CZ178396A3 - Novel tumor-suppressor gene - Google Patents

Abstract

This invention is an isolated and purified DNA sequence encoding an Rb binding protein comprising a subsequence having at least 60% homology with nine tetratricopeptide repeats at the C-terminal end, with the proviso that the sequence encodes for neither <u>S. pombe</u> yeast protein nuc2, <u>Aspergillus nidulans</u> protein bimA, nor <u>S. cerevisiae</u> yeast protein CDC27, vectors containing said DNA, DNA probes based on said DNA, and methods of therapy utilizing said DNA and vectors. This invention is also directed to proteins encoded by said DNA, methods of therapy utilizing said proteins, and methods of expressing said proteins. Finally, this invention is directed to antibodies to said proteins, hybridomas producing said monoclonal antibodies, and diagnostic methods utilizing said antibodies.

Description

A new tumor suppressor gene

Technical field

O

C / X

The present invention relates to tumor suppressor genes (anti-oncogenes) and, in general, to methods and products for practical broad spectrum use in tumor suppressor therapy of human cancer. In particular, the invention relates to methods of treating cancer cells comprising 1) administering vectors comprising a nucleotide sequence encoding a novel protein designated herein as H-NUC, or 2) administering an effective amount of a protein encoded by said nucleotide sequence.

Cancer is the second most common cause of death in the US, with 450,000 people killed every year. One in three Americans develops cancer and one in five dies (Scientific American Medicine, 12,1,1, 1987). While considerable progress has been made in identifying the external and genetic causes of cancer, statistical data on cancer mortality indicate an urgent need to improve therapies for cancer and related diseases and disorders.

A number of so-called cancer genes, i.e. genes involved in the onset of cancer, have been identified in the study of hereditary forms of cancer and tumor cells. The study of cancer cells provides an understanding of the mechanism of tumorigenesis. While much information about cancer genes remains unknown, the currently known cancer genes serve as a useful model for understanding tumorigenesis.

Cancer genes are generally categorized as "oncogenes", which induce tumorogenesis when activated, and "tumor suppressor genes", which fail to suppress tumorogenesis if damaged. It is also possible that certain genes may play different roles depending on their allelic forms, regulatory elements, genetic background, and location of expression.

One of the well-known working hypotheses about cancer is the following: 1) Most types of human cancer are genetic diseases and 2) result from the expression and / or inability to express specific genes (ie mutant versus normal growth regulatory genes or viral or other foreign genes in mammals) cells that cause abnormal, incorrectly timed, or ectopic expression of other classes of growth regulatory genes.

A simplified view of the biological basis for neoplasm formation is that there are two basic classes of oncogenes. The first class comprises mutant or otherwise aberrated alleles of normal growth regulatory genes involved in cell growth or replication control. These genes are cellular proto-oncogenes. If mutated, they can encode new cellular functions that disrupt normal cell growth and replication. These changes result in the production of a dominant tumor phenotype. In this model, which has prevailed since it was thought that neoplasms are due to genetic and mutational changes, it is suggested that the existence of a single wild-type allele is not sufficient to prevent tumor changes in the developmental program or cell growth properties. The genetic events responsible for the activation of these oncogenes can therefore be seen as single-intervention '. Evidence for the involvement of such transforming oncogenes in human cancer clinical cases are examples of activation of tumorigenic activities of mye oncogenes in Burkitt's lymphoma, expression of bcr-abl chimeric gene product in patients with chronic myelogenous leukemia, activation of H-ras and K-ras oncogenes in other tumor types. Genetically based treatments for these types of cancers would require specific destruction or inactivation of the expression of the respective responsible genes.

BACKGROUND OF THE INVENTION

The recently discovered group of genes of the cancer gene family are the so-called tumor suppressor genes, sometimes referred to as anti-oncogenes, growth suppressors, or cancer gene suppressors. Recent studies suggest that mutations that result in loss of function of genes of this class are also likely to be involved in a high percentage of human cancer. For example, tumor suppressor genes have been identified and cloned involved in the pathogenesis of retinoblastoma (rb), breast, intestinal (p53), Wilms' tumor (wt), and intestinal (dcc) carcinomas. Some aspects of their effect in tumorigenesis have already been elucidated.

The gene responsible for the formation of retinoblastoma (RB) is a prototype tumor suppressor. Mutations of this gene have been found in various types of human tumors (Bookstein and Lee, Crit. Rev. Oncog., 2: 211-227 (1991); Goodrich and Lee, Biochim. Biophys. Acta., 1155: 43-61 (1993)) Riley et al., Annu Rev. Cell Biol., 10: 1-29 (1994)). Re-introduction of a single copy of the normal Rb gene into murine tumor cells suppresses their ability to develop into tumors (Huang et al., Science, 242: 15631566 (1988); Sumegi et al., Cell Growth Differ., 1: 247-250, (1990) Bookstein et al., Science, 247: 712-715 (1990); Chen et al., Cell Growth Differ., 3: 119-125 (1992); Goodrich et al., Can. Res., 52: 1968 Takahashi et al., Proc. Natl. Acad. Sci. USA, 88: 5257-5261 (1991)). Microinjection of non-phosphorylated Rb protein into cells in the early G1 phase of the cell cycle blocks their entry into the S phase, suggesting its direct involvement in regulatory processes of cell growth (Goodrich et al., Cell, 67: 293-302 (1991). These results are supported Overexpression of the Rb protein from the human RB gene results in growth retardation at the organism level (Bignon et al., Genes Dev., 7: 1654-1662 (1993)).

In mouse embryos lacking functional expression of the RB gene caused by homozygous inactivation of the RB gene, their prenatal development is stopped and the embryos die (Lee et al., Nature, 359: 288-294, (1992); Jacks et al., Nature, 359 : 328-300, (1992); Clarke et al., Nature, 359: 328-330 (1992)). These experiments provide important data to elucidate the importance of the Rb protein in cell growth and in vivo differentiation.

The RB gene encodes a nuclear protein that is phosphorylated at the serine and threonine residues depending on the cell cycle progression (Lee et al., Nature, 329: 642-645 (1987); Buchkovich et al. Cell, 58: 1097-105 ( Chen, et al., Cell, 58: 1193-1198 (1989); DeCaprio et al., Cell, 58: 1085-1095 (1989)). During the G1 phase of the cell cycle, when the protein is in an active state, as indicated by microinjection experiments, the Rb protein exists in a hyperphosphorylated state (Goodrich et al., Cell, 67: 293-302 (1991); Goodrich and Lee, Nature, 360: 177 179 (1992)). The hyperphosphorylated Rb protein also occurs in the GO phase. It seems to play a decisive role in maintaining cells in the resting phase, in which the cell decides whether to enter a new cell cycle or whether differentiation occurs (Goodrich and

Lee, Biochim. Biophys. Acta., 1155: 43-61 (1993); Pardee, A. B., Science, 246: 603608 (1989)).

