NZ278745A - Tumour suppressor gene encoding retinoblastoma binding protein - Google Patents

Description

New Zealand No. 278745 International No.

TO BE ENTERED AFTER ACCEPTANCE AND PUBLICATION Priority dates: 20.12.1993; Complete Specification Filed: 20.12.1994 Classification:^) C12N15/12.83; C12N5/10; A61K48/00; C12Q1/68; C07K14/435; C12P21/00; C07K16/18; G01N33/53 Publication date: 22 September 1997 Journal No.: 1420 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of Invention: A novel tumor suppressor gene Name, address and nationality of applicant(s) as in international application form: BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM, a company organised under the laws of the United States of America of 201 West Seventh Street, Austin, Texas 78701, United States of America New Zealand No. International No. 278745 . PCTAJS94/14813 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of Invention: A novel tumor suppressor gene Name, address and nationality of applicant(s) as in international application form: BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM, a company organised under the laws of the United States of America of 201 West Seventh Street, Austin, Texas 78701, United States of America A NOVEL TUMOR SUPPRESSOR GENE 2787 This application is a continuation-in-part of U.S. Serial No. 08/170,586 filed December 20, 1993, the contents of which are hereby incorporated by reference into 5 the present disclosure.

BACKGROUND OP THE INVENTION This invention is in the field of tumor suppressor genes (anti-oncogenes) and relates in general to products and methods for practicing broad-spectrum tumor 10 suppressor gene therapy of various human cancers. In particular, the invention relates to methods for treating tumor cells (1) administering vectors comprising a nucleic acid sequence coding for the novel protein referred to herein as H-NUC or (2) administering an effective amount of 15 a protein coded for by the nucleic acid sequence.

Cancers and tumors are the second most prevalent cause of death in the United States, causing 450,000 deaths per year. One in three Americans will develop cancer, and one in five will die of cancer (Scientific American 20 Medicine, part 12, I, 1, section dated 1987) . While substantial progress has been made in identifying some of the likely environmental and hereditary causes of cancer, the statistics for the cancer death rate indicates a need for substantial improvement in the therapy for cancer and 25 related diseases and disorder.

A number of so-called cancer genes, i.e., genes that have been implicated in the etiology of cancer, have been identified in connection with hereditary forms of cancer and in a large number of well-studied tumor cells. 30 Study of cancer genes has helped provide some understanding of the process of tumorigenesis. While a great deal more remains to be learned about cancer genes, the presently 2 known csuicer genes serve as useful models for understanding tumorigenesis.

Cancer genes are broadly classified into "oncogenes" which, when activated, promote tumorigenesis, 5 and "tumor suppressor genes" which, when damaged, fail to suppress tumorigenesis. While these classifications provide a useful method for conceptualizing tumorigenesis, it is also possible that a particular gene may play differing roles depending upon the particular allelic form 10 of that gene, its regulatory elements, the genetic background and the tissue environment in which it is operating.

One widely considered working hypothesis of cancer is as follows: (1) Most of all human cancers are 15 genetic diseases and (2) they result from the expression and/or failure of expression of specific genes (i.e. mutant versions of normal cellular growth regulatory genes or viral or other foreign genes in mammalian cells that cause inappropriate, untimely, or ectopic expression of other 20 classes of vital growth-regulatory genes.

A simplistic view of the biologic basis for neoplasia is that there are two major classes of oncogenes. The first class consists of mutated or otherwise aberrant alleles of normal cellular genes that are involved in the 25 control of cellular growth or replication. These genes are the cellular protooncogenes. When mutated, they can encode new cellular functions that disrupt normal cellular growth and replication. The consequence of these changes is the production of dominantly expressed tumor phenotypes. In 30 this model of dominantly expressed oncogenes, a view that has predominated since the emergence of the concept of the genetic and mutational basis for neoplasia, it is imagined that the persistence of a single wild-type allele is not sufficient to prevent neoplastic changes in the 3 developmental program or the growth properties of the cell. The genetic events responsible for the activation of these oncogenes therefore might be envisioned as "single-hit" events. The activation of tumorigenic activities of the 5 mye oncogene in Burkitt lymphoma, the expression of bcr-abl chimeric gene product in patients with chronic myelogenous leukemia, the activation of the H-ras and K-ras oncogenes in other tumors represent some of the evidence for the involvement of such transforming oncogenes in clinical 10 human cancer. An approach to genetic-based therapy for dominantly expressed neoplastic disease presumably would require specific shutdown or inactivation of expression of the responsible gene.

Tumor suppressor genes .

A more recently discovered family of cancer- related genes are the so-called tumor-suppressor genes, sometimes referred to as antioncogenes, growth-suppressor, or cancer-suppressor genes. Recent research suggests strongly that it is loss-of-function mutations in this 20 class of genes that is likely to be involved in the development of a high percentage of human cancers; more than a dozen good candidate human tumor-suppressor genes have been identified in several human cancers. The-tumor-suppressor genes involved in the pathogenesis of 25 retinoblastoma (rb), breast, colonic, and other carcinomas (p53) , Wilm's tumors (wt) and colonic carcinoma (dcc) have been identified and cloned. Some aspects of their role in human tumorigenesis have been elucidated.

The retinoblastoma gene (RB) is the prototype 30 tumor suppressor. Mutation of the gene has been found in a variety of human tumors (Bookstein and Lee, Crit. Rev. Oncoy.. 2:211-227 (1991); Goodrich and Lee, Biochim. Biophys. Acta. . 1155:43-61 (1993); Riley et al . . Annu. Rev. Cell Biol.. 10:1-29 (1994)). Reintroduction of a single copy of normal RB into tumor cells suppresses their ability to form tumors in nude mice (Huang et al. . Science. 242:1563-1566 (1988); Sumegi et al., Cell Growth Differ.. 1:247-250 (1990); Bookstein et al. . Science. 247:712-715 5 (1990); Chen et al. . Cell Growth Differ.. 3:119-125 (1992); Goodrich et al. Can. Res.. 52:1968-1973 (1992); Takahashi et al.. Proc. Natl. Acad. Sci. USA. 88:5257-5261 (1991)). In addition, microinjection of unphosphorylated Rb protein into cells early in the G1 phase of the cell cycle blocks 10 progression into S phase, suggesting that Rb protein participates fundamentally in the regulatory processes of cell growth (Goodrich et al. . Cell. 67:293-302 (1991)). These results were further corroborated by recent observations in lines of engineered mice. Overexpression 15 of Rb protein from a human RB transgene results in growth retardation at the level of the organism (Bignon et al. . Genes Dev.. 7:1654-1662 (1993)). Moreover, in mouse embryos with complete ablation of functional Rb expression by homozygous inactivation of the RB gene, development is 20 halted prematurely and the embryos die in utero (Lee et al. nature, 359:288-294 (1992); Jacks et al.. Nature. 359:295-300 (1992); Clarke et al. . Nature. 359:328-330 (1992)). These experiments provide essential data establishing the importance of Rb protein in cell growth and differentiation 25 in vivo.

The RB gene encodes a nuclear protein which is phosphorylated on both serine and threonine residues in a cell cycle dependent manner (Lee et al.. Nature. 329:642-645 (1987); Buchkovich et al. . Cell. 58:1097-105 (1989); 30 Chen et al. . Cellf 58:1193-1198 (1989); DeCaprio et al. . Cell. 58:1085-1095 (1989)). During the G1 phase of the cell cycle when, according to microinjection experiments, the protein is active, Rb exists in a hypophosphorylated state (Goodrich et al.. Cell. 67:293-302 (1991); Goodrich 35 and Lee, Nature. 360:177-179 (1992)). Hypophosphorylated Rb also exists in the GO phase. It appears to play a critical role in maintaining cells in this quiescent phase, where they wait to respond to external signals and make decisions to enter the cell cycle or to differentiate (Goodrich and Lee, Biorhim. Biophys. Acta.. 1155:43-61 5 (1993); Pardee, A.B., Science. 246:603-608 (1989)).

During later Gl, S, and M phases, Rb is hyperphosphorylated, probably by members of the CDK family of kinases (Lees et al.. EMBO J.. 10:4279-4290 (1991); Lin et Si., EMBP J., 10:857-864 (1991); Hu et al., MpI. Cell. 10 Biol.. 12:971-980 (1992)). Phosphorylation of certain residues of Rb seems to allow commitment of the cell to proliferation. The phosphorylation pattern of Rb protein is correlated with its function in growth inhibition, and therefore a hypothesis currently accepted is that 15 phosphorylation negatively regulates the growth suppressing function of the protein (Hollingsworth et al.. Cuur. Opin.

Genet. Dev. . 3:55-62 (1993); Sherr, C. J., Trend Cell Biol.. 4:15-18 (1994)). Dephosphorylation of the Rb protein occurs in mid-M phase, and results in reactivation 20 of the protein prior to the next cell cycle. Evidence strongly suggests that type 1 protein phosphatase is critical for this dephosphorylation (Alberts et al.. Proc. Natl. Acad. Scl. PSA. 90:388-392 (1993); Durfee et al. . Genes Dev.. 7:555-569 (1993)).

The molecular mechanisms by which Rb participates in these cellular activities has not been completely elucidated. A current model holds that Rb interacts with many different cellular proteins and may execute its functions through these complexes. If the function of Rb 3 0 protein is to maintain cells at G0/G1 stage, Rb must "corral" and inactivate other proteins which are active and essential for entering Gl progression (Lee et al.. cshsob. LVI:211-217 (1991)). This "corral" hypothesis is consistent with recent observations that an important 35 growth-enhancing transcriptional factor, E2F-1, is tightly 6 regulated by Rb in a negative fashion (Helin et al.. Cell. 70:337-350 (1992); Kaelin et al.. Cell. 70:351-364 (1992); Shan et al.. Mol. Cell. Biol.. 12:5620-5631 (1992); Helin et al.. Mol. Cell. Biol.. 13:6501-6508 (1993); Shan et al., 5 Mol. Cell. Biol.. 14:229-309 (1994)). The instantly disclosed protein, H-NUC, binds to the Rb protein and thus participation in the regulation of mitosis.

The familial breast cancer gene, BRCA-1, has been mapped at chromosome 17 q21-22 by linkage analysis. It is 10 not clear whether this gene would behave as a tumor suppressor or dominant oncogene. However, the gene involved in human familial cancer syndrome such as Li-Fraumeni syndrome, p53, apparently acts as the classical tumor suppressor; similarly, the loss of RB gene is 15 associated with hereditary retinoblastoma (Knudson, 1993, £U££a)• Multiple Steps and Oncogenetic Cooperation Between these two extreme pictures of transforming oncogenes and purely recessive tumor-20 suppressor genes lie a number of additional mechanisms apparently involved in the development of neoplastic changes characteristic of many human tumors. It has been assumed for many years that most human cancer are likely to result from multiple interactive genetic defects, none of 25 which alone is sufficient but all of which are required for tumor development to occur. The true roles of both the cellular protooncogenes and the growth-regulating tumor-suppressor genes in neoplasia of mammalian cells are thought to represent a complex set of interactions between 30 these two kinds of genes.

