JPH09510343A - Novel tumor suppressor gene - Google Patents

Abstract

(57) Summary The present invention is an isolated and purified DNA sequence encoding an Rb binding protein comprising a partial sequence having at least 60% homology with nine C-terminal tetratricopeptide repeats. Te, said sequence, S. pombe yeast protein nuc2, Aspergillus nidulans bimA protein or S.ce any of revisiae yeast CDC27 protein does not encode, DNA sequence, base containing said DNA compactors, DNA probes based on said DNA,, and The present invention relates to a therapeutic method using the DNA and vector. The present invention also relates to a protein encoded by the DNA, a therapeutic method utilizing the protein, and a method for expressing the protein. Finally, the present invention relates to an antibody against the protein, a hybridoma producing the monoclonal antibody, and a diagnostic method utilizing the antibody.

Description

Detailed Description of the Invention                           Novel tumor suppressor gene   This application is a partial succession of US patent application Ser. No. 08 / 170,586 filed December 20, 1993. It is a sequel application, the content of which is incorporated herein by reference.                                Background of the Invention   The present invention is in the field of tumor suppressor genes (anti-oncogenes), and in general Products and methods for the implementation of a wide range of tumor suppressor gene therapies for various human cancers Concerning the law. In particular, the present invention relates to treating tumor cells, (1) herein using H-NUC Who administer a vector containing a nucleic acid sequence encoding a novel protein called Or (2) administering an effective amount of protein encoded by this nucleic acid sequence Regarding the method.   Cancer and tumors are the second most common cause of death in the United States, Causes 450,000 deaths. One in three Americans has cancer, And one in five people died of cancer (Scientific American Medicine, Part 12, I,  1, Section 1987). Actual progress may depend on some environmental and genetic It is done by clarifying the cause of cancer, but statistics on cancer mortality are , And the need to substantially improve the treatment of cancer and related diseases and disorders.   A number of genes called oncogenes, which are associated with the cause of cancer Genes are associated with cancer genotypes and in many well-studied tumor cells Was identified in. Oncogene studies provide some understanding of tumorigenic processes Helped to. There are so many things to learn about oncogenes Currently known oncogenes serve as a useful way to understand tumorigenesis.   Oncogenes promote "tumor formation" when activated. ) And a "tumor suppressor gene" (if this is injured, do not suppress tumor formation. Will be classified into These classifications are useful for conceptualizing tumorigenesis. Method, but the specific gene is a specific allelic form of this gene, its regulation Play different roles depending on the factors, the genetic background, and the organizational environment in which it operates It can be possible.   The widely considered working assumptions for cancer are: (1) almost all Human cancers are genetic diseases, and (2) they contain specific genes (ie, Mutants of normal cell growth regulatory genes, or viral or mammalian cells Are other foreign genes, and they are other classes of life-threatening growth-regulated genes. Undesired, mistimed or ectopic expression in the offspring) Or it occurs because it is not expressed.   An extremely simplistic view of the biological basis of neoplasia is two major classes. It means that there is an oncogene of Su. The first class is cell growth or Is a mutated allele or other abnormality of a normal cellular gene involved in controlling replication It consists of type alleles. These genes are cellular proto-oncogenes. When mutated, they are new cellular machinery that disrupts normal cell growth and replication. Can code Noh. These changes result in a predominantly expressed tumor phenotype. You. In this predominantly expressed model of the oncogene, which is associated with neoplasia (Although it is a view that has predominantly emerged from the emergence of the concept of genetic and mutational basis), The persistence of two wild-type alleles affects the developmental program or growth characteristics of cells. It is envisioned that it is not sufficient to prevent changes in neoplasia. Therefore, these Imagine a genetic event responsible for activation of the ncogene as a "single hit" event Can be done. Oncogenic activity of mye oncogene in Burkitt lymphoma , Expression of bcr-abl chimeric gene product in patients with chronic myelogenous leukemia, other tumors Activation of H-ras and K-ras oncogenes in ulcers in clinical human cancers Present some evidence of the involvement of such transforming oncogenes. You. Approaches to gene-based therapies for predominantly expressed neoplastic diseases are likely In particular, it may require specific termination or inactivation of expression of the causative gene. Tumor suppressor gene   A more recently discovered family of cancer-related genes is called tumor suppressor genes. And is sometimes referred to as the anti-oncogene, growth suppressor, or tumor suppressor gene. You. Recent studies show that the family is associated with a high percentage of human cancer development. Appears to be a loss-of-function mutation in this class of genes How many good candidate human tumor suppressor genes, more than a dozen, are Was identified in a human cancer. Retinoblastoma (rb), breast cancer, colon cancer, and other cancers Tumor depression associated with the etiology of tumor (p53), Wilms tumor (wt), and colon carcinoma (dcc) The repressor gene was identified and cloned. Those in human tumorigenesis Several aspects of the role have been elucidated.   The retinoblastoma gene (RB) is a precursor to tumor suppression. There are various mutations in this gene Found in human tumors ofCrit. Rev. Oncog.， 2: 211-227 ( 1991); Goodrich and Lee,Biochim. Biophys. Acta., 1155: 43-61 (1993); Ril ey et al.Annu. Rev. Cell Biol., 10: 1-29 (1994)). Single copy tumor of normal RB Reintroduction into tumor cells suppresses the ability of tumor cells to form tumors in nude mice (Huang et al.Science, 242: 1563-1566 (1988); Sumegi et al.,Cell Growth Differ.， 1 : 247-250 (1990); Bookstein et al.,Science, 247: 712-715 (1990); Chen et al.,Cell Gr owth Differ. 3: 119-125 (1992); Goodrich et al.,Can. Res., 52: 1968-1973 (1992) Takahashi et al.Proc. Natl. Acad. Sci. USA, 88: 5257-5261 (1991)). further, Microinjection of non-phosphorylated Rb protein into cells in the early G1 phase of the cell cycle Block the progression to S phase, which means that Rb protein is Suggest that it is fundamentally involved in the regulatory process of (Goodrich et al.,Cell， 67: 293-302 (1991)). These results further reflect the recent development in engineered mouse strains. Confirmed by observation. For overexpression of Rb protein from human RB transgene Cause a biological-level growth delay (Bignon et al.,Genes Dev.， 7: 1654-1662 (1 993)). Furthermore, homozygous inactivation of the RB gene completes functional Rb expression. In a completely eliminated mouse embryo, development stopped prematurely, and the embryo Die in the womb (Lee et al,Nature359: 288-294 (1992); Jacks et al.Nature359: 295- 300 (1992); Clarke et al.,Nature, 359: 328-330 (1992)). These experiments are The basic data that establishes the importance of Rb protein in cell growth and differentiation in bots. Provide data.   The RB gene has a cell cycle-dependent manner with both serine and threonine residues. It encodes a nuclear protein that is phosphorylated (Lee et al.,Nature329: 642-645 (1 987); Buchkovich et al.Cell, 58: 1097-105 (1989); Chen et al.,Cell， 58: 1193-1198 ( 1989); DeCaprio et al.,Cell, 58: 1085-1095 (1989)). During the G1 phase of the cell cycle, According to microinjection experiments, when the protein is active, Rb Is a hyperphosphorylated state (Goodrich et al.,Cell, 67: 293-302 (1991); Goodrich And Lee,Nature, 360: 177-179 (1992)). Hyperphosphorylated Rb is also in G0 phase Exists. It seems to play a crucial role in keeping cells in this stationary phase, During stationary phase, cells wait to respond to external signals and enter the cell cycle. Decide whether to enter or differentiate (Goodrich and Lee,Biochem. Biophys. Ac ta. , 1155: 43-61 (1993); Pardee, A.B.,Science, 246: 603-608 (1989)).   During later G1, S, and M phases, Rb is probably a CDK family kinner Are hyperphosphorylated by members of the zease (Lees et al.,EMBO J.， 10: 4279-4290 (1991) Lin et al.EMBO J., 10: 857-864 (1991); Hu et al.Mol. Cell. Biol.， 12: 971-980 ( 1992)). Phosphorylation of specific residues on Rb appears to constrain cells to proliferation. Rb The phosphorylation pattern of a protein is related to its function in growth inhibition, which Therefore, phosphorylation negatively regulates the growth inhibitory function of this protein. That assumption is now accepted (Hollingsworth et al.Cuur. Opin. Genet. D ev. , 3: 55-62 (1993); Sherr, C .; J.,Trend Cell Biol., 4: 15-18 (1994)). Rb Dephosphorylation of proteins occurs in the middle of the M phase and before the next cell cycle. Resulting in reactivation of the protein. By Evidence, Type 1 Protein Phosphata Have been suggested to be important for this dephosphorylation (Alberts et al.,Proc. Na tl. Acad. Sci. USA , 90: 388-392 (1993); Durfee et al.,Genes Dev.， 7: 555-569 (19 93)).   The molecular mechanism by which Rb participates in these cellular activities has not been fully elucidated. Not in. The current model shows that Rb interacts with many different cellular proteins and It is possible that these functions can be performed via these complexes. Function of Rb protein Is to maintain cells at the G0 / G1 stage, Rb Must "trap" and inactivate other proteins that are active and essential for translocation (Lee et al., CSHSOB, LVI: 211-217 (1991)). This "confinement" assumption Consistent with recent observations, that observation indicates that E2F-1 is an important growth-promoting transcription factor. Ne It is tightly regulated by Rb in a gative way (Helin et al.,Cell, 70: 337-350 (1992); Kaelin et al.,Cell, 70: 351-364 (1992); Shan et al.,Mol. Cell. B iol. , 12: 5620-5631 (1992); Helin et al.,Mol. Cell. Biol., 13: 6501-6508 (1993);  Shan et al.Mol. Cell. Biol., 14: 229-309 (1994)). Proteins disclosed here H-NUC binds to the Rb protein and is thus involved in the regulation of mitosis.   The familial breast cancer gene BRCA-1 was mapped to chromosome 17q21-22 by linkage analysis . Whether this gene acts as a tumor suppressor or a predominant oncogene is unclear. Not ridiculous. However, human familial cancer syndromes (for example, Li-Fraumeni syndrome) The conferring gene, p53, apparently acts as a classical tumor suppressor; also R B gene deletions are associated with inherited retinoblastoma (Knudson, 1993, supra). Multiple processes and oncogene cooperation   This of a transforming oncogene and a purely recessive tumor suppressor gene Between the two extreme concepts, the development of neoplastic changes characteristic of many human tumors There are many additional mechanisms that are clearly involved. Most human cancers are numerous It appears to result from the deletion of an interacting gene in the It has long been hypothesized that one of them is not enough and that all of them are needed. Have been. Cellular proto-oncogenes and growth in neoplasia of mammalian cells The real role of both regulatory tumor suppressor genes is the reciprocal role between these two genes. It is believed to represent a complex set of actions.                                