During the late G1, S and M phases, the Rb protein is hyperphosphorylated probably by some of the CDK kinases (Lees et al., EMBO J., 10: 4279-4290 (1991); Lin et al., EMBO J, 10: 857-864 (1991); Hu et al., Mol Cell Biol, 12: 971980 (1992)). Phosphorylation of certain amino acid residues appears to allow the cell to transition to proliferation. The mode of phosphorylation of the Rb protein is related to its function in inhibiting growth, and it has recently been hypothesized that phosphorylation negatively regulates the growth-suppressing function of this protein (hollingsworth et al., Curr. Opin. Genet. Dev., 3: 55-62 (1993); Sherr, CJ, Trend Cell Biol., 4: 15-18 (1994)). Dephosphorylation of the Rb protein occurs during the M phase and results in its reactivation before beginning a new cell cycle. Protein phosphatase type 1 has been shown to be critical for this dephosphorylation (Alberts et al., Proc. Natl. Acad. Sci. USA, 90: 388-392 (1993); Durfee et al., Genes Dev, 7: 555 -569 (1993)).

The molecular mechanism by which the Rb protein is involved in cellular activities has not yet been elucidated. The current concept suggests that the Rb protein interacts with many different proteins and can express its function in these complexes. If the function of the Rb protein is to keep the cell in the G0 / G1 phase, it must inactivate other proteins that are active and necessary for entry into the G1 phase and its progression (Lee et al., CSHSOB, LVL211-217 (1991)). This hypothesis is consistent with recent observations suggesting that the important growth-promoting transcription factor E2F1 is tightly negatively regulated by the Rb protein (Helin et al. Cell, 70: 337-350 (1992); Kaelin et al. Cell, 70: Shan et al Mol Cell Biol, 13: 6501-6508 (1993); Shan et al Mol Cell Biol, 14: 229-309 (1994)). The recently discovered H-NUC protein binds to the Rb protein and thus also participates in the regulation of mitosis.

The BRCA-1 gene, causing breast cancer, was localized to chromosome 17 q21-22 by mapping by binding analysis. It is unclear whether this gene acts as a tumor suppressor or as a dominant oncogene. However, the p53 gene involved in the onset of Li-Fraumeni syndrome functions as a classical tumor suppressor gene, and likewise, the loss of the RB gene is associated with hereditary retinoblastoma.

Among these extreme examples of transforming oncogenes and recessive tumor suppressor genes lie a number of additional mechanisms involved in the development of neoplasms. For many years, it has been assumed that most types of human cancer are likely to be due to multiple, interacting genetic defects, none of which is sufficient to develop a tumor. The intrinsic role of cellular proto-oncogenes and tumor-suppressive genes regulating growth represents a complex set of their interactions.

SUMMARY OF THE INVENTION

The present invention is based on the discovery of a nucleic acid molecule encoding an H-NUC protein having tumor suppressor capability. The gene was localized to region q21-22 of chromosome 17. The properties of H-NUC (amino acid sequence derived from total cDNA; ability to bind to DNA and activate transcription; change of position or loss of coding sequence in some breast cancer cell lines) are consistent with H -NUC as a nuclear protein and as a tumor suppressor protein. The newly described total cDNA encodes a protein of 824 amino acids in length. The protein contains ten 34 amino acid repeats characteristic of the TPR (tetratrico peptide) protein family.

Diagnostic methods using nucleic acid and H-NUC protein are known. The present invention relates to the administration of a wild-type H-NUC tumor tumor suppressor gene or protein capable of suppressing, destroying or reversing the neoplastic phenotype in cancer cells that do not themselves produce the H-NUC protein. The present invention demonstrates for the first time the administration of the wild-type HNUC gene to cancer cells lacking the wild-type H-NUC protein, for suppressing or reversing the neoplastic phenotype or altering their properties. This suppression of the neoplastic phenotype alternately suppressed or destroyed the abnormal mass of these tumor cells, i.e. tumors, and thus reduced the number of tumors (tumor burden) of the test organisms and increased their survival rate. The neoplastic properties that are monitored and which can be reversed are morphology, growth, and as the most important ability to develop into a tumor. Thus, the reduction in tumor burden is due to suppression of the neoplastic phenotype following administration of the wild-type H-NUC gene. Neoplastic phenotype is understood to mean phenotypic changes in cellular characteristics such as

,. . ^1. ·· -ί. ?

7 - \ - 4. ? '‘- -7« * -.

«- '·· *. >, Ψ ·. ·. mm ology, growth rate (i.e., doubling time), saturation density, formation on agar soils and ability to form tumors.

The invention provides vectors encoding the H-NUC protein and H-NUC proteins that can be readily utilized in the treatment of cancer, and methods for preparing the H-NUC proteins and vectors suitable for such use.

The finding further describes methods of treatment not only in humans but also generally in mammals, by treating abnormally proliferating cells and suppressing neoplastic cells. In general, the invention contemplates treating abnormally proliferating cells and diseases characterized by their presence by any suitable method that allows the entry of the H-NUC encoding vector into host compatible cells or the HN UC protein into those cells to be treated to achieve suppression of proliferation.

In another aspect, the invention provides a method of treating mammalian diseases characterized by proliferating cells by administering an expression vector kbiujuihc H-NCC protein, introducing the vector into abnormally proliferating bt.buK, and producing H-NUC protein in an amount effective to suppress the proliferation of these cells. The expression vector is introduced into cells by viral infection or transduction, liposome-mediated transfection, polybrene transfection, C10 transfection. _} and electroporation. Treatment is repeated as long as it is needed.

In another aspect, the invention provides a method of treating a mammalian abnormally affecting host cells by introducing an H-NUC encoding expression vector into these cells and producing therein in an amount effective to suppress proliferation of these cells.

I cells. Treatment is repeated as long as it is needed.

The invention provides a DNA molecule capable of suppressing the growth of abnormally perturbing cells. The DNA molecule encodes an Rb binding protein that contains at least 66% homology with nine repeats in the C-terminal region of the p-vdein molecule, provided that the DNA does not encode the NUC 21 protein or the Aspergillus nidulans bimA protein and the protein The Ci 'P / iCad lacquer Rb binding protein is an H-NUC protein having an amino acid sequence substantially according to SEQ ID NO. 2. The DNA molecule has the modifying sequence of SEQ ID NO. 1 and its expression is assured by expression. . .at. The expression vector may be any vector compatible

Ί the cell. The vector is usually selected in a form derived from retroviral, adenoviral and gaming virus vectors.

In another aspect, the invention provides an H-NUC protein having an amino acid sequence substantially according to SEQ ID NO. 2, and biologically active fragments thereof.

In another aspect, the invention provides a method of producing an H-NUC protein which comprises, and in the steps of: introducing a compatible expression vector susceptible to the H-NUC coding sequence into a host cell and inducing conditions such as to produce an H-NUC protein .

In another aspect, the invention provides a method of treating abnormally proliferating mammalian cells ex vivo by the steps of: collecting a tissue sample containing ab normally proliferating cells, contacting the tissue sample with an effective dose of an HNVC encoding expression vector, producing an H-NUC protein in abnormally pv -. iterating cells in an amount capable of effectively suppressing their proliferation. Lm / b is repeated, if necessary, and the tissue samples are returned to the original, or yes. orgarusmu. Preferably, the tissues used are blood or bone marrow.

In another aspect, the invention provides a method of treating a mammalian disease characterized by mammary proliferation comprising the steps of: administering H-NUC of a protein in an amount effective to suppress abnormal proliferation. Preferably, p; uses οι NUC protein encapsulated in liposome particles. Treatment is repeated if necessary.

In another aspect, the invention provides an oligonucleotide fragment capable of hybridizing to the H-NUC gene and methods for its use. These oligonucleotides may contain a maximum of 5 nucleotides, but oligonucleotides of 20 to 30 lengths are preferred.