PCIYUS94/14813 SUMMARY OP THE INVENTION This invention is based on the discovery of a nucleic acid molecule encoding a novel protein (H-NUC) 5 having tumor suppression capability. The nucleic acid molecule has been mapped to the q21-22 region of chromosome 17. The properties of H-NUC (amino acid sequence derived from the full length cDNA; ability to bind DNA and activate transcription; rearrangement or loss of the coding sequence 10 in some breast tumor cell lines) are all consistent with the identity of H-NUC as a nuclear protein and tumor suppressor protein. The newly disclosed full length cDNA encodes a novel 824 amino acid protein. The novel protein contains ten 34-amino acid repeats characteristic of the 15 TPR (tetratrico peptide) protein family.

Diagnostic methods using the nucleic acid and protein H-NUC are disclosed. The present invention is also directed to the administration of wild-type H-NUC tumor suppressor gene or protein to suppress, eradicate or 20 reverse the neoplastic phenotype in established cancer cells having no endogenous wild-type H-NUC protein. This invention demonstrated for the first time administration of wild-type H-NUC gene to established cancer cells to suppress or reverse the neoplastic phenotype or properties 25 of established human cancer cells lacking wild-type H-NUC protein. This suppression of the neoplastic phenotype in turn suppressed or eradicated the abnormal mass of such cancer cells, i.e. tumors, which in turn can reduce the burden of such tumors on the animal which in turn can 30 increase the survival of the treated animals. The neoplastic properties which are monitored and reversed included the morphology, growth, and most significantly, the tumorigenicity of cancer cells lacking the normal H-NUC protein. Thus, the "reduction of the burden of tumor 35 cells" in an animal is a consequence of the "suppression of the neoplastic phenotype" following the administration of 278745 8 wild-type H-NUC tumor suppressor gene. "Neoplastic phenotype" is understood to refer to the phenotypic changes in cellular characteristics such as morphology, growth rate (e.g., doubling time), saturation density, soft agar colony 5 formation, and tumoricity.

Therefore, the invention provides H-NUC encoding vectors and H-NUC proteins for use in treatment of tumors or cancers, and methods of preparing H-NUC proteins and vectors suitable for use in methods of treatment.

The invention also discloses methods of treatment for mammals such as humans, as well as methods of treating abnormally proliferating cells, such as cancer or tumor cells or suppressing the neoplastic phenotype. Broadly, the invention contemplates treating abnormally 15 proliferating cells, or ' mammals having a disease characterized by abnormally proliferating cells by any suitable method known to permit a host cells compatible-H-NUC encoding vector or a H-NUC protein to enter the cells to be treated so that suppression of proliferation is 20 achieved.

In one embodiment, the invention discloses a method of treating a disease characterized by abnormally proliferating cells, in a mammal, by administering an expression vector coding for H-NUC to the mammal having a 25 disease characterized by abnormally proliferating cells, inserting the expression vector into the abnormally proliferating cells, and expressing H-NUC in the abnormally proliferating cells in an amount effective to suppress proliferation of those cells, The expression vector is 3 0 inserted into the abnormally proliferating cells by viral infection or transduction, liposome-mediated transfection, polybrene-mediated transfection, CaPO, mediated transfection and electroporation. The treatment is repeated as needed. 278745 In another embodiment, the invention comprises a method of treating abnormally proliferating cells of a mammal in vitro by inserting a H-NOC encoding expression vector into the abnormally proliferating cells and expressing H-NUC 5 therein in amounts effective to suppress proliferation of those cells. The treatment is repeated as needed.

In another alternative embodiment, the invention provides a DNA molecule able to suppress growth of an abnormally proliferating cell. The DNA molecule encodes a 10 retinoblastoma (Rb) binding protein comprising a sequence having at least six tetratricopeptide repeats at the C-terminal end of the protein, wherein the protein sequence comprises amino acids 559 to 824 of Sequence ID. No. 2, provided that the DNA sequence does not also code for S. pombe yeast NUC 2, Asperqillas nidulans bimA and S. cerevisiae yeast CDC27 protein. An example of such an Rb binding protein is H-NUC protein having an amino acid sequence substantially according to SEQ. I.D. NO. 2. In a more preferred embodiment, the DNA molecule has the DNA sequence of SEQ. I.D. NO. 1, and is expressed by an expression vector. The expression vector may be any host cell-compatible vector. The vector is preferably selected from the group consisting of a retroviral vector, an adenoviral vector and a herpesviral vector.

In another alternative embodiment, the invention provides a H-NUC protein having an amino acid sequence 25 substantially according to SEQ. I.D. NO. 2 and biologically active fragments thereof.

In another alterative embodiment, the invention provides a method of producing a H-NUC protein by the steps of: inserting a compatible expression vector comprising a 30 H-NUC encoding gene into a host cell and causing the host cell to express H-NUC protein.

In another alterr^tiverenibc^±^^^~|the invention comprises a method of treating--abnormally -9 JUL proliferating 278745 cells of a mammal ex vivo by the steps of: removing a tissue sample in need of treatment from a mammal, the tissue sample comprising abnormally proliferating cells; contacting the tissue sample in need of treatment with an 5 effective dose of an H-NUC encoding expression vector; expressing the H-NUC in the abnormally proliferating cells in amounts effective to suppress proliferation of the abnormally proliferating cells. The treatment is repeated as necessary; and the treated tissue sample is returned to 10 the original or another mammal. Preferably, the tissue treated ex vivo is blood or bone marrow tissue.

In another alternative embodiment, the invention discloses a method of treating a disease characterized by abnormal cellular proliferation in a mammal/by a process 15 comprising the steps of administering H-NUC protein to a mammal having a disease characterized by abnormally proliferating cells, such that the H-NUC protein is inserted into the abnormally proliferating cells in amounts effective to suppress abnormal proliferation of the cells. 20 In a preferred embodiment, the H-NUC protein is liposome encapsulated for insertion into cells to be treated. The treatment is repeated as necessary.

In another alternative embodiment, oligonucleotide fragments capable of hybridizing with the H-NUC gene, and assays utilizing such fragments, are provided. These oligonucleotides can contain as few as 5 nucleotides, while those consisting of about 20 to about 3 0 oligonucleotides being preferred. These oligonucleotides may optionally be labelled with radioisotopes (such as tritium, 32phosphorus and 35sulfur) , enzymes (e.g., alkaline phosphatase and horse radish peroxidase), fluorescent compounds (for example, fluorescein, Ethidium, terbium chelate) or chemiluminescent compounds (such as the acridinium esters, isoluminol, and the like). These and other labels, such as the ones discussed in "Non-isotopic N.Z. PATENT OFFICE -9 JUL 1997 t-kcsivH 11 DNA Probe Techniques", L.J.Kricka, Ed., Academic Press, New York, 1992, (herein incorporated by reference,) can be used with the instant oligonucleotides. They may be used in DNA probe assays in conventional formats, such as Southern and 5 northern blotting. Descriptions of such conventional formats can be found, for example, in "Nucleic Acid Hybridisation - A Practical Approach", B. D. Hames and S. J. Higgins, Eds., IRL Press, Washington, D. C.,1985, herein incorporated by reference. Preferably these probes 10 capable of hybridizing with the H-NUC gene under stringent conditions. The oligonucleotides can also be used as primers in polymerase chain reaction techniques, as those techniques are described in, for example, "PCR Technology", H.A. Ehrlich, Ed., Stockton Press, New York, 1989, and 15 similar references.

DESCRIPTION OF THE FIGURES Figures 1A and IB show that similar regions of RB are required for binding H-NUC and T antigen. Figure 1A is 20 a schematic of Gal4-RB fusions used to determine binding domains. The Gal4 DNA-binding domain (amino acids 1-147) is fused to various RB mutants. The T/ElA-binding domains of RB are shown as hatched boxes. Domains affected by mutation are depicted as spotted boxes. Figure IB shows 25 detection of interactions between H-NUC and RB mutants in vivo. Y153 was cotransformed with the indicated panel of Gal4-RB mutants and with either the Gal4- (H-NUC) -expression clone (Gal4-(C-49)) or YIpPTGlO. Chlorophenyl-red-£-D-galactopyranoside colorimetric assay (CPRG) quantitation of 30 iS-galactosidase activity was done in triplicate for each transformation as described by Durfee et al., Genes Devel. 7:555-569 (1993), incorporated herein by reference.

Figures 2A and 2B show that H-NUC binds to unphosphorylated RB. Figure 2A shows GST and inframe GST 12 fusions with cDNA encoding H-NUC (GST-491) and the amino-terminal 273 amino acids of SV40 T antigen (GST-T) were expressed in E. coli. GST and GST-fusions were bound to glutathione-sepharose beads and washed extensively.

Samples were quantitated by Coomassie blue staining of-SDS-polyacrylamide gels, and equivalent protein amounts were used in each lane. Shown in Figure 2B are extracts made from WR2E3 cells that were mixed with bound samples for 30 minutes at room temperature. Following extensive washings, 10 complexes were separated by SDS-polyacrylamide gels and transferred for immunoblotting. The amount of RB protein present and the extent of its phosphorylation in WR2E3 cells was determined by immunoprecipitation with anti-Rb mAb 11D7 antibody (lane 1) . The blot was probed with anti-15 RB mAb 11D7 and visualized by fluorography.

Figure 3 is the nucleotide (SEQ. I.D. NO.: 1) and predicted amino acid (SEQ. I.D. NO.: 2) sequences of the full length H-NUC cDNA and protein.

Figures 4A and 4B show that the full length H-NUC 20 encodes a member of the tetratricopeptide repeat (TPR) family of proteins. Figure 4A shows the location of the ten 34-residue polypeptide unit repeats in H-NUC, Schizosaccharomyces S. nombe nuc2+ and Aspergillus nidulana bimA proteins. Sketch showing location of the ten (0-9) 25 34-residue polypeptide unit repeats (TPR) in nuc2+, H-NUC and bimA proteins. Unit repeat 3 of the three polypeptides (indicated by stippled box), termed 34v-repeat, lacks the conserved motif. Figure 4B is an alignment of the amino acid sequences: of the 9 TPR unit repeats (1-9) in nuc2+,-H-3 0 NUC and bimA proteins. Conserved residues are boxed. TPR unit repeat 6 of all three proteins contains a glycine in position 6. Gly6 in repeat 6 of nuc2 is thought to be essential. 13 Figures 5A and 5B show that C-terminal TPR repeats of H-NUC bind to the RB protein. Figure 5A is a schematic of Gal4-H-NUC fusions used to determine binding domains. The Gal4 transactivation domain is fused to 5 various H-NUC deletion mutants. The TPR unit repeats of-H-NUC are shown as cross-hatched boxes. Figure 5B shows detection of interactions between RB and H-NUC deletion mutants in vivo. Y153 was cotransformed with the indicated panel of Gal4-H-NUC mutants and with either the Gal4-RB2 or 10 Gal4-H209. CPRG quantitation of b-galactosidase activity was done in triplicate for each transformation.