Summary of the Invention   The present invention provides a nucleic acid encoding a novel protein (H-NUC) having tumor suppressor ability. It is based on the discovery of molecules. This nucleic acid molecule maps to the q21-22 region of chromosome 17. Have been. Characteristics of H-NUC (Amino acid sequence derived from full-length cDNA; binds DNA and transcribes Ability to activate E. coli; rearrangements or deletions of coding sequences in some breast tumor cell lines Loss) is consistent with the uniqueness of H-NUC as a nuclear protein and tumor suppressor protein. Match. This newly disclosed full-length cDNA is a novel 824 amino acid protein. Code This novel protein is called TPR (tetratricopeptide). o peptide)) contains 10 34 amino acid repeats characteristic of the protein family .   A diagnostic method using this nucleic acid and protein H-NUC is disclosed. The present invention Furthermore, in established cancer cells that do not have endogenous wild-type H-NUC protein, Wild-type H-NUC tumor suppressor genes to suppress, eradicate, or reverse the formation phenotype. Or protein administration. The present invention is based on the established genes of the wild-type H-NUC gene. Administration to established human cancer cells lacking wild-type H-NUC protein. It was shown for the first time to suppress or reverse the neoplastic phenotype or trait of the vesicle. next, This suppression of the neoplastic phenotype causes the abnormal mass (ie, tumor) of such cancer cells to Suppressed or eradicated. This in turn may reduce the tumor burden in such animals. This, in turn, can increase the survival of treated animals. Monitor and new reversed The formation characteristics are morphology, growth, and most of the cancer cells lacking normal H-NUC protein. Includes significant tumor formation. Therefore, the “reduction of tumor cell burden” in animals is It is a result of "suppression of the neoplastic phenotype" after administration of the live H-NUC tumor suppressor gene. " A neoplastic phenotype is a characteristic of a cell (e.g., morphology, growth rate (e.g., doubling time), Phenotypic in saturation density, soft agar colonization, and tumoricity) It is understood to mean change.   Accordingly, the present invention provides a vector encoding H-NUC for use in treating tumors or cancer. And H-NUC proteins, and H-NUC proteins suitable for use in treatment methods Methods for preparing qualities and vectors are provided.   The invention also relates to methods of treating mammals, eg, humans, and cancer or tumor cells. Provide a method for treating abnormally proliferating cells such as vesicles or a method for suppressing neoplastic phenotype I do. Broadly, the invention is characterized by abnormally proliferating cells, or abnormally proliferating cells. It is intended to treat a mammal having the disease described by any suitable method. That A suitable method is a vector or H-NUC tamper encoding host cell compatible H-NUC. The cytoplasm into the cells to be treated so that suppression of growth can be achieved. It is known.   In one embodiment, the invention features an overproliferating cell in a mammal. Illness, in mammals having a disease characterized by abnormally proliferating cells, Administering an expression vector encoding H-NUC, abnormally growing the expression vector Inserting H-NUC into these cells, and inserting H-NUC into these cells. The method includes treating by a step of expressing in an amount effective for suppressing proliferation. Expression Are responsible for viral infection or transduction of abnormally proliferating cells, liposome-mediated Transfection, polybrene-mediated transfection, CaPO_FourRelationship Insertion via transfection and electroporation. place The placement is repeated if necessary.   In another embodiment, the present invention provides an expression vector encoding H-NUC to an abnormal growth cell. Cell, and the amount of H-NUC effective there to inhibit the growth of these cells. A method of treating mammalian hyperproliferative cells by the expressing step is included. treatment Is repeated if necessary.   In another alternative embodiment, the invention provides a DN capable of inhibiting the growth of hyperproliferative cells. Provide the A molecule. The DNA molecule encodes an Rb-binding protein The quality has at least 60% homology with the nine C-terminal tetratricopeptide repeats. Wherein the DNA molecule also comprisesS. pombeYeast NUC2,Aspergillas n idulans  Does not code bimA and CDC27. Examples of such Rb binding proteins are Is a H-NUC protein having an amino acid sequence substantially according to SEQ ID NO: 2. Sa In a further preferred embodiment, the DNA molecule has the DNA sequence of SEQ ID NO: 1 and Expressed by the current vector. The expression vector can be any host cell compatible vector. Can be. The vector is preferably a retrovirus vector, adenovirus Selected from the group consisting of S. vector and herpes virus vector.   In another alternative embodiment, the invention provides an amino acid substantially according to SEQ ID NO: 2. Provide H-NUC protein having sequence and biologically active fragment thereof I do.   In another alternative embodiment, the invention provides the H-NUC protein by the steps of A method for producing: A compatible expression vector containing an H-NUC encoding gene The step of inserting into the main cell and the step of expressing the H-NUC protein in the host cell.   In another alternative embodiment, the invention comprises the steps of:Ex vivoFeeding Methods of treating abnormally proliferating cells in an animal include: feeding a tissue sample in need of treatment. The tissue sample containing abnormally proliferating cells; the tissue sample requiring treatment. The agent with an effective dose of an expression vector encoding H-NUC; Cell expressing H-NUC in an amount effective to suppress the proliferation of abnormally proliferating cells. The treatment is Repeated as necessary; and treated tissue sample is returned to the original or other mammal Will be returned. Preferably, the ex vivo treated tissue is blood or bone marrow tissue. You.   In another alternative embodiment, the present invention relates to abnormally proliferating cells in a mammal. Of diseases characterized by abnormally proliferating cells Method of treating an animal by a process comprising the step of administering H-NUC protein And thus the H-NUC protein suppresses the abnormal proliferation of cells to the abnormally proliferating cells. Is inserted in an effective amount. In a preferred embodiment, the H-NUC protein is treated. It is liposome-encapsulated for insertion into the desired cells. Action required If not, it is repeated.   In another alternative embodiment, an oligonucleotide capable of hybridizing to the H-NUC gene. Cletide fragments, and assays using such fragments, are proposed. Provided. These oligonucleotides may include at least 5 nucleotides However, those consisting of about 20 to about 30 oligonucleotides are preferred. These Rigonucleotides are optionally radioisotopes (e.g., tritium,³²Rin And³⁵Sulfur), enzymes (e.g. alkaline phosphatase, and horseradish pero) Oxidase), fluorescent compounds (e.g. fluorescein, ethidium, terbium (t erbium) chelate), or chemiluminescent chemicals (e.g., acridinium ester, It may be optionally labeled with isolminol, etc.). These and other labels (for example, " Non-radioactive isotope DNA probe technique ”, edited by L.J. Kricka, Academic Press, New Y ork, 1992, (incorporated herein by reference)) of the present invention. It can be used with oligonucleotides. They are Southern and Northern It can be used in a DNA probe assay in a conventional manner such as rotting. This Descriptions of conventional formats such as, for example, "Nucleic Acid Hybridization-Practical Approach ", B. D. Hames and S.H. J. Higgins, IRL ress, Washington, D. C., 1985, incorporated herein by reference. Preferably , These probes hybridize with the H-NUC gene under stringent conditions. You can Oligonucleotides can also be primed by the polymerase chain reaction technique. age These techniques can be used, for example, in “PCR Engineering”, H.A. Ehrlich edition, Stock Ton Press, New York, 1989, and similar references.                                Description of the drawings   1A and 1B show that a similar region of RB is required for H-NUC and T antigen binding. Indicates that Figure 1A: Ga14-RB fusion used to determine the binding domain. Is a schematic diagram of. Ga14 DNA-binding domain (amino acids 1-147) fused to various RB variants Have been. The T / E1A binding domain of RB is shown as a shaded box. Influenced by mutation The spanned domains are shown as spotted boxes. Figure 1B shows H-NUC and RB in vivo. Detection of interactions with mutants is shown. Y153 is a panel of the indicated Gal4-RB mutants. And either Gal4- (H-NUC) expressing clone (Gal4- (C-49)) or YIpPTG10. Was co-transformed. β-galactosidase active chlorophenyl-red- A β-D-galactopyranoside colorimetric assay (CPRG) assay was performed for each transformation. 3 points in parallel, Durfee et al.Genes Devel. 7: 555-569 (1993) (referenced herein ).   2A and 2B show that H-NUC binds to non-phosphorylated RB. Figure 2A In-frame GST fusion (GST-491) with cDNAs encoding GST, GST and H-NUC and And an in-frame GST fusion (GST-T) with the amino-terminal 273 amino acids of SV40 T antigen,E. coli It is expressed in. GST and GST fusions with glutathione-SEF Allose beads were bound and washed extensively. Load the sample with SDS polyacrylic Quantify by Coomassie blue staining of the mid gel, and an equal amount of protein is determined for each assay. It was used in the factory. Figure 2B shows WR2E mixed with bound sample for 30 minutes at room temperature. It is an extract made from 3 cells. After thorough washing, the composite is SDS polyacrylic. Separated by amide gel and transferred for immunoblotting. Present in WR2E cells The amount of RB protein present and the degree of its phosphorylation were determined by comparing with the anti-Rb mAb 11D7 antibody. Determined by immunoprecipitation (lane 1). The blot was probed with anti-RB mAb 11D7. , And visualized by fluorography.   Figure 3 shows the nucleotide (SEQ ID NO: 1) sequence of the full-length H-NUC cDNA and protein. Sequence and deduced amino acid (SEQ ID NO: 2) sequence.   Figures 4A and 4B show that full-length H-NUC is a tetratricopeptide repeat (TPR) family. It shows that it encodes a member of the Lee protein. Figure 4A shows the H-NUC tamper Pomegranate, SchizosaccharomycesS. pombe nuc2 + protein, andAspergillus ni dulans  10 single 34-residue polypeptides in bimA protein (SEQ ID NOS: 4-30) Indicates the position of the repeat position. nuc2 + protein, H-NUC protein, and bimA tamper A schematic showing the position of the repeat (TPR) of 10 (0-9) 34-residue polypeptide units in the cytoplasm. It is. Unit repeat 3 of 3 polypeptides (indicated by the shaded box) (34v-reverse (Renamed) lacks a conserved motif. FIG. 4B shows nuc2 + protein, -H. -NUC protein and 9TPR unit repeats (1-9) in bimA protein (SEQ ID NO: 4-30) is an alignment of amino acid sequences. The conserved residues are boxed. TPR unit repeat 6 of all three proteins contains glycine at position 6. anti of nuc2 Gly6 in 6th is considered to be essential.   5A and 5B show that the C-terminal TPR repeat of H-NUC binds to RB protein. Show. Figure 5A is a schematic representation of the Gal4-H-NUC fusion used to determine the binding domain. FIG. The Gal4 transactivation domain is fused to various H-NUC deletion mutants I have. -H-NUC TPR unit repeats are shown as shaded boxes. Figure 5B shows R in vivo Detection of the interaction between B and the deletion mutant of H-NUC is shown. Y153, indicated Gal4-H -Co-trait with a panel of NUC variants and with either Gal4-RB2 or Gal4-H209 Converted. CPRG quantification of β-galactosidase activity was determined by 3 for each transformation. It was done in parallel.   