protein .
To allow identification of this novel H-NUC
protein in protein gels and Western blots, mouse antibodies to it were prepared. Gst-C-49 was expressed in E. coli, (Smith and .Johnson, 1988, 13l~, and Shan et al., 1992, ~r~, each incorporated herein by reference) purlfied using glutathione beads, and used as an antigen to induce an antibody response in mice. Serum cnnt~;n;n~ polyclonal anti-H-~UC antibody was then harvested. After the antibody was available, an erythrolPllk~m;~ cell line (K562) metabolically labeled with 35S-r th;nn;nf~ was used to prepare cell lysates, which were ; nprecipitated with polyclonal antibody, as described previously. As shown in Figure 6A, a specif ic protein with molecular weight of about 95 kd was precipitated by the immune serum (lane 2) but not by preimmune 3erum . The complex f alls apart in gels. Only a 95 kDa protein is seen because of specific labelling of ~C562 protein with 35S-metl~inn;nF~. This 95 kd protein also was detected when using the GST protein for competition in; no~recipitationl demonstrating that the polyclonal antibody does not recognize GST alone. On the other hand, the original antigen is able to compete with endogenous cellular protein, and the 95 kd band becomes undetectable (lanes 3 & 4) . The P~r~C; f; ~ Y of thi s;
35 antibody was further confirmed when the primary o 9~/17198 PCT/USs4/l48l3 immunopreclpitates were denatured and re-L ~-ipitated- As shown in Figure 6B (lane 3~, the 95 kd protein ~ s the only band detected, and the background i6 clean. All ; Innl n~ical evidence suggests, then, that the 595 kd protein is the H-NUC gene product.
H-N~C protein ha~ DNA-}linding activity.
About lX107 cells were labeled with 35s_ methionine, then lysed in Lysis 250 buffer (250mM NaCl, 5mM
EDTA, 50mM Tris (pH 8.0), 0.1% NP40, lmM
10 phenylmethylsulfonyl fluoride (PMSF), 8 ug/ml of leupeptin and 8 ug/ml of antipain~ . Lysates were clarif ied by centrigugation and diluted with 2 volumes of loading buffer (lOmM KH,PO~, pH6.2, lmM MgCl2, 0.5% NP40, lmM DTT, 10 glycerol). The diluted extract was then applied to a DNA-15 cellulo6e column (native calf thymus DNA, phiqrr-ri~, Poscatawas, NJ) as previously described, and the mixture was incubated for 1 hour at 4 degrees C with gentle shaking. The column was washed with 5 bed volumes of loading bu~fer and then eluted with the same buffer 20 rnnt~in;n~ increasing rnnrpntrations of NaCl.
Fractions of each of the eluent~ were analyzed by immuno-precipitation (as described above) with antibodies against r~t;nnhl~toma protein (llD7, Figure 7A), H-NUC
(Figure 7B), or GST beads (Figure 7C). Aliquots of each 25 fraction were also incubated with gll~t~th;nn~ beads to detect glutathione transferease. RB protein has DNA-binding activity and serves as a positive control. The-H-NUC protein has similar D~A-binding activity, while gl~lt~th;nnr transferase alone has no such activity.
30 Sequence homology analysis argues that the DNA-binding region of H-NUC is located outside the ~RP region.

