SK76896A3 - A novel tumor suppressor gene - Google Patents

Abstract

This invention is an isolated and purified DNA sequence encoding an Rb binding protein comprising a subsequence having at least 60% homology with nine tetratricopeptide repeats at the C-terminal end, with the proviso that the sequence encodes for neither <u>S. pombe</u> yeast protein nuc2, <u>Aspergillus nidulans</u> protein bimA, nor <u>S. cerevisiae</u> yeast protein CDC27, vectors containing said DNA, DNA probes based on said DNA, and methods of therapy utilizing said DNA and vectors. This invention is also directed to proteins encoded by said DNA, methods of therapy utilizing said proteins, and methods of expressing said proteins. Finally, this invention is directed to antibodies to said proteins, hybridomas producing said monoclonal antibodies, and diagnostic methods utilizing said antibodies.

Description

Technical field

The present invention relates to tumor suppressor genes (anti-oncogenes) and, in general, to methods and products for practical broad-spectrum use in tumor suppressor therapy of human cancer. In particular, the invention relates to methods of treating cancer cells comprising 1) administering vectors comprising a nucleotide sequence encoding a novel protein designated herein as H-NUC; or 2) administering an effective amount of a protein encoded by said nucleotide sequence.

Cancer is the second leading cause of death in the US, with 450,000 people succumbing to it each year. One in three Americans develops cancer and one in five dies (Scientific American Medicine, 12,1,1, 1987). While considerable progress has been made in identifying the external and genetic causes of cancer, statistics on cancer mortality indicate an urgent need to improve therapies related to cancer and related diseases and disorders.

A series of so-called cancer genes, i. genes that contribute to cancer have been identified in the study of hereditary forms of cancer and tumor cells. The study of cancer cells provides an understanding of the mechanism of tumorigenesis. While much information about cancer genes remains unknown, the currently known cancer genes serve as a useful model for understanding tumorigenesis.

Cancer genes are generally divided into "oncogenes" which, upon activation, induce tumorogenesis, and "tumor suppressor genes", which fail to suppress tumorogenesis if damaged. It is also possible that certain genes may play different roles depending on their allelic forms, regulatory elements, genetic background, and location of expression.

One of the commonly known working hypotheses about cancer development is as follows: 1) Most types of human cancer are genetic diseases and 2) result from expression and / or inability to express. specific genes (i.e., mutant versions of normal growth regulatory genes or viral or other foreign genes in mammalian cells that cause abnormal, incorrect timed, or ectopic expression of other classes of growth regulatory genes

Ί

A simplified view of the biological basis for neoplasm formation is that there are two basic classes of oncogenes. The first class contains mutant or otherwise aberrant alleles of normal growth regulatory genes involved in cell growth or replication control. These genes are cellular proto-oncogenes. When mutated, they can encode new cellular functions that disrupt normal cell growth and replication. These changes result in the production of a dominant tumor phenotype. In this model, which has prevailed since it was thought that neoplasms are due to genetic and mutational changes, it is suggested that the existence of a single wild-type allele is not sufficient to prevent tumor changes in the developmental program or cell growth characteristics. The genetic events responsible for the activation of these oncogenes can therefore be regarded as single-intervention '. Evidence for the involvement of such transforming oncogenes in clinical cases of human cancer are examples of activation of mycogenic oncogenic tumor activities in Burkitt's lymphoma, expression of the bcr-abl chimeric gene product in patients with chronic myelogenous leukemia, activation of H-ras and K-ras oncogenes. Genetically based treatment of these types of cancers would require specific destruction or inactivation of the expression of the respective responsible genes.

BACKGROUND OF THE INVENTION

The recently discovered group of genes of the cancer gene family are the so-called tumor suppressor genes, sometimes referred to as anti-oncogenes, growth suppressors or cancer gene suppressors. Recent studies suggest that mutations that result in loss of function of genes of this class are also likely to be involved in a high percentage of human cancer. By way of example, tumorsuppressor genes that are involved in the pathogenesis of retinoblastoma (rb), breast, colon (p53), Wilms' tumor (wt), and colon carcinoma (dcc) have been identified and cloned. Some aspects of their effect in tumorigenesis have already been elucidated.

The gene responsible for the formation of retinoblastoma (RB) is a prototype tumor suppressor.

A mutation of this gene has been found in a variety of human tumor types (Bookstein and Lee,

Crit. Rev. Oncog., 2: 211-227 (1991); Goodrich and Lee, Biochim. Biophys. Acta., 1155: 433 (1993); Riley et al., Annu. Rev. Cell Biol., 10: 1-29 (1994)). Re-introduction of a single copy of the normal Rb gene into murine tumor cells suppresses their ability to develop into tumors (Huang et al., Science, 242: 1563-1566 (1988); Sumegi et al., Cell Growth Differ., 1: 247-250, (1990); Bookstein et al., Science, 247: 712-715 (1990); Chen et al., Cell Growth Differ., 3: 119-125 (1992); Goodrich et al., Can. Res., 52 Takahashi et al., Proc. Natl. Acad. Sci. USA, 88: 5257-5261 (1991)). Microinjection of non-phosphorylated Rb protein into cells in the early G1 phase of the cell cycle blocks their entry into the S phase, indicating its direct involvement in cell growth regulatory processes (Goodrich et al., Cell, 67: 293-302 (1991). These results are supported. Overproduction of the Rb protein from the human RB gene results in growth retardation at the organism level (Bignon et al., Genes Dev, 7: 16541662 (1993)).

In mouse embryos that do not have functional RB gene expression due to homozygous inactivation of the RB gene, their prenatal development is stopped and the embryos die (Lee et al., Nature, 359: 288-294, (1992); Jacks et al., Nature, 359 : 328-300, (1992); Čiarke et al., Nature, 359: 328-330 (1992)). These experiments provide important data to elucidate the importance of the Rb protein in cell growth and differentiation in vivo.

The RB gene encodes a core protein that is phosphorylated on the serine and threonine residues depending on the cell cycle progression (Lee et al., Nature, 329: 642-645 (1987); Buchkovich et al., Cell, 58: 1097-105 ( Chen et al., Cell, 58: 1193-1198 (1989); DeCaprio et al., Cell, 58: 1085-1095 (1989)). During the G1 phase of the cell cycle, when the protein is in an active state, as indicated by microinjection experiments, the Rb protein exists in a hyperphosphorylated state (Goodrich et al., Cell, 67: 293-302 (1991); Goodrich and Lee, Nature, 360: 177-179 (1992)). The hyperphosphorylated Rb protein also occurs in the GO phase. It appears to play a critical role in keeping cells at rest, in which the cell decides whether to enter a new cell cycle or whether differentiation occurs (Goodrich and Lee, Biochim. Biophys. Acta., 1155: 43-61 (1993) Pardee, AB, Science, 246: 603-608 (1989)).

During the late G1, S, and M phases, the Rb protein is hyperphosphorylated probably by some of the CDK kinases (Lees et al., EMBO J., 10: 4279-4290 (1991); Lin et al., EMBO J., 10: 857-864 ( Hu, et al., Mol Cell Biol., 12: 971-980 (1992)). Phosphorylation of certain amino acid residues appears to allow the cell to transition to proliferation. The method of phosphorylating an Rb protein is related to its function in inhibiting growth, and it has recently been hypothesized that phosphorylation negatively regulates the growth-suppressing function of this protein (hollingsworth et al., Curr. Opin. Genet. Dev., 3: 55-62 (1993); Sherr, CJ, Trend Cell Biol., 4: 15-18 (1994)). Dephosphorylation of the Rb protein occurs during the M phase and results in its reactivation before initiating a new cell cycle. Protein phosphatase type 1 is confirmed to be critical for this dephosphorylation (Alberts et al., Proc. Natl. Acad. Sci. USA, 90: 388-392 (1993); Durfee et al., Genes Dev., 7: 555-569 (1993)).

The molecular mechanism by which the Rb protein is involved in cellular activities is not yet fully understood. The present concept suggests that the Rb protein interacts with many different proteins and can express its function in these complexes. If the function of the Rb protein is to keep the cell in the G0 / G1 phase, it must inactivate other proteins that are active and necessary for entry into the G1 phase and its progression (Lee et al., CSHSOB, LVI: 211-217 (1991)). This hypothesis is consistent with recent observations suggesting that the important growth-promoting transcription factor E2F-1 is closely negatively regulated by the Rb protein (Helin et al., Cell, 70: 337-350 (1992); Kaelin et al., Cell, 70: 351-364 (1992); Shan et al., Mol Cell Biol., 13: 6501-6508 (1993); Shan et al., Mol Cell Biol., 14: 229-309 (1994) ). The recently discovered H-NUC protein binds to the Rb protein and thus also participates in the regulation of mitosis.

The BRCA-1 gene, causing breast cancer, was localized to chromosome 17 q21-22 by mapping by binding analysis. It is unclear whether this gene acts as a tumor suppressor or as a dominant oncogene. However, the p53 gene involved in the development of LiFraumeni syndrome functions as a classical tumor suppressor gene, and likewise, the loss of the RB gene is associated with hereditary retinoblastoma.

Among these extreme examples of transforming oncogenes and recessive tumor suppressor genes lie a number of additional mechanisms involved in the development of neoplasms. For many years, it has been assumed that most types of human cancer are likely to be the result of multiple, interacting genetic defects, none of which is sufficient for tumor development. The intrinsic role of growth-regulating cellular proto-oncogenes and tumor-suppressive genes represents a complex set of their interactions.

SUMMARY OF THE INVENTION

The present invention is based on the discovery of a nucleic acid molecule encoding an H-NUC protein having tumor suppressor capability. The gene has been localized to region q21-22 of chromosome 17. The properties of H-NUC (amino acid sequence derived from total cDNA; ability to bind to DNA and activate transcription; change of position or loss of coding sequence in some breast cancer cell lines) are consistent with H -NUC as a core protein and as a tumor suppressor protein. The newly described total cDNA encodes a protein of 824 amino acids in length. The protein contains ten repeats, 34 amino acids in length, characteristic of the TPR (tetratrico peptide) protein family.

Diagnostic methods using nucleic acid and H-NUC protein are known. The present invention relates to the administration of a wild-type H-NUC tumor suppressor gene or protein that is capable of suppressing, destroying or reversing a neoplastic phenotype in cancer cells that do not themselves produce the H-NUC protein. The present invention demonstrates for the first time the administration of the wild-type H-NUC gene to cancer cells lacking the wild-type H-NUC protein, for suppressing or reversing the neoplastic phenotype or for altering their properties. This suppression of the neoplastic phenotype alternately suppressed or destroyed the abnormal mass of these tumor cells, i. qimory, thus reducing the number of tumors (tumor burden) of the test organisms and increasing their survival rate. The neoplastic properties that are monitored and which can be reversed are morphology, growth and as the most essential ability to develop into a tumor. Thus, a reduction in tumor burden is a consequence of suppression of the neoplastic phenotype following administration of the wild-type H-NUC gene. Neoplastic phenotypes are understood to be phenotypic changes in cellular characteristics, such as e.g. morphology, growth rate (i.e., doubling time), saturation density, colony formation on agar media, and the ability to form tumors.

The invention provides vectors encoding the H-NUC protein and H-NUC proteins. which can be used in the treatment of cancer and methods for the preparation of H-NUC proleins and vectors suitable for such use

The invention further provides methods of treating not only human but also generally mammals, methods of treating abnormally proliferating cells and suppressing the neoplastic phenotype. In general, the invention contemplates treating abnormally proliferating cells and diseases characterized by their presence by any suitable method that allows the entry of the H-NUC coding vector into host compatible cells or the H-NUC protein into these cells to be treated to be suppressed proliferation.

In a first aspect, the invention provides a method of treating a mammal disease characterized by an abnormally proliferating cell by administering an expression vector encoding the H-NUC protein, introducing the vector into the abnormally proliferating cell and producing the H-NUC protein in an amount effective to suppress proliferation of these cells. The expression vector is introduced into cells by viral infection or transduction, liposome transfection, polybrene transfection, CaPO4 transfection and electroporation. Treatment is repeated as necessary.

In another aspect, the invention provides a method of treating mammalian abnormally proliferating cells by introducing an H-NUC encoding expression vector into these cells and producing it there in an amount effective to suppress proliferation of the cells. Treatment is repeated as long as it is needed.

The invention provides a DNA molecule capable of suppressing the growth of abnormally proliferating cells. The DNA molecule encodes an Rb binding protein that contains a sequence with at least 66% homology with nine repeats in the C-terminal region of the protein molecule, provided that the DNA does not encode Schisosaccharomyces pombe NUC or Aspergillus nidulans bim A and CDC27. An example of such an Rb binding protein is an H-NUC protein having an amino acid sequence substantially according to SEQ ID NO. The DNA molecule has the nucleotide sequence of SEQ ID NO. 1 and its expression is provided by an expression vector. The expression vector may be any vector compatible with the host cell. The vector is usually selected in a form derived from retroviral, adenoviral and herpesviral vectors.

In another aspect, the invention provides an H-NUC protein having amino acid sequences substantially according to SEQ ID NO. , and biologically active fragments thereof.

In another aspect, the invention provides a method of producing an H-NUC protein, comprising the steps of: introducing a compatible expression vector comprising an H-NUC coding sequence into a host cell and introducing conditions for the host cell to produce an H-NUC protein.

In another aspect, the invention provides a method of treating an abnormally proliferating mammalian cell ex vivo by the steps of: collecting a tissue sample comprising the abnormally proliferating cells, contacting the tissue sample with an effective dose of an H-NUC encoding expression vector, producing H-NUC protein in the abnormally proliferating cells in an amount capable of effectively suppressing their proliferation. Treatment is repeated as necessary and tissue samples are returned to the original or other organism. Preferably, the tissues used are blood or bone marrow.

In another aspect, the invention provides a method of treating a mammalian disease characterized by abnormal cell proliferation comprising the steps of: administering an H-NUC protein in an amount effective to suppress abnormal proliferation. Preferably, an H-NUC protein encapsulated in liposome particles is used. Treatment is repeated as necessary.

In another aspect, the invention provides an oligonucleotide fragment capable of hybridizing to the H-NUC gene and methods for its use. These oligonucleotides may contain at least 5 nucleotides, but oligonucleotides of 20 to 30 nucleotides in length are preferred. These oligonucleotides may be labeled with radioisotopes (tritium, ³² phosphorus, ³⁵ sulfur), enzymes (e.g., alkaline phosphatase, horseradish peroxidase), fluorescent labels (e.g., fluorescein, Ethidium, terbium chelate), or chemiluminescent labels (e.g., acridine esters, isoluminol). . These and other labels described in the "Non-Isotope DNA Probe Techniques", LJ Krick, Ed., Academic Press, New York, 1992, can be used to rapidly prepare oligonucleotides and for conventional methods such as southem and nothem blotting. Descriptions of these methods are e.g. in "Nucleid Acid Hybridization - A Practical Approach," BDHames and SJ Higgins, Eds., IRL Press, Washington, DC, 1985. Preferably, these probes can be used to hybridize to the H-NUC gene under stringent conditions. These oligonucleotides can be used as primers for PCR techniques (described, for example, in "PCR Technology", HA Ehrlich, Ed., Stockton Press, New York, 1989).

Image descriptions

Figures 1A and 1B show that similar regions of RB are required for H-NUC and T-antigen binding. Figure 1A is a scheme of the Gal4-RB fusion that is used to determine binding domains. The Ga14 DNA-binding domain (amino acids 1 to 147) is fused to various mutant forms of RB. The T / E1A binding domains are shown shaded. Domains affected by mutations are shown dotted. Figure 1B shows the detection of interactions between H-NUC and RB mutants in vivo. Y153 was co-transformed with Gal4-Rb mutants and either with the Gal4- (H-NUC) expression clone (Gal4- (C-49)) or with YIpPTG10. The chlorophenyl-red-bD-galactopyranoside colorimetric assay (CPRG) was performed to quantify the pgalctosidase activity for each transformation (Durfee et al., Genes Devel., 7: 555-569 (1993)).

Figures 2A and 2B show that H-NUC binds to non-phosphorylated RB. Figure 2A shows GST and GST fused to the cDNA encoding H-NUC (GST-419) and the N-terminal region of 273 amino acids of the SV40 T-antigen that were expressed in E.coli. GST and GST fusion proteins bound to glutathione-sepharose beads and washed extensively. Samples were quantified using Commassie Blue on SDS-polyacrylamide gels. An equal amount of protein was loaded on each lane. Figure 2B shows extracts obtained from WR2E3 cells that were mixed with the samples for 30 minutes at room temperature. After extensive washing, the complexes were resolved on SDS polyacrylamide gels and immunoblotted. The amount of Rb protein present and the degree of phosphorylation thereof was determined by immunoprecipitation with anti-Rb monoclonal antibody 11D7 (lane 1). The blot was tested with the same antibody and visualized by fluorography.