From the rationidide. These oligonucleotides may be labeled with radioisotopes (tritium, ³² phosphorus, chia, enzymes (e.g., alkaline phosphatase, horseradish peroxidase), fluorescent roe (e.g., fluorescein, Ethidium, terbium chelate) or

c.Iomiluminescent labels (eg acridine esters, isoluminol). These and those described in the "Non-isotope DNA Probe Techniques", L.J.Rricka, Ed., Ávudemie Press. New York, 1992 can be used for rapid preparation of drugs and for conventional methods such as Southern and Nothern blotting. These methods are, for example, in "Nucleid Acid Hybridization - A Practical Alien". H., o.ii.Hanies and S.J. Higgins, Eds., IRL Press, Washington, D. C., 1985. Advantageously, these probes can be used for hybridization to the H-NUC gene under sirentic conditions. These oligonucleotides can be used as primers for PCR techniques (described in, e.g., "PCR Technology", H. A. Ehrlich, Ed., Stockton Pfers, New York, 1989). -. - - ·. - · -

Ay images

Figures 1A and 1B show that similar regions of RB are required for the binding of HN-γ and T-aadgene. Figure 1A is a scheme of a Gal4-RB fusion that is used to determine binding domains. The Gal4 DNA-binding domain (amino acids 1 to 147) is fused to various mutant forms of RB. The T / E1A binding domains are generally reigned. Domains affected by mutations are shown in dotted lines. Figure 13 shows the detection of interactions between H-NUC and RB mutants in vivo. Y153 binds to the .alpha., .Alpha., .Alpha., Gal4-Rb mutants and either the Gal4- (H-NUC) expression clone (Gal4 (C-49b.) Or YIpPTG10. The ucirical assay (CPRG) was performed to quantify the β-galactosidase ac-Avica for each transformation (Durfee et al., Genes Devel., 7: 555-569 (1993)).

Figures 2A and 2B show that H-NUC binds to non-phosphorylated RB. Figure 2A shows GST and GST fused to the cDNA encoding H-NUC (GST-419) and N to the 273 amino acid region of the SV40 T-antigen that were expressed in E '. OSY and GST fusion proteins bound to glutathione-sepharose beads and washed extensively. Samples were quantified using Commassia blue on SDSpciyacrylanuana gels. An equal amount of black steel was applied to each lane. Figure 2B depicts extracts obtained from WR2E3 cells that were maintained for 30 minutes at room temperature. After intensive washing, the complexes were separated on SDS-polyacrylamide gels and iniotioids. The amount of Rb protein present and the degree of phosphorylation thereof was determined by immunoprecipitation with anti-Rb monoclonal antibody 11D7 (lane).

J. <: - ·. with the same antibody and visualized fluorographically.

O. r ζ.ολ 3 is the nucleotide (SEQ. ID NO .: 1) and putative aos (i. ·) \ - j sequence (SEQ. ID NO .: 2) of the total cDNA of the H-NUC gene and H1 'lp> tei!

Figures 4A and 4B show that H-NUC encodes a product that is a member of the β family _; <RTIgt; eins </RTI> with 3 tetratricopeptide repeats (TPR). Figure 4A depicts the 3-to-10 34-amino acid repeats in H-NUC, Schisosaccharomyces on Aspergillus nidulans bimA proteins, in SEQ ID NOS: 4 to Sb. The sketch shows the location of ten (0-9) repeat units (TPR) in nuc2 +, HNJC and bimA proteins. The repeat unit 3 of these polypeptides (shown in dotted lines) lacks a conservative motif. Figure 4B shows the amino acid sequences of 9 TRP repeat units (1-9) in H-NUC1 proteins. nuc2 + and bimA (SEQ ID NOS: 4 to 30). Conservative sections are \ Cdeinicich. The TRP unit 6 of all three proteins contains glycine at position 6. GlyG in repetition of nuc2 protein 6 appears to be essential.

Figures 5A and 5B show binding of C-terminal TRP repeats of H-NUC to Rb protein. Figure 6A is a schematic representation of the Gal4-H-NUC fusion, used to teach the weighted domains. The Gal4 transactivation domain is fused to various or mutagenic forms of H-NUC. TRP repeats of H-NUC are zp; viewed by a shark bathtub. Figure 5B shows the detection of interactions between Rb and H-NUC cl -... chiututants in vivo. Y153 was cotransformed with the indicated Gal4-H-NUCs and either with Oal4-RB2 or Gal4-H209. Each transformation was quantitated by CFRG (detection of β-galactosidase activity).

Figures bA and 6B show a mutation in essential Gly created in a temperature-sensitive H-NUC mutant that diminishes its ability to bind to Rb at n permissive temperature. Figure 6A shows in detail the amino acid substitution in H-NUC (áGaOD) (SEQ ID NO: 31-33). The essential glycine (G) (amino acid 540) of nue2 was substituted by an aspartic kine (D; SEQ ID NO: 34-35) in the temperature-sensitive mutant. Glycine at position 640 of the H-NUC protein is cited with aspartic acid (D). Figure 6B depicts the interactions between Rb and H-NuC GabD.1 in a form at 37 ° C. Y153 was co-transformed with Gal4-Rb2 and b,. CAN-HCCJC. or Gal4-H-NUC (640D). Transformants were grown in liquid to bii at 2UC for 24 hours. The culture was then diluted in fresh medium and at 37 ° C. Aliquots of yeast culture were harvested at various times of growth and β-galactosidase activity. This activity is aided by CRPG.

• V, ir <

iu

Figures 7A and 7B depict the preparation of antisera against H-NUC and detection of H10C in human cell lines. In Figure 7A, G-49 is used to immunize mice. fCrotein proteins. Pre-immune serum (lane 1), irr: aru SL vnn ·; lane 2), immune serum preincubated with Gst protein (lane 3) and ton serum preincubated with Gst-491 (lane 4). Z-562 cells to prepare a cell lysate labeled with Cuy ^35th The same amount of cell I was used for immunoprecipitation. The resulting immunoprecipitates were separated by SDSp; by electrophoresis. In Figure 7B, S ³⁵ labeled lysates are prepared from CV-1 cells. Equal amounts of cell lysate were immunoprecipitated with pre-immune serum (lane 1) or immune serum (lanes 2 and 3). Immunoprecipitates were resolved by SIC pmyacrylamide electrophoresis The immunosera was specifically recognized by p.eu with a molecular weight of 90 kDa (indicated by the arrow).

Gbruzt-K8 shows that the H-NUC protein has DNA-binding activity. The β-cent lysate from K562 cells, labeled with ^35- methionine, was loaded onto a sr1 column. by d>; strand DNA from calf thymus on cellulose and eluting the growing R, I, IV-iodine. In the lens after elution, either (A) mAb 11D7 for z was immunoprecipitated. Rb protein, or (B) an immune serum recognizing H-NUC. Aliquots of gravity in the sample were also used for incubation with glutathione-sepharose (C).

Figure 9 shows the location of the gene encoding H-NUC on the q21-22 region of chromosome i ?.

Pictures. Figures 10A and 10B show the results of Southern blot analysis of DNA from breast tumor seals with H-NUC as a probe. DNA was extracted from cell lines and digested with EcoRI. Blots from the cell lines tested in Figure 10A are rotational days. In Figure 10B, a homozygous deletion of the H-NUC gene was evident in the T47D and MB157 cell lines. Heterozygous mutations which probably you · ·, O cell lines MB231 and BT549 ΒΊΌ0578-7, was characterized with OA .. I _i di cutter to the 14 kbp EcoRI fragment.