Figures 6A and 6B show mutation at the essential glycine of amino acid residue 640 creates a temperature-sensitive H-NUC mutant that diminishes binding to RB at 15 nonpermissive temperatures. Figure 6A details the amino acid substitution in the H-NUC (640D). The essential glycine (G) (amino acid 540) of nuc2 was substituted with aspartic acid (D) in the temperature sensitive mutant. Thus, the glycine at 640 amino acid residue of K-NUC was 20 changed into aspartic acid (D) . Figure 6B shows interactions between RB ar.d H-NUC(640D) mutant at 37°C. Y153 was cotransformed with the Gal4-RB2 and with either Gal4-H-NUC or Gal4-H-NUC(640D). The transformants were grown in liquid culture at 28°C for 24 hours. The overnight 25 yeast cultures were diluted with fresh medium and grown at 37°C. Aliquots of yeast culture were removed at various time points to determine the yeast growth (OD66O) and £-galactosidase activity. CPRG quantitation of £- galactosidase activity was done in triplicate for each 30 transformation.

Figures 7A and 7B show the production of antiserum against H-NUC and detection of H-NUC in human cell lines. In Figure 7A, Gst-491 fusion proteins were used to immunize mice. The preimmune serum (lane 1) , 35 immune serum (lane 2), immune serum preincubated with Gst 14 protein (lane 3) and immune serum preincubated with Gst-491 protein (lane 4) were used for immunoprecipitation. S35-labelled cell lysate were prepared from K-562 cells. Equal amounts of cell lysate were used for immunoprecipitation.

The resulting immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis. In Figure 7B, S35-labelled cell lysate were prepared from CV-1 cells. Equal amounts of cell lysate were used for immunoprecipitation by preimmune serum (lane 1), or immune serum (lane 2 and 3). 10 The resulting immunoprecipitates were denatured by boiling in 200 fil of 2% SDS containing solution (lane 3) and diluted with 200 fil of NETN buffer. The immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis. A 90 KD protein as indicated by the arrow was specifically 15 recognized by the immune serum.

Figure 8 shows that H-NUC protein has DNA-binding activity. Protein lysate of K562 metabolically labelled with S35-methionine were passed through double-stranded calf thymus DNA-cellulose column and eluted with increasing 20 concentrations of NaCl. The elutes were immunoprecipitated with either (A) mAb 11D7 to locate the RB protein or (B) with immune serum recognizes H-NUC to locate H-NUC. (C) Aliquots of elutes were also used to incubate with glutathione sepharose beads.

Figure 9 shows that the gene encoding H-NUC is located on chromosome 17q21-22.

Figures 10A and 10B are the results of Southern blotting analysis of breast tumor cell DNA with H-NUC as probe. DNA was extracted from cell lines and digested with 30 EcoRI. The blots from the cell lines probed in Figure 10A are all normal. In Figure 10B, a homozygous deletion of the H-NUC gene was apparent in cell lines T47D and MB157. A heterozygous deletion of the gene appeared in cell lines MB231, BT0578-7 and BT549 is suggested by decreased hybridization to the 14 kbp EcoRI fragment.

Figure 11 shows AC-H-NUC inhibits cell growth in T-47D breast tumor cells in vitro. The upper left shows 5 MDA-MB-231 cells infected with ACN (MOI 10) for 3 days and stained with crystal violet. The upper right shows T-47D cells infected with ACN (MOI 10) . The lower left shows MDA-MB-231 cells infected with AC-H-NUC (MOI 10) . The lower right shows T-47D cells infected with AC-H-NUC. 10 (+/-) indicates MDA-MB-231 cells are heterozygous for H-NUC. (-/-) indicates T-47D cells contain a homozygous deletion of H-NUC (ref. Lee, W.H.). AC-H-NUC is a recombinant human adenovirus containing the H-NUC tumor suppressor gene under control of the human CMV promoter. 15 ACN is the same recombinant human adenovirus vector without the H-NUC tumor suppressor gene.

Figure 12 shows AC-H-NUC suppresses T-47D tumor cell growth in vitro. T47-D (deleted for H-NUC) and MDA-MB-231 (heterozygous for H-NUC) breast cancer cells were 20 plated in 96-well plates and treated with AC-H-NUC or ACN at infection multiplicities of 10 and 100 (quadruplicate). Cells were permitted to grow for 5 days and 3H-thymidine incorporated into cellular nucleic acid was used as a measure of proliferation. Data (mean±SD) for AC-H-NUC are 25 plotted as a percent of the average proliferation of ACN control at the corresponding MOI.

Figure 13 shows AC-H-NUC suppresses T-47D tumor growth in nude mice. T-47D human breast cancer cells were treated ex-vivo with ACN or AC-H-NUC at infection 30 multiplicity of 30 (N=4/group) . Approximately 107 cells were injected subcutaneously into the flanks of nude mice, each animal receiving ACN treated cells on one flank and AC-H-NUC cells on the contralateral flank. Tumor sizes were measured with calipers, and estimates of tumor volume 16 were calculated assuming a spherical geometry. Average (±SD) tumor volumes are plotted for tumors resulting from ACN and AC-cBTSG cells. Average (±SD) volumes of bilateral tumors from untreated cells are plotted for comparison.

DETAILED DESCRIPTION OF THE INVENTION This invention provides a novel mammalian protein designated H-NUC. H-NUC is composed of 824 amino acids (Figure 3) and has a molecular weight of about 95 kD and has been found to interact with unphosphorylated, full 10 length retinoblastoma (RB) protein. It has also been discovered that H-NUC derivatives, such as a truncated version of the H-NUC protein, containing the last six "TPR" regions ("tetratricopeptide, 34-amino acid repeats) in the C-terminal region, in other words, containing amino acids 15 numbers 559 through 770, bind the wild-type Rb protein. Mutations to the protein which destroy its-retinoblastoma-binding function may contribute to the hyperproliterative pathology which is characteristic of RB negative cells, e.g., breast cancer cells.

H-NUC protein is a human protein and can therefore be purified from human tissue. "Purified", when used to describe the state of H-NUC protein or nucleic acid sequence, denotes the protein or DNA encoding H-NUC free of the other proteins and molecules normally associated with 25 or occurring with H-NUC protein or DNA encoding H-NUC in its native environment. As used herein the term "native" refers to the form of a DNA, protein, polypeptide, antibody or a fragment thereof that is isolated from nature or that which is without an intentional amino acid alteration e.g., 3 0 a substitution, deletion or addition. Recovery of purified 95 kd H-NUC protein from SDS gels can be accomplished using methods known to the ordinarily skilled artisans, for example, first react a cell extract containing H-NUC with 17 anti-H-NUC antibody to precipitate as described in more detail below. Separate the protein antibody complex and recover the 95 kd H-NUC protein by elution from the SDS gel as described in Fischer et al., Teehnicmsfi in Protein 5 Chemistry, ed. T. E. Hugli, Academic Press, Inc., pp. 36-41 (1989), incorporated herein by reference.

As used herein, the term "hyperprol iterative cells" includes but is not limited to cells having the capacity for autonomous growth, i.e., existing and 10 reproducing independently of normal regulatory mechanisms. Hyperproliferative diseases may be categorized as pathologic, i.e., deviating from normal cells, characterizing or constituting disease, or may be categorized as non-pathologic, i.e., deviation from normal 15 but not associated with a disease state. Pathologic hyperproliferative cells are characteristic of the following disease states, thyroid hyperplasia - Grave's Disease, psoriasis, benign prostatic hypertrophy, Li-Fraumeni syndrome, cancers including breast cancer, 20 sarcomas and other neoplasms, bladder cancer, colon cancer, lung cancer, various leukemias and lymphomas. Examples of non-pathologic hyperproliferative cells are found, for instance, in mammary ductal epithelial cells during development of lactation and also in cells associated with 25 wound repair. Pathologic hyperproliferative cells characteristically exhibit loss of contact inhibition and a decline in their ability to selectively adhere which implies a change in the surface properties of the cell and a further breakdown in intercellular communication. These 30 changes include stimulation to divide and the ability to secrete proteolytic enzymes. Moreover, reintroduction or supplementation of lost H-NUC function by introduction of the protein or nucleic acid encoding the protein into a cell can restore the cell to a non-hyperproliferative 35 state. Malignant proliferation of cells can then be halted. 18 As is known to those of skill in the art, the term "protein" means a linear polymer of amino acids joined in a specific sequence by peptide bonds. As used herein, the term "amino acid" refers to either the D or L 5 stereoisomer form of the amino acid, unless otherwise specifically designated. Also encompassed within the scope of this invention are H-NUC derivatives or equivalents such as H-NUC truncated protein, polypeptide or H-NUC peptides, having the biological activity of purified H-NUC protein. 10 "H-NUC derivatives" refers to compounds that depart from the linear sequence of the naturally occurring proteins or polypeptides, but which have amino acid alterations, i.e., substitutions, deletions or insertions such that the resulting H-NUC derivative retains H-NUC biological 15 activity. "Biological activity" or "biologically active" shall mean in one aspect having the ability to bind to the unphosphorylated retinoblastoma protein pllO*®. H-NUC binding to Rb is lost at 37 degrees Celsius if, for example, the highly conserved glycine (amino acid 640) is 20 changed to aspartic acid. These H-NUC derivatives can differ from the native sequences by the deletion, substitution or insertion of one or more amino acids with related amino acids, for example, similarly charged amino acids, or the substitution or modification of side chains 25 or functional groups.

It is further understood that limited modifications may be made to the primary sequence of H-NUC without destroying its biological function, and that only a portion of the entire primary structure may be required 3 0 in order to effect activity, one aspect of which is the ability to bind pllO*®. The nucleic acid sequence coding for pllO™ has been published in Lee, W.-H., et al., Science 235:1394-1399 (1987), incorporated herein by reference. Another aspect of its biological function is the ability of 35 H-NUC to bind DNA. The ability to bind DNA can be determined by one skilled in the art using the method 19 described in Lee, W.-H., et al., Nature (London) 329:642-645 (1987), incorporated herein by reference. One biologically active H-NUC derivative is the protein comprising the last 6 TPR regions at the C-terminal end of 5 H-NUC and the fusion protein-Gal4-C49, each of which is described below. The Gall4-C49 derivative has the sequence shown in Figure 3 from amino acid 559 to the end. of the sequence. The TPR containing derivative has a sequence shown in Figure 3 from amino acid 559 through 770. 10 Moreover, fragments of the amino acid sequence shown in Figure 3, in addition to the previously described Gal4-C49 fusion protein or the TPR derivative, which retain the function of the entire protein are included within the definition of H-NUC derivative. These H-NUC derivatives 15 can be generated by restriction enzyme digestion of the nucleic acid molecule of Figure 3 and recombinant expression of the resulting fragments. It is understood that minor modifications of primary amino acid sequence can result in proteins which have substantially equivalent or 20 enhanced function as compared to the sequence set forth in Figure 3. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental such as through mutation in hosts which are H-NUC producers. All of these modifications are included as long 25 as H-NUC biological function is retained.