6A and 6B show that the essential glycine mutation at amino acid residue 640 is Show that they produce temperature-sensitive H-NUC mutants that reduce binding to RB at non-permissive temperatures You. Figure 6A details the amino acid substitutions in H-NUC (640D) (SEQ ID NOS: 31-33). n The essential glycine (G) of uc2 (amino acid 540) is asparagine in temperature-sensitive mutants. It was replaced with acid (D) (SEQ ID NO: 34 and 35). Therefore, the amino acid residue at position 640 of H-NUC remains. The group glycine was changed to aspartic acid (D). Figure 6B shows RB at 37 ° C. And the interaction between H-NUC (640D). Y153 with Gal4-RB2, and Gal4-H-NU Cotransformation with either C or Gal4-H-NUC (640D). Liquid transformant The cells were cultured in the medium at 28 ° C for 24 hours. Dilute the yeast overnight culture with fresh medium, and 37 ℃ It was cultured in. Aliquots of yeast cultures were taken at various time points to allow yeast growth (OD6 60) and β-galactosidase activity were measured. C for β-galactosidase activity PRG quantification was done in 3 point parallels for each transformation.   7A and 7B show generation of antisera against H-NUC and H in human cell lines. -Indicates detection of NUC. In Figure 7A, the Gst-491 fusion protein immunizes mice. Used to. Pre-immune serum (lane 1), immune serum (lane 2), Gst protein Immune serum pre-incubated with lane (lane 3), and Gst-491 tamper Immune serum (lane 4) preincubated with cytoplasm for immunoprecipitation used. S³⁵Labeled cell lysates were prepared from K-562 cells. Equal amount of cell lysis The material was used for immunoprecipitation. The resulting immunoprecipitate was mixed with SDS Separated by Dogel electrophoresis. In FIG. 7B, S³⁵Labeled cell lysate with CV-1 cells Prepared from. An equal volume of cell lysate was used to prepare pre-immune serum (lane 1) or immune serum (reagent). It was used for immunoprecipitation with lanes 2 and 3). The resulting immunoprecipitate was Denatured by boiling in 1 of a solution containing 2% SDS (lane 3), and 200 μl of Diluted with NETN buffer. Immunoprecipitates were subjected to SDS polyacrylamide gel electrophoresis. separated. The 90 KD protein indicated by the arrow is specifically recognized by immune sera. Was.   FIG. 8 shows that the H-NUC protein has DNA binding activity. S³⁵Methioni The protein lysate of K562 metabolically labeled with lysine was treated with double-stranded calf thymus DNA cellulosics. Over the column and eluted with increasing concentrations of NaCl. The eluate is (A) RB MAb 11D7 to locate proteins, or (B) H-N to locate H-NUC It was immunoprecipitated with any of the immune sera that recognize UC. (C) Take an aliquot of the eluate. Used to incubate with glutathione sepharose beads Was.   Figure 9 shows that the gene encoding H-NUC is located on chromosome 17q21-22.   FIGS. 10A and 10B show the results of breast tumor cell DNA using H-NUC as a probe. It is the result of the imblotting analysis. DNA extracted from cell lines and cut with EcoRI did. In Figure 10A, the blots from the probed cell lines are all normal. . In FIG. 10B, a homozygous deletion of the H-NUC gene was revealed in cell lines T47D and MB157. It was nice. Heterologous genes found in cell lines MB231, BTO578-7, and BT549 Contact The combined deletion results in reduced hybridization to the 14 kbp EcoRI fragment. More suggested.   Figure 11: AC-H-NUC inhibits cell growth in T-47D breast tumor cells in vitro. Indicates that The upper left is infected with ACN (MOI 10) for 3 days, and crystal bio Met-MB-231 cells stained with lett are shown. The upper right is infected with ACN (MOI 10) Shows T-47D cells. The bottom left is MDA-MB-231 cells infected with AC-H-NUC (MOI 10). Cells. The lower right shows T-47D cells infected with AC-H-NUC. (+/-) is MDA-MB -231 cells are heterozygous for H-NUC. (-/-) Is T-47D Shows that the cell contains a homozygous deletion of H-NUC (reference, Lee, W.H.). AC-H-NUC is , A recombinant human adenocarcinoma containing the H-NUC tumor suppressor gene under the control of the human CMV promoter It is a virus. ACN is the same recombinant human adenovirus without the H-NUC tumor suppressor gene. It is a viral vector.   FIG. 12 shows that AC-H-NUC suppresses T-47D tumor cell growth in vitro. T 47-D (H-NUC deleted) and MDA-MB-231 (H-NUC is heterozygous) Breast cancer cells are plated in 96-well plates, and then AC-H-NUC or AC N was used to treat multiplicity of infection of 10 and 100 (4 parallels). Grow cells for 5 days And incorporated into the nucleic acid of the cell^ThreeUse H-thymidine as a measure of proliferation did. Data for AC-H-NUC (mean ± SD) is converted to ACN data at the corresponding MOI. Plotted as a percentage of average troll growth.   Figure 13 shows that AC-H-NUC suppresses T-47D tumor growth in nude mice. You. T-47D human breast cancer cells were infected with ACN or AC-H-NUC at a multiplicity of infection of 30 (N = 4). / Group) treated ex vivo. About 10⁷Cells subcutaneously in the flank of nude mice Each animal was injected with ACN-treated cells on one flank and AC-H-NUC cells on the other flank. Received a cell. Tumor size is measured with calipers to estimate tumor volume and spherical geometry. It was calculated on the assumption. Mean (± SD) tumor volume generated from ACN and AC-cBTSG cells Plot for tumor. Ratio of mean (± SD) volume of bilateral tumors from untreated cells Plot for comparison.                             Detailed description of the invention   The present invention provides a novel mammalian protein designated H-NUC. H-NUC is It consists of 824 amino acids (Figure 3), has a molecular weight of approximately 95 kD, and is non-phosphorylated, complete. It has been found to interact with the full length retinoblastoma (RB) protein. C end The last 6 "TPR" regions of the end region ("tetratricopeptide, 34 amino acid repeat sequence )), In other words, an H-NUC derivative containing amino acid numbers 559 to 770 (eg, , Truncated H-NUC protein) was found to bind to wild-type Rb protein Have been. Mutations that disrupt the retinoblastoma-binding function of this protein are found in RB-negative cells. Cells may contribute to the hyperproliferative pathology that is characteristic of cells (eg, breast cancer cells).   H-NUC protein is a human protein and therefore can be purified from human tissue You. “Purified” is used to describe the condition of the H-NUC protein or nucleic acid sequence. Used to encode H-NUC protein or H-NUC in its natural environment. Proteins without other proteins and molecules that normally bind to or co-occur with the DNA It represents DNA encoding protein or H-NUC. The term “natural” as used herein , Isolated from nature, or internally modified amino acids (eg, substitutions, deletions or DNA, protein, polypeptide, antibody, or their flags The form of ment. The recovery of the 95 kd H-NUC protein purified from the SDS gel was This can be achieved using methods known to those skilled in the art. See, for example, in more detail below. First, the cell extract containing H-NUC is reacted with anti-H-NUC antibody to precipitate it. . The protein-antibody complex was separated and the 95 kd H-NUC protein was isolated from Fischer et al.Tech niques in Protein Chemistry ， T.E.Hugli, Academic Press ， Inc. ， pp.36-41 (1989), incorporated herein by reference, by eluting from SDS gels. And collect.   The term “hyperproliferative cell” as used herein has the ability to self-grow (ie, Present and regenerate independently of normal regulatory mechanisms), but are not limited to Not done. Hyperproliferative disorders are pathological (ie, they exhibit the property of deviating from normal cells). Illness or its constituent diseases) or non-pathological (ie normal or not) Deviate but not related to the medical condition). Pathological hyperproliferation Sex cells are a hallmark of the following pathologies: That is, thyroid hyperp lasia) -Graves disease, psoriasis, benign prostatic hyperplasia, Li-Fraumeni syndrome, breast cancer, Sarcoma and other neoplasms, bladder cancer, colon cancer, lung cancer, various leukemias and phosphorus For example, cancer including patum. Examples of non-pathological hyperproliferative cells are, for example, during lactation development. Found in mammary duct epithelial cells of Escherichia coli and in cells associated with wound healing . Pathological hyperproliferative cells have a loss of contact inhibition and a reduced ability to selectively adhere. Characteristically shown. These are alterations in the surface properties of cells and further exposure to intracellular transmission. Means collapse. These changes affect mitotic stimulation and proteolytic enzyme Includes secretory capacity. In addition, the H-NUC protein or Reintroduction or replacement of H-NUC function lost due to the introduction of nucleic acid Can recover to a fertile state. The malignant growth of cells can then be stopped.   As is known to those of skill in the art, the term "protein" refers to a specific peptide bond. By a linear polymer of amino acids linked in rows. As used herein The term "amino acid" refers to either the D or L of the amino acids, unless otherwise specified. Refers to stereoisomers. H-NUC having biological activity of purified H-NUC protein Truncated proteins, polypeptides, or H-NUC derivatives such as H-NUC peptides. Or equivalents are also included within the scope of the invention. "H-NUC derivatives" are naturally produced H-NUC induction away from the linear sequence of the protein or polypeptide Amino acid modifications (ie, substitutions, deletions) so that the body retains the biological activity of H-NUC. Loss, or insertion). "Biological activity" or "biologically" "Active" refers to the non-phosphorylated retinoblastoma protein p110^RBHave the ability to bind to Means one aspect. The binding of H-NUC to Rb is, for example, highly conserved glycine. It is lost at 37 ° C when the amino acid (amino acid 640) is changed to aspartic acid. these The H-NUC derivatives of are one or more of the related amino acids such as, for example, similarly charged amino acids. For substitution or insertion of the above amino acids, or substitution or modification of side chains or functional groups Therefore, it differs from the natural sequence.   Make restricted modifications to the primary sequence of H-NUC without destroying its biological function. In order to be produced and to bring about activity (one aspect is p110^RBAbility to bind to It is further understood that only a portion of the entire primary structure (which is force) may be required . p110^RBThe nucleic acid sequence coding for is described by Lee, W.-H., et al.Science 235: 1394-1399 (1987 ), Incorporated herein by reference, and published. Of its biological function another An aspect is the ability of H-NUC to bind DNA. The ability to bind to DNA is not Lee, W.-H. et al.Nature(London) 329: 642-645 (1987), referenced herein. Can be measured using the method described in. One biologically active H-NU C derivatives are proteins and fusions containing the last 6 TPR regions at the C-terminus of H-NUC. Protein-Gal4-C49, each of which is described below. The Gal4-C49 derivative is shown in Figure 3. It has a sequence from the indicated amino acid 559 to the end of the sequence (SEQ ID NO: 3). Invitation to include TPR The conductor has the sequence of amino acids 559 to 770 shown in FIG. In addition, already mentioned In addition to the Gal4-C49 fusion protein or TPR derivative, Fragments that retain the function of the entire protein are H-NUC-derived. Included in the definition of a conductor. These H-NUC derivatives are the restriction enzymes of the nucleic acid molecule of FIG. It can be produced by elementary digestion and recombinant expression of the resulting fragment. Primary amino Minor modifications of the acid sequence are substantially equivalent as compared to the sequence described in Figure 3. Alternatively, a protein with enhanced function can be produced. These modifications are site-specific May be deliberate, as by dynamic mutagenesis, and suddenly in the host that is the H-NUC producer. It can be accidental like a mutation. All these modifications are due to the biological mechanism of H-NUC. Included as long as Noh is retained.   "Inhibitoryly active" also inhibits the normal functioning of the protein, Of the H-NUC thereby mediating host cell division and / or host cell proliferation Flags of the H-NUC protein that act in a predominant negative manner that inhibit biological roles Mento and variants (“muteins”). These proteins and Lagment may be made by chemical methods well known to those skilled in the art. Muteins and inhibitory Active fragments are used to promote hyperproliferation of cells therapeutically and of antibodies. It is useful for producing such diagnostic reagents.   These agents induce cell growth or proliferation in vitro or by the method described below. Is promoted or inhibited by contacting the drug with the drug in vivo Useful for. Therefore, the present invention also relates to hyperproliferative cells such as breast cancer cells. Of inhibiting the growth or proliferation of various cells by contacting the cells with a drug I will provide a. Also, diseases characterized by hyperproliferative cell growth such as breast cancer. In a concentration that is effective for inhibiting cell growth in appropriate subjects. Methods of treatment by administration are provided. Suitable subjects for this method are , But not limited to, vertebrates, monkeys, mice, and human patients .   The invention also includes any composition of the above substances and one or more pharmaceutically acceptable Provided is a pharmaceutical composition containing a carrier. A pharmaceutically acceptable carrier is Aqueous solutions or other solvents such as physiologically buffered saline well known in the art Is glycol, glycerol, vegetable oil (eg olive oil) or injectable Includes vehicles such as organic esters. A pharmaceutically acceptable carrier is H- Administering NUC or a precursor thereof to cells in vitro or to a subject in vivo Can be used for   A pharmaceutically acceptable carrier can be, for example, a protein or polypeptide. Physiology that acts to regulate or increase or decrease drug absorption It may contain a pharmaceutically acceptable compound. Physiologically acceptable compounds are eg , Carbohydrates such as glucose, sucrose, or dextran, ascorbi Antioxidants such as acids, chelating agents, low molecular weight proteins or other stabilizers Or it may include an excipient. Other physiologically acceptable compounds are humectants, emulsifiers Agents, dispersants, or preservatives (to prevent the growth or action of microorganisms (Especially useful). Various preservatives are well known and include phenol and And ascorbic acid. Those of ordinary skill in the art will appreciate that a pharmaceutically acceptable carrier (physiological (Including pharmaceutically acceptable compounds) is dependent upon the route of administration of the polypeptide and Depending on the specific physio-chemical characteristics of a specific polypeptide You will know. For example, raw materials such as aluminum monosterate or gelatin A physically acceptable compound is a retarder, which is the pharmaceutical composition administered to the subject. It is particularly useful for extending the absorption rate of substances). Carrier, stabilizer, or Further examples of adjuvants are Martin,Remington's Pharm. Sci., 15th Edition (Mac k Publ. Co., Easton, 1975), incorporated herein by reference, obtain. Pharmaceutical compounds may also be used in liposomes, microspheres, if desired. Or it can be incorporated into other polymer matrices (Gregoriadis,Liposome Te chnology , Volume 1 (CRC Press, Boca Raton, Florida 1984), referenced herein Quoted as). For example, liposomes composed of phospholipids or other lipids are Construction And non-toxic, physiologically acceptable and metabolizable capsules that are relatively easy to administer. Rear.   Purified H-NUC (protein) or H-NUC (nucleic acid) pharmaceutical compositions are Cells, such as purified H-NUC, or active fragments, Alternatively, a composition containing these polypeptides or proteins is contacted with cells. It is useful for inhibiting by touching.   For purposes of the present invention, contacting is in vitro, ex vivo, or in vivo. It can be brought by Bo. If the cell is inhibited in vitro, the contact is with the nucleic acid of the invention. Or mix the protein composition with the cell culture medium and then supply the cells Or by adding the nucleic acid composition or protein directly to the medium. You. Methods of determining an effective amount are well known to those of skill in the art.   The method also treats or in vivo a pathology associated with abnormally proliferating cells in a subject. Is useful to prevent. Thus, if contact is provided in vivo, An effective amount of the composition of the invention is an amount effective to inhibit the growth of cells in a subject. Administered to the subject. For the purposes of the present invention, a "subject" is an animal, a mammal. , Any human, or any vertebrate such as rat. This method is non-functional Especially for treating or preventing breast cancer in patients with H-NUC protein production Useful.   Methods of drug administration are well known in the art and include oral, intravenous and intramuscular administration. Administration includes, but is not limited to, intraperitoneal administration. Administration can be continuous or Can be delivered intermittently, as in the case of other therapeutic recombinant proteins. (Landmann et al.,J. Interferon Res. 12 (2): 103-111 (1992); Aul itzky et al.Eur. J. Cancer 27 (4): 462-467 (1991); Lantz et al.,Cytokine 2 (6): 402- 406 (1990); Supersaxo et al.,Pharm. Res. 5 (8): 472-476 (1988); Demetri et al.,J. Cl in. Oncol.  7 (10): 1545-1553 (1989); and Le Maistre et al.,Lancet 337: 1124-112 5 (1991)).   Purified mammalian H-NUC protein, H-NUC derivative, mutein and its active protein Isolated and encoding the amino acid sequence corresponding to the anti-H-NUC antibody. Further provided by the invention are nucleic acid molecules. As used herein, "nuclear "Acid" means single- and double-stranded DNA, cDNA, and mRNA. One implementation In an embodiment, this nucleic acid molecule encoding H-NUC proteins and fragments Has the sequence shown in FIG. 3 or a portion thereof. Nucleic acid molecule or its complement (eg Nucleic acid that hybridizes under stringent conditions to the sequence shown in FIG. 3). Molecules are also within the scope of the invention. Such hybridizing nucleic acid molecule Alternatively, the probe may be prepared, for example, by nick translation of the nucleic acid molecule of FIG. Nucleic acid molecules that can be prepared and hybridize in this case are those whose sequence is shown in FIG. It can be a random fragment of the offspring. For the preparation of such fragments For the methodology of Sambrook et al.,Molecular Cloning: A Laboratory Manual C old Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), see herein. See for reference. Nucleic acid fragmen of at least 10 nucleotides Are useful as hybridization probes. Isolated nucleic acid fla Gumento is also useful for producing novel peptides. These pepti Is also an immunogen for the production of polyclonal and monoclonal antibodies. Useful as Methods for preparing and using probes and immunogens are well known in the art. Is knowledge.   The nucleic acid sequences are also useful for inhibiting cell division and cell proliferation. Nucleic acid The molecule is inserted into a cell and the H-NUC protein encoded by the nucleic acid is The cells are grown under conditions such that the concentration is effective for inhibiting the growth of vesicles. Of the present invention For the purpose, the nucleic acid may be liposomes or lipidated DNA or Sambrook et al.the above, The virus vector disclosed in, incorporated herein by reference. It may be inserted by another gene carrier such as a vector. Mutant H-NUC protein Breast cancer cells that have production are those cells that would benefit from this method.   The treatment of human diseases by gene transfer is currently in the theoretical to practical range. Have moved to the fencing. The first trial of human gene therapy started in September 1990 and Regarding the transfer of the nonosine deaminase (ADA) gene into lymphocytes of patients, Had a fatal deficiency of this enzyme that resulted in immunodeficiency. This first The trial results were very encouraging and helped stimulate further clinical trials ( Culver, K.W., Anderson, W.F., Blease, R.M.,Hum. Gene. Ther., 1991 2: 1 07).   So far, most of the approved gene transfer attempts in humans have It relies on retroviral vectors for transduction of offspring. Leto in this situation Rovirus vector is a viral protein in cells infected with the vector. All viral genes have been removed or modified so that It is a retrovirus. The virus replication function is Retrovirus that produces protein but not infectious virus Ng "cells. Retrovirus vector DNA package Introducing into the S. lignin cells carries the vector RNA and can infect target cells, but Resulting in the production of virions that do not result in viral transmission. This process In order to distinguish Ruth from natural viral infections that continue to replicate and spread, the term " "Transduction" is often used rather than infection.   For purposes of illustration only, one of the delivery systems for nucleic acid insertion may include multiple There is a non-manufacturable retovirus vector. As used herein, the term "retrovirus" Rus "is a vector that has the ability to selectively target and introduce nucleic acids into dividing cells. Or delivery vehicle. As used herein The term "incompetent" refers to the pre-existence of vector transmission in infected host cells. Defined as the inability to produce viral proteins.   Another example of a replication incompetent retroviral vector is LNL6 (Miller, A.D. et al.,Bi oTechniques  7: 980-990 (1989)), incorporated herein by reference. gene Use of replication incompetent retroviruses for retrovirus-mediated gene transfer of markers The methodology is well established (Correll, P.H. et al.PNAS USA 86: 8912 (1989 ); Bordignon, C. et al.PNAS USA 86: 8912-52 (1989); Culver, K. et al.PNAS USA88: 3 155 (1991); Rill, D.R., et al.Blood 79 (10): 2694-700 (1991)) Incorporated by reference in the book. Clinical studies have shown that the adverse effects associated with viral vectors Indicates little or no (Anderson,Sience, 256: 808-13).   The major advantage of retroviral vectors for gene therapy is that their replication High efficiency of gene transfer into cells, accurate integration of transferred genes into cellular DNA And no further sequence transmission after gene transduction (Miller, A.D.,Nature, 1992, 357: 455-460).   Potential for replication-competent (helper) virus production during retroviral vector production Remains a concern, but for practical purposes this issue has been resolved. Until now By the way, all FDA-approved retroviral vectors were PA317 amphotropic retroviruses. Created using packaging cells (Miller, A.D., and Buttimor e, C.,Molec. Cell Biol., 1986 6: 2895-2902). Viral sequences in PA317 cells The use of vectors with little or no overlap with amplifies such events. Eliminate even the helper virus production by a rigorous assay that allows (Lynch, C.M. ., And Miller, A.D.,J. Viral., 1991, 65: 3887-3890). Other packaging Cells are available. For example, different retrovirus coding regions may The cell line designed for isolation on Smid is a recombinant helper virus It should reduce the likelihood of production. Such packaging cell lines The produced vector also provides an efficient system for human gene therapy. Get (Miller, A.D., 1992Nature, 357: 455-460).   Non-retroviral vectors are being considered for use in gene therapy You. One such alternative is the adenovirus (Rosenfeld, M.A., et al. 19 92,Cell, 68: 143-155; Jaffe, H.A. et al., 1992,Proc. Natl. Acad. Sci. USA, 8 9: 6482-6486). The major advantage of the adenovirus vector is its large DNA cell size. The potential to carry a pigment (36 kb genome), a very high titer (10¹¹/ ml), insi The ability to infect tissues (especially the lungs) in chu. The most striking thing so far The use of the vector for human pancreatic cysts by intratracheal instillation into the airway epithelium of cotton rats Delivery of the transmembrane conductance regulator (CFTR) gene of inflammatory fibrosis (Rosenfeld, M.A. et al.,Cell, 1992, 63: 143-155). Similarly, herpes The virus may also prove beneficial in human gene therapy (Wolfe, J.H. et al., 1 992,Nature Genetics, 1: 379-384). Of course, any other suitable virus K. can also be used in the gene therapy of the present invention.   