Wo gS/17198 ~ l 7 ~ PCT/US94114813 ~I-NITC is mapped to the ch~ 17q21-22.
In situ hybr;~l;7~t;~n of the 3H-labeled, 3.3 kb-H-NUC cD~A probe to human chromosomes showed specif ic hF~l; n~ at the q21-22 region of ChL~ 17, as shown in ~igure 9. 0 :the 320 grains from 150 cells scored, 42 (13.19c) were found to be at 17q21-22. No other sites were labeled above background. secause a portion of the probe used ~-~mt~;nF~ a sequence homologous to its pseudogene, multiple hybridizations to the short arm3 of acrocentric chromosomes were detected in every cell ~y~m;npd and were excluded from the analysia. Similar mapping results were obtained by the somatic cell-hybrid method, which also maps H-NUC to chromosome 17. The location of H-~UC is interesting because the ~Am; l; ~l breast cancer gene has been mapped to the same region and Tumor Suppressor Activity of H-NUC.
The tumor suppressor activity of H-NUC was assessed in both ; n vitl^o cell culture conditions and in nude mouse animal models. The cells lines used to a33ess H-NUC tumor suppres30r activity were MDA-Ms-231 which contains one functional allele of ~-~UC and T-47D which is a homozygous mutant of the E~-NUC locus.
Briefly, the effect of H-NUC on the proliferation of the above two cell line3 was assessed following expression of ~-NUC using a adenoviral expression vector.
ACN is a control adenoviral vector lacking a cDNA insert while AC-H-NUC is an adenoviral vector expres3ing H-NUC
under the control of the human CMV promoter.
Adenoviral Vector C~lnt~;n;n~ ~-NIJC.
To construct the adenoviral expression vector, a 2520 base pair ~ nt:~;n;n~ the ~ull length cDNA ~or Wo95117198 2 1 ~B~45 PCTIU594/14813 H-NUC was amplified by PCR from Quick Clone double-stranded placental cDNA (Clontech) . The primers used for amplification of H-NUC added a Kpn I restriction site at the 5 ' end of the fragment and a Xho I site at the 3 ' end 5 to allow for directional cloning into the multiple cloning site of pBluescript II KS+ (5 prime oligo 5 ' CGCGGTACCATGACGGTGCTGCAGGAA3 '; 3 prime oligo 5 'ATLL~Ll~AGCAGAAGTTAA~ATTCATC3 ' ) . The PCR cycles were as follows: 1 cycle at 94 degrees Celsius 1 min; 30 cycles at 10 94 degrees Cel8ius 1 min, 53 degrees Celsius 11/2 min, 72 degrees Celsius 2 min; and 1 cycle at 72 degrees Celsius 7 min. Clones were screened for the ability to produce a 95 KD protein in the TnT Coupled Reticulocyte Lysate System (Promega). The T3 promoter in the Bluescript vector allows 15 for transcription and translation of the H-NUC coding sequence by rabbit reticulocytes. One microgram of mini-lysate DNA was added per T~T Reticulocyte reaction and incubated for 1 hour at 30 degrees Celsius. Ten microliters of the reaction was mixed with loading buffer 20 and run on a 10~ polyacrylamide gel (Novex) for 1 1/2 hour at 165 V. The gel was dried down and exposed to film overnight. Four clones making full-length protein were sequenced. The H-NUC insert was recovered from the vector following digestion with Kpn I and Hind II and subcloned 25 into the KpnI-BgIII sites of pAdCMVb-vector (BgIII was filled-in to create a blunt end). All four clones rnnt~inf~fl some mutations therefore, a clone rnnt~in;n~ the correct wild-type sequence was created by ligating fragments from two clones.
To construct recombinant adenovirus, the above plasmids were linearized with Nru I and co-transfected with the large fragment of a Cla I digested dl309 mutants (Jones and Shenk, S~ , 17:683-689 (1979) ) which is incorporated herein by reference, using CaPO~ transfection kit (Stratagene). Viral plaques were isolated and recombinants identified by both restriction digest analysis and PCR