"Inhibitively active" also shall mean fragments and mutants of the H-NUC protein ("muteins") that act in a dominant negative fashion thereby inhibiting normal function of the protein, thereby inhibiting the biological 30 role of H-NUC which is to mediate host cell division and/or host cell proliferation. These proteins and fragments can be made by chemical means well known to those of skill in the art. The muteins and inhibitively active fragments are useful therapeutically to promote hyperproliteration of 35 cells and to generate diagnostic reagents such as antibodies.

These agents are useful to promote or inhibit the growth or proliferation of a cell by contacting the cell, in vitro or in vivo with the agent by methods described below. Accordingly, this invention also provides a method 5 to inhibit the growth or proliferation of a cell, such as a hyperproliferative cell like a breast cancer cell, by contacting the cell with the agent. Also provided are methods of treating pathologies characterized by hyperproliferative cell growth, such as breast cancer, by 10 administering to a suitable subject these agents in an effective concentration such that cell proliferation is inhibited. A suitable subject for this method includes but is not limited to vertebrates, simians, murines, and human patients.

This invention also provides pharmaceutical compositions comprising any of the compositions of matter described above and one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are well known in the art and include aqueous solutions such as 2 0 physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, vegetable oils (eg., olive oil) or injectable organic esters. A pharmaceutically acceptable carrier can be used to administer H-NUC or its derivatives to a cell in vitro or 25 to a subject in vivo.

A pharmaceutically acceptable carrier can contain a physiologically acceptable compound that acts, for example, to stabilize the protein or polypeptide or to increase or decrease the absorption of the agent. A 30 physiologically acceptable compound can include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients. Other 35 physiologically acceptable compounds include wetting 21 agents, emulsifying agents, dispersing agents or preservatives, which are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, 5 phenol and ascorbic acid. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the polypeptide and on the particular physio-chemical 10 characteristics of the specific polypeptide. For example, a physiologically acceptable compound such as aluminum monosterate or gelatin is particularly useful as a delaying agent, which prolongs the rate of absorption of a pharmaceutical composition administered to a subject. 15 Further examples of carriers, stabilizers or adjuvants can be found in Martin, Remington's Pharm. Hri . . 15th Ed. (Mack Publ. Co., Easton, 1975), incorporated herein by reference. The pharmaceutical composition also can be incorporated, if desired, into liposomes, microspheres or other polymer 20 matrices (Gregoriadis, Liposome Technology. Vol. 1 (CRC Press, Boca Raton, Florida 1984), which is incorporated herein by reference). Liposomes, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that 25 are relatively simple to make and administer.

Purified H-NUC (protein) or H-NUC (nucleic acid) pharmaceutical compositions are useful to inhibit the growth of a cell, such as a breast cancer cell, by contacting the cell with the purified H-NUC or an active 30 fragment or composition, containing these polypeptides or proteins.

For the purposes of this invention, the contacting can be effected in vitro, ex vivo or in vivo -When the cells are inhibited in vitro, the contacting is 35 effected by mixing the composition of nucleic acid or 22 protein of this invention with the cell culture medium and then feeding the cells or by directly adding the nucleic acid composition or protein to the culture medium. Methods of determining an effective amount are well known to those 5 of skill in the art.

This method also is useful to treat or prevent pathologies associated with abnormally proliferative cells in a subject in vivo. Thus, when the contacting is effected in vivo- an effective amount of the composition of 10 this invention is administered to the subject in an amount effective to inhibit the proliferation of the cells in the subject. For the purpose of this invention, "subject" means any vertebrate, such as an animal, mammal, human, or rat. This method is especially useful to treat or prevent 15 breast cancer in a patient having non-functional H-NUC protein production.

Methods of administering a pharmaceutical are well known in the art and include but are not limited to administration orally, intravenously, intramuscularly or 20 intraperitoneal. Administration can be effected continuously or intermittently and will vary with the subject as is the case with other therapeutic recombinant proteins (Landmann et al., J. Interferon Rsr. 12(2):103-111 (1992); Aulitzky et al., Eur. J. Cancer 27 (4):462-467 25 (1991); LantZ et al., Cytokine 2(6):402-406 (1990); Supersaxo et al., Pharm. Res. 5(8):472-476 (1988); Demetri et al., J. Clin. Oncol. 7(10:1545-1553 (1989); and LeMaistre et al., Lancet 337:1124-1125 (1991)).

Isolated nucleic acid molecules which encode 30 amino acid sequences corresponding to the purified mammalian H-NUC protein, H-NUC derivatives, mutein, active fragments thereof, and anti-H-NUC antibody are further provided by this invention. As used herein, "nucleic acid" shall mean single and double stranded DNA, cDNA and mRNA.

In one embodiment, this nucleic acid molecule encoding H-NUC protein and fragments has the sequence or parts thereof shown in Figure 3. Also included within the scope of this invention are nucleic acid molecules that hybridize under 5 stringent conditions to the nucleic acid molecule or its complement, for example, the sequence of which is shown in Figure 3. Such hybridizing nucleic acid molecules or probes, can by prepared, for example, by nick translation of the nucleic acid molecule of Figure 3, in which case the 10 hybridizing nucleic acid molecules can be random fragments of the molecule, the sequence of which is shown in Figure 3. For methodology for the preparation of such fragments, see Sambrook et al., Molecular Cloning; A Laboratory Manual Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 15 (1989), incorporated herein by reference. Nucleic acid fragments of at least 10 nucleotides are useful as hybridization probes. Isolated nucleic acid fragments also are useful to generate novel peptides. These peptides, in turn, are useful as immunogens for the generation of 20 polyclonal and monoclonal antibodies. Methods of preparing and using the probes and immunogens are well known in the art.

The nucleic acid sequences also are useful to inhibit cell division and proliferation of a cell. The 25 nucleic acid molecule is inserted into the cell, the cell is grown under conditions such that the nucleic acid is encoded to H-NUC protein in an effective concentration so that the growth of the cell is inhibited. For the purposes of this invention, the nucleic acid can be 30 inserted by liposomes or lipidated DNA or by other gene carriers such as viral vectors as disclosed in Sambrook et al., supra. incorporated herein by reference. A breast cancer cell having mutant H-NUC protein production is a cell that is benefited by this method. 24 The treatment of human disease by gene transfer has now moved from the theoretical to the practical realm. The first human gene therapy trial was begun in September 1990 and involved transfer of the adenosine deaminase (ADA) 5 gene into lymphocytes of a patient having an otherwise lethal defect in chis enzyme, which produces immune deficiency. The results of this initial trial have been very encouraging and have helped to stimulate further clinical trials (Culver, K.W., Anderson, W.F. , Blaese, 10 R.M., Hum. Gene. Ther.. 1991 2:107).

So far most of the approved gene transfer trials in humans rely on retroviral vectors for gene transduction. Retroviral vectors in this context are retroviruses from which all viral genes have been removed or altered so that 15 no viral proteins are made in cells infected with the vector. Viral replication functions are provided by the use of retrovirus 'packaging' cells that produce all of the viral proteins but that do not produce infectious virus. Introduction of the retroviral vector DNA into packaging 20 cells results in production of virions that carry vector RNA and can infect target cells, but no further virus spread occurs after infection. To distinguish this process from a natural virus infection where the virus continues to replicate and spread, the term transduction rather than 25 infection is often used.

For the purpose of illustration only, a delivery system for insertion of a nucleic acid is a replication-incompetent retroviral vector. As used herein, the term "retroviral" includes, but is not limited to, a vector or 30 delivery vehicle having the ability to selectively target and introduce the nucleic acid into dividing cells. As used herein, the terms "replication-incompetent" is defined as the inability to produce viral proteins, precluding spread of the vector in the infected host cell.

Another example of a replication-incompetent retroviral vector is LNL6 (Miller, A.D. et al., BioTechnigues 7:980-990 (1989)), incorporated herein by-reference. The methodology of using replication- incompetent retroviruses for retroviral-mediated gene transfer of gene markers is well established (Correll, P.H. et al., PNAS USA 86:8912 (1989); Bordignon, C. et al., PNAS IISA 86:8912-52 (1989); Culver, K. et al., PNAS USA 88:3155 (1991); Rill, D.R. et al., Blood 79(10):2694-700 (1991)), 10 each incorporated herein by reference. Clinical investigations have shown that there are few or no adverse effects associated with the viral vectors (Anderson, Science 256:808-13 (1992)).

The major advantages of retroviral vectors for 15 gene therapy are the high efficiency of gene transfer into replicating cells, the precise integration of the transferred genes into cellular DNA, and the lack of further spread of the sequences after gene transduction (Miller, A.D., Nature. 1992, 357:455-460).

The potential for production of replication- competent (helper) virus during the production of retroviral vectors remains a concern, although for practical purposes this problem has been solved. So far, all FDA-approved retroviral vectors have been made by using 25 PA317 amphotropic retrovirus packaging cells (Miller, A.D., and Buttimore, C. , Molec. Cell Biol.. 1986 6:2895-2902). Use of vectors having little or no overlap with viral sequences in the PA317 cells eliminates helper virus production even by stringent assays that allow for 30 amplification of such events (Lynch, C.M. , and Miller, A.D., J. Viral. . 1991, 65:3887-3890). Other packaging cell lines are available. For example, cell lines designed for separating different retroviral coding regions onto different plasmids should reduce the possibility of helper 35 virus production by recombination. Vectors produced by such 26 packaging cell lines may also provide an efficient system for human gene therapy (Miller, A.D., 1992 Nature.-357:455-460) .

Non-retroviral vectors have been considered for 5 use in genetic therapy. One such alternative is the adenovirus (Rosenfeld, M.A., et al., 1992, Cell. 68:143-155; Jaffe, H-A. et al., 1992, Proc. Natl. Acad. Sci. USA. 89:6482-6486). Major advantages of adenovirus vectors are their potential to carry large segments of DNA (36 kb 10 genome) , a very high titre (1011 ml"1) , ability to infecting tissues in situ, especially in the lung. The most striking use of this vector so far is to deliver a human cystic fibrosis transmembrane conductance regulator (CFTR) gene by intratracheal instillation to airway epithelium in cotton 15 rats (Rosenfeld, M.A., et al.. Cell. 1992, 63:143-155). Similarly, herpes viruses may also prove valuable for human gene therapy (Wolfe, J.H., et al. , 1992, Nature Genetics. 1:379-384). Of course, any other suitable viral vector may be used for genetic therapy with the present invention.

The other gene transfer method that has been approved by the FDA for use in humans is the transfer of plasmid DNA in liposomes directly to human cells in situ (Nabel, E.G., et al., 1990 Science. 249:1285-1288). Plasmid DNA should be easy to certify for use in human gene 25 therapy because, unlike retroviral vectors, it can be purified to homogeneity. In addition to liposome-mediated DNA transfer, several other physical DNA transfer methods such as those targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins have shown promise 30 in human gene therapy (Wu, G.Y., et al, 1991 J. Biol . Chem.. 266:14338-14342; Curiel, D.T., et al., 1991, Proc. Natl. Acad. Sci. USA. 88:8850-8854).