Other FDA-approved gene transfer methods for use in humans are: Direct transfer of plasmid DNA in posomes to human cells in situ (N abel, E.G. et al., 1990Science, 249: 1285-1288). Plasmid DNA is a human gene It should easily prove for use in therapy. Because the plasmid DN This is because, unlike the retovirus vector, A can be purified to homogeneity. Liposome In addition to mediated DNA transfer, by complexing plasmid DNA with proteins Some other physical DNA transfer, such as a method of targeting the DNA to a receptor on the cell. Enrollment shows promise in human gene therapy (Wu, G.Y. et al., 1991,J. B iol.Chem. , 266: 14338-14342; Curiel, D.T. et al., 1991,Proc. Natl. Acad. Sci . USA , 88: 8850-8854).   The gene encoding the H-NUC of the present invention is added by a method well known in the art. Placed in an expression vector, such as a mid expression vector or a viral expression vector. obtain. The plasmid expression vector was transfected with calcium phosphate transfection, Posome (eg LIPOFECTIN) mediated transfection, DEAE dextran Mediated transfection, polybrene mediated transfection, electro Introduction into cells by poration and any other method of introducing DNA into cells I can do it.   Viral expression vectors can be targeted to target cells in a form that can be expressed by infection or transduction. Can be introduced into the cell. Such viral vectors include, but are not limited to: Without limitation: retroviruses, adenoviruses, herpesviruses, and Bipox virus. When H-NUC is expressed in any abnormally proliferating cells, cell The cycle is stopped, which causes senescence and cell death and ultimately abnormal tissue (such as That is, a tumor or cancer) resulting in a decrease in the mass. Can introduce gene constructs into target cells , And a vector capable of expressing H-NUC in an amount that suppresses cell proliferation, Can be administered in an effective manner.   For example, a physiologically relevant solution containing an effective concentration of the active vector may be administered topically. Intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously, and Can be administered by any other effective method. In particular, the vector is Direct injection into target cancer or tumor tissue in an amount effective to treat tumor cells I can do it.   Alternatively, in a body cavity (eg, eye, gastrointestinal tract, genitourinary tract (eg, bladder), lung or And tumors present in the bronchial system, etc. Containing a physiologically relevant composition (eg saline or phosphate buffer) Such solutions, suspensions, or emulsions, which are sterile except for the vector ) Is placed in a hollow organ that covers the cancer or tumor Alternatively, it may be received by direct injection using another delivery tube. X-ray, sonogram, or light An effective imaging device, such as a fiber visualization system, can It can be used to locate and guide a needle or catheter tube.   In another alternative, a physiologically relevant solution containing an effective concentration of the active vector. To treat cancers or tumors that cannot be directly reached or anatomically isolated In addition, it can be administered systemically in the blood circulation.   Yet another alternative is to target the tumor or cancer cells with the H-NUC protein. It can be treated by introducing it in any known method. For example, liposomes , Drugs, proteins, and plasmid vectors in vitro or in vivo (Mannino, R.J. et al., 1988,Biotechniques, 6: 682-690) in target cells Are artificial membrane vesicles that are available for delivery to (Newton, A.C. and Hues tis, W.H.,Biochemistry, 1988, 27: 4655-4659; Tanswell, A.K. et al., 1990,Bio chmica et Biophysica Acta , 1044: 269-274; and Ceccoll, J. et al.Journal of Investigative Dermatology , 1989, 93: 190-194). Therefore, H-NUC protein Is highly efficiently encapsulated in liposome vesicles and B) or may be delivered in vivo.   Liposomal encapsulated H-NUC protein topically, intraocularly, parenterally, nasally Intratracheally, intrabronchially, intramuscularly, subcutaneously, or any other effective method Can be administered at a dose effective to treat hyperproliferative cells of the target tissue. Lipo Physiologically relevant, containing an effective amount of H-NUC protein encapsulating the some Can be administered in various compositions.   Other vectors are suitable for use in the present invention and contain the H-NUC gene. Selected for effective delivery of the nucleic acid. The nucleic acid can be DNA, cDNA, or RNA. possible.   In another embodiment, the isolated nucleic acid molecule of the invention is a promoter of RNA transcription. Operably linked. These nucleic acid molecules include H-NUC proteins and polypep tides. Useful for recombinant production of tide or for use in gene therapy and Useful.   The present invention also provides a vector into which the above isolated nucleic acid molecule is inserted. You. For example, a suitable vector is a plasmid, cosmid, or viral vector. Can be, but is not limited to. An example of a suitable vector is Sambro ok et al., supra, and Zhu et al.Science 261: 209-211 (1993). They are Incorporated herein by reference. Suitable host cells (eg, prokaryotic cells) Cell, eukaryotic cell), H-NUC may be recombinantly produced. Suitable Poor host cells include mammalian cells, insect cells, yeast cells, and bacterial cells. Can be mentioned. See Sambrook et al., Supra. This is hereby incorporated by reference Has been incorporated.   Suitable conditions for expressing the H-NUC encoded by the nucleic acid or a fragment thereof. Recombinant H-NUC or its derivatives by growing the above host cells under A method of producing a is provided by the present invention. Suitable conditions are well known to those skilled in the art. Can be determined using the method. See, eg, Sambrook et al., Supra. This is a reference Are incorporated herein by reference. The proteins and proteins produced in this way And peptides are also provided by the present invention.   According to the present invention, a complex is specifically formed with H-NUC protein or a fragment thereof. Antibodies that can be formed are also provided. The term "antibody" refers to a polyclonal antibody And monoclonal antibodies. Antibodies include mouse, rat, rabbit, or Human monoclonal antibodies.   As used herein, "antibody or polyclonal antibody" refers to an antigen or receptor. A protein produced in response to immunization with a scepter. "Monoclonal anti The term "body" refers to an immunoglobulin derived from a single clone of cells. This ku All loan-derived monoclonal antibodies are chemically and structurally identical and And is unique to only one antigenic determinant.   Those skilled in the art will be familiar with experimental methods for producing polyclonal and monoclonal antibodies. It is known. Harlow and Lane,Antibodies: A Laboratory Manual, Cold Spri ng Harbor Laboratory, New York (1988) (incorporated herein by reference) See). Monoclonal antibodies of the invention are used in animals (e.g., mice or Biologically by introducing H-NUC or a fragment thereof into Can be produced. Antibody producing cells in the animal have been isolated and myeloma cells or Fused with a heteromyeloma cell to give a hybrid cell or hybridoma Generate Therefore, a hybridoma producing the monoclonal antibody of the present invention Ma cells are also provided. The monoclonal antibodies produced in this way include: It includes, but is not limited to, the monoclonal antibodies described below.   Thus, using the H-NUC protein or its derivatives, and well-known methods Those skilled in the art will appreciate that the antibodies of the present invention can be hybridized with H-NUC. Antibody cells and antibodies can be produced and screened.   The present invention also provides the biology of the polyclonal and monoclonal antibodies described above. A chemically active fragment. These "antibody fragments" refer to Retains some ability to selectively bind the progenitor or immunogen. Such an antibody Fragments include, but are not limited to:   (1) With the enzyme papain to obtain Fab, complete light chain and part of one heavy chain Fragment containing a monovalent antigen-binding fragment of an antibody molecule produced by digestion of Event;   (2) treatment with pepsin to obtain Fab ′, complete light chain and part of heavy chain, A fragment of the antibody molecule obtained by subsequent reduction; two Fab 'fragments Obtained per antibody molecule;   (3) (Fab ')₂Obtained by treatment with the enzyme pepsin, without subsequent reduction Antibody fragment; (Fab ')₂Are held together by two disulfide bonds Is a dimer of two Fab 'fragments,   (4) Fv, light chain variable region and heavy chain variable region expressed as two chains Is defined as a genetically engineered fragment containing   (5) SCA, a polypeptide phosphorus suitable as a genetically fused single-chain molecule Genetically engineered to contain the variable region of the light chain, the variable region of the heavy chain, linked by a car Defined as a fragment.   Methods of making these fragments are known in the art, for example: See Harlow and Lane, supra (incorporated herein by reference). When.   Particular examples of "biologically active antibody fragments" include the CDR regions of antibodies. I will.   Anti-idio that specifically reacts with antibodies or biologically active fragments thereof Type peptides are also provided by the present invention. As used herein, "anti-idio A "type peptide" is injected into a distant species, recognized as a foreign antigen, and It is a purified antibody from a species that elicits a humoral immune response. general For a discussion of various methods, see Harlow and Lane, supra (incorporated herein by reference). Used).   Recombinantly produced, biochemically synthesized, chemically synthesized, or chemical Modified naturally corresponding polyclonal or monoclonal antibody Tamper that retains the ability to bind H-NUC or fragments thereof as Proteins or polypeptides are also provided by the present invention. With antigen or immunogen The ability to bind is determined by antigen binding assays known in the art such as antibody capture assays. Measured by Sei. For example, Harlow and Lane, supra (referenced herein Are incorporated by reference).   In one embodiment, the antibody or nucleic acid is as described in Harlow and Lane, supra. (Incorporated by reference in the text) or "Princi ples and Practice of Immunoassays ", C.J. Price and D.J. Newman, Sto ckton Press, New York (1991) (incorporated herein by reference). Using standard immunochemical techniques, such as immunohistochemistry, as discussed, An assay useful for detecting H-NUC proteins and fragments in a sample. Linked to a releasable reagent.   In another embodiment, the antibody binds H-NUC and alters its function intracellularly. Is administered for. Antibodies can be tested for H-NUC function by methods well known to those of skill in the art. It is administered at an effective concentration that will be restored. The antibody also binds to the retinoblastoma protein Inhibits cell growth or proliferation by binding to H-NUC, which has lost its ability to For that, it can be used therapeutically. This antibody refolds into an active conformation. It binds to the resulting H-NUC. In other words, the drug elicits the natural biological activity of H-NUC. Restore.   The antibodies and nucleic acid molecules of the invention may be H-NUC proteins or obtained from patients. The presence or absence of modified H-NUC gene in isolated cells or samples and Useful for making decisions. Thus, breast cancer or breast cancer susceptibility is diagnosed. Can be   The above-identified proteins, polypeptides, nucleic acids, antibodies and their fragments Lagment is useful in the preparation of therapeutic drugs as outlined above.   