11 shows the inhibitory effect of AC-H-NUC on cell growth in T-47D

v.; mi, y.L! -breast in vitro. The upper left figure shows MDA-MB-231 b · {> i. i O-. aae ACN ΜΟΙ 10) for 3 days and stained with crystal violet.

1. λ; . ; The figure shows T-47D cells infected with ACN (MOI 10). The lower left cues MDA-MB-231 cells infected with AC-H-NUC (MOI 10). The lower figure shows T-47D cells infected with AC-H-NUC. (+/-) indicates that? <Λ 231 cells are heterozygous for H-NUC. (- / -) indicates that T-47D b - ·: <> indicates a homozygous deletion of H-NUC (ref. Lee, W.H.). AC-H-NUC is a human o-adenovirus containing the H-NUC tumor suppressor gene below the r-caller of the human CVM promoter. ACN is the same recombinant human and ii. b, y in Kun * without H-NUC tumor suppressor gene.

Picture. 12 shows that AC-H-NUC suppresses the growth of T-47D tumor b. ók ii viwo. 1-470 (deleted for H-NUC) and MDA-MB-231 (herozygous for íLJ) of breast cancer cells were plated and treated with AC-H-NUC or /. multiplicities of 10 and 100. The cells were grown for 5 days. and for measuring the degree p _; ; b; H-thymidine incorporated into nucleic acids should be taken. Data for. l L ·. > jjjjj as the percentage of the average proliferation of the ACN control.

.. · · .ze ~. 13 shows that AC-H-NUC suppresses T-47D tumor growth in patients and patients. Γ-4 / D human breast cancer cells were treated ex-vivo with li. . . 1, ZoneUC at an infectious multiplicity of 30. Approximately 10 ⁷ cells per s .; ; · .Nijikovalg. into the flank of mice, each injected with ACN o 0 _; ml and αC-HN UC treated cells (one flank each). Measured w οι ί ka. The tumor volumes for ACN and AC-H-NUC cells are plotted. Mean tumor volumes from untreated cells are given p. sí \ .vuaiii.

The description of the invention describes a novel mammalian protein designated H-NUC. H-NUC with {. -2y amino acids (FIG. 3) and has a molecular weight of about 95 kD and i <. z, ar.-vaccination with non-phosphorylated retinoblastoma protein (RB). l · IÁ Anv.ay inap. truncated versions of the protein containing the last 6 TPR c. ·. · .. ··· · ·. mricopeptides. The 34-amino acid repeat) in the C-terminal region (i.e., the 559 version of the 559 site instead of 770) binds to the wild-type Rb-protein. Mutation in ρ>. · Em. leads to inability to bind to retinobiastoma protein, contributes to the hyperproliferative activity that is characteristic of Rb negative banks. eg, breast cancer cells.

The H-NUC protein is a human protein and can thus be isolated and purified from human molecules. A purified protein or nucleic acid is termed a nein or a nucleic acid not containing other proteins or other molecules associated with or occurring with H- NUC protein or DNA for native H-NUC. The term "native" refers to the form of a DNA, β-in, polspeptide, antibody, or fragment that is isolated in the natural state of something that contains no deliberate change in the amino acid composition, e.g., substitution, deletion or addition. Purification of 95 kD H-NUC proteins from SDS gels can be accomplished by a variety of methods, e.g., wherein the H-NUC-depleting cell extract is precipitated by an anti-H-NUC antibody (described in detail below) and k. .iipiex. The pro-antibody is separated from the other components by SDS gel electrophoresis from the gels of Fischer et al., Techniques in Protein Chemistry, eu. '\E. Hugu. Acedemic Press, Inc., 36-41 (1989).

Leia and hyperproliferating cells denote (but are not limited to) buvuu kHiée characterized by the ability of autonomous growth, i.e., existence and growth independently of normal regulatory mechanisms. Peripheral diseases can be divided into pathological, i.e., evolving from, normal diseases. they are characterized by pathological symptoms and non-pathological symptoms, i.e. which do not produce symptoms of the disease. Pathological hyperproliferating cells are congenital for the following diseases: thyroid hyperplasia (Graves' disease), psoriasis, benign prostate hypertrophy, Li-Fraumeni syndrome, the hand breast. sarcomas and other neoplasms, bladder cancer, intestines, ρ ;; various leukemias and lymphomas. Examples of non-pathologic cells are cells that are found in the mammary glands of the virus virus. ..ce as well as cells involved in wound healing. Pathological b;? (> I for Ji Hici cells usually show a loss of contact inhibition and lose selective adherence with the p-axis, suggesting changes in the surface properties of b..r-όκ and impaired intercellular communication. These changes also include with teachers The ability to secrete proteolytic enzymes Renewal of the cytoplasm of h-NUC by introduction of a protein or nucleic acid encoding

The cell can revert the cells to a non-proliferating state and stop the malignant irrigation.

The term "protein" refers to a linear polymer of amino acids linked by a peptide bond. The term "amino acid" refers to either the D or L t. • .. • ^m: _s Zor ierickou form amino acids (unless otherwise specifically indicated). J-: derivatives refer to substances derived from the linear sequence of the original protein r: polypeptide but which additionally have an amino acid change in their sequence (Gtdeue, iuserce) such that the H-NUC of the derivative retains the original

L.íggidio activity. Biological activity means the ability to bind to the recombinant retinoblastoma protein p110 ^RB . The H-NUC binding ability is derived from p &lt; 3 &gt; C if, for example, highly conserved glycine (amino acid 640) is derived from α-α-paragic acid. These H-NUC derivatives can be distinguished from P.0: 1. by deletions, insertions, or substitutions of one or more and, for similar amino acids, e.g., similarly charged amino acids, by modification of side chains or functional groups.

Zi.a.ao that only limited modifications can be introduced into the primary and. of: v. z .-. vUC without destroying its biological function and that only a small fraction of the complete The structure is required for carrying out biological activities (e.g., the binding of p / de-nucleic acid encoding p10 ^RB is published in Lee, W., et al., Science 235.1394-1399 (1989). NUC is a DNA binding ability, and DNA binding ability can be determined by methods disclosed in Lee, et al., Nature, London 329: 642-645 (1987). H-NUC derivative is a protein containing the last 6 TPR c or C-terminal region and a Gal4-C49 fusion protein The Gal4-C49 derivative has a targeting sequence in Figure 3 from amino acid position 559 to the end of the sequence.

in, 3; The TPR containing derivative has the sequence indicated in Figure 3 from a ·; τ. ·,> - sé. m-nx-positions 559 to 770. The sequence fragments of FIG. 3, wherein z: a | n. xim protein functions are also included in the definition of H-NUC derivatives.

The derivatives could be formed by cleavage of the nucleic acid by restriction in the combination expression of the resulting fragments. Minority modifications

When the fluorescence sequence results in a substantially equivalent or z. ¹ . and; These modifications are compared to the sequence shown in FIG

1c cc may be intentional, such as targeted mutagenesis, or may be random due to. These are mutations in the host organism that produces H-NUC. TJ of all the modifications involved retains H-NUC biological activity. Fragments or mutant forms of H-NUC that inhibit the normal function of a protein in a dominantly negative manner, thereby abolishing its biological role and causing cell division and / or proliferation, are referred to as inhibitory active. These proteins or fragments can be formed by well-known chemical methods by the action of various substances. Mutant proteins and fragments are used therapeutically to induce hyperproliferation and to generate diagnostic agents such as antibodies.