Figure 3 is the nucleotide (SEQ. I.D. NO .: I) and predicted amino acid sequence (SEQ. I.D. NO .: 2) of the total cDNA of the H-NUC gene and H-NUC protein.

Figures 4A and 4B show that H-NUC encodes a product that is a member of the tetratricopeptide repeat (TPR) family of proteins. Figure 4A shows the location of ten 34-amino acid repeats in H-NUC, Schisosaccharomyces nuc2 +, and Aspergillus nidulans bimA proteins. The repeat unit 3 of these polypeptides (shown in dotted lines) does not have a conservative motif. Figure 4B shows the alignment of the amino acid sequences of 9 TRP repeat units (1-9) in the HNUC, nuc2 +, and -bimA proteins. The conserved regions are in rectangles. The TRP unit 6 of all three proteins contains glycine at position 6. Gly6 appears to be essential in the repeat 6 of the nuc2 protein.

Figures 5A and 5B show binding of C-terminal TRP repeats of H-NUC to Rb protein. Figure 5A is a schematic representation of the Gal4-H-NUC fusion used to determine binding domains. The Gal4 transactivation domain is fused to various deletion mutant forms of H-NUC. TRP repeat units of H-NUC are shown shaded. Figure 5B shows the detection of interactions between Rb and H-NUC deletion mutants in vivo. Y153 was cotransformed with the indicated Gal4-H-NUC mutants and either with Gal4-RB2 or Gal4H209. Each transformation was quantitated by CPRG (detection of β-galactosidase activity).

Figures 6A and 6B show a mutation in essential Gly created in a temperature sensitive H-NUC mutant that diminishes its ability to bind to Rb at a non-permissive temperature. Figure 6A shows in detail the amino acid substitution in H-NUC (64OD). Essential glycine (G) (amino acid 540) of the nuc2 protein was substituted with aspartic acid (D) in a temperature sensitive mutant. Glycine at position 640 of the H-NUC protein was substituted with aspartic acid (D). Figure 6B shows the interactions between Rb and HNUC (640D) mutant form at 37 ° C. Y153 was cotransformed with Gal4-Rb2 and either GA14H-NUC or Gal4-H-NUC (640D). Transformants were grown in liquid culture at 28 ° C for 24 hours. The culture was then diluted in fresh medium and incubated at 37 ° C. Aliquots of yeast culture were taken at various times to determine growth rate and γgalactosidase activity. This activity was determined by CRPG.

Figures 7A and 7B depict the preparation of anti-H-NUC antisera and detection of H-NUC in human cell lines. In Figure 7A, Gst-491 fusion proteins are used to immunize mice. Pre-immune serum (lane 1), immune serum (lane 2), immune serum preincubated with Gst protein (lane 3), and immune serum preincubated with Gst-491 (lane 4) were used for precipitation. From the cells, K-562 cell lysate were prepared designated S ^35th An equal amount of cell lysate was used for immunoprecipitation. The resulting immunoprecipitates were separated by SDS-polyacrylamide electrophoresis. In Figure 7B, S ³⁵ labeled lysates are prepared from CV-1 cells. The same amount of cell lysate was immunoprecipitated with preimmune serum (lane 1) or immune serum (lanes 2 and 3). The resulting immunoprecipitates were denatured by boiling in 200 ml of a solution containing 2% SDS (lane 3) and diluted in 200 ml of NETN buffer. The immunoprecipitates were separated by SDS polyacrylamide electrophoresis. The protein with a molecular weight of 90 kDa (indicated by an arrow) was specifically recognized by the immune serum.

Figure 8 shows that the H-NUC protein has DNA-binding activity. The ^35- methionine-labeled protein lysate from K562 cells was loaded onto a column of bound double-stranded DNA from calf thymus on cellulose and eluted with increasing NaCl concentration. After elution, samples were immunoprecipitated with either (A) mAb 11D7 to detect Rb protein, or (B) immune serum recognizing H-NUC. Aliquots from the eluted samples were also used for incubation with glutathione-sepharose (C).

Figure 9 shows the location of the gene encoding H-NUC on the q21-22 region of chromosome 17.

Figures 10A and 10B are the results of a Southern blot analysis of DNA from breast tumor cells with H-NUC as a probe. DNA was extracted from cell lines and digested with EcoRI. The cell line blots tested in Figure 10A are all normal. In Figure 10B, a homozygous deletion of the H-NUC gene in T47D and MB157 cell lines was evident. The heterozygous mutation that appeared to occur in the MB231, BTO0578-7 and BT549 cell lines was characterized by reduced hybridization to the 14 kbp EcoRI fragment.

Figure 11 shows the inhibitory effect of AC-H-NUC on cell growth in T-47D breast tumor cells in vitro. The upper left figure shows MDA-MB-231 cells infected with ACN (MOI 10) for 3 days and stained with crystal violet. The upper right figure shows ACN-infected T-47D cells (MOI 10). The lower left figure shows MDA-MB-231 cells infected with AC-H-NUC (MOI 10). The lower right figure shows T47D cells infected with AC-H-NUC. (+/-) indicates that MDA-MB-231 cells are heterozygous for H-NUC. (- / -) indicates that T-47D cells are characterized by a homozygous deletion of H-NUC (ref. Lee, W.H.). AC-H-NUC is a recombinant human adenovirus containing the H-NUC tumor suppressor gene under the control of the human CVM promoter. ACN is the same recombinant human adenoviral vector without the H-NUC of the tumor suppressor gene

Figure 12 shows that AC-H-NUC suppresses the growth of T-47D tumor cells in vitro. T-47D (deleted for H-NUC) and MDA-MB-231 (herozygous for H-NUC) breast cancer cells were plated and treated with AC-H-NUC or ACN at an infectious multiplicity of 10 and 100. The cells were grown 5 The thymidine incorporated into the nucleic acids was used to measure the degree of proliferation. Data for AC-H-NUC is shown as a percentage of the average proliferation of the ACN control.

Figure 13 shows that AC-H-NUC suppresses T-47D tumor growth in mouse cells. T-47D human breast cancer cells were treated ex-vi with ACN or AC-H-NUC at infectious multiplicity of 30. Approximately 10 ⁷ cells were injected subcutaneously into the flank of mice, each injected with ACN treated and AC-H-NUC treated cells (each type to one side). Tumor size was measured and tumor volumes were calculated using spherical geometry estimates. Mean tumor volumes for ACN and AC-H-NUC cells are plotted. Mean tumor volumes from untreated cells are given for comparison.

DETAILED DESCRIPTION OF THE INVENTION

The present invention describes a novel mammalian protein designated H-NUC. H-NUC consists of 824 amino acids (Fig. 3) and has a molecular weight of about 95 kD and interacts with non-phosphorylated retinoblastoma protein (RB). H-NUC derivatives (e.g., truncated versions of a protein containing the last 6 TPR regions (tetratricopeptides, 34 amino acid repeats) in the C-terminal region, in other words, a version of 559 instead of 770) bind the wild type Rb protein. A mutation in a protein that results in the inability to bind to a retinoblastoma protein contributes to the hyperproliferative activity that is characteristic of Rb negative cells, e.g. breast cancer cells.

The H-NUC protein is a human protein and can thus be isolated and purified from human tissues. A purified protein or nucleic acid is a protein or nucleic acid not containing other proteins or other molecules normally associated with or occurring with the H-NUC protein or with the DNA encoding H-NUC in the natural state. The term "native" refers to a form of DNA, protein, polypeptide, antibody, or fragment that is isolated in its natural state or that contains no deliberate change in the amino acid composition, e.g. substitution, deletion or addition. Purification of the 95 kD H-NUC protein from SDS gels can be accomplished by a variety of methods, e.g. wherein the H-NUC-containing cell extract is precipitated with an anti-H-NUC antibody (described in detail below) and the protein-antibody complex is eluted from the gels according to Fischer et al., Techniques in Protein Chemistry after separation from the other components by SDS gel electrophoresis. ed. T.E. Hugli, Acedemic Press, Inc., 36-41 (1989).

The term hyperproliferating cells refers to, but is not limited to, cells that are characterized by the ability to grow autonomously, i. existence and reproduction independent of normal regulatory mechanisms. Hyperproliferative diseases can be divided into pathological, i. developing from normal cells, characterized by pathological symptoms, and non-pathological, i. which do not show signs of disease. Pathological hyperproliferating cells are characteristic of the following diseases: thyroid hyperplasia (Graves disease), psoriasis, benign prostatic hypertrophy, Li-Fraumeni syndrome, breast cancer, sarcomas and other neoplasms, bladder cancer, intestine, lung various leukemias and lymphomas. Examples of non-pathological hyperproliferating cells include cells that are found in the mammary glands during lactation, as well as cells involved in wound healing. Pathological hyperproliferating cells usually show a loss of contact inhibition and lose the ability to selectively adherence, suggesting changes in the cell surface properties and other intercellular communication damage. These changes further include stimulation of division and the ability to secrete proteolytic enzymes. Restoring or complementing the function of H-NUC by introducing a protein or nucleic acid encoding this protein into the cells can return the cells to a non-proliferating state, and the malignant proliferation can thus be stopped.

The term "protein" refers to a linear polymer of amino acids linked together by a peptide bond. The term "amino acid" refers to either the D or L stereoisomeric form of the amino acid (unless otherwise specifically designated). H-NUC derivatives refer to substances derived from the linear sequence of the original protein or polypeptide, but which additionally have an amino acid change in their sequence (substitution, deletion, insertion) such that the H-NUC derivative retains flooding biological activity. Biological activity means the ability to bind to the non-phosphorylated retinoblastoma protein p110-H-NUC binding ability is lost at 37 ° C if e.g. highly conserved glycine (amino acid 640) is replaced by aspartic acid. These H-NUC derivatives can be distinguished from the original sequence by deletions, insertions, or substitutions of one or more amino acids for related amino acids, e.g. similarly charged amino acids, or by substitution or modification of side chains or functional groups.

It is known that only limited modifications can be introduced into the primary sequence

H-NUC without destroying its biological function and that only a small fraction of the complete primary structure is required to perform biological activities (e.g., p110 ^RH binding). The pilo- ¹ encoding nucleic acid sequence is published in Lee, W., H., et al., Science 235: 1394-1399 (1989). Another biological activity of H-NUC is its ability to bind to DNA. DNA-binding capacity can be determined by the methods of Lee, W., H., et al., Nature (London) 329 642-645 (1987). One of the biologically active derivatives of H-NUC is a protein comprising the last 6 TPR regions on the C-terminal region and a Gal4-C49 fusion protein. The Gal4-C49 derivative has the sequence outlined in FIG. 3 from amino acid position 559 to the end of the sequence. The TPR containing derivative has the sequence shown in FIG. 3 from amino acid position 559 to 770. The fragment fragments of FIG. 3, which retain the original function of the protein, are also included in the definition of H-NUC derivatives. These H-NUC derivatives could be produced by nucleic acid cleavage by restriction enzymes and recombinant expression of the resulting fragments. Minor modification of the primary amino acid sequence results in a substantially equivalent or increased function compared to the sequence shown in FIG. These modifications may be intentional, such as e.g. targeted mutagenesis, or may be random due to mutations in a host organism that produces H-NUC. For all modifications included, H-NUC biological activity is retained.

Fragments or mutant forms of H-NUC which inhibit the normal function of a protein in a negative way and thereby disrupt its biological role and cause host cell division and / or proliferation are termed inhibitory active. These proteins or fragments can be produced by well known chemical methods by the action of various substances. Mutant proteins and fragments are used therapeutically to induce hyperproliferation and to generate diagnostic agents such as e.g. antibodies.

These agents are used to promote or suppress cell growth or proliferation by contacting them in vitro and in vivo according to the method below. The invention also provides a method of inhibiting cell growth or proliferation, e.g. breast cancer cells, a method of treating a pathological condition characterized by hypeproliferative cell growth (breast cancer) by administering said compounds at an effective concentration capable of inhibiting proliferation of a suitable object. Suitable objects for this method are vertebrates in general, including primates and human patients.

The invention provides pharmaceutical compositions comprising any of the ingredients described above and one or more suitable pharmaceutical carriers. Pharmaceutically acceptable carriers are, for example, physiological buffered saline solutions or certain solvents or vehicles such as glycerol, glycol, vegetable oil (e.g. olive oil) and injectable organic esters. A pharmaceutically acceptable carrier is used to administer HNUC or derivatives thereof to cells in vitro or an object in vivo.

The pharmaceutically acceptable carrier comprises a physiologically acceptable component which functions, e.g. in maintaining the stability of a protein or polypeptide, or increasing or decreasing the absorption of a substance. They may be used e.g. carbohydrates (e.g. glucose, dextrans), antioxidants (e.g. ascorbic acid, glutathione), chelating agents, low molecular weight proteins or others. stabilizers. Further included are other physiologically acceptable ingredients (humectants, emulsifying and dispersing agents, preservatives which are particularly useful for inhibiting the growth and action of microorganisms). As protective agents, e.g. phenol and ascorbic acid. The choice of a pharmaceutically acceptable carrier and other ingredients will depend upon the prescribed route of administration of the polypeptide and its specific physicochemical properties. E.g. aluminum monosterate or gelatin prolongs the absorption time of the pharmaceutical composition into the object. Additional examples of carriers, stabilizing and adjuvant agents are given in Martin, Remingtons. Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton, 1975). The pharmaceutical composition can, if desired, be incorporated into liposome vesicles, microspheres, or other polymer matrices (Gregoriadis, Liposome Technology, Vol. 1 (CRC Press, Boca Raton, Florida 1984). Liposomes, which consist of phospholipids or other types. lipids are non-toxic, physiologically acceptable and metabolizable carriers, relatively easy to prepare and to administer.

Purified H-NUC (protein) or H-NUC (nucleic acid) as a pharmaceutical composition may be used to inhibit the growth of cancer cells by contacting these cells with purified H-NUC or an active fragment or composition comprising these polypeptides or proteins.

This contact could be ensured in vitro, ex vivo or in vivo. When cells are inhibited in vitro, contact is ensured by mixing the composition comprising the nucleic acid or protein of the invention with cell culture and adding the composition to the medium. Methods for determining the effective amount of the composition are known.

The method is also suitable for treating or preventing pathological conditions characterized by abnormally proliferating cells in an object in vivo. In this case, an effective amount of an agent for inhibiting proliferation is administered directly to the subject (in the present invention vertebrates in general, e.g., mammals, human patients). This method is particularly useful for treating or preventing breast cancer in patients with non-functional H-NUC protein production.

Administration can be oral, intravenous, intramuscular or intraperitoneal. It may proceed continuously or at regular or irregular intervals and may vary according to the type of object as well as the type of recombinant proteins (Landmann et al., J. Interferon Res., 12 (2): 103-11 (1992); Aulitzky et al. ., Eur.

j. Cancer, 2 (6): 462-467 (1991); Lantz et al., Cytokine 2 (6): 402-406 (1990); Supersaxo et al., Pharm. Res., 5 (8): 472-476 (1988); Demetri et al., J. Clin. Oncol. 7 (10): 1545- 1553 (1989); LeMaistre et al., Lancet 337: 1124-1125 (1991)).

The invention provides isolated nucleic acids that encode an amino acid sequence corresponding to a purified mammalian H-NUC protein, H-NUC derivatives, H-NUC mutant forms, active fragments, and an anti-H-NUC antibody. The term "nucleic acids" as used herein means a single- or double-stranded DNA, cDNA or mRNA molecule. The nucleic acid sequence encoding the H-NUC protein or fragments thereof is shown in FIG. 3. Nucleic acid molecules that hybridize under stringent conditions to the DNA molecule shown in FIG. 3. Hybridizing molecules or probes were prepared e.g. by shifting the stealth discontinuity in the nucleic acid molecule, and the hybridizing molecules thus formed were random fragmentary of the parent molecule shown in FIG. 3. Methodology for the preparation of these fragments is provided by Sambrook et al., Miolecular Cloning: A Laboratory Manual of Cold Spring Harbor Press, Cold Sprig Harbor, N.Y. (1989). Fragments of at least 10 nucleotides in length can be used as hybridization probes. Isolated nucleic acid fragments can also be used to generate new peptides. These peptides can be used as immunogens to generate polyclonal and monoclonal antibodies.