Wo 95/17198 2 ~ 7 ~ 7 ~ ~ PCT/US94114813 using primers agai~st H-NUC cDNA sequence. Recombinant virus was further purified by limiting dilution, and virus particles were purif ied and titered by standard methods (Graham and van der Erb, Virology, 52 :456-457 (1973);
5 Graham and Prevec, ~nir~ t1nn of adenovirus vectors. In:
Methn~lc in Molecul~r Biology Vol 7: GeneTr;~n~fer ~n~l k~7ression Protocols, Murray E.J. (ed.) The EIumana Press Inc., Clifton N.J., 7:109-128 (l991)), both of which are incorporated herein by ref erence .
To ensure that the H-NUC vector above expressed a protein of the appropriate size, T-47 D cells are inf ected with either the control or the H-N~C containing re'_ ' ;n:ln~ adenoviruses for a period of 24 hours at increasing multiplicities of infection (MOI~ of plaque 15 forming units of virus/cell. Cells are then washed once with PBS and harvested in lysis buffer (50mM Tris-Hcl Ph 7.5, 250 Mm NaCl, 0.19~ NP40, 50mM NaF, 5mM EDTA, 10ug/ml aprotinin, 10 ug/ml leupeptin, and lmM PMSF). Cellular proteins are separated by 10~ SDS-PAGE and transferred to 20 nitrnc.olll-ln~. Mem.branes are ;n~llh~tF.~ with an anti-H-NUC
antibody followed by sheep anti-mouse IgG con~ugated with horseradish peroxidase. Accurate expression of H-NUC
protein is visualized by ~h~m; ll.m;n~o~cence (ECL kit, Amersham) on Kodak XAR-5 film.
25 Tn Vitro.
Breast tumor cells lines, MDA-MB-231 and T-47D, were seeded at lx106 cells per 100 mm plate in Kaighn's F12/DME medium (Irvine Scientific) Sllrr'~ ted with 1056 FBS and 0 . 2 IU insulin (Sigma), for T-47D cells . The 30 plates were in~ llhaterl overnight at 37C in 796 CO2. The following day, the cells were refed with 10 mls. of growth medium and infected with either ACN control viral lysate (MOI 10) or with AC-H-NUC viral lysate (MOI 10) and allowed to incubate at 37C. After 3 days, the medium was removed ~g 78~
Wo95/17198 PCT/US94/14813 and the cells fixed with a 1:5 acetic acid-methanol solution. The cells were stained with a 209~ methanol-0.596 crystal violet solution for 30 minutes and rinsed with tap water to remove excess stain.
Infection of T-47D cells with AC-H-NUC resulted in growth inhibition of these cells by the expressed H-NUC
protein (Figure 11) . A visual observation of AC-H-N~rC
infected T-47D cells stained with crystal violet show a reduced number of cells (approximately 50~) when compared to the ACN control cells. In addition, a change in T-47D
cell morphology occurred. The cells appeared to become ~.. ,,1, q~.l, loging their normal growth characteristics. No change was apparent when T-47D cells were rh~ n~ed with control ACN virus. In contrast, the heterozygous cells, 15 MDA-MB-231, did not appear to be affected by either ACN or AC-X-NUC in vitro .
Thymidine incorporation was also used to assess the effects of H-NUC on cell proliferation. Briefly, approximately 3x103 MDA-MB-231 and T-47D cells were plated 20 in each well of a 96-well plate (Costar) and allowed to incubate overnight (37C, 79~ CO,) . Serial dilutions of ACN
or AC-H-NUC were made in DME:F12/159~ FBS/1~ glutamine, and cells were infected at multiplicity of infection (MOI) of 10 and 100 (4 replicate wells at each MOI) with each 25 adenovirus. One-half of the cell medium volume was changed 24 hours after infection and every 48 hours until harvest.
At 13 hours prior to harvest, 1 /LCi of 3H-thymidine (Amersham) was added to each well. Cells were harvested onto glass-fiber filters 5 days after infection, and 3H-30 thymidine incorporated into ~ r nucleic acid wasdetected using liquid sc;nt;11;1~ion (TopCount, Packard Instruments) . Cell proliferation (cpm/well) at each MOI
was expressed as a percentage of the average proIiferation of untreated control cells.