You do it. The compounds are used to promote or inhibit the growth or proliferation of cells by contacting them in vitro and in vivo according to the method below. The present invention also provides a method of inhibiting the growth or proliferation of cells, e.g., breast cancer cells, a method of treating a pathological condition characterized by hypeproliferative cell growth (breast cancer) by administering these agents at an effective concentration capable of inhibiting proliferation to a suitable object. Suitable objects for this method are vertebrates in general, including primates and human patients.

The invention provides pharmaceutical compositions comprising any of the ingredients described above and one or more suitable pharmaceutical carriers. Pharmaceutically acceptable carriers are, for example, physiological buffered saline solutions or certain solvents or vehicles such as glycerol, glycol, vegetable oil (eg olive oil) and injectable organic esters. A pharmaceutically acceptable carrier is used to administer H-NUC or derivatives thereof to cells in vitro or an in vivo object.

The pharmaceutically acceptable carrier comprises a physiologically acceptable component that functions, e.g., to maintain the stability of the protein or polypeptide, or to increase or decrease the absorption of the agent. For example, carbohydrates (eg glucose, dextrans), antioxidants (eg ascorbic acid, glutathione), chelating agents, low molecular weight proteins or other stabilizers may be used. In addition, other physiologically acceptable components (humectants, emulsifying and dispersing agents, preservatives which are particularly useful for inhibiting the growth and action of microorganisms) are included. For example, they use phenol and ascorbic acid as preservatives. The choice of a pharmaceutically acceptable carrier and other ingredients will depend upon the prescribed route of administration of the polypeptide and its specific physicochemical properties. E.g. aluminum monosterate or gelatin prolongs the absorption time of the pharmaceutical composition into the object. Other examples of carriers, stabilizing and adjuvant agents are given in Martin, Remingtons. Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton, 1975). The pharmaceutical composition can, if desired, be incorporated into liposome vesicles, microspheres, or other polymer matrices (Gregoriadis, Liposome Technology, Vol. 1 (CRC Press, Boca Raton, Florida 1984). Liposomes, which consist of phospholipids or other types lipids are non-toxic, physiologically acceptable and metabolizable carriers, relatively easy to prepare and administer.

Purified H-NUC (protein) or H-NUC (nucleic acid) as pharmaceutical compositions can be used to inhibit the growth of cancer cells by contacting the cells with purified H-NUC or an active fragment or composition comprising these polypeptides or proteins.

This contact could be ensured in vitro, ex vivo or in vivo. When cells are inhibited in vitro, contact is accomplished by mixing the composition comprising the nucleic acid or protein of the invention with cell culture and adding the composition to the medium. Methods for determining the effective amount of the composition are known.

The method is also useful for treating or preventing pathological conditions characterized by abnormally proliferating cells in an object in vivo. In this case, an effective amount of an agent for inhibiting proliferation is administered directly to the subject (in the case of the present invention a vertebrate in general, eg, mammals, human patients). This method is particularly useful for treating or preventing breast cancer in patients with non-functional H-NUC protein production.

Administration may be oral, intravenous, intramuscular, or intraperitoneal. It may proceed continuously or at regular or irregular intervals and may vary according to the type of object as well as the type of recombinant proteins (Landmann et al., J. Interferon Res., 12 (2): 10311 (1992); Aulitzky et al. Eur., Cancer, 2 (6): 462-467 (1991); Lantz et al., Cytokine 2 (6): 402-406 (1990); Supersaxo et al., Pharm. Res., 5 (8): 472-476 (1988), Demetri et al, J. Clin Oncol 7 (10): 1545-1553 (1989); LeMaistre et al., Lancet 337: 1124-1125 (1991)).

The invention provides isolated nucleic acids that encode an amino acid sequence corresponding to purified mammalian H-NUC protein, H-NUC derivatives, H-NUC mutant forms, active fragments, and an anti-H-NUC antibody. The term "nucleic acids" as used herein means a single- or double-stranded DNA, cDNA or mRNA molecule. The nucleic acid sequence encoding the H-NUC protein or fragments thereof is shown in Figure 3. Nucleic acid molecules that hybridize under stringent conditions to the DNA molecule shown in Fig. 3 are disclosed. Hybridizing molecules or probes were prepared, for example, by shifting a stealth break in the nucleic acid molecule, and the resulting hybridizing molecules were random fragments of the parent molecule shown in Figs. 3. Methodology for the preparation of these fragments is provided by Sambrook et al., Miolecular Cloning: A Laboratory Manual of Cold Spring Harbor Press, Cold Sprig Harbor, NY. (1989). Fragments of at least 10 nucleotides in length can be used as hybridization probes. Isolated nucleic acid fragments can also be used to generate new peptides. These peptides can be used as immunogens to generate polyclonal and monoclonal antibodies.

The nucleic acid is also useful for inhibiting cell division and proliferation. The nucleic acid is introduced into the cells, the cells are cultured under conditions that allow the production of the H-NUC protein at an effective concentration to inhibit cell growth. The nucleic acid can be delivered by liposome vesicles, in a lipidized state, or by other gene carriers such as viral vectors (Sambrook et al.). Preferably, the method is applicable to breast cancer cells having mutant H-NUC protein production.

In recent years, the treatment of human diseases by gene transfer has shifted from theory to practice. As a first case in human therapy, there has been described the transmission of the adenosine deaminase (ADA) gene to the lymphocytes of a patient suffering from a lethal damage to that gene which resulted in severe immunodeficiency (September 1990). The results were highly encouraging and prompted further clinical trials (Culver, K.W., Anderson, W.F., Blaese, R.M., Hum. Gene. Ther., 1991 2: 107).

The most gene transfer ever performed in human patients is based on a retroviral transformation system. Retroviral vectors are retro viruses from which all viral genes have been removed or altered so that they cannot be produced in infected cells. The replication ability of the virus is ensured by the "packaging" cells that produce all the viral proteins without forming infectious viral particles. The introduction of retroviral vectors into "packaging" cells results in the production of virions that carry the vector in the form of RNA and can infect target cells, but at the same time there is no further spread of the virus after infection. To distinguish the process of natural infection, where replication and further spread of the virus occur, the term transduction rather than infection is used.

A system capable of delivering DNA delivery to a cell is a replication incomplete retroviral vector. The term "retroviral" includes, but is not limited to, a vector or other delivery system capable of selectively selecting target cells and introducing nucleic acids into these dividing cells. The term "replication incomplete" is defined as the inability to produce the viral proteins necessary to propagate the vector in infected host cells.

An example of a replication incomplete retroviral vector is LNL6 (Miller, A., D., Et al., BioTechniques 7: 980-990 (1989)). Methods for using replication incomplete retroviral vectors are reported in Correll, P., H. PNAS USA 86: 8912 (1989), Bordignon, C., et al., PNAS USA 86: 8912-52 (1989), Culver, K. et al., PNAS USA 88: 3155 (1991), Rill, D. , R. et al., Blood 79: 2694-700 (1991). Clinical trials have shown that there were no or little adverse effects associated with the use of viral vectors (Anderson, Science 256: 808-13 (1992)).