The nucleic acid is also useful for inhibiting cell division and proliferation. The nucleic acid is introduced into the cells, and the cells are grown under conditions that allow the production of the H-NUC protein at an effective concentration to inhibit cell growth. The nucleic acid can be delivered by liposome vesicles, in a lipidized state, or by other gene carriers such as viral vectors (Sambrook et al.). Preferably, the method is applicable to breast cancer cells having mutant H-NUC protein production

In recent years, the treatment of human diseases by gene transfer has been transferred from theory to practice. As the first case in human therapy, the case of the transfer of the adenosine deaminase (ADA) gene to the lymphocytes of a patient suffering from lethal damage to the gene, which resulted in severe immunodeficiency, is described (September 1990). The results were very encouraging and encouraged further clinical trials (Culver, K.W., Anderson, W.F., Blaese, R.M., Hum. Gene. Ther., 1991 2: 107).

. So far, most gene transfers in human patients have been based on a retrovims transformation system. Retroviral * vectors are retroviruses from which all viral genes have been removed or altered so that they cannot be produced in infected cells. The replication ability of the virus is assured by the "packaging" cells that produce all the viral proteins without forming infectious viral particles. The introduction of retroviral vectors into "packaging" cells results in the production of virions that carry the vector in the form of RNA and can infect target cells, but at the same time there is no further spread of the virus after infection. To distinguish between the natural infection process, where replicas occur and the virus spreads further, the term transduction is preferred to infection.

A system capable of providing DNA delivery to a cell is a replication incomplete retroviral vector. The term "retroviral" includes, but is not limited to, a vector or other delivery system capable of providing selective selection of target cells and introduction of nucleic acids into these dividing cells. The term "replication incomplete" is defined as the inability to produce the viral proteins necessary to propagate the vector in infected host cells.

An example of a replication incomplete retroviral vector is LNL6 (Miller, A., D., Et al., BioTechniques 7: 980-990 (1989)). Methods for using replication incomplete retroviral vectors are disclosed in Correll, P., H. PNAS USA 86: 8912 (1989), Bordignon, C., et al., PNAS USA 86: 8912-52 (1989), Culver, K. et al., PNAS USA 88: 3155 (1991), Rill, D. , R. et al., Blood 79: 2694-700 (1991). Clinical trials have shown that there were no or only minor adverse effects associated with the use of viral vectors (Anderson, Science 256: 808-13 (1992)).

The main advantages of retroviral vectors for gene therapy are the high efficiency of gene transfer into replicating cells, the precise integration of the transferred genes into cell DNA, and the inability of the virus to spread further after gene transduction (Miller, A., D., Nature, 1992, 357: 455-460 ).

The potential production of helper-replication competent helper during the production of retroviral vectors remains under consideration, although for practical purposes this problem has been solved. To date, all FDA-approved retroviral vectors have been generated using PA317 amphotrophic "packaging" cells (Miller, A.D., Buttimore, C, Molec. Cell Biol. 1986 6: 2895-2902). The use of vectors having little or no overlapping region with the PA317 viral sequence in cells eliminates helper virus production (Lynch, C.M., Miller, A.D., J. Viral., 1991, 65: 3887-3890). Other cell packaging lines may be used, e.g. cell lines derived to separate different retroviral coding regions into different plasmids should reduce helper virus production by recombination. Vectors generated by these cell lines also provide an efficient system for human gene therapy (Miller, A.D., 1992 Nature, 357: 455-460).

Non-retroviral vectors are also used in gene therapy. One alternative is adenovirus (Rosenfeld, MA et al., Proc. Natl. Acad. Sci. USA, 89: 6482-6884). The main advantages of adenoviral vectors are their ability to transmit large stretches of DNA (36 kb gene), high titer (10 ⁿ / ml), the ability to infect tissues in situ (especially lung). To date, the most convincing example of using such a vector is to introduce the human cystic fibrosis (CFTR) -related transmembrane regulator (CFTR) gene intra-nasally into rat airways (Rosenfeld, MA, et al., Celi, 1991, 63: 143-155). Also, herpes viruses can be used for human gene therapy (Wolfe, JH, et al., Nature Genetics, 1-379384).

Another method of gene transfer is the transfer of plasmid DNA in liposome vesicles directly to human cells in situ (Nabel, E.G., et al., Science, 1990, 249, 12851288). Plasmid DNA should readily be certified for use in human therapy because, unlike retroviral vectors, it can be purified to homogeneity. In addition to liposome-mediated transmission, there are other methods of DNA transfer, e.g. DNA binding to cellular receptors, if previously plasmid complexes with suitable proteins have been formed which are suitable for use in human gene therapy (Wu, GY, et al., J. Biol. Chem., 1991, 266: 14338-14342, Curiel, DT, et al., Proc. Natl. Acad Sci. USA, 1991, 88: 8850-8854).

The H-NUC coding gene can be inserted into known expression vectors (plasmid or viral) using known methods. The plasmid expression vector can be introduced into tumor cells by transfection in the presence of calcium phosphate, using liposomes (e.g., LIPOFECTIN), transfection mediated by DEAE dextran, electroporation, and other methods suitable for DNA entry into the cell.

The viral expression vector may enter the target cell in a form capable of selfexpression by infection or transduction. Retroviral, adenoviral and herpes and avipox virus-derived vectors are used. When H-NUC is expressed in any abnormally proliferating cell, the cell cycle is stopped, the cells stasis and die, resulting in a reduction in the amount of abnormal tissue. A vector capable of introducing a gene construct into a target cell and capable of expressing H-NUC in an amount that suppresses cell proliferation can be administered by any effective means.

A physiologically acceptable solution containing an effective concentration of the active vector can be administered intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously, or by any other effective means. The vector may be directly injected into the target tumor tissue in an amount effective to treat the tumor cells of that tissue.

Alternatively, tumors occurring in the body cavities (eyes, gastrointestinal tract, genitourinal tract (e.g., bladder), pulmonary, and bronchial system) may be treated with a physiologically acceptable composition (saline or phosphate buffer, suspension or emulsion that is sterile) containing an effective concentration of the active vector by direct injection or catheterization into the affected organ. X-rays, sonography, or a fiberooptical visualization system can be used to control precise intervention.

A physiologically acceptable solution containing an effective concentration of the active vector can be administered continuously into the bloodstream. This method is useful in cases where tumors are not directly achievable or cannot be anatomically isolated.

Target tumor cells can be treated directly by introducing the H-NUC protein, e.g. in liposome vesicles suitable for delivery of drugs, proteins and plasmid vectors in vitro and in vivo (Mannini, RJ, et al., Biotechiques, 1988, 6: 682690) to target cells (Newton, AC, Huestis, WH, Biochimica et. Biophysica Acta,

1990, 1044: 269-274, Ceccoll, J., et al., Joumal of Investigative Dermatology, 1989, 93: 190-194). The H-NUC protein is encapsulated into liposome vesicles and introduced into high efficiency mammalian cells.

The encapsulated H-NUC protein may be administered intraocularly, parenterally, intranasally, intratracheally, subcutaneously, etc. in an amount effective to treat abnormally proliferating cells in the target tissue. Liposomes can be administered in any physiologically acceptable composition comprising an effective concentration of the encapsulated HNUC protein.

A variety of other types of vectors are suitable for introducing the nucleic acid encoding the H-NUC gene. The nucleic acid may be DNA, cDNA or RNA.

The isolated nucleic acid molecule described herein can be effectively inserted after a promoter directing RNA transcription. These molecules are suitable for the production of recombinant H-NUC protein or as vectors used in gene therapy.

The invention provides a vector comprising the inserted isolated nucleic acid molecule described above. Preferably cosmids, plasmid or viral vectors may be used. A variety of suitable vectors are described in Sambrook et al., Supra and Zhu et al., Science, 261: 209-211 (1993). Upon introduction into a suitable host cell (prokaryotic or eukaryotic), recombinant H-NUC protein is produced. Suitable host cells include mammalian, insect, yeast, and bacterial cells (Sambrook et al., Supra).

The present invention provides a method for producing recombinant H-NUC protein or derivatives thereof by growing host cells under suitable conditions for expression of a nucleic acid encoding H-NUC or fragments thereof. Suitable conditions can be determined using a variety of methods, see Sambrook et al., Supra.

The invention provides an antibody capable of complexing with the H-NUC protein or fragments thereof. The term "antibody" includes polyclonal and monoclonal antibodies herein. They are usually rat, mouse, rabbit or human antibody.

The term "antibody or polyclonal antibody" means a protein that is produced in response to immunization with an antigen or receptor. The term "monoclonal antibody" refers to an immunoglobulin derived from a single cell clone. All monoclonal antibodies derived from a single clone are chemically and structurally identical and specific for a single antigenic determinant.

Laboratory methods describing the preparation of monoclonal and polyclonal antibodies are exemplified by e.g. in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1989). Monoclonal antibodies can be biologically produced by introducing H-NUC or fragments thereof into an organism, e.g. rabbit or mouse. Antibody-producing cells in the body are isolated and fused with myeloma or hetcromyeloma cells to produce monoclonal antibody-producing hybridomas. The invention provides hybridomas producing the monoclonal antibody used herein.

The invention provides biologically active fragments of the polyclonal and monoclonal antibodies listed above. These "antibody fragments" retain some ability to selectively bind to an antigen or immunogen. These antibody fragments include:

1) Fab, a fragment that contains a monovalent antigen-binding fragment of the original antibody molecule obtained by enzyme digestion (using the papain enzyme) to form an intact light and part of one heavy chain of the antibody molecule,

2) Fab ', an antibody fragment obtained by treatment with pepsin and subsequent reduction to produce an intact light chain and part of the heavy chain; two Fab * fragments are obtained per antibody molecule,

3) (Fab'fe, a fragment obtained by treatment with pepsin without subsequent reduction, F (ab *) ₂ is a dimer of two Fab * linked by two disulfide bonds,

4) Fv, a fragment generated by genetic engineering techniques that comprises a light chain variable region and a heavy chain variable region expressed as two chains,

5) SCA, a molecule produced by genetic engineering techniques that comprises a light chain variable region and a heavy chain variable region linked by a suitable polypeptide linker to a single fused molecule.

Methods for generating fragments are disclosed, e.g. in Harlow and Lane, supra. Specific examples of a "biologically active antibody fragment" include the CDR regions of antibodies.

The invention provides anti-idiotypic peptides specifically reacting with antibodies or biologically active fragment thereof. The term "anti-idiotypic peptides" refers to purified antibodies from one species that are injected into an evolutionary distant species and are recognized here as foreign and elicit a strong humoral immune response (Harlow and Lane, supra).

Proteins or polypeptides that have been produced by the recombinant pathway are biochemical or chemically synthesized or chemically modified so as to retain their ability to bind H-NUC or fragments thereof. The ability to bind antigen or immunogen is determined by antigen binding assays (Harlow and Lane, supra).

The antibody or nucleic acid is coupled to a detectable agent that allows the H-NUc protein or fragments thereof to be detected in a sample using standard immunochemical techniques (e.g., immunohistochemistry), see Harlow and Lane, supra, Principles and Practice of Immunoassays, eds. CJ Price and D.J. Newman, Stockton Press, New York, (1991).

The antibody administered can bind to H-NUC and alter its function in the cell. The antibody is administered at an effective concentration such that H-NUC function is recoverable. The antibody can also be used therapeutically to inhibit cell growth by binding to H-NUC, thereby losing its ability to bind to retinoblastoma protein. The antibody binds to H-NUC and causes it to fold into an active configuration.

The antibodies and nucleic acid molecules disclosed herein can be used to detect and determine the presence or absence of an H-NUC protein, or alternatively, an altered H-NUC gene in a cell or sample taken from a patient. In this way it is possible to diagnose breast cancer or an increased sensitivity to its occurrence.

The aforementioned proteins, polypeptides, nucleic acids, and fragments can be used to prepare drugs useful in therapy.

The invention will now be described in greater detail by the following examples. These examples are illustrative only and are not to be construed as limiting the invention.

DETAILED DESCRIPTION OF THE INVENTION

Experimental methods and results

Using the yeast two-hybrid system, 25 clones were isolated that interacted with the C-terminal region of RB (p56-RB). One of these clones is the C49 clone (Durfee et al., Gene Devel., 7: 555-569 (1993)). The C-terminal region of the RB protein has two non-touching domains necessary for binding of oncoproteins from different tumor DNA viruses and a region involved in DNA binding activity. One of the RB-associated proteins has a primary structure and biochemical properties similar to the nuc2 S pombe protein and the bim A protein of the genus Aspergillus. Mutation of these two genes in lower eukaryotes causes cell cycle arrest in metaphase, suggesting the importance of the role of these proteins during mitosis. These proteins contain a repetitive amino acid motif (34 amino acids), referred to as the TRP motif. The function of these repeats is unknown, but is likely to form amphipathic alpha-helices that could direct protein interactions. The protein described herein is the first human TRP protein to be isolated and characterized.

Testing of cDNA libraries and sequence analysis

To isolate the total length of the H-NUC cDNA, the 1.5 kb BglII fragment of C-49, prepared by Durfee et al., Was labeled with the stealth discontinuity method and used to test the human fibroblast cDNA library by plaque hybridization. The cDNA inserts were subcloned into the EcoRI site of the pBSK + vector (Stragene, San Diego, Ca) to facilitate DNA sequencing. Self sequencing was performed using dideoxy-NTP and Sequenase 2.0 according to the manufacturer's specification (Biochemicals). DNASTAR software (DNASTAR, In c., Madison, WI) was used for sequence analysis and homology search.

Construction of GST fusion proteins, protein preparation and its binding in vitro

Due to the construction of GST-491, plasmid C-49 was digested with BglII and the resulting 1.3 kb fragment was subcloned into the BamHI site on plasmid pGEX-3X (Pharmacia, Piscataway, N.J.). GST-T was prepared by digestion with HindIII. the resulting ends were blunt-ended with the Klenow fragment and the 823 bp fragment was subcloned into pGEX-3X at the SmaI site. Expression of the GST fusion protein in E. coli (Smith and Johnson, Gene, 67: 31-40 (1988)) was induced with 0.1 mM IPTG. Cells were centrifuged and the pellet was resuspended in Lysis 250 buffer (250 mM NaCl, 5 mM EDTA, 50 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 8mm leupeptin, 8mm antipain). . After 4 mg of lysozyme was added and incubated for 30 min at 4 ° C, the cells were lysed by sonication. The coarse residues were removed by centrifugation and the supernatant was added to the glutathione-bound sepharose beads.

For in vitro binding activity assays, extracts prepared from 2 x 10 ⁶ 2E3 cells (Chen et al., 1992, infra) were incubated with sepharose beads containing 2-3 mg GST or GST alluvial protein in Lysis 150 buffer (50 mM Tris (pH) 7.4), 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM PMSF, 1 mg leupeptin per ml, 1 mg antipain per ml), for 30 minutes at room temperature. The complexes were washed extensively in Lysis 150 buffer and, after boiling in loading buffer, were separated by SDS-PAGE by electrophoresis. The gels were transferred to nitrocellulose membranes and incubated with anti-RB monoclonal antibody 11D7 after blotting. As a secondary, an alkaline phosphatase-linked antibody was used which, in the presence of 5-bromo-4-chloro-3-indolylphosphate (toluidine salt) and tetrazolium blue, visualized the bound RB protein (BCIP, NBT, Promega, Madison, WI).

Antibody formation and protein identification

Anti-H-NUC antibodies were prepared according to Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988). 100 mg of the GST-491 fusion protein was used to immunize mice. Collected serum was directly used for immunoprecipitation experiments. Approximately 10 ⁷ cells from each cell line were metabolically labeled with ( ³ S) -methionine and subsequently lysed in cold Lysis 150 buffer. The purified lysate was incubated with various antibodies at 4 ° C for 1 hour, then Sepharose-bound protein A was added and incubated for an additional 30 minutes at the same temperature. After washing with lysis buffer and boiling in SDS sample buffer, immunoprecipitates were separated by SDS electrophoresis. In the case of double immunoprecipitation, the resulting immunocomplexes were boiled in 200 ml dissociation buffer I (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% SDS, 5 mM DDT) to denature the proteins. The denatured proteins were dissolved in 200 ml dissociation buffer II (20 mM TrisCl, pH 7.4, 50 mM NaCl, 1% NP-40, 1% Na-deoxycholate) and immunoprecipitated with the antibody again.

Cell fractionation

The method for separating membrane, nuclear and cytoplasmic fractions is adapted according to Lee, H.W., Nature, (1987). All three fractions were tested for the presence of RB and H-NUC proteins by immunoprecipitation, and aliquots from each fraction were incubated with glutathione sepharose beads to verify its composition.