WO 95/17198 2 1 7 ~ 7 ~ 5 PCT/US94/14813 The results obtained showed that the proliferation of MDA~ 231 cells (heterozygous for H-NUC) was similar af ter treatment with either ACN or AC-X-NT,7C
(See Figure 12) . In contrast, a specific re3ponse to AC-H-5 NUC was observed for T-47D cells (deleted for H-NUC) that waa enhanced at higher MOI. These date demon3trate an anti-rrnl; f~r~tive effect of adenovirus-mediated gene transfer of the H-NUC gene on H-NUC altered cella.
l!:X Vlvo Gene Th~rnpy.
To asaess the effect of H-NUC expreasion on tumorigenicity, the above tumor cell lines were tested for their ability to produce tumors in nude mouse models.
Approximately 2x107 T-47D cells were plated into T225 flasks, and cells were treated with sucrose buffer 15 containing ACN or AC-H-NUC at MOI of 3 or 30. Following overnight infections, cells were harvested and approximately 107 cells were injected subc~t~n~o~ly into the left and ri~ht flanks of BALB/c nude mice (4/group) that had previously received subcutaneous pellets of 17~:-20 estradiol. One flank was injected with ACN-treated cells, while the contralateral flank was injected with AC-H-NUC
cells, each mouse serving as its own control. Animals receiving bilateral injections of untreated cell3 served as an ~ l;tinn~l control for tumor growth. Tumor dimensions 25 (length, width, height) and body weights were then measured twice per week. Tumor volumes were estimated for each animal assuming a spherical geometry with radius equal to one-half the average of the mea3ured tumor dimensions.
3 0 The results of this experiment are 3hown in Figure 13 and reveal a significant reduction in tumor growth of the cells expressing H-NUC. Briefly, twenty-one days after inoculation of cells, tumors were measurable on both sides of all animals. Tumors that arose from cells Wo 95/17198 2 ~ 7 B 7 4 ~ PCT/llSs4/14813 treated with AC-H-NUC (MOI=30) were smaller than contralateral tumors from cells treated with ACN (MOI=30~
in 4 of 4 mice Average tumor 6ize from AG-H-NUC treated cells (MOI=30) Y in~1 3maller than that of the ACN
5 treated cells (MOI=30) for the 21-day period (See Figure 3 ) . These data further indicate the tumor suppressor activity of the H-NUC protein disclosed herein.
In Vivs Tumor Suppre~sion H-I~C.
Human breast cancer cell line T-47D cells are l0 injected subcutaneously into female BALB/c athymic nude mice. Tumors are allowed to develop for 32 days. At this point, a single injection of either ACN (control) or AC-H-NUC (c~ntAinin~ H-NUC gene) adenovirus vector is injected into the peritumoral space ~uLLvu~-ding the tumor. Tumors 15 are then excised at either Day 2 or Day 7 following the adenovirus injection, and poly-A+ RNA is isolated from each tumor. Reverse transcriptase-PCR using H-NUC specific primers, are then used to detect H-NUC RNA in the treated tumors. Amplification with actin primers aerves as a 20 control for the RT-PCR reaction while a plasmid ~nnt:~;nin~
the recombinant- (H-NUC) se~uence serve~ as a positive control of the recombinant- (H-NUC) specif ic band .
In a separate experiment, T-47D cells are injected into the subc11tAn~o1~ space on the right flank of 25 mice, and tumors are allowed to grow for 2 weeks. Mice receive peritumoral injections o~ buffer or recombinant virus twice weekly for a total of 8 doses. Tumor growth is monitored throughout treatment in the control animals receiving ACN and buffer and those animals receiving AC-H-30 NUC. Body weight and survival time is also monitored.

Wo 9S117198 2 ~ ~ ~ 7 4 5 PCT/US94114813 ~xpre~ion o~ exogcneous II-N~C l" breast cancer cell line T-47D cells.
Breast cancer cells from breast cancer cell line T-47D which ~~nnt~;nc no endogeneous H-NUC, because of 5 homozygous mutation of its gene, provides a clean background for functional studies of H-NUC. T-47D cells are inf ected with comparable titers of either AC-H-NUC or control ACN v~ctor. Most colonies are indlvidually prop=~at~ into mass cultures.
Infected cells were me~=hnl;-~lly labeled with 35S
and used to prepare cell lysates to evaluate the amount of protein produced. AC-AH-NUC; n~ cted cultureg are ~
to control cells in terms of morphology, growth rate (e.g., doubling time), saturation density, soft-agar colony 15 formation and tumorigenicity in nude mice are determined.
Although the invention has been described with reference to the presently-preferred embodiment, it should be understood that various modif ications can be made without departing from the spirit of the invention.
20 Accordingly, the inverLtion is limited only by the following claims .

Claims (31)

What is claimed is:

1. An isolated and purified DNA sequence encoding an Rb binding protein comprising a subsequence having at least 60% homology with nine tetratricopeptide repeats at the C-terminal end, with the proviso that the sequence encodes for neither S.pombe yeast protein nuc2, Aspergillus nidulans bimA protein, nor S. cerevisiae yeast CDC27 protein.

2 . An isolated and purified DNA sequence encoding an Rb binding protein of claim 1, said DNA
sequence having 60% homology to amino acids 465 through 770 of Sequence I.D. No 1.