The main advantages of retroviral gene therapy vectors are the high efficiency of gene transfer into replicating cells, the accurate integration of the transferred genes into cellular DNA, and the inability to further spread the virus after gene transduction (Miller, A., D., Nature, 1992, 357: 455-460 ).

The potential production of helper-replication competent helper during the production of retroviral vectors remains under consideration, although for practical purposes this problem has been solved. To date, all FDA-approved retroviral vectors have been generated using PA317 amphotrophic "enveloping" cells (Miller, A.D., Buttimore, C., Molec. Cell Biol. 1986 6: 2895-2902). The use of vectors having little or no overlapping region with the viral sequence of PA317 cells eliminates helper virus production (Lynch, C.M., Miller, A.D., J. Viral., 1991, 65: 38873890). Other cell packaging lines may be used, eg, cell lines derived for separating different retroviral coding regions into different plasmids should reduce helper virus production by recombination. The vectors produced by these cell lines also provide an efficient system for human gene therapy (Miller, A.D., 1992 Nature, 357: 455-460).

Non-retroviral electrons are also used in gene therapy. One alternative is adenovirus (Rosenfeld, MA et al., Proc. Natl. Acad. Sci. USA, 89: 6482-6884). The main advantage of adenoviral vectors is their ability to transmit large stretches of DNA (36 kb genome), high titer (10 ^µl / mL, ability to infect tissues in situ (especially pulmonary). To date, the most convincing example of such vectors is the introduction of the human transmembrane regulator cystic fibrosis (CFTR) intracheally into the respiratory tract of rats (Rosenfeld, MA, et al., Cell, 1991, 63: 143-155) Herpes viruses can also be used for human gene therapy (Wolfe, JH, et al., Nature) Genetics, 1-379-384).

Another method of gene transfer is the transfer of plasmid DNA in liposome vesicles directly to human cells in situ (Nabel, E.G., et al., Science, 1990, 249; 1285-1288). Plasmid DNA should readily obtain a certificate for use in human therapy because, unlike retroviral vectors, it can be purified to homogeneity. In addition to liposome-mediated transmission, there are other ways *

DNA transfer, e.g., binding of DNA to cellular receptors, when plasmid complexes with suitable proteins have previously been formed which are suitable for use in human gene therapy (Wu, GY, et al., J. Biol. Chem., 1991, 266) 14338-14342, Curiel, DT, et al., Proc. Natl. Acad. Sci. USA, 1991, 88: 8850-8854).

The H-NUC encoding gene can be inserted into known expression vectors (plasmid or viral) using known methods. The plasmid expression vector can be introduced into tumor cells by transfection in the presence of calcium phosphate, using liposomes (eg, LIPOFECTIN), transfection mediated by DEAE dextran, electroporation, and other methods suitable for DNA entry into the cell.

The viral expression vector may enter the target cell in a form capable of self-expression of infection or transduction. Retroviral, adenoviral and herpes and avipox virus-derived vectors are used. When H-NUC is expressed in any abnormally proliferating cell, the cell cycle stops, the cells age and die, resulting in a reduction in the amount of tissue abnormalities. A vector capable of introducing the gene construct into a target cell and capable of expressing HNUC in an amount suppressing cell proliferation can be administered by any effective means.

A physiologically acceptable solution containing an effective concentration of the active vector can be administered intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously, or by any other effective means. The vector may be directly injected into the target tumor tissue in an amount effective to treat the tumor cells of that tissue.

Alternatively, tumors occurring in the body cavities (eyes, gastrointestinal tract, genitourinal tract (eg bladder), pulmonary and bronchial system) can be treated with a physiologically acceptable composition (saline or phosphate buffer, suspension or emulsion that is sterile) comprising an effective concentration of the active vector by direct injection or catheterization into the affected organ. X-ray beams, sonography or a fiberooptical visualization system can be used to control precise intervention.

A physiologically acceptable solution containing an effective concentration of the active vector can be administered continuously into the bloodstream. This method is useful when tumors are not directly achievable or cannot be anatomically isolated.

Target tumor cells can be treated directly by introducing the H-NUC protein, eg, in liposome vesicles, which are suitable for delivering drugs, proteins and plasmid vectors in vitro and in vivo (Mannini, RJ, et al., Biotechiques, 1988, 6: 682 -690) to target cells (Newton, AC, Huestis, WH, Biochimica et Biophysica Acta, 1990, 1044: 269-274; Ceccoll, J., et al., Journal of Investigative Dermatology, 1989, 93: 190-194) . The H-NUC protein is encapsulated into liposome vesicles and introduced into mammalian cells with high efficiency.

The encapsulated H-NUC protein may be administered intraocularly, parenterally, intranasally, intratracheally, subcutaneously, etc. in an amount effective to treat abnormally proliferating cells in the target tissue. Liposomes can be administered in any physiologically acceptable composition comprising an effective concentration of the encapsulated H-NUC protein.

A variety of other types of vectors are suitable for introducing the nucleic acid encoding the H-NUC gene. The nucleic acid may be DNA, cDNA or RNA.

The isolated nucleic acid molecule described herein can be effectively inserted after a promoter directing RNA transcription. These molecules are suitable for the production of recombinant H-NUC protein or as vectors used in gene therapy.

The invention provides a vector comprising the inserted isolated nucleic acid molecule described above. Preferably cosmids, plasmid or viral vectors may be used. A number of suitable vectors are described in Sambrook et al., Supra and Zhu et al. Science, 261: 209-211 (1993). Upon insertion into a suitable host cell (prokaryotic or eukaryotic), recombinant H-NUC protein is produced. Mammalian, insect, yeast and bacterial cells (Sambrook et al, supra) can be used as suitable host cells.

The invention provides a method for producing recombinant H-NUC protein or derivatives thereof by growing host cells under suitable conditions for expression of the nucleic acid encoding H-NUC or fragments thereof. Suitable conditions can be determined using a variety of methods, see Sambrook et al., Supra.

The invention provides an antibody capable of complexing with the H-NUC protein or fragments thereof. The term "antibody" includes polyclonal and monoclonal antibodies herein. They are generally rat, mouse, rabbit or human antibodies.

The term "antibody or polyclonal antibody" refers to a protein that is produced in response to immunization with an antigen or receptor. The term "monoclonal antibody" refers to an immunoglobulin derived from a single cell clone. All monoclonal antibodies derived from a single clone are chemically and structurally identical and specific for a single antigenic determinant.

Laboratory methods describing the preparation of monoclonal and polyclonal antibodies are found, for example, in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1989). Monoclonal antibodies can be biologically produced by introducing H-NUC or fragments thereof into an organism, eg, a rabbit or mouse. Antibody-producing cells in the body are isolated and fused to myeloma or heteromyeloma cells to produce monoclonal antibody-producing hybridomas. The invention discloses a hybridoma producing the monoclonal antibody used herein.

The invention provides biologically active fragments of the polyclonal and monoclonal antibodies listed above. These "antibody fragments" retain some ability to selectively bind to an antigen or immunogen. These antibody fragments include:

1) Fab, a fragment that contains a monovalent antigen-binding fragment of the original antibody molecule obtained by enzymatic digestion (using the papain enzyme) to form the intact light and part of one heavy chain of the antibody molecule,

2) Fab ', an antibody fragment obtained by treatment with pepsin and subsequent reduction to produce an intact light chain and part of the heavy chain; two Fab fragments are obtained per antibody molecule,

3) (Fab>) 2, a fragment obtained by treatment with pepsin without subsequent reduction, Fib '2) is a dimer of two Fab' linked by two disulfide bonds,

4) Fv, a gene engineered fragment that contains the light chain variable region and the heavy chain variable region expressed as two chains,

5) SCA, a genetically engineered molecule that comprises a light chain variable region and a heavy chain variable region linked by a suitable polypeptide linker to a single fused molecule.