DNA binding assay of 1x10 ⁷ K526 cells (human chronic myelogenous leukemia (ATCC)) was labeled with ³⁵ S-methionine and lysed in Lysis 250 buffer. The lysates were clarified by centrifugation and dissolved in two volumes of loading buffer (10 mM KH ₂ PO ₄ , pH 6.2, 1 mM MgCl 2, 0.5% NP40, 1 mM DTT, 10% glycerol). The dissolved extracts were applied to a DNA-bound cellulose column (calf thymus DNA, Pharmacia, Piscataway, NJ). Incubate for 1 hour at 4 ° C with gentle shaking. The column was washed with 5 volumes of loading buffer and eluted with the same buffer containing a further increasing concentration of NaCl. Individual fractions were analyzed by immunoprecipitation with either anti-RB antibody or anti-H-NUC antibody according to the procedure described above. Aliquots from each fraction were incubated with glutathione beads to verify the presence of glutathione transferase.

Yeast H-NUC expression vector, deletion mutants

DNA fragments derived from H-NUC cDNA were subcloned into pSE1107 (Durfee et al., 1993). Stem 491 is the original stem isolated by a two-hybrid yeast system. H-NUC was constructed by inserting a 3.3 kb XhoI fragment into the modified pSE1107 to produce a fusion protein. The RV contains an N-terminal XhoI-EcoRV fragment. BR208, BR207, B5 and B6 are partial products after cleavage of Sau3A. The Gal4 fusion protein derived from these constructs comprises the amino acid sequences: 1-824 for H-NUC, 559-824 for 491, -1-663 for RV, 699-824 for BR2-8, 797-824 for BR2-7, 559- 769 for B5, 597-796 for B6. A temperature sensitive mutant was generated by inserting a Nsil fragment from HNUC with the primers attached. The primers are as follows:

Primer 1.

TGGTATGACCTAGGAATGATTTATTACAAGCAAGAAAAATTCAGCCTTGCAGAA

ATGC

Primer 2.

TTTCTGCAAGGCTGAATTTTTCTTGCTTGTAATAAATCATTCCTGGTCATACCAT GCA

All constructs were verified by DNA sequence analysis.

Yeast transformation and quantification of β-galactosidase activity

Yeast transformation was performed by the LiOAC method described above (Durfee et al., 1993, supra). After transformation, the cells were seeded in tryptophan and leucine-free synthetic medium dishes. This medium ensured selection for the presence of the plasmid. After 2-3 days growth at 30 ° C, individual colonies from each transformation were inoculated into a suitable selection medium and grown to an OD 600 of 1.0-1.2. Cells were further processed according to Guarente, L., Methods Enzymol., 101: 181-191 (1983). Quantification was performed with chlorophenyl-N-galactopyranoside (CPRG, Boehringer Mannheim) according to Duee, 1993, supra.

H-NUC binds to non-phosphorylated RB protein in SV40-like region of T-antigen binding domain

The engineered deletion mutations of the RB protein originally used to describe the Binding Domain were subcloned into plasmids containing the Gal4 DNA binding domain, pAS1 (Durfee, 1993, supra). Two of these DNA constructs, an expression plasmid containing the Gal4-activating domain-C-49 fusion protein and Y1 pPTIO (indicating plasmid containing beta-galactosidase), were used to co-transform the yeast strain Y153 (Durfee, 1993, supra). The expression level of RB fusion proteins was determined by Westem blot analysis according to Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989). The expression level did not differ more than 23 times. The resulting transformants were tested for beta-galactosidase activity according to the procedure above. As shown in FIG. 1, the binding of C-49 fusion protein to Gal-4-RB diminishes in many of the same RB protein mutations, including a point mutation that confers Cys 706 to Phe and that eliminates SV 40 T-antigen binding There is one exception, C49 no is capable of binding Ssp mutants that do not have the 160 amino acid C-terminal region of the RB protein, although T-antigen binding persists, albeit with less affinity. The M1 deletion (amino acids 612-632) that affects the linker region between the two binding domains is the only mutation whose product is capable of binding both H-NUC and T-antigen. Thus, it is clear that similar but not identical regions are required for T-antigen and C-49 binding.

Further, the ability of the C-49 fusion protein to bind to p110 ™ in vitro was tested. The amino acid sequence of p110 ™ is set forth in Lee, W.H., Science 235. 1394-1399 (1987). The 1.3 kb cDNA clone (Figure 3) was expressed as a glutathione-S-transferase (GST) fusion protein in E. coli (Smith and Johnson, Gene 67: 31-40 (1988). Glutathione beads containing the same amount GST-C-49 protein and two controls, GST alone and GST-T-antigen (Fig. 2) were incubated with total cell extract from human retinoblastoma cell lines (WERI RB27) in which the RB gene was reconstituted (Chen et al, Cell Growth Differ. 3: 119-125 (1992)) Under standard conditions, these WERI (RB +) cells expressed different isoforms of RB protein, representing different phosphorylated states (see Figure 2B, lane 2). by SDS-PAGE and West blotting according to Sambrook, supra. The blot was tested with anti-RB antibody 11D7 (Shan et al., Mol. Cell. Biol, 12: 5620-5631 (1992)). capable of binding only to the non-phosphorylated form of p110 ™ with an affinity similar to GST-T, which GST alone does not bind any RB protein (see FIG. IA, lanes 2-4). These results indicate that the H-NUC protein is only able to complex with non-phosphorylated, native, and complete RB protein.

Total cDNA and its sequences

To characterize the new protein thoroughly, a 1.3 kb cDNA clone was used as a probe to test the human fibroblast cDNA library. Of the 12 isolated clones, the longest 3.3 kb cDNA clone was completely sequenced. The open reading frame encodes a protein of 824 amino acids (Fig. 3). The protein has 35% homology to two known proteins, nuc2 S pombe and bimA Aspergillus nidulans. Proteins of both of these lower eukaryotes are involved in mitosis, and in temperature sensitive mutations in these genes, cells arrest in metaphase. Nuc2 and bimA contain ten 34 amino acid repeat sequences arranged such that one repeat is located in the N-terminal portion of the molecule and the remaining nine in the C-terminal portion (see Figure 4). A similar repetitive pattern was also found for the novel protein associated with the RB protein. If only nine repeat regions are compared, the sequence identity is 60% (FIG. 4B). However, the sequences between the first and second repeats of nuc2 and bimA have very low homology. This low homology is also characteristic of proteins from clone C-49. According to this sequence homology, the isolated clone is likely to be a human homolog of yeast nuc2 and bimA from Aspergillus nidulans. Therefore, this protein was designated as HNUC.

The C-terminal repeat sequences of the H-NUC protein bind to the RB protein

The H-NUC protein contains neither the known L-X-C-X-E motif by which the T-antigen and the E1A adenovirus bind to RB, nor the 18 amino acid sequence of EF2, which is also important for RB protein binding. These findings suggest that the H-NUC protein uses a different motif for RB protein binding. To facilitate locating and defining this binding motif, a series of deletion mutants were constructed, each containing a different region of H-NUC cDNA and expressing the Gal4-fusion protein (see Fig. 5). A yeast two-hybrid system was used to determine the region of the protein that contains the binding motif (Durfee, 1993, supra). The whole protein and the original clone (containing 6 repeat sequences) bind the RB protein equally well. However, the N-terminal region that contains the first repeat sequence does not have the ability to bind. Deletion mutants derived from different portions of the original clone also fail to bind the RB protein. These data suggest that H-NUC may bind to RB in a novel manner, perhaps by a larger region with a specific secondary structure.

Changing Gly 640 to Asp creates an H-NUC temperature sensitive mutant that has a lower RB binding ability at a non-permissive temperature

To confirm the physiological significance of H-NUC binding to the RB protein, a mutant H-NUC protein was constructed with a single point mutation that caused the Gly 640 to be switched to Asp. A similar change (Gly 504 for Asp) in nuc2 is responsible for the temperature-sensitive phenotype that stops the cell cycle progression in metaphase in S. pombe (Hirano, TY, Hiaoka and M. Yanagida, J. Cell Biol. 106: 1171-1183 ( 1988)). Gly is conserved in H-NUC, as well as in its yeast homology, so it would be possible to test whether a mutation which replaced Gly with Asp would cause defects in binding to the RB protein at a non-permissive temperature. According to FIG. The 6 H-NUC protein with the Gly 604 mutation at the non-permissive temperature (37 ° C) is unable to bind, but at the permissive temperature (22 ° C) this ability is restored. These data show the linkage between the temperature-sensitive phenotype of putative cell cycle progression in metaphase and the ability to bind RB protein.

Preparation of anti-H-NUC antibody and identification of H-NUC protein

To identify the H-NUC protein in protein gels and Western blots, an anti-H-NUC antibody was prepared. GST-C-49 was expressed in E. coli (Smith and Johnson, 1988, supra, Shan et al., 1992, supra), purified using glutathione beads, and used as an antigen that induced an antibody response in mice. The serum contained a polyclonal anti-H-NUC antibody. The erythroleukemic cell line (K562) was metabolically labeled with ^3S S-methionine and used to prepare cell lysates. These lysates were immunoprecipitated with a polyclonal antibody. As can be seen in FIG. 6A, a specific protein with a molecular weight of 95 kD (lane 2) was precipitated by the immune serum, with no similar reaction with the pre-immune serum. The 95 kD protein was also identified when a GST-fusion protein was used, but not in the case of GST alone. However, the parent antigen is capable of competing with endogenous cellular proteins and the 95 kD protein band becomes unidentifiable (lanes 3 and 4). The specificity of the antibody was further confirmed when the first immunoprecipitates were subjected to denaturation and subsequent re-immunoprecipitation. As can be seen in FIG. The 6B, 95 kD protein is the only detectable protein band and the background is clear. All immunological evidence suggests that the 95 kD protein is the product of the H-NUC gene.

The H-NUC protein has DNA binding activity

Approximately 1x10 ⁷ cells labeled with ^3S S-methionine were lysed in Lysis 250 buffer (250 mM NaCl, 5 mM methionine, 50 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 8mg / ml. ml leupeptin, 8 ml / ml antipain). The lysates were clarified by centrifugation and diluted with two volumes of loading buffer (10 mM KH 2 PO 4, pH 6.2, 1 mM MgCl ₂ , 0.5% NP40, 1 mM DTT, 10% glycerol). The diluted lysates were loaded onto a DNA-coupled cellulose column (veal thymus DNA, Pharmacia, Poscantawas, NJ) and incubated for 1 hour at 4 ° C with gentle shaking. The column was then washed with 5 volumes of loading buffer and eluted with the same solution with increasing NaCl concentration.

Fractionation of each eluted sample was analyzed by immunoprecipitation with antibody to retinoblastoma protein (11D7, Figure 7A), against H-NUC (Figure 7B) or glutathione (GST) beads (Figure 7C). Aliquots from each fraction were also incubated with GST beads to detect glutathione transferase. The RB protein has DNA binding activity and serves as a positive control. The H-NUC protein has similar DNA binding activity, whereas glutathione transferase alone did not show any similar activity. Sequence homology analysis suggests that the DNA binding region of the H-NUC protein lies outside the TRP region.

H-NUC lies on chromosome 17q21-22

In situ hybridization with a ³ H-labeled probe (3.3 kb H-NUC cDNA) on human chromosomes revealed specific labeling of the q21-22 region on chromosome 17 (Fig. 9). 320 positive signals were evaluated on 150 cells, of which 42 (13.1) were in the q21-22 region of chromosome 17. Since part of the probe used contained sequences homologous to its pseudogenes, multiple hybridizations to short arms of acrocentric cells were detected in each cell tested. chromosomes. These results were not analyzed. Similar results were obtained by hybridization of somatic cells, where H-NUC was also localized to chromosome 17. The location of H-NUC is interesting because the known breast cancer gene has been mapped to the same region.

Tumor-suppressor activity of H-NUC

Tumor suppressor activity of H-NUC was tested both in vitro in cell culture conditions and in animal models (mice). The following cell lines were used: MDA-MB-231, which contains one functional allele of H-NUC, and T-47D, which is a homozygous mutant in the H-NUC ectus.

The effect of H-NUC on the proliferation of the above cell lines was tested by expression of H-NUC using an adenoviral expression vector. ACN is a control adenoviral vector that does not contain a cDNA insert, AC-H-NUC is an adenoviral vector expressing H-NUC under the control of the human CMV promoter.

Adenoviral vector containing H-NUC

To construct an adenoviral expression vector, it was necessary to amplify a fragment (2520 bp) comprising total H-NUC cDNA by PCR from Quick Clone ds placental cDNA (Clontech). The primers used for amplification added a Iρη I restriction site at the 5 'end of the fragment and an Xho I restriction site at the 3' end. These restriction sites allowed direct cloning into the multiple cloning site of plasmid pBluescript II KS + (5 primer 5CGCGGTACCATGACGGTGCTGCAGGAA3 ', 3 primer 5' ATCGGCTCGAGCAGAAGTTAAAATTCATC3). PCR cycles were run as follows: 1 cycle of 94 ° C for 1 minute, 30 cycles of 94 ° C for 1 minute, 53 ° C for 11.5 minutes, 72 ° C for 2 minutes, 1 cycle of 72 ° C for 7 minutes. Clones were tested for the ability to produce KD protein in the TnT reticulocyte lysis system (Promega). The T3 promoter in the Bluescript vector allowed transcription and translation of the H-NUC coding sequence in rabbit reticulocytes. 1 mg of minilyzate DNA was added per reticulocyte reaction and incubated for 1 hour at 30 ° C. To the 10 ml reaction mixture, a loading buffer was added and the sample was applied to a 10% polyacrylamide gel (Novex) and separated at 165 V for 1.5 hours. The gel was dried, film was applied and exposed overnight. Four complete protein clones were sequenced. The H-NUC insert was excised from the vector by ηρη I and Hind Π and subcloned into the Kpn I-Bgl 11 site of the plasmid vector pAdCMV (Bgl II blunt ends). All 4 clones contained some mutations, so the correct wild-type sequence was generated by ligating fragments from the two clones.

To construct a recombinant adenovirus, the above plasmid was linearized with Nru I and cotransfected with a large fragment of Cla30 cleaved mutants dl309 (Jones and Shenk, Cell 17: 683-689 (1979) using the CaPO ₄ transfection system (Stratagene)). and recombinant forms were identified by both cleavage analysis and PCR using primers against the H-NUC cDNA sequence. The recombinant virus was further purified and titrated by standard methods (Graham and van der Erb, Virology, 52: 456-457 (1973), Graham and Prevec, manipulation of adenovirus vectors In: Methods in Molecular Biology Vol 7, GeneTransfer and Expression Protocols, Munay EJ, (ed.) The Humana Press, Inc., Clifton NJ, 7: 109-128 (1991)).

To determine whether the H-NUC vector above expresses a protein of the appropriate size, T-49 cells were infected with either control or recombinant adenovirus vectors at 24-hour intervals with increasing multiplicity of infection (MO1, plaque forming unit / cell number). Cells were washed once in PBS and lysed in lysis buffer (50 mM tris-HCl, pH 7.5, 250 mM NaCl, 0.1% NP40, 50 mM NaF, 5 mM EDTA, 10 mg / ml aprotinin, 10 ml (g leupeptin, 1 mM PMSF). Cell proteins were resolved by SDS-PAGE by electrophoresis and transferred to a nitrocellulose membrane.

Membranes were incubated with anti-H-NUC antibody and then with sheep anti-mouse IgG conjugated with horseradish peroxidase. Expression of H-NUC protein was visualized by chemiluminescence (ECL kit, Amersham) on Kodak XAR-5 film.

In vitro

MDA-MB-231 and T-47D breast tumor cells were seeded at approximately 1x10 ⁶ cells per 100 mm dish on Kaighn F12 / DME medium (Irvine Scientific) supplemented with 10% FBS and 0.2 IU insulin (Sigma) for T -47D cells. Plates were incubated for 24 hours at 37 ° C in 7% CO 2. The following day, cells were overlaid with 10 ml of growth medium and infected with either ACN control virus lysate (MOI 10) or ACH-H-NUC virus lysate (MOI 10) and incubated at 37 ° C. After three days the medium was removed and the cells were fixed with a 1: 5 acetic acid / methanol solution. Cells were stained with 20% methanol / 0.5% crystal violet for 30 minutes and then rinsed with water to remove excess dye.