The present invention is now described in great detail by reference to the examples below. I have. These examples are intended to be illustrative of the invention and not limiting. There is no.                            Experimental methods and results   The yeast two-hybrid system was used to interact with the C-terminal region of RB (p56-RB). Twenty-five working clones were isolated. One of these is clone C49. (Durfee ,Gene Devel., 7: 555-569 (1993)). Several C-terminal parts of RB protein Two non-adjacent domains required for binding to the oncoprotein of DNA oncovirus It has a C-terminal region associated with in and DNA binding activity. In this specification, RB related One of the proteinsS. pombeYeast nuc2 protein and fungalAspergillus It has been characterized as having similar primary sequence and biochemical properties to the genus bimA. Mutations in these latter two genes in lower eukaryotic cells are Arrests cells, which are responsible for these proteins in the normal process of mitosis Demonstrate the important role of quality. These two proteins are called the TRP motif , Containing a novel repeating amino acid in a 34 residue motif. Functions of these iterations Are not known, but these do not rely on protein-protein interactions in principle. It is hypothesized to form an amphipathic α-helix that can be driven. Reported here The protein described is the human TRP protein originally isolated and reported. Screening and sequencing analysis of cDNA libraries.   For isolation of the full length H-NUC cDNA, use the method of Durfee et al. The 1.5 Kb BglII fragment of C-49 isolated in Human fibroblast cDNA library by plaque hybridization. Used to screen Lee. Insert the cDNA insert into the pBSK + vector (Str atagene, San Diego, Ca.) Subcloning into the EcoRI site for DNA sequencing Made easy. Sequencing was performed with the dideoxy-NTP and Sequenase 2.0 provided by the manufacturer. It was carried out according to the specifications (US Biochemicals). Sequence analysis and phase Same-sex search is performed using DNASTAR software (DNASTAR, Inc., Madison, WI). Was. Construction of GST fusions, protein preparation, and in vitro conjugation.   To construct GST-491, plasmid C-49 was digested with BglII and a 1.3 Kb Insert the insert fragment into the BamHI site of pGEX-3X (Pharmacia, Piscataway, N.J.). Was subcloned. GST-T was cut with HindIII to Y62-25-2 and terminated with Klenow. Subcloning the 823 bp fragment into pGEX-3X, blunted and digested with SmaI. It was generated byE. coliExpression of GST fusion protein in (Smith And Johnson,Gene, 67: 31-40 (1988)) was induced with 0.1 mM IPTG. 10K cells Centrifuge for 5 minutes at room temperature, and pellet the resulting pellet with Lysis 250 buffer (250 mM NaCl. 5 mM EDTA, 50 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfoni Resuspended in rufluoride (PMSF), 8 μg leupeptin, 8 μg antipain) Was. Add 4 mg of lysozyme, and place the cells at 4 ° C for 30 minutes, and sonicate the cells. Dissolved by wave treatment. Cell debris is removed by centrifugation (10K, 30 minutes), The supernatant was then added to the glutathione-coated beads.   The in vitro binding assay was performed as follows. 2 x 10⁶2E3 cells (Chen et al., 1992, below, incorporated by reference herein), Lysis 150 buffer with beads containing 2-3 μg GST or GST fusion protein Liquid (50 mM Tris (pH7.4), 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM  PMSF, 1 μg / ml leupeptin, 1 μg / ml antipain) for 30 minutes at room temperature Incubated. Wash the complex thoroughly with lysis 150 buffer and Boiled in Reading Buffer and run on a 7.5% SDS-PAGE gel. Gel Transfer to an immobilon membrane and immunoprevent with anti-RB monoclonal antibody 11D7. Blotted. After addition of alkaline phosphatase-conjugated secondary antibody, bound RB The protein was treated with 5-bromo-4-chloro-3-indolyl phosphate toluidinium and nitric acid. Visible with Toroblue Tetrazolium (BCIP, NBT; Promega, Madison, WI) Turned into Antibody production and protein identification.   Anti-H-NUC antibodies were produced using methods well known to those of skill in the art. Harlow and Lane,A ntibodies: A Laboratory Manual , Cold Spring Harbor Laboratory (1988), book It is incorporated by reference in the specification. Simply put, about 100 μg of GST-491 fusion Mice were immunized with the protein and boosted three times. Immunized mouse Serum was collected from and used directly in immunoprecipitation experiments. About 1 x from each cell line Ten⁷Cell³⁵Lysis 250 metabolically labeled with (S) -methionine for 2 hours followed by ice cooling Dissolved in buffer. The clarified lysate was incubated with various antibodies for 1 hour at 4 ° C. Incubate, then add Protein A Sepharose beads and add at 4 ° C to dry. And incubated for 30 minutes. After extensive washing with lysis buffer, beads are SDS-supported. Boiled in sample buffer and immunoprecipitates were separated by 7.5% SDS-PAGE. Double For immunoprecipitation, the resulting immune complex was treated with 200 μl of dissociation buffer I (20 mM Tris-Cl Protein at pH 7.4, 50 mM NaCl, 1% SDS, and 5 mM DTT). Denatured. Unfold the denatured protein in 200 μl of Dissociation Buffer II (20 mM Tris-Cl, pH 7 .4, 50 mM NaCl, 1% NP40, and 1% sodium deoxycholate) And re-immunoprecipitated with antibody. Cell fractionation procedure.   The procedure for separating the membrane, nucleus, and cytoplasmic fractions is described by Lee, H.-W. et al.Nature, (1987) , Supra (incorporated herein by reference). Then three All fractions of RB protein and H-NUC content were immunoprecipitated as described above. Assay and aliquots of each fraction also confirm the composition of each fraction Was Incubation with glutathione beads for this purpose. DNA binding assay.   About 1 × 10⁷K562 human chronic myelogenous leukemia cells (ATCC)³⁵Labeled with S-methionine And then lysed in Lysis 250 buffer. Clarify the lysate by centrifugation, 2 volumes of loading buffer (10 mM KH₂PO_Four, PH 6.2, 1 mM MgCl₂, 0.5% NP40 , 1 mM DTT, 10% glycerol). The diluted extract is then added to the DNA-se Apply it to a lulose column (natural calf thymus DNA, Pharmacia, Piscataway, NJ) and relax. Incubated at 40 ° C for 1 hour with gentle shaking. Next, the column is 5 beds Wash with a volume of loading buffer and then wash with the same buffer containing increasing concentrations of NaCl. It was eluted with the buffer. Fractions were treated with either anti-RB antibody or anti-H-NUC antibody as described above. Were analyzed by immunoprecipitation. Aliquots of each fraction are also glutathione trans Incubated with glutathione beads to detect ferrase. H-NUC yeast expression plasmid; deletion mutant   A DNA fragment derived from the H-NUC cDNA was ligated into pSE1107 (Durfee et al., 1993, supra). Cloned: Clone 491 was cloned by the yeast two-hybrid screen. It is an original clone isolated from A 3.3 kb XhoI fragment in the modified pSE1107. H-NU by inserting a Lagment to generate an in-frame fusion protein I built C. RV contains the N-terminal XhoI-EcoRV fragment. BR208, BR207, B5, And B6 are Sau3A partial digests. Gal4 fusion tamper derived from these constructs The quality of amino acids is 1 to 824 for H-NUC and 5 for 491, respectively. 59-824, amino acids -1 to 663 for RV, amino acids 699 to 824 for BR2-8, B To amino acids 797-824 for R2-7, amino acids 559-796 for B5, and B6 It contains amino acids 597-796. The ts mutant was cloned with the NsiI fragment of H-NUC. It was generated by substituting with a nealed primer. The primers are It was: Primer 1: Primer 2: All constructs have been confirmed by DNA sequencing analysis. Yeast transformation and quantification of β-galactosidase activity.   Yeast transformation was previously reported (Durfee et al., 1993, supra, incorporated herein by reference). ), And the LiOAC method is used. Plus after transformation Free of tryptophan and leucine to select for the presence of the mid Cells were seeded on synthetic dropout medium. Each form after 2-3 days growth at 30 ° C A single colony of quality conversion was inoculated into the appropriate selection medium. Appropriate 2.5 ml culture OD in crisp selection medium₆₀₀Were grown to 1.0-1.2. Then listed Like (Guarente, L.,Methods Enzymol. 101: 181-191 (1983), herein Incorporated by reference), cells were prepared and permeabilized. Chloropheni Using red-β-D-galactopyranoside (CPRG; Boehringer Mannheim) For amounts, standard conditions were used (Durfee, 1993, supra, see references herein). Has been adopted.) H-NUC binds to unphosphorylated RB in a region similar to the SV40 T-antigen binding region.   A panel of deletion mutants of the RB protein was constructed. These mutants were originally T- It has been used to delineate binding domains, and these are Gal-4 DNA junctions. Previously reported in plasmid pAS1 containing the codomain (Durfee et al., 1993, supra, herein. , Which is incorporated by reference). These DNA structures Two constructs, Gal-4 activation domain-C-49 fusion expression plasmid (original clone C-49) and YI pPTG10 (instruction plasmid containing β-galactosidase), It was used to co-transform the yeast strain Y153 (Durfee et al., 1993, supra). Each RB fusion server The expression level of the protein was determined by Sambrook et al.Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), herein Method, which is incorporated by reference). And there was no more than 2-3 fold change. Then, the obtained transformant is Up Assayed for β-galactosidase activity as described. As shown in Figure 1 , C-49 fusion protein binding to Gal-4-RB binds to many of the same mutations in the RB protein. It is more attenuated, which is a point change to amino acid 706 Cys to Phe that eliminates SV40 T-antigen binding. Including differences. C-49 binds an Ssp variant lacking the C-terminal 160 amino acids of the RB protein No, but one exception is that T-antigen can bind with reduced affinity. is there. M1 deletion (a part of the linker region between the two binding subdomains is deleted ( Amino acids 612-632) are the only variants that can bind both H-NUC and T-antigen. is there. Apparently, similar but non-identical regions of the RB protein are T-antigen and C- Needed to combine both 49.   Then in vitro p110^RBThe ability of the C-49 fusion protein to bind to was tested. p110^RBThe amino acid sequence of Lee, W.-H. et al.Science, 235: 1394-1399 (1987) (honmei) Incorporated by reference in the detailed text). 1.3 kb cDNA clone (Fig. 3)E.coliGlutathione S-transferase (GST) fusion tamper in As a quality (Smith and Johnson,Gene, 67: 31-40 (1988), herein Is incorporated as a reference). Equal amount of GST-C-49 protein and two additions Control, GST alone, and glutathione B containing GST-T antigen (Fig. 2A) From a human retinoblastoma cell line (WERI RB27) reconstituted with the RB gene. Incubated with cell extract (Chen et al.,Cell Growth Differ. 3: 119-125 (19 92)). Under standard culture conditions, these WERI (RB +) cells are shown in Figure 2B (lane As shown in 2), different isoforms of RB protein exhibiting different phosphorylation states are expressed. Manifest. After extensive washing, the protein bound to the beads was washed with Sambrook et al. SDS- according to the method disclosed in the above, incorporated herein by reference). Analyzed by PAGE and Western blotting. The blot shown is anti-RB The antibody 11D7 was used as a probe (Shan et al.,Mol. Cell. Biol. 12: 5620-5631 (1992), Incorporated herein by reference). Under these conditions, H-NUC is positive Non-phosphorylated p110 with similar affinity to Gst-T used as a control^RBTie only I got it. GST alone does not bind any Rb protein (Fig. 1A, lane) 2-4). These results show that the H-NUC protein is a non-phosphorylated native It can be complexed only with the full-length RB protein of. Full-length cDNA and its sequence.   