Methods for generating fragments are disclosed, for example, in Harlow and Lane, supra. Specific examples of a "biologically active antibody fragment" include CDR regions of antibodies.

The invention provides anti-idiotypic peptides specifically reacting with antibodies or biologically active fragments thereof. The term "anti-idiotypic peptides" refers to purified antibodies from one species that are injected into an evolutionarily distant species and are recognized here as foreign and elicit a strong humoral immune response (Harlow and Lane, supra).

Proteins or polypeptides that have been produced by the recombinant pathway are biochemically or chemically synthesized or chemically modified so as to retain their ability to bind H-NUC or fragments thereof. The ability to bind antigen or immunogen is determined by antigen binding assays (Harlow and Lane, supra).

An antibody or nucleic acid is coupled to a detectable agent that allows the H-NUc protein or fragments thereof to be detected in a sample using standard immunochemical techniques (eg, immunohistochemistry), see Harlow and Lane, supra, Principles and Practice of Immunoassays, eds. C.J. Price and D.J. Newman, Stockton Press, New York, (1991).

The antibody administered can bind to H-NUC and alter its function in the cell. The antibody is administered at an effective concentration such that H-NUC function is recoverable. The antibody can also be used therapeutically to inhibit cell growth by binding to H-NUC, thereby losing its ability to bind to retinoblastoma protein. The antibody binds to H-NUC and causes it to fold into an active configuration.

The antibodies and nucleic acid molecules disclosed herein can be used to detect and determine the presence or absence of an H-NUC protein, or alternatively, an altered H-NUC gene in a cell or sample taken from a patient. In this way, breast cancer or increased sensitivity to its occurrence can be diagnosed.

The aforementioned proteins, polypeptides, nucleic acids and fragments can be used for the preparation of drugs suitable for therapy.

The invention will now be described in greater detail by means of the following examples. These examples are illustrative only and are not to be construed as limiting the invention.

DETAILED DESCRIPTION OF THE INVENTION

Experimental methods and results

Using the yeast two-hybrid system, 25 clones were isolated that interacted with the C-terminal region of RB (p56-RB). One such clone is clone C49 (Durfee et al. Gene Devel, 7: 555-569 (1993)). The C-terminal region of the RB protein has two non-touching domains necessary for binding of oncoproteins from different tumor DNA viruses and a region involved in DNA binding activity. One of the RB-associated proteins has a primary structure and biochemical properties similar to the nuc2 S.pombe protein and the bimA protein of the genus Aspergillus. Mutations of these two genes in lower eukaryotes cause cell cycle arrest in metaphase, suggesting an important role of these proteins in mitosis. These proteins contain a repetitive amino acid motif (34 amino acids), referred to as the TRP motif. The function of these repeats is unknown, but is likely to form amlxpathic alpha-helices that could drive protein interactions. The protein described herein is the first human TRP protein to be isolated and characterized.

Testing of cDNA libraries and sequence analysis

To isolate the total length of the H-NUC cDNA, the 1.5 kb BglII fragment of C-49, prepared by Durfee et al., Was labeled with the stealth discontinuity method and used to test the human fibroblast cDNA library by plaque hybridization. The cDNA inserts were cloned into the EcoRI site of the pBSK + vector (Stragene, San Diego, CA) to facilitate DNA sequencing. Sequencing was performed using dideoxy-NTP and Sequenase 2.0 according to the manufacturer's specification (Biochemicals). DNASTAR software (DNASTAR, Inc, Madison, WI) was used for sequence analysis and homology search.

Construction of GST fusion proteins, protein preparation and its binding in vitro

To construct GST-491, plasmid C-49 was digested with BglII and the resulting 1.3 kb fragment was cloned into the BamHI site of pGEX-3X (Pnarmacia, Piscataway, N.J.). GST-T was prepared by digestion with HindIII, the resulting ends blunt-ended with a Klenow fragment and a fragment of length

The 823 bp was subcloned into pGEX-3X into the SmaI site. Expression of the GST fusion protein in E. coli (Smith and Johnson, Gene, 67: 31-40 (1988)) was induced with 0.1 mM IPTG. Cells were centrifuged and the pellet was resuspended in Lysis 250 buffer (250 mM NaCl, 5 mM EDTA, 50 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 8pm leupeptin, 8 pm antipain) . After adding 4 mg of lysozyme and incubating for 30 min at 4 ° C, the cells were lysed by sonication. The coarse residues were removed by centrifugation and the supernatant added to the glutathione-bound sepharose beads.

For in vitro binding activity assays, extracts prepared from 2x10 ⁶ 2E3 cells (Chen et al., 1992, infra) were incubated with sepharose beads containing 2-3 µg of GST or GST fusion protein in Lysis 150 buffer (50 mM Tris (pH) 7.4), 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 50 mM NaF, 1 mM PMSF, 1 µg leupeptin per ml, 1 µg antipain per ml, for 30 minutes at room temperature. The complexes were washed extensively in Lysis 150 buffer and, after boiling in loading buffer, separated by SDS-PAGE by electrophoresis. Gels were transferred to nitrocellulose membranes and incubated with anti-RB monoclonal antibody 11D7 after blotting. As a secondary, an alkaline phosphatase-linked antibody was used that visualized the bound RB protein (BCIP, NBT, Promega, Madison, WI) in the presence of 5-bromo-4-chloro-3-indolylphosphate (toluidine salt) and tetrazolium blue.

Antibody formation and protein identification

Anti-H-NUC antibodies were prepared according to Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988). 100 µg of the GST-491 fusion protein was used to immunize mice. The collected serum was directly used for immunoprecipitation experiments. Approximately 10 ⁷ cells from each cell line were metabolically labeled with ( ³ ° S) -methionine and subsequently lysed in chilled Lysis 150 buffer. The purified lysate was incubated with various antibodies at 4 ° C for 1 hour, then Sepharose-bound protein A was added and incubated for an additional 30 minutes at the same temperature. After washing with lysis buffer and boiling in SDS sample buffer, immunoprecipitates were separated by SDS electrophoresis. In the case of double immunoprecipitations, the resulting immunocomplexes were boiled in 200 μΐ dissociation buffer I (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% SDS, 5 mM DDT) to denature the proteins. The denatured proteins were dissolved in 200 μΐ dissociation buffer II (20 mM Tris-Cl, pH 7.4, 50 mM NaCl, 1% NP-40, 1% Na-oxycholate) and immunoprecipitated again with the antibody.

Cell fractionation

The method for separating membrane, nuclear and cytoplasmic fractions is adapted according to Lee, H.W., Nature, (1987). All three fractions were tested for the presence of RB and H-NUC proteins by immunoprecipitation and an aliquot from each fraction was incubated with glutathione sepharose beads to verify its composition.