The H-NUC encoding gene of the present invention may be placed by methods well known to the art into an expression vector such as a plasmid or viral expression vector. A plasmid expression vector may be introduced into a tumor cell by calcium phosphate transfection, liposome (for example, LIPOFECTIN)-mediated transfection, DEAE 5 Dextran-mediated transfection, polybrene-mediated transfection, electroporation and any other method of introducing DNA into a cell.

A viral expression vector may be introduced into a target cell in an expressible form by infection or 10 transduction. Such a viral vector includes, but is not limited to: a retrovirus, an adenovirus, a herpes virus and an avipox virus. When H-NUC is expressed in any abnormally proliferating cell, the cell replication cycle is arrested, thereby resulting in senescence and cell death 15 and ultimately, reduction in the mass of the abnormal tissue, i.e., the tumor or cancer. A vector able to introduce the gene construct into a target cell and able to express H-NUC therein in cell proliferation-suppressing amounts can be administered by any effective method.

For example, a physiologically appropriate solution containing an effective concentration of active vectors can be administered topically, intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously or by any other effective 25 means. In particular, the vector may be directly injected into a target camcer or tumor tissue by a needle in amounts effective to treat the tumor cells of the target tissue.

Alternatively, a cancer or tumor present in a body cavity such as in the eyes, gastrointestinal tract, 30 genitourinary tract (e.g., the urinary bladder), pulmonary and bronchial system and the like can receive a physiologically appropriate composition (e.g., a solution such as a saline or phosphate buffer, a suspension, or an emulsion, which is sterile except for the vector) containing an effective concentration of active vectors via direct injection with a needle or via a catheter or other delivery tube placed into the cancer or tumor afflicted hollow organ. Any effective imaging device such as X-ray, 5 sonogram, or fiberoptic visualization system may be used to locate the target tissue and guide the needle or catheter tube.

In another alternative, a physiologically appropriate solution containing an effective concentration 10 of active vectors can be administered systemically into the blood circulation to treat a cancer or tumor which cannot be directly reached or anatomically isolated.

In yet another alternative, target tumor or cancer cells can be treated by introducing H-NUC protein 15 into the cells by any known method. For example, liposomes are artificial membrane vesicles that are available to deliver drugs, proteins and plasmid vectors both in vitro or in vivo (Mannino, R.J.( et al. , 1988, Biotechniqraeg. 6:682-690) into target cells (Newton, A.C. and Huestis, 20 W.H., Biochemistry. 1988, 27:4655-4659; Tanswell, A.K. et al., 1990, Bioehmica et Biophvsira Acta. 1044:269-274; and Ceccoll, J. et al, Journal of Investigative Dermatology. 1989, 93:190-194). Thus, H-NUC protein can be encapsulated at high efficiency with liposome vesicles and delivered 25 into mammalian cells in vitro or in vivo.

Liposome-encapsulated H-NUC protein may be administered topically, intraocularly, parenterally, intranasal ly, intratracheally, intrabronchially, intramuscularly, subcutaneously or by any other effective 30 means at a dose efficacious to treat the abnormally proliferating cells of the target tissue. The liposomes may be administered in any physiologically appropriate composition containing an effective concentration of encapsulated H-NUC protein. 29 Other vectors are suitable for use in this invention and will be selected for efficient delivery of the nucleic acid encoding the H-NUC gene. The nucleic acid can be DNA, cDNA or RNA.

In a separate embodiment, an isolated nucleic acid molecule of this invention is operatively linked to a promoter of RNA transcription. These nucleic acid molecules are useful for the recombinant production of H-NUC proteins and polypeptides or as vectors for use in gene 10 therapy.

This invention also provides a vector having inserted therein an isolated nucleic acid molecule described above. For example, suitable vectors can be, but are not limited to a plasmid, a cosmid, or a viral vector. 15 For examples of suitable vectors, see Sambrook et al., supraf and Zhu et al. , Science 261:209-211 (1993), each incorporated herein by reference. When inserted into a suitable host cell, e.g., a procaryotic or a eucaryotic cell, H-NUC can be recombinantly produced. Suitable host 20 cells can include mammalian cells, insect cells, yeast cells, and bacterial cells. See Sambrook et al., supra. incorporated herein by reference.

A method of producing recombinant H-NUC or its derivatives by growing the host cells described above under 25 suitable conditions such that the nucleic acid encoding-H-NUC or its fragment, is expressed, is provided by this invention. Suitable conditions can be determined using methods well known to those of skill in the art, see for example, Sambrook et al., supra. incorporated herein by 3 0 reference. Proteins and polypeptides produced in this manner also are provided by this invention.

Also provided by this invention is an antibody capable of specifically forming a complex with H-NUC protein or a fragment thereof. The term "antibody" includes polyclonal antibodies and monoclonal antibodies. The antibodies include, but are not limited to mouse, rat, rabbit or human monoclonal antibodies.

As used herein, a "antibody or polyclonal antibody" means a protein that is produced in response to immunization with an antigen or receptor. The term "monoclonal antibody" means an immunoglobulin derived from a single clone of cells. All monoclonal antibodies derived 10 from the clone are chemically and structurally identical, and specific for a single antigenic determinant.

Laboratory methods for producing polyclonal antibodies and monoclonal antibodies are known in the art, see Harlow and Lane, Antibodies: A laboratory Manual. Cold 15 Spring Harbor Laboratory, New York (1988), incorporated herein by reference. The monoclonal antibodies of this invention can be biologically produced by introducing H-NUC or a fragment thereof into an animal, e.g., a mouse or a rabbit. The antibody producing cells in the animal are 20 isolated and fused with myeloma cells or heteromyeloma cells to produce hybrid cells or hybridomas. Accordingly, the hybridoma cells producing the monoclonal antibodies of this invention also are provided. Monoclonal antibodies produced in this manner include, but are not limited to the 25 monoclonal antibodies described below.- Thus, using the H-NUC protein or derivative thereof, and well known methods, one of skill in the art can produce and screen the hybridoma cells and antibodies of this invention for antibodies having the ability to bind 30 H-NUC.

This invention also provides biological active fragments of the polyclonal and monoclonal antibodies described above. These "antibody fragments" retain some -~.v WO 95/17198 31 ability to selectively bind with its antigen or immunogen. Such antibody fragments can include, but are not limited to: (1) Fab, the fragment which contains a 5 monovalent antigen-binding fragment of an antibody molecule produced by digestion with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab", the fragment of an antibody molecule obtained by treating with pepsin, followed by reduction, to yield an intact light chain and a portion of the heaivy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab1) 2, the fragment of the antibody that is obtained by treating with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab* fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (5) SCA, defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.

Methods of making these fragments are known in the art, see for example, Harlow and Lane, supra. incorporated herein by reference.

WO 95/17198 PCT/US94/14813 32 Specific examples of "biologically active antibody fragment" include the CDR regions of the antibodies.

Anti-idiotypic peptides specifically reactive with the antibodies or biologically active fragments 5 thereof also are provided by this invention. As used herein, "anti.-idiotypic peptides" are purified antibodies from one species that are injected into a distant species and recognized as foreign antigens and elicit a strong humoral immune response. For a discussion of general 10 methodology, see Harlow and Lane, supra. incorporated herein by reference.

Also encompassed by this invention are proteins or polypeptides that have been recombinantly produced, biochemically synthesized, chemically synthesized or 15 chemically modified, that retain the ability to bind H-NUC or a fragment thereof, as the corresponding native polyclonal or monoclonal antibody. The ability to bind with an antigen or immunogen is determined by antigen-binding assays known in the art such as antibody capture 20 assays. See for example, Harlow and Lane, supra. incorporated herein by reference.

In one embodiment, an antibody or nucleic acid is linked to a detectable agent, useful to detect the H-NUC protein and fragments in a sample using standard 25 immunochemical techniques such as immunohistochemistry as described by Harlow and Lane, supra. incorporated herein by reference or as discussed in "Principles and Practice of Immunoassays", eds. C.J. Price and D.J. Newman, Stockton Press, New York, (1991), herein incorporated by reference. 3 0 In a separate embodiment, the antibody is administered to bind to H-NUC and alter its function within the cell. The antibody is administered by methods well known to those of skill in the art and in an effective 33 concentration such that H-NUC function is restored. The antibody also can be used therapeutically to inhibit cell growth or proliferation by binding to H-NUC which has lost its ability to bind to retinoblastoma protein. This 5 antibody binds to H-NUC causing it to refold into an active configuration. In other words, the agent restores the native biological activity of H-NUC.

The antibodies and nucleic acid molecules of this invention are useful to detect and determine the presence 10 or absence of H-NUC protein or alternatively, an altered-H-NUC gene in a cell or a sample taken from a patient. In this way, breast cancer or susceptibility to breast cancer can be diagnosed.

The above-identified proteins, polypeptides, 15 nucleic acids, antibodies, and fragments thereof are useful for the preparation of medicaments for therapy, as outlined above.

The invention will now be described in greater detail by reference to the following examples. These 20 examples are intended to illustrate but not limit the invention.

EXPERIMENTAL METHODS AND RESULTS Using the yeast two-hybrid system, 25 clones have been isolated that interact with the C-terminal region of 25 RB (p56-RB). One of these is the clone C49. (Durfee et aJL*., Gene Devel.. 7:555-569 (1993)). The C-terminal portion of RB protein has two noncontiguous domains required for binding to ^he oncoproteins of several DNA tumor viruses and a C-terminal region associated with DNA-3 0 binding activity. Here, one of the RB-associated proteins has been characterized which has primary sequences and 34 biochemical properties similar to those of the nuc2 protein of S. pombe yeast and bimA of the Aspergillus genus of fungi. Mutation of these latter two genes in lower eucaryotic cells arrests the cells in metaphase, pointing 5 to an important role for these proteins in the normal process of mitosis. These two proteins contain novel, repeating amino acids in motifs of 34 residues, so-called TRP motifs. The function of these repeats is not known, but it has been postulated that they form amphipathic 10 alpha-helices that could, in principle, direct protein-protein interactions. The protein reported here is the first human TRP protein isolated and reported.

Screening of cDNA libraries and sequencing analysis.

For isolation of full length H-NUC cDNAs, a 1.5 15 Kb Bglll fragment of C-49, isolated as described above using the method of Durfee et al. id., was labeled by nick translation and used to screen a human fibroblast cDNA library by plaque hybridization. The cDNA inserts were subcloned into EcoRI site of the pBSK+ vector (Stratagene, 20 San Diego, Ca.) to facilitate DNA sequencing. Sequencing was performed by using dideoxy-NTPs and Sequenase 2.0 according to the manufacturer's specifications (US Biochemicals). Sequence analysis and homology searches were performed using DNASTAR software (DNASTAR, Inc., 25 Madison, WI).