Infection of T-47D cells with ACN-H-NUC resulted in inhibition of the growth of these cells caused by expression of the H-NUC protein. Direct observation of crystal violet stained T-47D cells infected with ACN-H-NUC showed a decreasing number of cells (about 50%) compared to control cells infected with ACN. Furthermore, there was a change in the morphology of T-47D cells. The cells became more condensed and lost their growth characteristics. No such changes occurred when the cells were infected with ACN. The heterozygous MDA-MB-231 cells showed no apparent effect on either ACN or ACN-H-NUC infection in vitro.

Thymidine incorporation was further used to estimate the effect of H-NUC on cell proliferation. Approximately 3x10 5 MDA-MB-231 and T-47D cells were plated per well of a 96-well plate (Costar) and incubated for 24 hours at 37 ° C in 7% CO 2? The ACN or ACN-H-NUC control board was prepared in DME: F12 / 15% FBS / 1% glutamine and cells were infected with a multiplicity of 10 and 100 infection (4 wells per MOI). Half the volume of the medium was changed 24 hours after infection and every 48 hours until the end of incubation. 18 hours before the end of incubation, ImC'H-thymidine (Amersham) was added to each well. 5 days after infection, cells were harvested on glass filters and ³ H-thymidine incorporated into nucleic acids was detected by liquid scintillation (TopCount, Packard Instruments). The degree of cell proliferation (cpm / well) was expressed as a percentage of the average proliferation of untreated control cells.

The results obtained indicate that the proliferation of MDA-MB-231 cells (heterozygous for H-NUC) was similar after infection with both ACN and ACN-H-NUC (Fig. 12). However, T-47D cells (H-NUC deletion) had a specific response to ACN-H-NUC infection, which increased with increasing MOI. These data show the anti-proliferative effect induced by adenoviral vector-mediated H-NUC gene transfer into mutant H-NUC cells.

Ex vivo gene therapy

To determine the effect of H-NUC expression on tumorigenicity, the above tumor cell lines were tested for their ability to form tumors in a model organism (mouse). Approximately 2x10 ⁷ T-47D cells were treated with sucrose buffer containing ACN or ACN-H-NUC at an MOI of 3 or 30. After about 12 hours of infection, 10 ⁷ cells were injected subcutaneously into the left and right flanks of BALB / c mice previously received subcutaneous pellets of 17b-estradiol. One flank was injected with ACN-treated cells, the other with ACN-H-NUC-treated cells; each organism therefore served as its own control. Animals receiving bilaterally untreated cells served as an additional control for tumor growth. Tumor dimensions (length, width, height) and weight were measured twice a week. Tumor volume was estimated by spherical geometry with a radius corresponding to one half the diameter of the measured tumor sizes.

and

The results of this experiment are shown in FIG. 13 and indicate a significant loss of tumor growth in cells expressing H-NUC. 21 days after cell inoculation, tumors were measured in all animals. Tumors from ACN-H-NUC-treated cells (MOI = 30) were smaller than ACN-H-NUC-treated cells (MOI = 30) in 4 out of 4. Mean tumor size for ACN-H-NUC (MOI = 3%) treated cells remained smaller compared to ACN (MOI = 30) treated cells over a 21-day period (see FIG.

3). These data further confirm the tumor suppressor activity of the H-NUC protein presented in the present invention.

In Vivo tumor suppression H-NUC

T-47D human breast cancer cells were injected subcutaneously into female BALB / c mice. Tumors developed for 32 days. Then, either the ACN adenoviral vector (as a control) or the ACN-H-NUC adenoviral vector (containing the H-NUC gene) was injected into the peritumoral space surrounding the tumor. Tumors were then harvested either on the second or seventh day after the adenovirus infection and poly-A + RNA was isolated from each tumor. Reverse transcriptase PCR (RT-PCR) using H-NUC specific primers served to detect H-NUC RNA in treated tumors. As an RT-PCR control, amplification with actin primers served, a plasmid containing the recombinant H-NUC sequence provided a positive control of the position of the recombinant H-NUC band.

In a separate experiment, T-47D cells are injected subcutaneously into the right flank of the mouse, and tumors are allowed to grow for two weeks. Mice receive peritumoral injections of buffer or recombinant virus twice a week for a total of 8 doses. Tumor growth is monitored in control organisms that only received ACN and buffer, and in organisms that received ACN-H-NUC. Further, their body weight and survival are monitored.

Expression of Exogenous H-NUC in T-47D Breast Cancer Cells

Cancer cells of the T-47D line, which contain no endogenous H-NUC due to homozygous mutation, provide clear control for the functional study of H-NUC. T-47D cells are infected with a comparable titer with either ACN-H-NUC or a control ACN vector. Most colonies are individually developed for tissue culture.

Infected cells are metabolically labeled with ^3S S-methionine and used to prepare lysates to assess the amount of protein produced. ACN-H-NUC infected cultures are compared to control cells for morphology, growth rate (ie, doubling time), saturation density, agar colony formation, and tumorigenicity.

Industrial usability

The invention provides diagnostic methods using a nucleic acid encoding an HNUC protein and an H-NUC protein. The present invention relates to the administration of a wild-type HNUC tumor suppressor gene or protein that is capable of suppressing, destroying or reversing the neoplastic phenotype in cancer cells that do not themselves produce the H-NUC protein. The invention provides vectors encoding an H-NUC protein and H-NUC proteins that can be used in the treatment of cancer and methods for preparing the H-NUC protein and vectors suitable for such use.

I

3f

sequence

1) general information

(i) applicant: Lcc, Wen - Hwa

Chen, Phang - Lang ii) Title of the invention: Novel tumor suppressor gene iii) Number of sequences: 35 iv) Mailing address:

A) Address: Campbell and Flores, B) Street: 4370 La Jolla Village Drivc, suite 700

Q City: San Diego, D) State: California

E) country: USA

F) routing number: 92122

(v) computer unit

A) medium: floppy didc

B) Computer: IBM PC

C) Operating System: PC * DOS / MS - DOS

D) software: PatcntlnRdcasc 1.0, version 1.25 vi) current application details

A) Application number: US 08 / 170,586

(B) Date of performance: 20.12.1992

Evaluation (vii) previous application data

A) Application number: US 08 / 170,586

B) Date of performance: 20.12.1992 • viii) Representative

Name: Campbell, Cathiyn

B) Registration number: 31,815 ix) Phone: (619) 535 - 9001 Fax: (619) 535 - 89

2) SEQ ID No: 2:

(i) sequence characteristics:

A) length: 3320 bp

B) type: nucleic acid

C) string: double chains

D) topology: linear ii) molecular type: cDNA iii) other characteristics:

(A) Name / code: CDS

B) location: 101 ...... 2572 iv) sequence: SEQIDNo: 1:

CGGAATTCGC GGCCGCGTTT AAATGAGCTG GGGCTGGCCG GGCCGGAGCC GCTACAGGGG

GGGCCTGAGG CACTGCAGAA AGTGGGCCTG AGCCTCGAGG ATG Met 1

ACC GTG CTG CAG

Thr Val lcu Gin

115

GAA CCC GTC CAG GCT GCT ATA TGG 163 Glu Pro val Gin Ala Ala: Trp Gin Ala Leu Asn His Tyr 10 15 20 CGA GAT GCG GTT TTC CTC ² GCA GAA CGC CTT TAT GCA GAA GTA CAC TCA 211 Arg Asp Ala Val Phe Leu. Ala Glu Arg Leu Tvr Ala Glu val His Ser 25 30 35 GAA GAA GCC TTG TTT TTA CTG GCA ACC TGT TAT TAC CGC TCA GGA AAG 259 Glu Glu Ala Leu Leu Ala Thr Cys Tyr Tyr Arg Gly Lys 40 45 50 GCA TAT AAA GCA TAT AGA CTC TTG AAA GGA CAC AGT TGT ACT ACA CCG 307 Ala Tyr Lys Ala Tyr Arg Leu Leu Lys Gly His Ser Cys Thr Thr Pro 55 60 65 CAA TGC AAA TAC CTG CTT GCA AAA TGT TGT GTT GAT CTC AGC AAG CTT 355 Gin Cys Lys Tyr Leu Leu Ala Lys Cys Cys Val Asp Leu Ser Lys Leu 70 75 80 85 GCA GAA GGG GAA CAA ATC TTA TCT GGT GGA GTG TTT AAT AAG CAG AAA 403 Ala Glu Gly Glu Gin White Leu Ser Gly Gly Val Phe Asn Lys Gin Lvs 90 95 100 '‘ AGC CAT ATAT GTT ACT GAG TTT GGT GAT TCA GCT TGC TTT ACT 451 Ser His Asp Asp Val Val Thr Glu Phe Gly Asd - Ser Ala Cys Phe Thr 105 110 115 CTT TCA TTG TTG GGA CAT GTA TAT TGC AAG ACA GAT CGG CTT GCC AAA 499 Leu Ser Gly His Val Tvr cys Lys Thr Asp Are Leu Ala Lys 120 125 130 GGA TCA GAA TGT TAC CAA AAG AGC CTT AGT TTA AAT CCT TTC CTC TGG 547 Gly ser Glu cys Tyr Gin Lys Ser Leu Ser Leu Asn Pro Phe Leu Trp 135 140 145 TCT CCC TTT GAA TCA TTA TGT GAA ATA GGT GAA AAG CCA GAT CCT GAC 595 Ser Pro Phe Glu cys Glu white Gly Glu Lys For Asd Pro Asd 150 155 160 165 CAA ACA TTT AAA TTC ACA TCT TTA CAG AAC TTT AGC AAC TGT CTG CCC 643 Gin Thr Phe Lys Phe Thr Ser Leu Gin Asn Phe Ser Asr. Cys Leu Pre 170 175 180 AAC TCT TGC ACA GTA CCT AAT CAT AGT TTA TCT CAC CACA C .-. '¾- € 91 Asr. Ser Cys Thr Thr Gin val Pro Asn His Ser Leu Ser His Are G. *. 185 190 195 CCT GAG ACA GTT CTT ACG GAA ACA CCC : CAG GAC . TTA AAC 73? Pro Glu Thr Val Leu Thr Glu Thr Pro and Gin Asd Thr Glu Leu Asr. 200 205 21C AGA TTG AAT TTA GAA TCT TCC AAT TCA AAG TAC 787 Arg Leu Asn Leu Glu ser Ser Asn Ser Lys Asr Ser Lej Asn Thr Am 215 / 220 225 TCC TCA . GTG TCT TAT ATT GAT TCA GCT ATT TCA GCT ACT GTC 83Ξ Ser Ser Val ser tyr white t Asp Ser Ala Val White Ser For asd Thr Val 230 235 240 of 4 * CCA CTG I GGA ACA GGA ACT TCC ATA TTA TCT AAA 883 Pro Leu . Gly Thr Gly Thr Ser: 1c Leu Ser Lys Gin val Gin Asn Lvs 250 255 260

CCA Pro AAA Lys ACT GGT Thr Gly 265 CGA? Rg AGT TTA TTA GGA GCA AGT CCA 931 Ser Leu Leu Gly 270 Gly for Ala Ala Leu 275 ser for TTA ACC CCA AGT TTT GGG ATT TTG CCA TTA GAA ACC CCA AGT CCT GGA 979 Leu Thr for Ser Phe Gly Ile Leu for Leu Glu Thr for Ser for Gly 280 285 290 GAT GGA TCC TAT TTA CAA AAC TAC ACT AAT ACA CCT CCT GTA ATT GAT 1027 Asp Gly Ser Tyr Leu gin same time Tyr Thr same time Thr for For wall Ile Asp

295 300 305

GTG CCA TCC ACC GGA GCC CCT GTT GCC AGA ATC GGC 1075 wall 310 for Ser Thr Gly Ala 315 for Ser Lys Lys ser 320 Val Ala Arg Gly 325 CAA ACT GGA ACA AAG TCT GTC TTC TCA CAG AGT GGA AAT AGC CGA GAG 1123 gin Thr Gly Thr Lys Ser wall Phe Ser gin Ser Gly same time Ser Arg Glu 330 335 340 GTA ACT CCA ATT CTT GCA CAA ACA CAA AGT TCT GGT CCA CAA ACA AGT 1171 wall Thr for Ile Leu Ala gin Thr gin Ser Ser Gly for gin Thr Ser 345 350 355 ACA ACA CCT CAG GTA TTG AGC ccc ACT ATT ACA TCT CCC CCA AAC GCA 1219 Thr Thr for gin wall Leu Ser for Thr Ile Thr Ser for for same time Ala 360 365 370 CTG CCT CGA AGA AGT TCA CGA CTC TTT ACT AGT GAC AGC TCC ACA ACC 1267 Leu for Arg Arg Ser Ser Arg Leu Phe Thr Ser ASD Ser Ser Thr Thr 375 380 385 AAG GAG AAT AGC AAA AAA TTA AAA ATG AAG TTT CCA CCT AAA ATC CCA 1315 Lys Glu same time Ser Lys Lys Leu Lys Met Lys Phe for for Lys Ile ? ro 390 395 400 405 AAC AGA AAA ACA AAA AGT AAA ACT AAT AAA GGA GGA ATA ACT CAA CCT 1363 same time Arg Lys Thr Lys Ser Lys Thr same time Lys Gly Gly Ile Thr gin ? ro 410 415 420 AAC ATA AAT GAT AGC CTG GAA ATT ACA AAA TTG GAC TCT TCC ATC ATT 1411 same time Ile same time Asp Ser Leu G1U Ile Thr Lys Leu Asp Ser Ser Ile ill 425 430 435 TCA CAA GGG AAA ATA TCC ACA ATC ACA CCT CAG ATT CAG GCC TTT AAT 1459 Ser GIU Gly Lys Ile Ser Thr Ile Thr for gin Ile gin Ala Phe same time 440 445 450 CTA CAA AAA GCA GCA GCA GAA GGT TTG ATG AGC CTT CTT CGT C-AA ATG 1507 Leu gin Lys Ala Ala Ala Glu Gly Leu Met Ser Leu Leu Arg Glu Het 455 460 465

GGG AAA GGT TAT TTA GCT TTG TGT TCA TAC AAC TGC AAA GAA GCT ATA 1555 Gly Lys Gly Tyr Leu Ala Leu Cys Ser Tyr same time Cys Lys Glu Ala ill 470 475 480 485 AAT ATT TTG AGC CAT CTA CCT TC7 CAC CAC TAC AAT ACT GGT TGG CTA 1603 same time xle Leu ser His Leu for Ser Hjls His Tyr same time Thr Glv Trp wall • 490 1 495 500 CTG TGC CAA ATT GGA AGG GCC TAT TTT GAA CTT TCA GAG TAC ATG CAA 1651 Leu Cys gin Ile Gly Arg Al a Tyr Phe Glu Leu Ser Glu Tyr Met gin 505 = 10 515 GCT GAA AGA ATA TTC TCA GAG GTT AGA AGG ATT GAG AAT TAT AGA GTT 1699 But Glu Arg Ile Phe Ser Glu wall ÄJľq Arg Ile Glu same time Tyr Arg wall 520 525i 530