The 1.3 kb cDNA was used as a probe to further characterize the new protein. And used to screen a human fibroblast cDNA library. Isolated From a dozen clones, the longest cDNA clone (about 3.3 kb) was completely sequenced Was. The open reading frame encodes a protein of 824 amino acids ( (Figure 3). Proteins are two known proteins,S. pombeYeast nuc2 andAsperg illus nidulano  It has 35% overall homology to bimA. Of these two genes Lower eukaryotic proteins because temperature-sensitive mutants arrest cells in metaphase Both qualities are known to be associated with mitosis. Nuc2 and bimA proteins As shown in FIG. 4, the quality was one in the N-terminal region and nine in the C-terminal region. Contains 10 34 amino acid repeats organized into a bundle. Similar repeating arrangements also Found in a novel RB-related protein. Compare only 9 repeat regions of 3 proteins By comparison, the sequence identity is 60% (Figure 4B). But nuc2 and bimA first The sequence between the first and second repeats has very low homology. This low homology also Certainly retained for the protein from Lone C-49. Based on sequence homology And the isolated clones are human homologues of yeast Nuc2 and Aspergillus bimA. Seems to be. Therefore, the C-49 clone was named H-NUC. The C-terminal repeat of H-NUC binds to the RB protein.   This H-NUC protein binds RB by T-antigen and adenovirus E1A The well-known L-X-C-X-E motif used in the above has also been shown to be important for binding RB. It does not include the 18 amino acid sequence of E2F that has been described. This finding indicates that H-NUC protein is RB It is suggested that different motifs may be used to bind the. Such a combined mode Contains different regions of the H-NUC cDNA to help define the chief Constructing a deletion mutant of the line and expressing the Gal-4 fusion protein as shown in FIG. I let it. Invitro of previously reported yeast two-hybrid system (Durfee, 1993, supra) Bo binding assay was used to determine the region of the protein containing the binding motif. full length Protein and the original clone (containing 6 repeats) Combine well. However, the N-terminal region containing the first repeat does not bind to RB. Orient All deletion mutants from different parts of the zinal clone do not interact with RB. This These data indicate that H-NUC is a novel method, probably a tamper with a particular secondary structure. It is suggested that RB can be bound by using a larger region of texture. Gly to Asp change at amino acid 640 reduces binding to RB at nonpermissive temperatures Generate temperature sensitive H-NUC mutants.   To help confirm that H-NUC binding to RB is physiologically important In addition, a single point mutation at amino acid 640 (Gly to Asp) was site-specific in the H-NUC protein. Generated by mutagenesis. Similar changes of Gly504 to Asp in nuc2 are temperature sensitive Is the cause of the sexual phenotype,S. pombe Stop metastatic progression of yeast (Hirano, T., Y. Hiraoka, and M. Yanagida.J. Cell Biol 106: 1171-1183 (1988)). Gly residue Is conserved in the H-NUC protein, similar to the yeast homolog, Gly to Asp The generation of the mutation indicates that this H-NUC protein lacks binding to RB at non-permissive temperatures. Test whether or not. As shown in FIG. 6, H-NUC protein containing Gly-640 mutation Quality does not interact with RB when yeast grow at 37 ° C (non-permissive temperature) Retains its ability to bind RB when grown at 22 ° C (permissive temperature). This data Is a link between putative metaphase arrest temperature-sensitive (ts) phenotypes for Rb-binding properties Prove that. Preparation of H-NUC antibody and identification of H-NUC protein.   Of this novel H-NUC protein on protein gels and Western blots Mouse antibodies against it were prepared to allow identification. Gst-C-49E. c oli (Smith and Johnson, 1988, supra, and Shan et al., 1992, supra. , Each of which is incorporated herein by reference), using glutathione beads And purified and used as an antigen to elicit an antibody response in mice. Next Then, serum containing the polyclonal anti-H-NUC antibody was collected. After getting the antibody,³⁵S-Me Preparation of cell lysate using erythroleukemia cell line (K562) metabolically labeled with thionine Then, immunoprecipitation was performed using a polyclonal antibody as described previously. As shown in FIG. 6A, 95kd A specific protein with a molecular weight of It was not precipitated by the preimmune serum. The complex separates on the gel. 95kDa Tan Only quality is³⁵K562 protein is specifically labeled with S-methionine Can be seen. This 95kd protein uses GST protein as a competitor for immunoprecipitation. It is also detected when there is. This is because the polyclonal antibody does not recognize GST alone. And On the other hand, the original antigen may compete with endogenous cellular proteins and 95 kd band is no longer detected (lanes 3 and 4). The specificity of this antibody is Further confirmation was made when the sub-immunoprecipitate was denatured and re-immunoprecipitated. Figure 6 As shown in B (lane 3), the 95kd protein is the only band detected. , And the background is clean. So all the immunological evidence It suggests that the 95 kd protein is the H-NUC gene product. The H-NUC protein has DNA binding activity.   About 1 × 10⁷Cells³⁵Label with S-methionine, then Lysis 250 buffer (250 mM Na Cl, 5 mM EDTA, 50 mM Tris (pH8.0), 0.1% NP40, 1 mM phenylmethylsulfoni Lefluoride (PMSF), 8 μg / ml leupeptin, and 8 μg / ml antipie Solution). The lysate was clarified by centrifugation and 2 volumes of loading buffer Immersion liquid (10 mM KH₂PO_Four, PH 6.2, 1 mM MgCl₂, 0.5% NP40, 1 mM DTT, 10% glyceride Roll). The diluted extract is then treated with DNA-cellulose as described above. Column (native calf thymus DNA, Pharmacia, Piscataway, NJ) and mix The material was incubated at 4 ° C for 1 hour with gentle shaking. Column 5 beds Wash with a volume of loading buffer and then wash with the same buffer containing increasing concentrations of NaCl. It was eluted with the buffer.   Fractions of the eluate were labeled with antibodies (11D7, 7A), an antibody against H-NUC (FIG. 7B), or against GST beads (FIG. 7C). Analyzed by immunoprecipitation with antibody. Aliquots of each fraction are also glutathione Incubate with glutathione beads to detect lancerase did. RB protein has DNA binding activity and serves as a positive control Used. H-NUC protein has similar DNA binding activity, but glutathione Transferase alone does not have such activity. Sequence homology analysis is H- It shows that the DNA binding region of NUC is located outside the TRP region. H-NUC maps to chromosome 17q21-22.   ^ThreeIn situ hybridization of H-labeled 3.3 kb H-NUC cDNA probe to human chromosome As shown in FIG. 9, the hybridization was specific to the q21-22 region of chromosome 17. It showed various signs. Out of 320 grains derived from 150 cells scored , 42 (13.1%) were found in 17q21-22. Other parts are above the background It wasn't labeled. Some of the probes used are sequences homologous to the pseudogene. Therefore, multiple hybridizations to the short arm of the acrocentric chromosome are detected. Detected in all cells examined and excluded from analysis. Of similar mapping Results were obtained by a somatic cell-hybrid method that also maps H-NUC to chromosome 17. Was. The location of H-NUC is different because the familial breast cancer gene is mapped to the same region. Tasteful. Tumor suppressor activity of H-NUC.   The tumor suppressor activity of H-NUC was determined by in vitro cell culture conditions and nude mouse animal models. Evaluated by both Dell. The cell line used to evaluate H-NUC tumor suppressor activity was H -MDA-MB-231 containing one functional allele of NUC, and homo of the H-NUC locus It was a zygotic mutant, T-47D.   Briefly, the effect of H-NUC on the growth of the above two cell lines was adenovirus. It was evaluated by H-NUC expression using the loose expression vector. ACN is a clone that lacks a cDNA insert. AC-H-NUC, a control adenovirus vector, is a human CMV promoter. Is an adenovirus vector that expresses H-NUC under the control of the adenovirus. Adenovirus vector containing H-NUC.   To construct an adenovirus expression vector, the full-length cDNA for H-NUC was A 2520 base pair fragment containing a Quick Clone double-stranded placenta cDNA (Clontech) Was amplified by PCR. The primers used for amplification of H-NUC were pBluescript II KS + In order to make directional cloning in the multiple cloning site of A Kpn I restriction site at the 5'end and an Xho I site at the 3'end of the fragment were added (5 Prime oligo 5'CGCGGTACCATGACGGTGCTGCAGGAA3 '; 3 prime oligo 5'ATCGGC TCGAGCAGAAGTTAAAATTCATC3 '). The PCR cycle was as follows: 94 ° C 1 min 1 cycle; 1 minute at 94 ° C, 1.5 minutes at 53 ° C, 2 minutes at 72 ° C for 30 cycles; and 72 ° C for 7 minutes 1 cycle. The clone was cloned into the TnT Coupled Reticulocyte Lysate System (Promeg We screened in a) for the ability to produce the 95KD protein. Bluescrip The T3 promoter in the t vector is the H-NUC coding sequence for rabbit reticulocytes. Allows transcription and translation of sequences. 1 μg mini-lysate per TnT reticulocyte reaction DNA was added and incubated at 30 ° C for 1 hour. Load 10 μl reaction Mixing buffer and 10% polyacrylamide gel (Novex) at 165V for 1.5 hours Electrophoresed. The gel was dried and exposed to film overnight. Full-length protein The four resulting clones were sequenced. Insert H-NUC insert into Kpn I and Hind  Recovered from the vector after digestion with II and the KpnI-BgIII part of the pAdCMVb-vector Subcloned into position (BgIII was filled in to generate blunt ends. ). All four clones contained some mutations. Therefore, the right field To ligate the clones containing the raw sequence with the fragments from the two clones More generated.   To construct the recombinant adenovirus, the above plasmid was linearized with Nru I. , And CapO_FourCla I digestion using the transfection kit (Stratagene) Dl309 mutant (Jones and Shenk,Cell, 17: 683-689 (1979), which is here Co-transfected with the large fragment (incorporated by reference in the text) Was. Virus plaques were isolated and subjected to restriction digest analysis and H-NUC cDNA sequence Recombinants were identified by both PCR with primers. Recombinant virus Further purification by limiting dilution and purification of virus particles and standard methods Titered by (Graham and van der Erb,Virology, 52: 456-457 (1973 ); Graham and prevec, manipulation of adenovirus vectors,Methods in Molecul ar Biology Volume 7: GeneTransfer and kExpression Protocols , Murray E.J. Edition Th e Humana Press Inc., Clifton N.J., 7: 109-128 (1991), both herein. reference Is used as).   Confirm that the above H-NUC vector expressed the appropriate size protein In order to enhance T-47 D cells with increasing multiplicity of infection (MOI) plaque formation of the virus Units / cell, either control or recombinant adenovirus containing H-NUC Infection for 24 hours. The cells are then washed once with PBS and lysis buffer Liquid (50 mM Tris-HCl pH7.5, 250 mM NaCl, 0.1% NP40, 50 mM NaF, 5 mM EDTA, 10 μg / ml aprotinin, 10 μg / ml leupeptin, and 1 mM PMSF). You. Cellular proteins were separated by 10% SDS-PAGE and loaded onto nitrocellulose. Transfer. Membranes were stained with anti-H-NUC antibody followed by horseradish peroxidase-conjugated sheep. Incubate with di-anti-mouse IgG. Accurate expression of H-NUC protein Visualize by chemiluminescence (ECL kit, Amersham) on Kodak XAR-5 film. In vitro.   Breast tumor cell lines MDA-MB-231 and T-47D with 10% FBS for T-47D cells And Kaighn's F12 / DME medium (Irvine Sci) supplemented with 0.2 IU insulin (Sigma) entific) 1 × 10 per 100mm plate⁶Cells were seeded. Plate 7% CO₂ Incubated overnight at 37 ° C. The next day, the cells are replenished with 10 ml of culture medium Cells and control cells with ACN control virus lysate (MOI 10) or AC-H-NUC. Infected with any of the Ils lysates (MOI 10) and incubated at 37 ° C . After 3 days, medium was removed and cells were fixed with 1: 5 acetic acid-methanol solution. Was. Stain cells with 20% methanol-0.5% crystal violet solution for 30 minutes, Then rinsed with tap water to remove excess stain.   