Construction of GST fusions/ protein preparation and in Vitro binding.

To construct GST-491, the plasmid C-49 was digested with Bglll and the 1.3 Kb insert fragment 30 subcloned into the BamHI site of pGEX-3X (Pharmacia, Piscataway, N.J.). GST-T was made by cutting Y62-25-2 with Hindlll, blunt ending with Klenow, and subcloning the 823bp fragment into pGEX-3X cut with Smal. Expression of GST fusion proteins in E. coli (Smith and Johnson, Gene. 67:31-40 (1988)) was induced with 0.1 mM IPTG. Cells were centrifuged at 10K for 5 minutes, and the resultant pellet resuspended in Lysis 250 buffer (250 niM NaCl, 5 mM EDTA, 50 5 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF) , 8 fig leupeptin, 8 fig antipain) . 4 mg lysozyme was added, and the cells held at 4°C for 30 minutes and the cells lysed by sonication. Cell debris was removed by centrifugation (10 K for 30 minutes) and the supernatant 10 added to glutathione coated beads.

The in vitro binding assay was performed as follows. Extracts made from 2xl06 2E3 cells (Chen et al., 1992, infra. incorporated herein by reference) were incubated with beads containing 2-3 fig of GST or GST fusion 15 proteins in Lysis 150 buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 5 rnM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM PMSF, 1 fig leupeptin per ml, 1 fig antipain per ml) for 30 minutes at room temperature. Complexes were washed extensively with lysis 150 buffer, boiled in loading buffer, and run on 7.5% 20 SDS - PAGE gels. Gels were transferred to immobilon membranes and immunoblotted with an anti-RB monoclonal antibody, 11D7. Following addition of an alkaline-phosphatase-conjugated secondary antibody, bound RB protein was visualized with 5-bromo-4-chloro-3-indolylphosphate 25 toluidinium and nitro blue tetrazolium (BCIP, NBT; Promega, Madison, WI).

Antibody production and protein identification.

Using methods well known to those of skill in the art, anti-H-NUC antibodies were produced. Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988), incorporated herein by reference. Briefly, about 100 fig of GST-491 fusion protein was used to immunize mice and boost for three times. Sera were collected from the immunized mice and used directly for the 36 immunoprecipitation experiment. About lxlO7 cello from each cell line were metabolically labelled with (3SS) -methionine for 2 hours and subsequently lysed in ice-cold Lysis 250 buffer. The clarified lysate was incubated with various 5 antibodies at 4°C for 1 hour, then protein A sepharose beads were added and incubated for another 30 minutes at 4°C. After washing extensively with lysis buffer, the beads were boiled in SDS sample buffer and the immunoprecipitates were separated with 7.5% SDS-PAGE. For double immunoprecipitation, the resulting immune complexes were boiled in 200 /il dissociation buffer I (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% SDS and 5 mM DTT) to denature the proteins. The denatured proteins were diluted with 200 /zl dissociation buffer II (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 15 1% NP40 and 1% Na-deoxycholate) and re-immunoprecipitated with antibodies.

Cell fractionation procedures.

The procedures to separate membrane, nuclear, and cytoplasmic fractions were adapted from Lee, H.-W., et al., 20 Nature. (1987) supra, incorporated herein by reference. All three fractions were then assayed for RB protein and-H-NUC content by immunoprecipitation as described above and aliquotes of each fractions were also incubated with glutathione beads to verify the composition of each 25 fraction.

DNA binding assay.

About lxl07 K562 human chronic myelogenous leukemia cells (ATCC) were labeled with 35S-methionine, then lysed in Lysis 250 buffer. Lysates were clarified by 30 centrifugation and diluted with 2 volumes of loading buffer (10 mM KH2P04, pH 6.2, 1 mM MgCl2, 0.5% NP40, 1 mM DTT, 10% glycerol). The diluted extract was then applied to a DNA-cellulose column (native calf thymus DNA, Pharmacia, 37 Piscataway, NJ) , which was incubated for 1 hour at 40°C with gentle shaking. The column was next washed with 5 bed volumes of loading buffer and then eluted with the same buffer containing increasing concentrations of NaCl. 5 Fractions were analyzed by immunoprecipitation with either anti-RB antibody or anti-H-NUC antibody as described above. Aliquotes of each fractions also were incubated with glutathione beads to detect the glutathione transferase.

H-NUC Yeast Expression Plasmid; Deletion Mutants The DNA fragments derived from H-NUC cDNA were subcloned into pSE1107 (Durfee et al.. 1993 supra): Clone 4 91 is the original one isolated by the yeast two-hybrid screening. H-NUC was constructed by insertion of 3.3kb Xhol fragment into a modified pSE1107 to create an in-frame 15 fusion protein. RV contains the N-terminal XhoI-EcoRV fragment. BR208, BR207, B5 and B6 are the Sau3A partial digestion products. The Gal4 fusion protein derived from these constructs will contain aa: 1-824 for H-NUC, aa: 559-824 for 491, aa: -1-663 for RV, aa: 699-824 for BR2-8, 20 aa: 797-824 for BR2-7, aa: 559-796 for B5, and aa: 597-796 for B6, respectively. The ts mutant was generated by replacing the Nsil fragment of H-NUC with the annealed primers. The primers were as follows: Primer 1: 2 5 TGGTATGACCTAGGAATGATTTATTACAAGCAAGAAAAATTCAGCCTTGCAGAAATGCA Primer 2: TTTCTGCAAGGCTGAATTTTTCTTGCTTGTAATAAATCATTCCTGGTCATACCATGCA All the constructs have been verified by DNA sequence 3 0 analysis. 38 Yeast transformation and Quantitation of S-galactosidase activity.

Yeast transformation was carried out by using the LiOAC method as described previously (Durfee et al., 1993, 5 supra), incorporated herein by reference. After transformation, cells were plated on synthetic dropout medium lacking tryptophan and leucine to select for the presence of plasmids. Following 2 to 3 days of growth at 3 0°C, single colonies from each transformation were 10 inoculated into the appropriate selecting media. 2.5 ml cultures were grown in the appropriate selecting media to ODS00 1.0-1.2. Cells were then prepared and permeabilized as described (Guarente, L. , Methods Enzymol. 101:181-191 (1983)) incorporated herein by reference. For quantitation 15 using chlorophenyl-red-fi-D-galactopyranoside (CPRG? Boehringer Mannheim) standard conditions were used (Durfee, 1993, supra). incorporated herein by reference.

H-MUC binds to unphosphorylated RB in a region similar to the SV40 T-antigen binding region.

A panel of deletion mutants of RB protein were constructed. These mutants had originally been used to delineate the T-binding domain, and were subcloned into plasmids containing a Gal-4 DNA-binding domain, pASl, as described previously (Durfee et al., 1993, supra)f 25 incorporated herein by reference. Two of these DNA constructs, a Gal-4 activation domain-C-49 fusion expressing plasmid (the original cloned C-49) and YI pPTGlO, an indicator plasmid containing beta-galactosidase, were used to co-transform yeast strain Y153 (Durfee et al. . 30 1993, supra) . The expression level of each of the RB fusion proteins was measured by Western blot analysis using the methods of Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), incorporated herein by reference, and did not vary more than 2 to 3-fold. The resulting transformants were then assayed for beta-galactosidase activity as described above. As shown in Figure 1, binding of the C-49 fusion protein to Gal-4-RB is diminished by 5 many of the same mutations of the RB protein, including the amino acid 706 Cys to Phe point mutation which eliminates SV 40 T-antigen binding. There is one exception; C-49 is unable to bind the Ssp mutant, which lacks the C-terminal 160 amino acids of the RB protein, whereas T-antigen can 10. bind, albeit with reduced affinity. The Ml deletion (amino acids 612-632), which deletes part of the linker region between the two binding subdomains, is the only mutant able to bind both H-NUC and T-antigen. Clearly, a similar but not identical region of the RB protein is required for 15 binding both T-antigen and C-49.

Next, the ability of the C-49 fusion protein to bind to P110RB in vitro was examined. The amino acid sequence of pllO*8 is disclosed in Lee, W.-H., et al., Science 235:1394-1399 (1987), incorporated herein by 20 reference. The 1.3 kb cDNA clone (Figure 3) was expressed as a glutathione S-transferase (GST) fusion protein in E. coli (Smith and Johnson, Gene 67:31-40 (1988), incorporated herein by reference). Glutathione beads containing equal amounts of GST-C-49 protein and two additional controls, 25 GST alone and GST-T antigen (Figure 2A) were incubated with whole cell extracts from a human retinoblastoma cell line (WERI RB27) that has been reconstituted with the RB gene (Chen et al., Cf>11 Growth Differ. 3:119-125 (1992)). In standard culture conditions, these WERI (RB+) cells express 30 different isoforms of RB protein, representing different phosphorylation states, as shown in Figure 2B (lane 2) . Following extensive washing, proteins binding to the beads were analyzed by SDS-PAGE arid Western blotting according to the methods disclosed in Sambrook et al, supra. 35 incorporated herein by reference. The blot shown was probed with an anti-RB antibody, 11D7 (Shan et al., Mol.

PCT/CS94/J4813 40 Cell. Biol. 12:5620-5631 (1992), incorporated herein by reference). Under these conditions, H-NUC was able to bind only unphosphorylated pllO*® with an affinity similar to that of Gst-T, which served as a positive control. GST 5 alone does not bind to any Rb protein (see Figure 1A, lanes 2-4) . These results indicate that the H-NUC protein is able to complex with only the unphosphorylated, native, full length RB protein.

Full length cDNA and its sequence.

To more thoroughly characterize the new protein, the 1.3 kb cDNA was used as a probe to screen a human fibroblast cDNA library. From the dozen clones isolated, the longest cDNA clone, some 3.3 kb, was completely sequenced. The open reading frame encodes a protein of 824 15 amino acids (Figure 3) . The protein has 35% overall homology to two known proteins, S. pombe yeast nuc2 and Aspergillus nidulano bimA. Both lower eucaryotic proteins are known to be involved in mitosis, since temperature-sensitive mutants of these two genes arrest cells in 20 metaphase. The Nuc2 and bimA proteins contain ten 34-amino acid repeats organized such that one is at the N-terminal region and nine are clustered at the C-terminal region, as shown in Figure 4. Similar repeat arrangement also is found in the novel RB-associated protein. If only the nine 25 repeat regions of the three proteins are compared, the sequence identity is 60% (Figure 4B) . The sequences between the first and second repeats of nuc2 and bimA, however, have very low homology. This poor homqlogy also holds true for the protein from clone C-49. Based on the 3 0 sequence homology, the isolated clone is likely the human homolog of yeast Nuc2 and Aspergillus bimA. Therefore, the C-49 clone was designated H-NUC. 41 C-terminal repeats o£ H-NUC bind to RB protein.