GAA GGC ATG GAG ATC TAC TCT ACA ACA CTT TGG CAT CTT CAA AAA GAT Glu Gly Met Glu White Tyr Ser Thr Thr Leu Trp His Leu Gin Lys asd 1747 535 540 545 GTT GCT CTT TCA GT7 CTG TCA AAA GAC 1795 Val Ala Leu: Contacts Ser Val Leu Ser Lys As Le 550 555 560: δ5 TCG CCA GAG < GCC TGG TGT GCT GCA GGG AAC 1E42 ser Pro Glu. Ala Trp Cvs Ala Ala Gly Asn Cys Phe Ser Leu Gin Arg 570 575 580 GAA CAT GAT ATT GCA ATT AAA TTC ' TTC CAG AGA GCT 16 = 1 Glu His Asp Ala and Lys Phe Phe Gin Arg Ala and Gin Val Asp 585 590 595 CCA AAT TAC GCT TAT CTA TTA GGG CAT GAG 1929 For Asn Tyr Ala Tyr Ala Tyr Thr Phu Val Leu Leu Leu 600 605 610 ACT GAA GAA TTG GAC AAA GCA TTA GCT TGT TTT CGA GAT ATC ASA 19E - Thr Glu Glu Leu Asd Lys by Ala Leu Ala cys Phe Arg Asn Ala ile · c 615 620 625 GTC AAT CCT AGA CAT TAT AAT GCA TGG TAT GGT TTA GGA ATG ATT 7AT 202: Val Asn Pro Arg His Tyr Asn Ala Trp Tyr Gly Leu Gly Met I Tyr 630 635 640 £ 45 TAC AAG CAA AAA AAA TTC AGC CTT GCA GAA ATG CAT TTC 2CE1 Tyr Lys Gin Glu Lys Phe Ser Leu Ala Glu Het His Phe Glr. Lys Ala 650 655 660 CTT GAT ATC AAC CCT CAA AGT TCA GTT TTA CTT TGC CTC ATT GGA C-7A 2131 Leu Asp Ile Asn Pro Gin Ser Ser Val Leu Leu cys His White Gly Lice 665 670 675 GTT CAA CAT GCA CTG AAA AAA TCA GAG AAG GCT GAT ACC CTA AAC 217 = val Gin His Ala Leu Lys Lys ser Glu Lys Ala - Leu Asp Thr Leu Asn 680 68S 690 AAA GCC ATT GTC ATT GAT CCC AAG AAC CCT CTA TGC AAA 222t Lys Ala Ile Val ile Asp Pro Lys Asn Pro Leu cys lys phe his ar = 695 700 705 GCC TCA GTT TTA TTT GCA AAT GAA AAA TAT AAG TCT CAA GAA 227-1 Ala Ser Leu Phe Ala Asn Glu Lys Tyr Lvs Ser Ala Leu Gin c.r 710 715 720 T. ~ CTT GAA GAA TTG AAA CAA ATT GTT CCC AAA GAA TCC CTC GTT TAC 2321 Leu Glu Leu Lys Glr. Val Val Pro Lvs Clu Ser Leu Val Tyr à- 730 735 740 ATA GGA AAG GTT TAC TTA GGT CAA ACG CAC 2271 Leu White Gly Lys Val Lys Lys Lys Leu Gly Thin His Leu Ala r. * - r 745 750 755 ATG AAT TTC ATG GAT TTA GAT CCT AAA GGA GCC AAT 24 1: Met Asn Phe Ser Trp. Ala Met Asp Leu Asp For Lys Gly Ala Asn Ai :. 760 765 770 CAG ATT AAA  F . GAG GCA ATT GAT AAG CGT TAT CCT GAT GAT GAG GAG 246 ' Gin White Lys Glu Ala: Le Asp Lys hrc Tyr Leu Asd Asp Glu G1. 775 780 785 CCA ATA ACC : CAA GAA ATG GGA ACA GAT GAA TCC CAG GAG 25 i i For Thr Glu Glu Gin Ilc i Met Gly Thr Asp Glu 790 795 800 ecí

ZiGC Ser

AGC Ser

ATG Met

ACA GAT GCG

Asp Asp Thr 81 * 0

CAA CTT CAT GCA GCT Gin Leu His Ala Ala 815

GAA AGT Glu Ser S20

2563

GAT GAA TTT Asp Glu Phe TAACTTCTGG AAATCAGACT TTTACAACTG GATGTGTGAC 2612 TAGTGCTGAC GTGTTTCTTG TCCCTCTGTA TACTGAGTCT TTACTCTTGA GCTGGCGC-TG 2672 TCATCGTCCG TCACTTATAC CATGAGTGTG CCACTTTCAT TGGACCCTGA CTGTATACAG 2732 AATGAAAGGC AGTGCAATAT TTAGCTGCTA ACAAGACTGG CTCTTTTACC AGTATGAATG 2792 ACAATTTATG GGGGGTAGGG TGGGGAACTT TCTTTTCTGT TTTTCTTTAA TCTCCCTTTG 2852 TTGGAAAGTA TCATGAAGGA AGAGTTATGC TTTATCTTGA AGGAACCATT AGATATGGAA 2912 AATAGTGATG AACCAGAGTT TCTTGGTTGC TTTTTCAAAA ATTTGGTTCT 2972 GTTCCAGATA AACAGAGTÄA CTGACCTTCA TTTCTAGGTT CTTCAAGAAT GGTGTTTC-CA 3032 AGTGCCAGAT GGAACAATAA AAGACGTTGC CTATAACAGT GACTTGATTG CCAAGGAA7G 3092 TAAATTACCT TAAACTTCGA TGATCTCCCA TAAACAAATG TAATGGGCAT ATTGGGAC7C 3152 G7ATGTAGGA ATCAAATATC CCTCCATACA GTGTACTCTT ATTCTTGGCA AGAATGCT7T 3212 AÄTGTATAAC CAAGAATTTT AATTTATTCA TCTTGCTTCA AAGTGTTGAT CATTG77GTC 3272 TTGGTATTGC AAACTTTAÄA ATTGTTTCTT ACCAGCGGCC GCGAATTC 332C

2) SEQ ID No: 1:

(i) wooden characteristics:

A) length: 824 amino acids

B) type: amino acid chain

C) topology: linear ii) molecular type: protdn xi) sequence: SEQ ID No: 2:

Met 1 Thr val Leu Gin 5 Glu Pro Val Gin Ala 10 Ala Ile Trp Glr. Ala 15 Le_ same time H L s Tyr Ala Tyr Are Asp Λ. lá wall Phe Leu Ala Glu A: c Leu T r -.- L0 25 -C Ala Glu va. : -: is Ser Glu Glu £ A- Leu Phe Leu Leu Ala Thr cys Tyr >: w - 40 45 Tyr are ser. Gly Lys Ala Tyr Lys Ala Tyr are Leu Leu LVF Gly hr: 5o 55 F-0 ser Cys T h.- Thr Pro Gin Cys lyj Tyr Leu Lei. Ala Lys Cys : ys v _c . 65 _e 73 75 g Asp Leu Se: Lys Leu Ala Glu Gly Glu gin I le- Leu sej- Gly Gly Vi .. 85 90 95 P.ne same time Lyr Glr. Lys ser His Asp Asp Ile va 1 Thr Glu Phe Gly as; 100 105 110 Ler A.a Cy :. Phe Thr Leu Ser Lc-J Lc u Gly 1: 1 wall Tyr c y 3 L y « r ··. 11- 120 125

* fO

Asp Arg Leu Ala Lys Gly ser Glu Cys Tyr gin Lys Ser Leu Ser Leu 130 135 140 same time for Phe Leu Trp Ser for Phe Glu Ser Leu cys Glu: .e Gly Glu 145 150 155 160 Lys for Asp for Asp gin Thr Phe Lys Phe Thr ser Leu Glr. same time Phe 165 170 175 Ser same time Cys Leu for same time Ser Cys Thr Thr gin wall For A £ ?. !: 1S ser 180 185 . = 3 Leu Ser His Ara gin for Glu Thr wall Leu Thr Glu Thr? R = Gin Asp 195 200 205 Thr Ile Glu Leu same time Arg Leu same time Leu Glu ser Ser Asn Ser Lys Tyr 210 215 220 Ser Leu same time Thr Asp Ser ser wall ser Tyr xle Asp Ser Ala val Ile 225 230 235 240 Ser for Asp · wall for Leu Gly Thr Gly Thr ser Leu Ser Lys 245 250 255 gin wall gin same time Lys for Lys Thr Gly Arg Ser Leu Gly Gly For

26C 265 2'2

Ala Ala Leu Ser for Leu Thr Pro 280 ser Phe Gly ile Leu 285 Pro Leu Glu 275 Thr for Ser breast Gly Asp Gly Ser Tyr Leu gin same time Tyr T .-. R Asn Thr 290 295 300 for for wall Ile Asp wall for Ser Thr Gly Ala for Ser Lys Lys Ser 305 310 315 320 wall Ala Arg Ile Gly gin Thr Gly Thr Lys ser wall Phe ser Gin ser 325 330 335 Gly same time Ser are Glu wall Thr for Ile Leu Ala gin Thr Gin ser Ser 340 345 350 Gly for gin Thr Ser Thr Thr for GLR. wall Leu Ser for T r. r ile Thr 355 360 365 ser for for Asr. Ala Leu for Arg Arg Ser ser Arg Leu S · Λ Ser 370 375 380

Asp Ser Ser Thr Thr Lys Glu Αε.ί Ser Lys Lys Leu Lvj. · P p.-. 395 390 395 '40 i! ¹ O

for Pro Lys Ile for 405 same time Arg Lys Thr Lys 410 Ser Lys Thr f. s n LVS 415 Gly Gly Ile Thr GLR. for same time Ile same time Aso Ser Leu Glu Ile 7: .r Lys Leu 420 42 * 5 «A  W Asp ser Ser Ile Ile ser Glu Gly Lys Ile Ser Thr Ile 7 .-. R for GLR. 435 440 445 ill gin Ala Phe same time Leu gin Lys Ala Ala Ala Glu Gly L u -.- Met Ser 450 455 460 Leu Leu Arg Glu Het Gly Lys Gly Tyr Leu Ala Leu Cys L ... L Tyr Asr. 465 470 475 4 80

Cys Lys Glu Ala ile 485 same time Leu Ser His Leu Pro 490 ser his H1S 495 Tyr same time Thr Gly Trp wall Leu Cys gin Ile Gly Arg Ala Tyr Phe Glu Leu 500 505 510 Ser Glu Tyr Het gin Ala Glu Arg Ile Phe Ser Glu wall Arg Arg Ile 515 520 525 Glu same time Tyr Arg wall Glu Gly Het Glu Ile Tyr Ser Thr Thr Leu Trp 530 535 540 His Leu gin Lys ASD wall Ala Leu Ser wall Leu Ser Lys Asp Leu Thr 545 550 555 560 Asp Met Asp Lys same time Ser for Glu Ala Trp Cys Ala Ala Gly same time cys 565 570 575 Phe Ser Leu gin Arg Glu His Asp Ile Ala Ile Lys Phe Phe gin are 580 585 590 Ala Ile gin wall Asp for same time Tyr Ala Tyr Ala Tyr Thr Leu Leu Gly 595 600 605 His Glu Phe wall Leu Thr Glu Glu Leu Asp Lys Ala Leu Ala cys Phe 610 615 620 .. Arg same time Ala ill Arg wall same time for Arg His Tyr same time Ala Trp Tyr GLV 625 630 635 640

Leu Gly Met Ile Tyr Tyr Lys 645 Gin Glu Lvs 650 Phe ser Leu Ala Glu MGt 655 His Phe gin Lys Ala Leu Asp Ile Asn Pro gin Ser Ser wall Leu Leu 660 665 670 cys His Ile Gly wall wall gin His Ala Leu Lys Lys Ser Glu Lys Ala 675 680 685 Leu Asp Thr Leu same time Lys Ala Ile val íle ASD for Lys same time for Leu 690 695 700 Cvs Lys Phe His Arg Ala Ser wall Leu Phe Ala same time Glu Lys Tyr Lys • 705 710 715 720 ser Ala Leu gin Glu Leu Glu Glu Lej Lys gin Ile wall for Lys Glu 725 730 35 s ·. · r Leu wall Tyr Phe Leu Ile Gly Lvs val you: Lys Lys Leu duties GLR. 740 745 750 Thr His Leu Ala Leu Het same time Phe Ser Trp Ala Met Asp Leu ASD For 755 760 765 Lys Gly Ala same time same time gin Ile LVS Glu Ala Ile ASD Lys Arg Tyr Leu 770 775 78 * 0 for Asp Asp GIU Glu for Ile Thr Gir. Glu Glu G1 n Ile Met duties T! '.: 785 790 79L EOO Asp Glu Ser gin Glu Ser Ser Met Thr Asp Ala Asp Asp C-r. Leu

B05 g 10 2L5 µ-Ala Ala Glu Ser Asp Glu Phe

820

W /

/

(2) SEQ ID No: 3:

(i) sequence characteristics:

A) length: 212 amino acids

B) type: amino acid chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 3:

Leu Thr Asp Het 1 ASD 5 ‘ Lys Asn Ser Pro Glu 10 Ala Trp Cys Ala Ala clv 15 same time cys Phe ser Leu gin Arg Glu His Asp Ile Ala Ile Lys Phe Phe 20 25 30 gin Arg Ala Ile gin wall Asp for same time Tyr But Tyr Ala Tyr Thr Leu 35 40 45 Leu Gly His Glu Phe wall Leu Thr Glu Glu Leu Asp Lys Ala Leu Ala 50 55 60 Cys Phe Arg same time Ala Ile Arg wall same time for Arg His Tyr Asia Ala Trp 65 70 75 80 Tyr Gly Leu Gly Het Ile Tyr Tyr Lys gin Glu Lys Phe ser Leu ALC 85 90 95 Glu Het His Phe gin Lys Ala Leu ASD Ile same time Ρ2ΓΟ gin ser Ser wall 100 105 110 Leu Leu Cys His Ile Gly wall wall gin His Ala Leu Lys Lys Ser Glu 115 120 125 Lys Ala Leu Asp Thr Leu same time Lys Ala Ile wall Ile Asp for Lys same time 130 135 140 for Leu Cys Lys Phe His Arg Ala Ser wall Leu Phe Ala same time Glu Lys 145 150 155 160 Tyr Lys Ser Ala Leu gin Glu Leu Glu Glu Leu Lys gin Ile wall For 165 170 17 5 Lys Glu Ser Leu wall Tyr Phe Leu Ile Gly Lys wall Tyr Lys Lys Leu 80 185 190 Gly Gin Thr His Leu Ala Leu Het same time Phe Ser Trp Ala Het Asp Lei. 195 200 205 Asp i Pro Lys 210 Gly 2) SEQ ID No: 5: (i) sequence characteristics: A) length: 34 amino acids B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 4:

Leu Leu Lys Leu 2

Leu Arg Glu Ala

Asn Thr

Phy Gly Lys Gly

Leu Asn Cys Phe val

Gin Ser Leu Pro

Ala Gin Tyr Lys White Glu Gin Gin

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: S:

Leu Leu

Cys Lys

Arg Glu

Glu Ala

Met Gly White Asn

Lys Gly Le leu

Tyr Leu ser His

Ala Leu

Leu Pro Cys Ser

Ser Hjls

Tyr Asn cis Tyr

Asn Thr

2) SEQ ID NO: 6:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 6:

Leu Phe Phe Lys Ile Ala ser Gly Tyr Phe Cys Leu so r are Tyr Lys 1 5 10 15 Cys Ser Asp Ala Ile gin Ile Phe Ser ser Leu Ser gin G1V gin Ara 20 25 30 '

Glu Thr

(2) SEQ ID No: 7:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ Π) No: 7:

wall 1 Lys Asp Het Glu 5 wall Phe Ser Thr Ala 10 Leu Trp His Leu gin 15 Lys ser wall for Leu 20 ser Tyr Leu Ala Hl S 25 Glu Thr Leu Glu Thr 30 same time for

Tyr ser

(2) SEQ ID No: 8:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sdcvenda: SEQIDNo: 8:

wall Glu Gly Het Glu Ile Ile ser Thr Thr Leu Trp H1S Leu GLR. LVS 1 5 10 15 Asp wall Ala Leu Ser wall Leu ser LVS Asp Leu Thr Asp Het Asp Lys 20 25 3 C- same time Ser

2) SEQ ID NO: 9:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sdcvenda: SEQIDNo: 9:

Leu Glu Asp Met Glu Ile Tyr ser Thr wall 1'-er Trp His M I.VS ΑΕΓ. 1 5 10 15 Asp wall Glu Leu Ala Tyr Leu Ala His Glu Leu Met Asp wall Asp Are 20 25 33 Leu Ser

2) SEQ ID NO: 10:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

Q strings: single string

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 10:

<ι5

Glu 1 Tyr Tyr Thr 5 Leu gin Gly His Glu 10 His Ser Ala same time Glu 15 Glu Tyr Glu Lys ser 20 Lys Thr Ser Phe Arg 25 Lys Ala Ile are val: c same time wall

Arg Ujs

(2) SEQ ID No: 11:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain Q chain: single chain

D) topology: linear thi) molecular type: peptide xi) sequence: SEQ ID No: 11:

Ala Tyr Ala Tyr Thr Leu Leu Gly His Glu Phe val Leu Thr Glu Glu 1 5 10 15 Leu Asp Lys Ala Leu Ala Cvs Phe Arg Asn Ala Are Are Val Asn for 20 25 3ϋ

Arg His

(2) SEQ ID No: 12:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear thi) molecular type: peptide xi) sequence: SEQ ID No: 12:

Ala

Tyr Gly

Phe

Thr Leu Glr. 5

Gly His

Glu Tyr

Val Ala A. s.-. Glu Glu

Tyr

Asp Lys

Ala

Leu Asp Ala

Tvr Arg

Ser Gly White As and Asp Ser r

Arg His

2) SEQ ID No: 12:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 13:

ser val Leu clay Thr Cvs clay Gly Het clay Tyr Glu Arg cys Lys Asp

5 10 15

Tyr Lvs Lys Ala Le Aso Phe Tvr Aso Arg Ala cvs Lys Leu Asp Glu 25 '25' 30

Lys Ser

(2) SEQ ID No: 14:

i) sequential charalrtMictiIry ·

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain DjtopoMgia: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 14:

Ser Val Leu Leu Cys His White Gly val Val Cys His Ala Leu Lys Lys 15 10 15

Ser Glu Lys Ala Leu Asp Thr Leu Asn Lys Ala White Val White Asp Pro 20 25 30

Lys Asn

(2) SEQ ID No: 15:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) string: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 15:

Ala wall Leu Ile cys Cys Ile Gly Leu wall Leu Glu Lys Met same time same time 1 5 10 15 for Lys ser Ala Leu Ile gin Tyr same time Arg Ala Cys Thr Leu Ala For 20 25 30

His ser tt

(2) SEQ ID No: 16:

(i) sequence characteristics:

A) length; 66 amino acids

B) type: amindkyddín chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 16:

Ala same time wall His Phe Leu Leu Gly Lys Ile Phe Lys gin mec Arg Lys 1 5 10 15 Lys same time Leu Ala Leu Lys His Phe Thr Ile Ala Trp same time Leu Asp Gly 20 25 30 Lys Xaa Ala Thr His Ile Ile Lys Glu Ser Ile Glu same time Leu Asp Ile 35 40 45 for Glu Glu same time Leu Leu Thr Glu Thr Gly Glu Ile Tyr are same time Leu 50 55 60

Glu Thr

2) SEQ Π> No: 17:

(i) sequence characteristics:

A) length: 88 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ JD No: 17:

Ser Leu wall Tyr Phe Leu Ile giv Lys wall Tyr Lys Lys Leu Gly gin and 5 10 15 Thr His Leu Ala Leu Met same time Phe Ser Trp Ala Met Asp Leu Asp for 20 25 2 C Lys Gly Ala same time same time G Ír. Ile Lys Phe Ala Ile Asp L} - are Tyr Leu 35 40 '.5 for Asp Asp cl u Glu for Ile Thr gin Glu Glu gin líc- Met Gly Thr 50 » 55 60 Asp Glu Ser gin Glu Ser ser Met Thr Asp Ala Asp AST Thr gin Leu 65 '0 75 80

His Ala Ala Glu Ser Glu Phe

(2) SEQ ID No: 18:

(i) sequence characteristics:

A) length: 56 amino acids

B) type: amino acid chain ^:

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 18:

Ala same time wall His Tyr Leu Leu Gly Lys Leu Tyr Lys Met Leu Arg Asp 1 5 10 15 Lys Gly same time Ala ill Lys His Phe Thr Thr Ala Leu same time Leu Asp for 20 25 30 Lys Ala Ala gin Tyr Ile Lys same time Ala Met Glu Ala Leu Asp Asp Asp 35 * 40 45 Glu Glu Asp Glu Glu Asp Met Ala 50 55

(2) SEQ ID No: 19:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

(C) chains: single-phase

D) topology: linear ii) moid type: peptide xi) sequence: SEQ ID No: 19:

Pro Phe Val Leu Gly Zle Thr Tyr Phe Glu Leu ValAsc

5 10 15

Tyr Glu Lys Ser Glu Glu Val Phe Gin Lys Leu Arg Asp Leu SerPre

2530

Ser Arg

(2) SEQ ID NO: 20:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 20:

Gly Trp val Leu Cys Gin White Gly Arg Ala Tyr Phe Glu l.cu ser Glu

10 i5

Tyr Het Gin Ala Glu Arg Phe Ser Glu val Arg Arg Glu Asn 20 25 30

Tyr Arg

(2) SEQ ID No: 21:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain ^:

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 21:

Pro Trp val Leu Ala Gin White Gly Arg Ala Tyr Tyr Glu Gin Ala Met 15 10 15

Tyr Thr Glu Ala Glu Lys

Ser Arg

2) SEQ ID No: 23:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: anunoacid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 22:

for Glu Ser Trp Cys Ile Leu Ala same time Trp Phe ser Leu gin Ara GIU 1 5 10 15 His Ser gin Ala Leu LV3 Cys Ile same time Arg Ala Ile gin Leu Asp 20 25 20 Thr Phe

(2) SEQ ID No: 23:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 23:

Pro Glu Ala Trp Cys Ala Ala Gly Asn Cys Phe Ser Leu Gin Arg Glu 15 10 15

His Asp Goals Ala Lys phe Phe Gin Arg Ala Goals Gin val Asp for 20 25 30

Asn Tyr

2) SEQ ID No: 25:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 24:

for Glu Ala Trp cys Ala val Gly Asn ser Phe ser His Gin Arg Asp 1 5 10 -15

His Asp Gin Ala Leu Lys cys Phe Lys Arg

His Phe

(2) SEQ ID No: 25:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 25:

Tyr Asn Ala Trp Tyr Gly Leu Lys Thr Glv Arg

5 10 15 *

Asn Asp Gin Ala Asp Phe His Phe Gin Arg Ala Ala Glu White Asn Pro

25 30

Asn Asn

2) SEQ ID No: 25:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 26:

Tyr 1 same time Ala Trp Tyr S Gly Leu Gly Het xle 10 Tyr Tyr LVS gin Glu 15 Lys Phe ser Leu Ala 20 Glu Het His Phe gin 25 Lys Ala Leu Asp xle 30 same time for

Gin Ser

(2) SEQ ID No: 27:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single-chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ IDNo: 27:

Tyr same time Ala Trp Tyr Gly Leu Gly Thr wall Tyr Asp Lys Het Gly Lys 1 5 10 15 Leu Asp Phe Ala Glu gin His Phe Arg same time Ala Ala Lys Ile same time for 20 25 30

Ser Asn

2) SEQ ID NO: 28:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single-stranded

D) Urology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 28:

Ser 1 Leu Ala are Phe 5 Lys Lys Ala Lys wall 10 Leu Ile LCU Leu H1S Asp 15 His Asp Lys Ala 20 Leu wall Glu Leu Glu 25 gin Leu Lys Ala xle 30 Ala Pro

Asp Glu

2) SEQ ID NO: 29:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 29:

Pro Leu Cys Lys Phe His Arg But ser val Leu Phe Ala Asn Glu Lys 15 10 15

Tyr Lys ser Ala Leu Glu Glu Leu Glu Glu Leu Lys Gin White val Pro 20 25 30

Lys Glu

(2) SEQ ID No: 30:

(i) sequence characteristics:

A) length: 34 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecule> type: peptide xi) sdcvenda: SEQ ID No: 30:

val Leu Ala Arg Phe Arg Lys Ala Arg Ala Leu Gin Asc 1 5 10 15 Leu Lys Ser Leu Thr Glu Leu Lys wall Leu Lys Asp Met Ala For 20 25 30 Asp Glu

2) SEQ ID No: 32:

(i) sequence characteristics:

A) length: 27 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 31:

Phe Arg Lys Ala Zle Arg Asn Val Arg His Tyr Asn Ala Trp Tyr 15 10 15

Gly Leu Gly Met val. Tyr Leu Lys Thr Gly Arg

25

2) SEQ ID No: 33:

(i) sequence characteristics:

A) length: 27 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 32:

ss

Phe Arg Asn Ala ile Arg Val Asn Pro Arg His Tyr Asn Ala Trp Tyr 15 10 15

Gly Leu Gly Met I Tyr Tyr Lys Gin Glu Lys

25

2) SEQ ID NO: 33:

(i) sequence characteristics:

A) length: 27 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: peptide xi) sequence: SEQ ID No: 33:

Phe Arg Asn Ala ile Arg val Asn For Arg His Tyr Asn Ala Trp Tyr 15 10 15

Asp Leu Gly Het White Tyr Tyr Lys Gin Glu Lys

25

(2) SEQ ID No: 34:

(i) sequence characteristics:

A) length: 3320 bp

B) type: nucleic acid

C) chain: double-stranded

DJtopology: linear ii) mddml type: cDNA ix) other characteristics:

A) nameAad: CDS

B) location: 101 ...... 2572 xi) sequence: SEQ ID No: 34:

CGGAATTCGC GGCCGCGTTT AAATGAGCTG GGGCTGGCCG GGCCGGAGCC GCTACAGGGG 60

GGGCCTGAGG CACTGCAGAA AGTGGGCCTG i AGCCTCGAGG ATG ACG GTG CTG CAG 115 Met 1 Thr Val Leu GLR. c rf GAA CCC GTC CAG GCT GCT ATA TGG CAA GCA CTA AAC CAC TAT GCT TAC 163 Glu for wall gin Ala Ala Ile Trp gin Ala Leu same time His Tvr Ala Tyr 10 15 20 CGA GAT GCG GTT TTC CTC GCA GAA CGC CTT TAT GCA GAA GTA CAC TCA 211 Arg Asp Ala wall Phe Leu Ala Glu Arg Leu Tyr Ala Glu Val Hls Ser .25 30 35 GAA GAA GCC TTG 1 TTT TTA CTG GCA ACC TGT TAT TAC CGC TCA GGA AAG 259 Glu G1U Ala Leu Phe Leu Leu Ala Thr Cys Tyr Tyr Arg Ser Gly Lys <0 45 50 GCA TAT AAA GCA TAT AGA CTC TTG AAA GGA CAC AGT TGT ACT ACA CCG 307 Ala Tyr Lys Ala Tyr Arg Leu Leu Lys Gly 1US ser Cys Thr Thr For 55 60 65

S * f

CAA TGC AAA TAC CTG CTT GCA AAA TGT TGT GTT GAT CTC AGC AAG CTT 355 gin Cys Lys Tyr Leu Leu Ala Lys Cys cys wall Asp Leu ser Lys Leu 70 75 80 85 GCA GAA GGG GAA CAA ATC TTA TCT GGT GGA GTG TTT AAT AAG CAG AAA 403 Ala Glu Gly GIU gin Ile Leu ser Gly GLV wall Phe same time Lys gin Lys 90 95 00 AGC CAT GAT GAT ATT GTT ACT GAG TTT GGT GAT TCA GCT TGC TTT ACT 451 ser HLS Asp Asp Ile wall Thr Glu Phe Gly Asp Ser Ala Cys Phe Thr 105 110 115 CTT TCA TTG TTG GGA CAT GTA TAT TGC AAG ACA GAT CGG CTT C-CC AAA 499 Leu Ser Leu Leu Gly His wall Tyr Cys Lys Thr Asp Ara Leu Ala Lys 120 125 130 GGA TCA GAA TGT TAC CAA AAG AGC CTT AGT TTA AAT CCT TTC CTC TGG 547 Gly ser G1U Cys Tyr gin Lys ser Leu ser Leu same time for Phe Leu Trp 135 140 145 TCT CCC TTT GAA TCA TTA TGT GAA ATA GGT GAA AAG CCA GAT CCT GAC 595 Ser for Phe Glu Ser Leu Cys Glu Ile Gly Glu Lys for Asp for ASD 150 155 160 165

CAA ACA TTT AAA TTC ACA TCT TTA CAG AAC TTT AGC 643 gin Thr Phe Lys Phe Thr 170 ser Leu Gin Asn Phe Ser Asn Cys Leu -Pro 175 L £ 0 AAC TCT TGC ACA ACA CAA GTA CCT AAT CAT AGT TTA TCT CAC AC-A CAG 691 same time Ser Cys Thr Thr gin wall for same time His ser Leu Ser His Are Gin 185 190 195 CCT GAG ACA GTT CTT ACG GAA ACA CCC CAG GAC ACA ATT GAA TTA AAC 739 for Glu Thr wall Leu Thr Glu Thr for gin Asp Thr Ile Glu Leu Asn 200 205 210 AGA TTG AAT TTA GAA TCT TCC AAT TCA AAG TAC TCC TTG AAT ACA GAT 787 Arg Leu same time Leu Glu ser ser same time Ser Lys Tyr Ser Leu Asn Thr Asp 215 220 225 TCC TCA GTG TCT TAT ATT GAT TCA GCT GTA ATT TCA CCT GAT ACT GTC 835 Ser Ser wall Ser Tyr Ile Asp Ser Ala wall Ile Ser for Asp Thr 230 235 240 245 CCA CTG GGA ACA GGA ACT TCC ATA TTA TCT AAA CAG GTT CAA AAT AAA 883 for Leu Gly Thr Gly Thr Ser Ile Leu Ser Lys gin wall Gin Asn Lys 250 255 2 £ 0 CCA AAA ACT GGT CGA AGT TTA TTA GGA GGA CCA GCA GCT CTT AGT CCA 931 for Lys Thr Gly are Ser Leu Leu Gly Gly for Ala Ala Leu Ser Pro 265 270 275 TTA ACC CCA AGT TTT GGG ATT TTG CCA TTA GAA ACC CCA AGT CCT GGA 979 Leu Thr for ser Phe Gly Ile Leu for Leu Glu Thr for ser Pro Gly 280 285 290 GAT GGA TCC TAT ΤΤΆ CAA AAC TAC ACT AAT ACA CCT CCT GTA ATT GAT 1027 Asp GLV Ser Tyr '.' U gin same time Tyr Thi same time Thr for for Val ile Asp 25i 300 305 GTG CCA TCC ACC GGA GCC CCT TCA AAA AAG TCT GTT GCC AGA ATC GGC 1075 wall For Ser Thr Gly Ala For ser Lys Lys Ser wall Ala Are ile Gly 310 315 320 325 CAA ACT GGA . ACA . AAG TCT GTC TTC TCA , CAG AGT GGA AAT AGC CGA GAG 1123 gin Thr Gly Thr Lys ser wall Phe Ser gin ser Gly same time Ser Ara Glu 330 335 3 «3

ACT GAA GAA TTG GAC AAA GCA ATA AGA1987

Thr Glu Glu Leu Asp Lys Ala Leu Ala Cys Phe Arg Asn Ala IleArg

615 620625

GTC AAT CCT AGA CAT TAT AAT GCA TGG TAT GGT TTA GGA ATG ATT TAT2035

Val Asn Pro Arg His Tyr Asn Ala Trp Tyr Gly Leu Gly Met WhiteTyr

630 635 640645

TAC AAG CAA GAA AAA TTC AGC GTC2083

Tyr Lys Gin Lys Phe Ser Leu Ala Glu Met His Phe Gin LysAla

650 655660

CTT GAT ATC AAC CCT CAA AGT TCA GTT TTA A2131

Leu Asp Xle Asn For Gin Ser Ser Val Leu Leu Cys His White Glyval

665 670675

GTT CAA CAT GCA ACC GTA AAC2179 val Gin Lys Lys Ser Glu Lys Ala

680 685690

AAA GCC ATT GTC ATT GAT

Lys Ala Xle val Aso Pro Lys Asn Pro Leu Cys Lys Phe HisArg

695 '700705

GCC TCA GTA TAT GTA TAT GAT AAT GAA AAA TAT AAG TCT

Ala Ser val Leu Phe 'Ala Asn Glu Lys Tyr Lys Ser Ala Leu GinGlu

710 715 720'725

CTT GAA GAA TTG AAA CAA ATT GTT TTC2323

Leu Glu Glu Leu Lys Gin Xle val For Lys Glu Ser Leu val TyrPhe

730 735740

TTA ATA GGA AAG GTT TAC AAG AAG TTA GGT CAA ACG CAC CTC GCC CTG2371

Leu Gly Lys Val Tyr Lys Leys Gly Gin Thr His Leu AlaLeu

745 750755

ATG AAT TTC TCT TGG GCT ATG GAT TAT GAT CCT AAA GGA GCC AAT AAC2419

Met Asn Phe Ser Trp Ala Met Asd Leu Asp Pro Lys Gly Ala AsnAsr.