Infection of T-47D cells with AC-H-NUC caused these to be expressed by H-NUC proteins. Resulted in growth inhibition of cells (Fig. 11). AC stained with crystal violet -Visible observation of T-47D cells infected with -H-NUC is similar to that of ACN control cells. Shows a decrease in number (about 50%). In addition, changes in T-47D cell morphology occurred. Cells It appeared condensed and lost its normal growth properties. T-47D cells No changes were seen when challenged with Troll ACN virus. Conversely , MDA-MB-231, a heterozygous cell, was tested by ACN or AC-H-NUC in vitro. Shadow It didn't seem to sound.   Thymidine incorporation also to assess the effect of H-NUC on cell proliferation Using. Simply put, it is about 3 x 10^ThreeMDA-MB-231 and T-47D cells in 96 well plate Plate each well of the Costar and incubate overnight (37 ° C) , 7% CO₂). Make serial dilutions of ACN or AC-H-NUC using DME: F12 / 15% FBS / 1% Glucose. Cells were made with tamin and cells were infected with 10 and 100 of each adenovirus. Infection was severe (MOI) (4 replicate wells at each MOI). Feel half of the cell culture volume It was changed 24 hours after dyeing and every 48 hours until collection. 18 hours before collection 1μ Ci's^ThreeH-thymidine (Amersham) was added to each well. 5 days after infection of cells Collected on a fiber filter and incorporated into the nucleic acid of cells^ThreeH-chimi did. Cell growth (cpm / well) at each MOI was increased by an average of untreated control cells Expressed as a percentage of breeding.   The results obtained show that the proliferation of MDA-MB-231 cells (heterozygous for H-NUC) is ACN. Or was shown to be similar after either treatment with AC-H-NUC (see Figure 12). That). On the contrary, the specific response to AC-H-NUC was shown in T-47D cells (for H-NUC Deleted), which was enhanced at higher MOI. These de Data show adenovirus-mediated gene transfer of the H-NUC gene in H-NUC-modified cells. Prove anti-proliferative effect. Ex vivo gene therapy.   In order to evaluate the effect of H-NUC expression on tumorigenicity, the above tumor cell lines were used. It was tested for its ability to generate tumors in a nude mouse model. About 2 × 10⁷ T-47 D cells are plated in T225 flasks and cells are plated with ACN or AC-H-NUC. Treated with claus buffer at a MOI of 3 or 30. After overnight infection, collect cells , And about 107 cells previously received a subcutaneous pellet of 17β-estradiol BALB / c nude mice (4 / group) were subcutaneously injected into the left flank and the right flank. one ACN-treated cells were injected into one flank and AC-H-NUC cells were injected into the opposite flank and each mouse was injected. Was used as its own control. Received bilateral injections of untreated cells Animals were used as an additional control for tumor growth. Then the size of the tumor The dimensions (length, width, height) and body weight were measured twice a week. Tumor body The product is estimated for each animal and is equal to half the mean tumor size measured here. A spherical geometry with a diameter was assumed.   The results of this experiment are shown in Figure 13 and indicate the tumor growth of cells expressing H-NUC. Shows a significant decrease in Briefly, 21 days after cell inoculation, the tumor is all moving. It was measurable on both sides of the object. Tumor arising from cells treated with AC-H-NUC (MOI = 30) The ulcer was the contralateral side derived from cells treated with ACN (MOI = 30) in 4 out of 4 mice. Was smaller than the tumor. The average tumor size from AG-H-NUC treated cells (MOI = 30) is , Smaller than average tumor size from ACN-treated cells (MOI = 30) over a 21-day period It remained (see Figure 3). These data are further disclosed herein. The tumor suppressor activity of the indicated H-NUC protein is shown. In vivo tumor suppressor H-NUC.   Human breast cancer cell line T-47D cells are injected subcutaneously into female BALB / c athymic nude mice. The tumor develops for 32 days. At this point, ACN (control) or AC-H-NUC (H -A single injection of either adenovirus vector (including the NUC gene) Inject into the surrounding peritumoral space. Tumors were then injected after adenovirus injection Excision on either day 2 or day 7 and isolation of poly A + RNA from each tumor I do. Tumors then treated using reverse transcription PCR with H-NUC specific primers Detect H-NUC RNA in. Amplification with actin primer is related to RT-PCR reaction. A plasmid containing recombinant (H-NUC) sequence Is used as a positive control for recombinant (H-NUC) specific bands.   In another experiment, T-47D cells were injected into the subcutaneous space of the right flank of mice and The tumor is allowed to grow for 2 weeks. Mice are dosed twice weekly for a total of 8 doses of buffer or Receive injection of recombinant virus around tumor. Tumor growth requires ACN and buffer Treated with control animals given and animals given AC-H-NUC Monitored throughout the period. Body weight and survival time are also monitored. Expression of exogenous H-NUC in breast cancer cell line T-47D cells.   Breast cancer cell line T-47D that does not contain endogenous H-NUC due to homozygous mutation of the gene Native breast cancer cells provide a clean background for functional studies of H-NUC. Offer. Use T-47D cells with either AC-H-NUC vector or control ACN vector Infect with the same titer of somebody. Most colonies were grown individually in bulk culture You.   Infected cells³⁵Of the protein produced by using it metabolically labeled with S Cell lysates were prepared for quantitation. AC-AH-NUC infected cultures are measured Morphology, growth rate (eg, doubling time), saturation density, soft agar colonization, and And tumorigenicity in nude mice are compared with control cells.   Although the present invention has been described by reference to the presently preferred embodiments, various modifications are possible. It should be understood that it can be done without departing from the spirit of the invention. Obedience Thus, the present invention is limited only by the following claims.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁶ Identification code Internal reference number FI C07H 21/04 9356-4H C07K 14/47 C07K 14/47 9356-4H 16/18 16/18 9637-4B C12P 21/02 C C12N 5/10 9637-4B 21/08 C12P 21/02 7823-4B C12Q 1/68 A 21/08 0276-2J G01N 33/574 A C12Q 1/68 9284-4C A61K 39/395 D G01N 33/574 9284-4CN // A61K 39/395 9282-4B C12N 5/00 C 9051-4C A61K 37/02 (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FR, GB , GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN, TD, TG), AP (KE, MW, SD, SZ), AM, AU, BB, BG, BR, BY, CA, CN, CZ, FI, GE, HU, JP, KE, KG, KP, KR, KZ, LK, LT, LV, MD, MG, MN, MW, NO, NZ, PL, RO, RU, SD, SI, SK, TJ, T T, UA, UZ, VN (72) Inventor Chen, Fan-Lan United States Texas 78245, San Antonio , Omicron Drive Number 201 14825

Claims (1)

[Claims] 1. An isolated and purified DN A sequence encoding an Rb binding protein comprising a partial sequence having at least 60% homology with the C-terminal 9 tetratricopeptide repeats, said sequence comprising: S. pombe Yeast protein nuc2, Aspergillus nidulans bimA protein, or S. A DNA sequence that does not encode any of the cerevisiae yeast CDC27 proteins. 2. An isolated and purified DNA sequence encoding an Rb binding protein according to claim 1, wherein said DNA sequence has 60% homology with amino acids 465 to 770 of SEQ ID NO: 1. 3. An isolated and purified DNA sequence according to claim 1, which encodes amino acids 465 to 770 of SEQ ID NO: 1. 4. The isolated and purified DNA sequence of claim 1, encoding an H-NUC that substantially matches the sequence set forth in SEQ ID NO: 1. 5. A recombinant vector comprising the isolated and purified DNA sequence of claim 1, 2, 3, or 4. 6. The recombinant vector according to claim 5, wherein the vector is a cosmid, a plasmid, or is derived from a virus. 7. An expression vector comprising a DNA molecule according to claim 1, 2, 3 or 4, which is capable of inserting said DNA molecule into a mammalian host cell and expressing a protein therein. 8. The expression vector according to claim 7, wherein the expression vector is selected from the group consisting of plasmids and viral vectors. 9. The expression vector according to claim 8, wherein the viral vector is selected from the group consisting of a retrovirus vector and an adenovirus vector. 10. The expression vector according to claim 9, wherein the expression vector is AC-H-NUC. 11. Production of a biologically active polypeptide or protein of H-NUC protein, or a biologically active derivative thereof, comprising the vector according to claim 7, 8, 9 or 10 in a suitable host cell. Host-vector system for. 12. 12. The host-vector system of claim 11, wherein the host cell is a prokaryotic cell. 13. The host-vector system according to claim 11, wherein the host cell is a eukaryotic cell. 14． A pharmaceutical composition comprising the vector of claim 7 and a pharmaceutically acceptable carrier. 15. A pharmaceutical composition comprising the vector of claim 8 and a pharmaceutically acceptable carrier. 16. A pharmaceutical composition comprising an AC-H-NUC vector and a pharmaceutically acceptable carrier. 17． A DNA probe comprising at least about 27 nucleotides complementary to the DNA sequence of claim 1. 18. The DNA probe according to claim 17, wherein the nucleotide is complementary to the DNA sequence of SEQ ID NO: 1. 19. Comprising an amino acid sequence having at least six tetratricopeptide repeats at the C-terminus, an isolated and purified mammalian protein that binds to the Rb protein, the protein, S. A protein that is not pombe yeast nuc2 protein, Aspergillus nidu lans bimA protein, or S. cerevisiae yeast CDC27 protein. 20. 20. The isolated and purified mammalian protein of claim 19, comprising an amino acid sequence having 9 tetratricopeptide repeats at the C-terminus. 21. 21. The isolated and purified mammalian protein of claim 20, which is H-NUC having the amino acid sequence of SEQ ID NO: 2. 22. A method for producing the protein of claim 19, comprising the steps of: a. Inserting a compatible expression vector containing a gene encoding the protein of claim 19 into a host cell; b. Expressing the protein in the host cell. 23. 23. The method of claim 22, wherein the host cell is selected from the group consisting of prokaryotic host cells and eukaryotic cells. 24. 24. The method of claim 23, wherein the host cell is a eukaryotic host cell which is a mammalian host cell and the expression vector is compatible with the mammalian host cell. 25. A method for suppressing a neoplastic phenotype of a cancer cell having no endogenous H-NUC protein, which comprises the step of administering to the cancer cell an effective amount of the DNA according to claim 1, 2, 3, or 4. 26. The method according to claim 25, wherein the step of administering the H-NUC gene is performed by using a recombinant vector. 27. A method for suppressing a neoplastic phenotype of a cancer cell having no endogenous H-NUC protein, which comprises the step of administering the protein according to claim 19 to a cancer cell. 28. An antibody that binds to the Rb binding protein comprising a subsequence having at least six tetratricopeptide repeats at the C-terminus, the protein, S. An antibody that is not pombe yeast protein nuc2, Aspergillus niger bimA protein, or S. cerevisiae yeast CDC27 protein. 29. 29. The antibody of claim 28, which binds to an H-NUC protein having the amino acid sequence of SEQ ID NO: 2. 30. A hybridoma that produces a monoclonal antibody that binds to the H-NUC protein having the amino acid sequence of SEQ ID NO: 2. 31. A method for detecting the absence of H-NUC protein in tumor cells, comprising the steps of: a. Preparing a tissue section from the tumor; b. Contacting the antibody of claim 26 or 27 with the tissue section; and c. Detecting the presence or absence of the antibody that binds to the tissue section.