This H-NUC protein contains neither the known-L-X-C-X-E motif, which T-antigen and adenovirus E1A use to bind RB, nor the 18-amino acid sequence of E2F that has 5 been shown to be important for binding RB. This finding suggests that the H-NUC protein may use a different motif to bind RB. To help define such a binding motif, serial deletion mutants were constructed, each containing different regions of the H-NUC cDNA, and expressed Gal-4 10 fusion proteins, as shown in Figure 5. An in vivo binding assay, the yeast two-hybrid system previously described, (Durfee, 1993, supra). was used to determine the region of the protein containing the binding motif. The full length protein and the original clone (containing six repeats) 15 bind to RB equally well. The N-terminal region containing the first repeat, however, fails to bind to RB. Deletion mutants derived from different portions of the original-clone all fail to interact with RB. These data suggest that H-NUC can bind to RB in a novel manner, perhaps by 20 using a larger region of the protein with a specific secondary structure.

Changing amino acid 640 Gly to Asp creates a temperature-sensitive H-NUC xnutant that diminishes binding to RB at nonpermissive temperatures.

To help confirm that the binding of H-NUC to RB is physiologically significant, a single point mutation at amino acid 640 (Gly to Asp) was created by site-directed mutagenesis of the H-NUC protein. A similar change of Gly504 to Asp in nuc2 is responsible for the temperature-30 sensitive phenotype that arrests metaphase progression of S. pombe yeast (Hirano, T., Y. Hiraoka and M. Yanagida. J. Cell Biol 106:1171-1183 (1988)). Since the residue Gly is conserved in the H-NUC protein, as well as the yeast homolog, creation of a Gly to Asp mutation would test 42 whether the H-NUC protein is defective in binding to RB at nonpermissive temperatures. As shown in Figure 6, the H-NUC protein containing the Gly-640 mutation fails to interact with RB when yeast is growing at 37°C 5 (nonpermissive temperature), but retains its ability to bind to RB when yeast is growing at 22°C (permissive temperature) . This data demonstrates a link between the temperature sensitive (ts) phenotype of presumed metaphase arrest to the Rb-binding property.

Preparation of H-NUC antibody and identification of H-NUC protein.

To allow identification of this novel H-NUC protein in protein gels and Western blots, mouse antibodies to it were prepared. Gst-C-49 was expressed in E. coli. 15 (Smith and Johnson, 1988, supra. and Shan et al. , 1992, supra. each incorporated herein by reference) purified using glutathione beads, and used as an antigen to induce an antibody response in mice. Serum containing polyclonal anti-H-NUC antibody was then harvested. After the antibody 20 was available, an erythroleukemia cell line (K562) metabolically labeled with 35S-methionine was used to prepare cell lysates, which were immunoprecipitated with polyclonal antibody, as described previously. As shown in Figure 6A, a specific protein with molecular weight of 25 about 95 kd was precipitated by the immune serum (lane 2) but not by preimmune serum. The complex falls apart in gels. Only a 95 kDa protein is seen because of specific labelling of K562 protein with 35S-methionine. This 95 kd protein also was detected when using the GST protein for 30 competition in immunoprecipitation, demonstrating that the polyclonal antibody does not recognize GST alone. On the other hand, the original antigen is able to compete with endogenous cellular protein, and the 95 kd band becomes undetectable (lanes 3 & 4) . The specificity of this 35 antibody was further confirmed when the primary 43 immunoprecipitates were denatured and re-immunoprecipitated. As shown in Figure 6B (lane 3), the 95 kd protein is the only band detected, and the background is clean. All immunological evidence suggests, then, that the 5 95 kd protein is the H-NUC gene product.

H-NUC protein has DNA-binding activity.

About 1x107 cells were labeled with 35s-methionine, then lysed in Lysis 250 buffer (250mM NaCl, 5mM EDTA, 50mM Tris (pH 8.0), 0.1% NP40, ImM 10 phenylmethylsulfonyl fluoride (PMSF), 8 ug/ml of leupeptin and 8 ug/ml of antipain). Lysates were clarified by centrigugation and diluted with 2 volumes of loading buffer (lOmM KH2P04, pH6.2, ImM MgCl2, 0.5% NP40, ImM DTT, 10% glycerol). The diluted extract was then applied to a DNA-15 cellulose column (native calf thymus DNA, Pharmacia, Poscatawas, NJ) as previously described, and the mixture was incubated for 1 hour at 4 degrees C with gentle shaking. The column was washed with 5 bed volumes of loading buffer and then eluted with the same buffer 20 containing increasing concentrations of NaCl.

Fractions of each of the eluents were analyzed by immuno-precipitation (as described above) with antibodies against retinoblastoma protein (11D7, Figure 7A) , H-NUC (Figure 7B) , or GST beads (Figure 7C) . Aliquots of each 25 fraction were also incubated with glutathione beads to detect glutathione transferease. RB protein has DNA-binding activity and serves as a positive control. The-H-NUC protein has similar DNA-binding activity, while glutathione transferase alone has no such activity. 30 Sequence homology analysis argues that the DNA-binding region of H-NUC is located outside the TRP region. 44 H-NUC is mapped to the chromosome 17q21-22.

In situ hybridization of the ^-labeled, 3.3 kb-H-NUC cDNA probe to human chromosomes showed specific labeling at the q21-22 region of chromosome 17, as shown in 5 Figure 9. Of the 320 grains from 150 cells scored, 42 (13.1%) were found to be at 17q21-22. No other sites were labeled above background. Because a portion of the probe used contains a sequence homologous to its pseudogene, multiple hybridizations to the short arms of acrocentric 10 chromosomes were detected in every cell examined and were excluded from the analysis. Similar mapping results were obtained by the somatic cell-hybrid method, which also maps H-NUC to chromosome 17. The location of H-NUC is interesting because the familial breast cancer gene has 15 been mapped to the same region and Tumor Suppressor Activity of H-NUC.

The tumor suppressor activity of H-NUC was assessed in both in vitro cell culture conditions and in nude mouse animal models. The cells lines used to assess 20 H-NUC tumor suppressor activity were MDA-MB-231 which contains one functional allele of H-NUC and T-47D which is a homozygous mutant of the H-NUC locus.

Briefly, the effect of H-NUC on the proliferation of the above two cell lines was assessed following 25 expression of H-NUC using a adenoviral expression vector. ACN is a control adenoviral vector lacking a cDNA insert while AC-H-NUC is an adenoviral vector expressing H-NUC under the control of the human CMV promoter.

Adenoviral Vector Containing H-NUC.

To construct the adenoviral expression vector, a 2520 base pair fragment containing the full length cDNA for WO 95/17198 PCT/US94/14813 45 H-NUC was aitplified by PCR from Quick Clone double-stranded placental cDNA (Clontech) . The primers used for amplification of H-NUC added a Kpn I restriction site at the 5' end of the fragment and a Xho I site at the 31 end 5 to allow for directional cloning into the multiple cloning site of pBluescript II KS+ (5 prime oligo 51CGCGGTACCATGACGGTGCTGCAGGAA3' ; 3 prime oligo ' ATCGGCTCGAGCAGAAGTTAAAATTCATC3 1) . The PCR cycles were as follows: 1 cycle at 94 degrees Celsius 1 min; 3 0 cycles at 10 94 degrees Celsius 1 min, 53 degrees Celsius 11/2 min, 72 degrees Celsius 2 min; and 1 cycle at 72 degrees Celsius 7 min. Clones were screened for the ability to produce a 95 KD protein in the TnT Coupled Reticulocyte Lysate System (Promega). The T3 promoter in the Bluescript vector allows 15 for transcription and translation of the H-NUC coding sequence by rabbit reticulocytes. One microgram of mini-lysate DNA was added per TnT Reticulocyte reaction and incubated for 1 hour at 30 degrees Celsius. Ten microliters of the reaction was mixed with loading buffer 20 and run on a 10% polyacrylamide gel (Novex) for 1 1/2 hour at 165 V. The gel was dried down and exposed to film overnight. Four clones making full-length protein were sequenced. The H-NUC insert was recovered from the vector following digestion with Kpn I and Hind II and subcloned 25 into the KpnI-Bglll sites of pAdCMVb-vector (Bglll was filled-in to create a blunt end). All four clones contained some mutations therefore, a clone containing the correct wild-type sequence was created by ligating fragments from two clones.

To construct recombinant adenovirus, the above plasmids were linearized with Nru I and co-transfected with the large fragment of a Cla I digested dl309 mutants (Jones and Shenk, Cell, 17:683-689 (1979)) which is incorporated herein by reference, using CaPO4 transfection kit 35 (Stratagene). Viral plaques were isolated and recombinants identified by both restriction digest analysis and PCR PCTAJS94/14813 46 using primers against H-NUC cDNA sequence. Recombinant virus was further purified by limiting dilution, and virus particles were purified and titered by standard methods (Graham and van der Erb, Virolocrv. 52:456-457 (1973); Graham and Prevec, Manipulation of adenovirus vectors. In: Met-.hr.ris in Molecular Biology Vol 7; GeneTrailgfer and kExnrpssion Protocols. Murray E.J. (ed.) The Humana Press Inc., Clifton N.J., 7:109-128 (1991)), both of which are incorporated herein by reference.

To ensure that the H-NUC vector above expressed a protein of the appropriate size, T-47 D cells are infected with either the control or the H-NUC containing recombinant adenoviruses for a period of 24 hours at increasing multiplicities of infection (MOI) of plaque 15 forming units of virus/cell. Cells are then washed once with PBS and harvested in lysis buffer (50mM Tris-Hcl Ph 7.5, 250 Mm NaCl, 0.1% NP40, 50mM NaF, 5tnM EDTA, lOug/ml aprotinin, 10 ug/ml leupeptin, and ImM PMSF). Cellular proteins are separated by 10% SDS-PAGE and transferred to 20 nitrocellulose. Membranes are incubated with an anti-H-NUC antibody followed by sheep anti-mouse IgG conjugated with horseradish peroxidase. Accurate expression of H-NUC protein is visualized by chemiluminescence (ECL kit, Amersham) on Kodak XAR-5 film. in Vitro.

Breast tumor cells lines, MDA-MB-231 and T-47D, were seeded at 1x10s cells per 100 mm plate in Kaighn's F12/DME medium (Irvine Scientific) supplemented with 10% FBS and 0.2 IU insulin (Sigma), for T-47D cells. The 30 plates were incubated overnight at 37°C in 7% C02. The following day, the cells were refed with 10 mis. of growth medium and infected with either ACN control viral lysate (MOI 10) or with AC-H-NUC viral lysate (MOI 10) and allowed to incubate at 37°C. After 3 days, the medium was removed WO 95/17198 PCT/US94/14813 47 and the cells fixed with a 1:5 acetic acid-methanol solution. The cells were stained with a 20% methanol-0.5% crystal violet solution for 30 minutes and rinsed with tap water to remove excess stain.

Infection of T-47D cells with AC-H-NUC resulted in growth inhibition of these cells by the expressed H-NUC protein (Figure 11) . A visual observation of AC-H-NUC infected T-47D cells stained with crystal violet show a reduced number of cells (approximately 50%) when compared 10 to the ACN control cells. In addition, a change in T-47D cell morphology occurred. The cells appeared to become condensed, losing their normal growth characteristics. No change was apparent when T-47D cells were challenged with control ACN virus. In contrast, the heterozygous cells, 15 MDA-MB-231, did not appear to be affected by either ACN or AC-H-NUC in vitro.