760 765770

CAG GAT GAT GAG GAT GAT GAG GAT GAT

Gin White Lys Clu Ala White Asp Lys Arg Tyr Leu For Asp Asp GluGlu

775 780785

CCA ATA ACC CAA GAA GAA CAG ATC ATG GGA ACA GAT GAA TCC CAG GAG2515? Ro Xle Thr Gin Glu Glu White Met Gly Thr Asp Glu Ser Gin Glu

790 795 800 e05

AGC AGC ATG ACA GAT GCG GAT GAC ACA CAA CTT CAT GCA GCT GAA AGT2563 Ser Ser Thr Asp Ala Asp Aso Thr Gin Leu His Ala Ala Glu Ser

810 815820

GAT GAA TTT TAATTCTGG AAATCAGACT TTTACAACTG GATGTGTGAC2612

Asp Glu Phe

TAGTGCTGAC GTGTTTCTTG TCCCTC7GTA TACTGAGTCT TTACTCTTG / ι GCTGGCGGTG2672

7CATCGTCCG TCACTTATAC CATGAG7GTG CCACTTTCAT TGGACCCTGA CTGTATACAG2732

AATGAAAGGC AGTGCAATAT TTAGCTGC7A ACAAGACTGG CTCTTTTACC AGTATGAÄTG2792

ACAATTTATG GGGGGTAGGG TGGGGAAC77 TCTTTTCTGT TTTTC7TTAA TCTCCC7TTG2852

77GGAAAG7A TCATGAAGGA AGAGTTATGC TTTATCTTGA AGGAACCATT AGATATGGAA2912

AATAGTGA7G AACCAGAGTT TCTTGGTTGC TTTTTCAAAA ATTTGTTTTT ATTTGGT7CT 2972

ŠG

GTA ACT CCA ATT CTT GCA CAA ACA CAA AGT TCT GGT CCA CAA ACA AGT 1171 wall Thr for Ile Leu Ala gin Thr gin Ser ser ciy for gin Thr ser 345 350 355 ACA ACA CCT CAG GTA TTG AGC CCC ACT ATT ACA TCT ccc CCA AAC GCA 1219 Thr Thr for gin wall Leu ser for Thr Ile Thr Ser for for Asr. Ala 360 365 370 CTG CCT CGA AGA AGT TCA CGA CTC TTT ACT AGT GAC AGC TCC ACA. ACC 1267 Lqu for Arg Arg Ser Ser Arg Leu Phe Thr Ser ASD Ser ser Thr 375 '80 385 AAG GAG AAT AGC AAA AAA TTA AAA ATG AAG TTT CCA CCT AAA ATC CCA 1315 Lys Glu same time Ser Lys Lys Leu Lys Met Lys Phe for for Lys ile Pro 390 395 400 405 AAC AGA AAA ACA AAA AGT AAA ACT AAT AAA GGA GGA ATA ACT CAA CCT 1363 same time Arg Lys Thr Lys Ser Lys Thr same time Lys Gly Gly Ile Thr Gin Pro 410 415 420 AAC ATA AAT GAT AGC CTG CAA ATT ACA AAA TTG GAC TCT TCC ATC ATT 1411 same time Ile same time Asp Ser Leu Clu Ile Thr Lys Leu Asp ser ser ile ile

425 430 435

TCA GAA GGG AAA ATA TCC ACA ATC ACA CCT CAG ATT CAG GCC AAT 1459 Ser Glu Gly Lys Ile Ser Thr White Thr for gin Ile gin Ala Phe same time 440 445 450 CTA CAA AAA GCA GCA GCA GAA GGT TTG ATG AGC CT ' ⁵ ' CTT CGT GAA ATG 1507 Leu gin Lys Ala Ala Ala Glu Gly Leu Met ser Leu Leu Arg G1U Met 455 í 60 465 GGG AAA GGT TAT TTA GCT TTG TGT TCA TAC AAC TGC AAA GAA GCT ATA 1555 Gly Lys duties Tyr Leu Ala Leu Cys Ser Tyr same time Cys Lys Glu Ala Ile 470 475 480 485 AAT ATT TTG AGC CAT CTA CCT TCT CAC CAC TAC AAT ACT GGT TGG GTA 1603 same time Ile Leu Ser HÍ9 Leuro ser His His Tyr same time Thr Gly Trp wall 490 495 500 CTG TGC CAA ATT GGA AGC GCC TAT TTT GAA CTT TCA GAG TAC ATG CAA 1651 Leu Cys gin Ile Gly Arg Ala Tyr Phe Glu Leu ser GIU Tyr Met gin 505 510 515 GCT GAA AGA ATA TTC TCA C-AG GTT AGA AGG ATT GAG AAT TAT AGA GTT 1699 Ala Glu Arg Ile Phe ser Glu val Arg Arg Ile Glu same time Tyr are wall

520 525 530

GAA GGC ATG Met GAG Glu ATC TAC White Tyr TT ACA: .e * Thr = i0 ACA CTT Thr Leu TGG Trp CAT H X S 545 CTT Leu CAA Gin AAA Lys GAT Asp 1747 Glu Gly 535 GTT GCT CTT TCA GTT CTG TCA AAA GAC TTA ACA GAC ATG GAT AAA AAT 1795 wall Ala Leu Ser wall Leu cer Lys Asp Leu Thr Asp Met Asp Lys same time 550 555 560 565 TCG CCA GAG GCC TGG TGT Gζτ GCA GGG AAC TGT TTC AGT CTG CAA CGG 1643 Ser for Clu Ala Trp Cys and Ala Gly same time Cys Phe Ser Leu gin are - 570 = 75 = £ 0 GAA CAT GAT ATT GCA ATT AAA TTC TTC CAG AGA GCT ATC CAA GTT GAT 1891 G1U HLS Asp Ile Ala Ile 3 Phe Phe gin Arg Al. '; Ile gin wall Asp 585 590 595 CCA AAT TAC GCT τίτ GCC TAT ACT CTA TTA GGG CAT GAG TTT GTC TTA 1939 for same time Tyr Ala Tyr Ala Tyr Thr Leu Leu Gly : -: x = Glu Phe wall Leu

600 605 610

GTTCCAGATA AACAGAGTAA CTGACCTTCA TTTCTAGGTT CTTCAAGAAT GGTGTTTGCA 3032 AGTGCCAGAT GGAACAATAA AAGACGTTGC CTATAACAGT GACTTGATTG CCAAGGAATG 3092 TAAATTACCT TAAACTTCGA TGATCTCCCZi TAAACAAATG TAATGGGCAT A77GGGACTC 3152 GTATGTAGGA ATCAAATATC CCTCCATACA GTGTACTCTT A7TCTTGGCA AGAATGCTTT 3212 AATGTATAAC CAAGAATTTT AATTTATTCA TCTTGCTTCA AAGTGTTGAT CATTGTTGTC 3272 TTGGTATTGC AAACTTTAAA ATTGTTTCTT ACCAGCGGCC G2GÄATTC 3320

2) SEQ ID No: 36:

(i) sequence characteristics:

A) length: 824 amino acids

B) type: amino acid chain

C) chains: single chain

D) topology: linear ii) molecular type: protein xi) sequence: SEQ ID No: 35:

Met Thr Val Leu Gin Glu Pro Val Gin Ala Ala I = Trp Gin Ala Leu 1 5 10 15.

Asn His Tyr Ala

20 25 30 Ala Glu wall His Ser Glu Glu Ala Leu Phe Leu Leu Ala Thr Cys Tyr 35 40 45 Tyr Arg Ser Gly Lys Ala Tyr Lys Ala Tyr Arg Leu Leu Lys Gly His 50 55 6C ser cys Thr Thr for gin Cys Lys Tyr Leu Leu Ala Lys Cys Cvs Val 65 70 75 80 Asp Leu Ser Lys Leu Ala Glu Gly Glu Gin Ile Leu Ser Gly Glv val 85 90 95 Phe same time Lys gin Lys Ser His Asp Asp íle wall Thr Glu Phe Glv Asd 100 105 110 ser Ala cys Phe Thr Leu Ser Leu Leu Gly His wall Tyr Cys Lys Thr 115 120 125 Asp Arg Leu Ala Lys Gly Ser Glu Cys Tyr gin Lys Ser Leu S c · r Leu 130 135 14C same time for Phe Leu Trp Ser for Phe Glu ser Leu Cys Glu G. G. Glu 145 150 155 160 Lys for Asp for Asp gin Thr Phe Lys Pne Thr Ser Leu Gin Asr. Phe 165 170 17 = ser same time Cys Leu for same time Ser cys Thr T.nr gin wall for Asn H :: Ser 180 185 190 Leu Ser His Arg gin for Glu Thr val Leu Thr Glu Thr Pro Glr. Asr 195 200 205 Thr Ile Glu Leu same time Arg Leu same time Leu Glu Ser ser same time Ser Lys Tyr 210 215 22C

5o

Ser 225 Leu same time Thr Asp Ser 230 Ser Val Ser Tyr Asp Ser Ala Val clay 235 240 Ser for Asp Thr wall for Leu Gly Thr Gly Thr ser Ile Leu Ser Lys 245 250 255 gin wall gin same time Lys for Lys Thr Gly Ara ser Leu Leu Gly Glv Pro 260 265 270 Ala Ala Leu Ser for Leu Thr for Ser Phe Gly Ile Leu For Leu Glu 275 280 285 Thr for Ser for Gly ASD Gly Ser Tyr Leu gin same time Tyr Thr Asn Thr 290 • 295 300 for for wall Ile Asp wall for Ser Thr Gly Ala for Ser Lys Lvs ser 305 310 315 320 wall Ala Arg Ile Gly gin Thr Gly Thr LVS ser wall Phe Ser Gin 325 330 225 Gly same time Ser Arg Glu wall Thr for Ile Leu Ala gin Thr Gin Ser Ser 340 345 350 Gly for gin Thr Ser Thr Thr for gin wall Leu ser for Thr White Thr 355 360 365 Ser for for same time Ala Leu for Arg Arg Ser ser Ara Leu Phe Thr 370 375 38o Asp Ser Ser Thr Thr Lys Glu same time Ser Lys Lys Leu Lys Met L-Phe 385 390 395 400 for for Lys Ile for same time Arg Lys Thr Lys ser Lys Thr Asn Lvs Gly 405 410 415 Gly Ile Thr gin for same time Ile same time ASD Ser Leu Glu Ile Lys Leu Thr

420 425 430

Asp Ser Ser White Glu Lys White Ser Thr White Thr Pro Gin 435 440 445 White Gin Ala Phe Asn Leu

Leu Leu Arg Glu Met Gl Lys Gly Tyr Leu Ala Leu Cys Ser m * · · same time 465 47C 475 460 Cys Lys Glu Ala Ile Asr. Leu ser His Leu for ser His HLS Tyr 485 490 495 same time Thr Gly Trp wall Leu Cys Gin Ile Gly Arg Ala Tyr Phe Glu Leu 500 505 510 ser Glu Tyr Met gin Ala Glu Arg Ile Phe ser Glu wall Arg Arg Ile 515 520 525 Glu same time Tyr. Arg VaJ Glu Glv Met Glu Ile TVR Ser Thr Thr Lc-J Trp 530 5Ξ5 540 His Leu gin Lys Asp wall Ala Leu Ser wall Leu Ser Lys Asp Leu Thr 545 55G 555 560 Asp Het Asp Lys same time Ser Pro Glu Ala Trp Cys Ala Ala Gly same time Cys 565 * 4 570 575

ss

Phe Ser Leu Gin Arg Clu His Asp Zle Ala Zle Lys Phe Phe Gin Arg 580 585590

Ala White Gin Val Asp Pro Asn Tyr Ala Tyr Thr Leu Leu Leu Gly 595 600605

His Glu Phe Val Thu Glu Glu Leu Asp Lys Ala Leu Ala Cys Phe 610 615620

Arg Asn Ala White Arg Val Asn Pro Ara His Tyr Asn Ala Trp Tyr Gly 625 630 635640

Leu Gly Het ile Tyr Tyr Lys Gin Lys Phe Ser Leu Ala Glu Het 645 650 655 His Phe gin Lys Ala Leu Asp Ile same time for gin Ser ser wall Leu Leu 660 665 670 Cys His Ile Gly wall wall gin His Ala Leu Lys Lys ser Glu Lys Ala 675 680 685 Leu Asp Thr Leu same time Lys Ala Ile wall Ile Asp for Lys same time for Leu 690 695 700 Cys Lys Phe His Arg Ala Ser wall Leu Phe Ala same time Glu Lys Tyr Lys 705 710 715 .720 ser Ala Leu gin Glu Leu Glu Glu Leu Lys gin Ile wall for Lys Glu 725 730 735 ser Leu wall Tyr Phe Leu ill Gly Lys wall Tyr Lys Lys Leu Gly gin 740 745 750 Thr His Leu Ala Leu Het same time Phe Ser Trp Ala Met Asp Leu Asp for 755 760 765 Lys Gly Ala same time same time gin ill Lys Glu Ala xle Asp Lys Arg Tyr Leu 770 775 780 for Asp Asp Glu Glu for xle Thr gin Glu Glu gin Ile Met Gly Thr • 785 790 795 800 Asp Glu Ser gin G1U Ser Ser Met Thr Asp Ala Asp Asp Thr gin Leu * 805 810 815 His Ala Ala Glu ser Asp Glu Phe 820

T > g-C8-fC

Claims (31)

PATENT CLAIMS An isolated and purified DNA sequence encoding an RB binding protein comprising a subsequence having at least 60% homology to the nine tetratricopepptide repeats in the C-terminal region, provided that the sequence does not encode either the S. pombe yeast nuc2 protein or the Aspergillus nidulans bim A protein. or the CDC27 protein of yeast S. cerevisiae. The isolated and purified DNA sequence encoding the RB binding protein of claim 1 having 60% homology to amino acids 465 to 770 of SEQ ID NO. No 1. The isolated and purified DNA sequence of claim 1, which encodes amino acids 465 to 770 of the I.D. No 1 The isolated and purified DNA sequence of claim 1, which encodes H-NUC according to the sequence of I.D. No 1. A recombinant vector comprising the isolated, purified DNA of claims 1, 2, 3 or 4. The recombinant vector of claim 5, wherein the vector is a cosmid, plasmid or is derived from a viral particle. An expression vector comprising a DNA molecule according to claims 1, 2, 3 or 4, capable of introducing said DNA molecule into a mammalian host cell and expressing said DNA molecule therein. The expression vector of claim 7, wherein the vector is selected from the group of plasmid or viral vectors. The expression vector of claim 8, wherein the viral vector is selected from the group of retroviral and adenoviral vectors. The expression vector of claim 9, wherein the expression vector is ACN-H-NUC. A host vector system for producing a polypeptide or protein having the biological activity of an H-NUC protein, or biologically active derivative thereof, comprising the vector of claims 7, 8, 9, or 10 in a suitable host cell. The host vector system of claim 11, wherein the host cell is a prokaryotic cell. The host vector system of claim 11, wherein the host cell is a eukaryotic cell. 14. A pharmaceutical composition comprising the vector of claim 7 and a pharmaceutically acceptable carrier. 15. A pharmaceutical composition comprising the vector of claim 8 and a pharmaceutically acceptable carrier 16. A pharmaceutical composition comprising an ACN-HNUC vector and a pharmaceutically acceptable carrier. 17. A DNA probe consisting of a fused 27 nucleotides complementary to the sequences of claim 1. The DNA probe of claim 17, wherein the nucleotide sequence is complementary to the DNA sequence I D. No 1. 19. An isolated and purified mammalian RB protein binding protein comprising at least six tetratricopeptide repeats in the C-terminal region of the molecule in its amino acid sequence, provided that the protein is not a S. pombe yeast nuc2 protein, Aspergillus nidulans bimA protein or CDC27 protein yeast S. cerevisiae. G1 The isolated and purified mammalian protein of claim 19, which comprises nine tetratricopeptide repeats in its C-terminal region of the molecule in its amino acid sequence. The isolated and purified mammalian protein of claim 20, wherein the H-NUC has the amino acid sequence of I.D. No 2. 22. The method of claim 19, wherein: a) introducing into a host cell a compatible expression vector comprising the gene encoding the protein of claim 19 b) expressing the protein in a host cell. 23. The method of claim 22, wherein the host cell is selected from the group of prokaryotic and eukaryotic host cells. 24. The method of claim 23, wherein the host cell is a eukaryotic mammalian cell and the expression vector is compatible with the host cell. 25. A method of suppressing the neoplastic phenotype of cancer cells which do not contain an endogenous H-NUC protein, comprising administering to said cells an effective amount of DNA according to claims 1, 2, 3 or 4. 26. The method of claim 25, wherein the H-NUC gene is administered in the form of a recombinant vector. A method of suppressing the neoplastic phenotype of cancer cells that do not contain an endogenous H-NUC protein. characterized in that a protein according to claims 19 to 21 is administered to said cancer cells. 28. An antibody that binds an RB binding protein whose amino acid sequence comprises at least six tetratricopeptide repeats in the C-terminal region of the molecule, provided that said protein is not a S. pombe yeast nuc2 protein, Aspergillus niger bimA protein or S. cerevisiae yeast CDC27 protein. . The antibody of claim 28, which binds to an H-NUC protein having the amino acid sequence of I.D. No 2. 30. A hybridoma that produces a monoclonal antibody that binds to an H-NUC protein having the amino acid sequence of I.D. No 2. 31. A method for detecting the absence of H-NUC protein in tumor cells, comprising: (a) preparing tissue sections from the tumor b) contacting the antibody of claims 26 or 27 with said tissue sections c) detecting the presence or absence of binding of said antibody on tissue sections.