3. The isolated and purified DNA sequence of claim 1, which encodes for amino acids 465 through 770 of Sequence I. D. No. 1.

4. An isolated and purified DNA sequence according to claim 1 encoding H-NUC substantially according to the sequence set forth in Sequence I.D. No. 1.

5. A recombinant vector containing the isolated, purified DNA of claims 1, 2, 3, or 4.

6. A recombinant vector of claim 5, wherein the vector is a cosmid, plasmid, or is derived from a virus.

7. An expression vector comprising said DNA
molecule of claims 1, 2, 3, or 4, capable of inserting said DNA molecule into a mammalian host cell and of expressing the protein therein.

8. An expression vector of claim 7, wherein said expression vector is selected from the group consisting of a plasmid and a viral vector.

9. An expression vector of claim 8, wherein said viral vector is selected from the group consisting of a retroviral vector and an adenoviral vector.

10. An expression vector of claim 9, wherein said expression vector is AC-H-NUC.

11. A host-vector system for the production of a polypeptide or protein having the biological activity of H-NUC protein or biologically active derivative thereof which comprises the vector of claims 7, 8, 9, or 10 in a suitable host cell.

12. A host-vector system of claim 11, wherein the host cell is a prokaryotic cell.

13. A host-vector system of claim 11, wherein the host cell is a eukaryotic cell.

14. A pharmaceutical composition comprising the vector of claim 7 and a pharmaceutically-acceptable carrier.

15. A pharmaceutical composition comprising the vector of claim 8 and a pharmaceutically-acceptable carrier.

16. A pharmaceutical composition comprising the AC-H-NUC vector and a pharmaceutically acceptable carrier.

17. A DNA probe comprised of at least about 27 nucleotides complementary to the DNA sequence of claim 1.

18. A DNA probe of claim 17, wherein the nucleotides are complementary to the DNA sequence of Sequence I.D. No. 1.

19. An isolated and purified mammalian protein which binds Rb protein comprising an amino acid sequence having at least six tetratricopeptide repeats at its C-terminal end provided that said protein is not S. pombe yeast nuc2 protein, Aspergillus nidulans bimA protein, nor S. cerevisiae yeast CDC27 protein.

20. An isolated and purified mammalian protein of claim 19 comprising an amino acid sequence having nine tetratricopeptide repeats at its C-terminal end.

21. An isolated and purified mammalian protein of claim 20 that is H-NUC having an amino acid sequence of Sequence I.D. No. 2.

22. A method of producing a protein of claim 19 comprising the steps of:
a. inserting a compatible expression vector comprising a gene encoding a protein of claim 19 into a host cell;
b. causing said host cell to express said protein.

23. A method according to claim 22, wherein said host cell is selected from the group consisting of a prokaryotic host cell and a eukaryotic cell.

24. A method according to according to claim 23, wherein said host cell is a eukaryotic host cell which is a mammalian host cell and said expression vector is compatible with said mammalian host cell.

25. A method of supressing the neoplastic phenotype of a cancer cell having no endogenous H-NUC
protein comprising administering to such cancer cell an effective amount of the DNA of claims 1, 2, 3 or 4.

26. The method of claim 25, wherein the administering of the H-NUC gene is by recombinant vector.

27. A method of suppressing the neoplastic phenotype of a cancer cell having no endogenous H-NUC
protein comprising administering to such cancer cell the protein of claims 19 through 21.

28. An antibody which binds an Rb-binding protein which protein is comprised of a subsequence having at least six tetratricopeptide repeats at its C-terminal end provided that said protein is not S. pombe yeast protein nuc2, Aspergillus niger bimA protein, nor S.
cerevisiae CDC27 protein.

29. An antibody of claim 28, which binds to the H-NUC protein having an amino acid sequence of Sequence I.D. No. 2.

30. A hybridoma which produces a monoclonal antibody that binds to the H-NUC protein having an amino acid Sequence I.D. No. 2.

31. A method of detecting the absence of H-NUC
protein in tumor cells, comprising the steps of;
a. preparing tissue sections from a tumor;
b. contacting the antibody of claims 26 or 27 with said tissue sections; and c. detecting the presence or absence of said antibody binding to said tissue sections.