Thymidine incorporation was alsp used to assess the effects of H-NUC on cell proliferation. Briefly, approximately 3xl03 MDA-MB-231 and T-47D cells were plated 20 in each well of a 96-well plate (Costar) and allowed to incubate overnight (37°C, 7% C02) . Serial dilutions of ACN or AC-H-NUC were made in DME:F12/15% FBS/l% glutamine, and cells were infected at multiplicity of infection (MOI) of 10 and 100 (4 replicate wells at each MOI) with each 25 adenovirus. One-half of the cell medium volume was changed 24 hours after infection and every 48 hours until harvest. At 18 hours prior to harvest, 1 fiCi of 3H-thymidine (Amersham) was added to each well. Cells were harvested onto glass-fiber filters 5 days after infection, and 3H-30 thymidine incorporated into cellular nucleic acid was detected using liquid scintillation (TopCount", Packard Instruments). Cell proliferation (cpm/well) at each MOI was expressed as a percentage of the average proliferation of untreated control cells. 48 The results obtained showed that the proliferation of MDA-MB-231 cells (heterozygous for H-NUC) was similar after treatment with either ACN or AC-H-NUC (See Figure 12) . In contrast, a specific response to AC-H-5 NUC was observed for T-47D cells (deleted for H-NUC) that was enhanced at higher MOI. These date demonstrate an anti-proliferative effect of adenovirus-mediated gene transfer of the H-NUC gene on H-NUC altered cells.

Ex Vivo Gene Therapy.

To assess the effect of H-NUC expression on tumorigenicity, the above tumor cell lines were tested for their ability to produce tumors in nude mouse models. Approximately 2xl07 T-47D cells were plated into T225 flasks, and cells were treated with sucrose buffer 15 containing ACN or AC-H-NUC at MOI of 3 or 30. Following overnight infections, cells were harvested and approximately 107 cells were injected subcutaneously into the left and right flanks of BALB/c nude mice (4/group) that had previously received subcutaneous pellets of 17S-20 estradiol. One flank was injected with ACN-treated cells, while the contralateral flank was injected with AC-H-NUC cells, each mouse serving as its own control. Animals receiving bilateral injections of untreated cells served as an additional control for tumor growth. Tumor dimensions 25 (length, width, height) and body weights were then measured twice per week. Tumor volumes were estimated for each animal assuming a spherical geometry with radius equal to one-half the average of the measured tumor dimensions.

The results of this experiment are shown in Figure 13 and reveal a significant reduction in tumor growth of the cells expressing H-NUC. Briefly, twenty-one days after inoculation of cells, tumors were measurable on both sides of all animals. Tumors that arose from cells PCT/U594/14813 49 treated with AC-H-NUC (M01=3 0) were smaller than contralateral tumors from cells treated with ACN (M01=3 0) in 4 of 4 mice. Average tumor size from AG-H-NUC treated cells (M01=30) remained smaller than that of the ACN 5 treated cells (M01=30) for the 21-day period (See Figure 3) . These data further indicate the tumor suppressor activity of the H-NUC protein disclosed herein.

In Vivo Tumor Suppression H-NUC.

Human breast cancer cell line T-47D cells are 10 injected subcutaneously into female BALB/c athymic nude mice. Tumors are allowed to develop for 32 days. At this point, a single injection of either ACN (control) or AC-H-NUC (containing H-NUC gene) adenovirus vector is injected into the peritumoral space surrounding the tumor. Tumors 15 are then excised at either Day 2 or Day 7 following the adenovirus injection, and poly-A+ RNA is isolated from each tumor. Reverse transcriptase-PCR using H-NUC specific primers, are then used to detect H-NUC RNA in the treated tumors. Amplification with actin primers serves as a 20 control for the RT-PCR reaction while a plasmid containing the recombinant-(H-NUC) sequence serves as a positive control of the recombinant-(H-NUC) specific band.

In a separate experiment, T-47D cells are injected into the subcutaneous space on the right flank of 25 mice, and tumors are allowed to grow for 2 weeks. Mice receive peritumoral injections of buffer or recombinant virus twice weekly for a total of 8 doses. Tumor growth is monitored throughout treatment in the control animals receiving ACN and buffer and those animals receiving AC-H-30 NUC. Body weight and survival time is also monitored.

WO 95/17198 PCT/US94/14813 50 Expression of exogeneous H-MUC in breast cancer cell line T-47D cells.

Breast cancer cells from breast cancer cell line T-47D which contains no endogeneous H-NUC, because of 5 homozygous mutation of its gene, provides a clean background for functional studies of H-NUC. T-47D cells are infected with comparable titers of either AC-H-NUC or control ACN vector. Most colonies are individually propagated into mass cultures.

Infected cells were metabolically labeled with 35S and used to prepare cell lysates to evaluate the amount of protein produced. AC-AH-NUC infected cultures are compared to control cells in terms of morphology, growth rate (e.g., doubling time), saturation density, soft-agar colony 15 formation and tumorigenicity in nude mice are determined.

Although the invention has been described with reference to the presently-preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention.

Accordingly, the invention is limited only by the following claims.

Claims (41)

10 30 35 17#7M What is claimed is:

1. An isolated and purified DNA sequence encoding a retinoblastoma (Rb) binding protein comprising a sequence having at least six tetratricopeptide repeats at the C-terminal end of the protein, wherein the protein sequence comprises amino acids 559 to 824 of Sequence ID. No. 2, with the proviso that said DNA sequence encodes neither S. pombe yeast protein nuc2, Aspergillus nxdulans bimA protein, nor S. cerevisiae yeast CDC27 protein.

2. An isolated and purified DNA sequence encoding an Rb binding protein of claim 1, said DNA sequence further comprising a DNA sequence encoding amino acids 465 through 770 of Sequence ID No. 2.

3. The isolated and purified DNA sequence of claim 2, wherein the DNA sequence encoding amino acids 465 through 770 comprises nucleotides 1493 to 15 2408 of Sequence I.D. No. 1.

4. An isolated and purified DNA sequence according to claim 1 encoding H-NUC, the sequence comprising the sequence set forth in Sequence I.D. No. 1. 2? 25

5. A recombinant vector containing the isolated, purified DNA of claims 1, 2, 3, or 4.

6. A recombinant vector of claim 5, wherein the vector is a cosmid, plasmid, or is derived from a virus.

7. An expression vector comprising said DNA molecule of claims 1,2,3, or 4, capable of inserting said DNA molecule into a mammalian host cell and of expressing the protein therein. N.Z. PATENT OFFICE' -9 JUL 1997 ' nibEivED 278745 yr

8. An expression vector of claim 1, wherein said expression vector is selected from the group consisting of a plasmid and a viral vector. 5

9. An expression vector of claim 8, wherein said viral vector is selected from the group consisting of a retroviral vector and an adenoviral vector.

10. An expression vector of claim 9, wherein 10 said expression vector is AC-H-NUC.

11. A host-vector system for the production of a polypeptide or protein having the biological activity of H-NUC protein or biologically active derivative thereof 15 which comprises the vector of claim 7, 8, £)•; or 10 in a suitable host cell.

12. A host-vector system of claim 11, wherein the host cell is a prokaryotic cell. 20

13. A host-vector system of claim 11, wherein the host cell is a eukaryotic cell.

14. A pharmaceutical composition comprising the 25 vector of claim 7 and a pharmaceutically-acceptable carrier.

15. A pharmaceutical composition comprising the vector of claim 8 and a pharmaceutically-acceptable 30 carrier.

16. A pharmaceutical composition comprising the AC-H-NUC vector and a pharmaceutically acceptable carrier. 35

17. A DNA probe comprised of at least about 27 nucleotides complementary, to nua gp.qnpnpo Df claim 1. N.Z. PATENT OFFICE -9 JUL 1997 RfcCEiVED 278745 53

18. A DNA probe of claim 17, wherein the nucleotides are complementary to the DNA sequence of Sequence I.D. No. 1. 5

19. An isolated and purified mammalian protein encoded by the DNA sequence of claim 1. 10

20. An isolated and purified mammalian protein of claim 19 comprising an eimino acid sequence having nine tetratricopeptide repeats at its C-terminal end. 15

21. An isolated and purified mammalian protein of claim 20 that is H-NUC having an amino acid sequence of Sequence I.D. No. 2. 20

22. A method of producing a protein of claim 19 comprising the steps of : a. inserting a compatible expression vector comprising a gene encoding a protein of claim 19 into a 25 host cell; b. causing said host cell to express said protein.

23. A method according to claim 22, wherein said 30 host cell is selected from the group consisting of a prokaryotic host cell and a eukaryotic cell. 35

24. A method according to according to claim 23, wherein said host cell is a eukaryotic host cell which is mammalian host cell anb vector is compatible with said mammalian host RECEIVED 27 87 43 y?

25. A method of supressing the neoplastic phenotype of a cancer cell in vitro having no endogenous H-NUC protein comprising administering to such cancer cell an effective amount of the DNA of claims 1, 2, 3 or 4. 5

26. The method of claim 25, wherein the administering of the H-NUC gene is by recombinant vector.

27. A method of suppressing the neoplastic 10 phenotype of a cancer cell in vitro having no endogenous H-NUC protein comprising administering to such cancer cell the protein of claims 19 through 21.

28. An antibody which binds the protein of claim 15 19. 20

29. An antibody of claim 28, which binds to the H-NUC protein having an amino acid sequence of Sequence I.D. No. 2. 25

30. A hybridoma which produces a monoclonal antibody that binds to the H-NUC protein having an amino acid Sequence I.D. No. 2.

31. A method of detecting the absence of H-NUC 30 protein in tumor cells, comprising the steps of; a. preparing tissue sections from a tumor; b. contacting the antibody of claim 28 or 29 with said tissue sections; and c. detecting the presence or absence of 35 said antibody binding to said tj^.sue^«cti'i5nii%~l rN.z. I Tg JUL 1997 5*5 278745

32. An isolated and purified DNA sequence according to claim 1 substantially as herein described or exemplified.

33. A recombinant vector according to claim 5 substantially as herein described or exemplified.

34. An expression vector according to claim 7 substantially as herein described or exemplified.

35. A host-vector system according to claim 11 substantially as herein described or exemplified.

36. A pharmaceutical composition according to claim 14 or 16 substantially as herein described or exemplified.

37. A DNA probe according to claim 17 substantially as herein described or exemplified.

38. An isolated and purified mammalian protein according to claim 19 substantially as herein described or exemplified.

39. A method according to anyone of claims 22, 25, 27 and 31 substantially as herein described or exemplified.

40. An antibody according to claim 28 substantially as herein described or exemplified.

41. A hybridoma according to claim 30 substantially as herein described or exemplified. END OF CLAIMS