DNA binding assay

1χ10 ^ζ K526 cells (human chronic myelogenous leukemia (ATCC)) were labeled with ³ ° S-methionine and lysed in Lysis 250 buffer. Lysates were clarified by centrifugation and dissolved in two volumes of loading buffer (10 mM KH 2 PO 4, pH 6.2, 1 mM MgCl 2, 0.5% NP40, 1 mM DTT, 10% glycerol). The dissolved extracts were loaded onto the column containing DNA-linked cellulose (calf thymus DNA, Pharmacia, Piscataway, NJ). Incubation was continued for 1 hour at 4 ° C with gentle shaking. The column was washed with 5 volumes of loading buffer and eluted with the same buffer containing a further increasing concentration of NaCl. Individual fr actions were analyzed by immunoprecipitation with either anti-RB antibody or antiH-NUC antibody according to the procedure described above. Aliquots from each fraction were incubated with glutathione beads to verify the presence of glutathione transferase.

Yeast H-NUC expression vector, deletion mutants

DNA fragments derived from H-NUC cDNA were subcloned into pSE1107 (Durfee et al., 1993). Clone 491 is an original clone isolated using a two-hybrid yeast system. H-NUC was constructed by inserting a 3.3 kb XhoI fragment into the modified pSE1107 to produce a fusion protein. The RV contains an N-terminal XhoI-EcoRV fragment. BR208, BR207, B5 and B6 are partial products after cleavage

Sau3A. The Gal4 fusion protein derived from these constructs comprises the amino acid sequences: 1-824 for H-NUC, 559-824 for 491, -1-663 for RV, 699-824 for BR2-8, 797-824 for BR2-7, 559- 769 for B5, 597-796 for B6. A temperature-sensitive mutant was generated by inserting a Nsil fragment from H-NUC with the primers attached. The primers are as follows:

Primer 1:

TGGTATGACCTAGGAATGATTTATTACAAGCAAGAAAAATTCAGCCTTGCAGAA

ATGCÁ

Primer 2:

TTTCTGCAAGGCTGAATTTTTCTTGCTTGTAATAAATCATTCCTGGTCATACCA

TGCA

All constructs were verified by DNA sequence analysis.

Yeast transformation and quantification of β-galactosidase activity

Yeast transformation was performed by the LiOAC method described above (Durfee et al., 1993, supra). After transformation, cells were plated on tryptophan and leucine-free synthetic medium dishes. This medium ensured selection for the presence of plasmids. After 2-3 days growth at 30 ° C, individual colonies from each transformation were inoculated into a suitable selection medium and grown to an OD goo of 1.0-1.2. Cells were further processed according to Guarente, L., Methods Enzymol., 101: 181-191 (1983). Quantification was performed with chlorophenyl-O-galactopyranoside (CPRG, Boehringer Mannheim) according to Durfee, 1993, supra.

H-NUC binds to a non-phosphorylated RB protein in a region similar to the SV40 T-antigen binding domain

The engineered deletion mutations of the RB protein, originally used to describe the Binding domain, were subcloned into plasmids containing the Gal4 DNA binding domain, pAS1 (Durfee, 1993, supra). Two of these DNA constructs, an expression plasmid containing the Gal4-activation domain-C-49 fusion protein and YI pPT10 (indicating plasmid containing beta-galactosidase), were used to co-transform the yeast strain Y153 (Durfee, 1993, supra). The expression level of RB fusion proteins was determined by Western blot analysis according to Sambrook et al., Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989). The expression level did not differ more than 2-3 times. The resulting transformants were tested for beta-galactosidase activity as described above. As shown in Figure 1, binding of the C-49 fusion protein to Gal-4RB diminishes in many of the same mutations in the RB protein, including a point mutation that confers Cys 706 to Phe and that eliminates SV 40 T-antigen binding. There is one exception, C-49 is unable to bind Ssp mutants that lack the 160 amino acid C-terminal region of the RB protein, although T-antigen binding persists, albeit with less affinity. The M1 deletion (amino acids 612-632) that affects the linker region between two binding domains is the only mutation whose product is capable of binding both H-NUC and T-antigen. Thus, it is clear that similar but not identical regions are required for the binding of Tancigen and C-49.

Further, the ability of the C-49 fusion protein to bind to p10 ^RB in vitro was tested. The amino acid sequence of p110 ^RB is shown in Lee, WH, Science 235: lo94-1399 (1987). The 1.3 kb cDNA clone (Fig. 3) was expressed as a glutathione S-transferase (GST) fusion protein in E. coli (Smith and Johnson, Gene 67: 31-40 <1988). Glutathione beads containing the same amount of GST-C-49 protein and two controls, GST alone and GST-T-antigen (Figure 2) were incubated with total cell extract from human retinoblastoma cell lines (WERI RB27) in which the RB gene was reconstituted (Chen et al., Cell Growth Differ. 3: 119-125 (1992)). Under standard conditions, these WERI (RB +) cells expressed different RB protein isoforms that represented different phosphorylated states (see Figure 2B, lane 2). After washing, bound proteins were analyzed by SDSFAGE and Western blotting according to Sambrook, supra. The blot was screened with anti-RB antibody 11D7 (Shan et al., Mol. Cell. Biol., 12: 5620-5631 (1992)). Under these conditions, H-NUC was able to bind only to the non-phosphorylated form of p10 ^RB with an affinity similar to GST-T, which served as a positive control. GST alone does not bind any RB protein (see Figure 1A, lanes 2-4). These results show that the HNUC protein is able to complex only with the non-phosphorylated, native and complete RB protein.

Total cDNA and its sequence

In order to characterize the novel protein thoroughly, a 1.3 kb cDNA clone was used as a probe to test the human fibroblast cDNA library. Of the 12 isolated clones, the longest 3.3 kb cDNA clone was completely sequenced. The open reading frame encodes a protein of 824 amino acids (Fig. 3). The protein has 35% homology to two known proteins, nuc2 S.pombe and bimA Aspergillus nidulans. Proteins of both of these lower eukaryotes are involved in mitosis; in temperature-sensitive mutations in these genes, cells stop at metaphase. Nuc2 and bimA contain ten 34 amino acid repeat sequences arranged such that one repeat is located in the N-terminal portion of the molecule and the remaining nine in the C-terminal portion (see Figure 4). A similar repetitive arrangement was found for the novel protein associated with the RB protein. If only nine repeat regions are compared, the sequence identity is 60% (Fig. 4B). However, the sequences between the first and second repeats of nuc2 and bimA have very low homology. This low homology is also characteristic of proteins from clone C-49. According to this sequence homology, it is likely that the isolated clone is a human homolog of yeast nuc2 and bimA from Aspergillus nidulans. Therefore, this protein was designated as H-NUC. .

The C-terminal repeat sequences of the H-NUC protein bind to the RB protein

The H-NUC protein contains neither the known L-X-C-X-E motif by which Tantigen and adenovirus E1A bind to RB, nor the 18 amino acid sequence of EF2, which is also important for RB protein binding. These findings suggest that the H-NUC protein uses a different motif for RB protein binding. To facilitate locating and defining this binding motif, a series of deletion mutants were constructed, each containing a different region of the H-NUC cDNA and expressing the Gal4-fusion protein (see Figure 5). A yeast two-hybrid system was used to determine the region of the protein that contains the binding motif (Durfee, 1993, supra). The whole protein and the original clone (containing 6 repeat sequences) bind the RB protein equally well. However, the N-terminal region that contains the first repeat sequence lacks the ability to bind. Deletion mutants derived from different portions of the original clone also fail to bind the RB protein. These data suggest that H-NUC can bind to RB in a novel manner, perhaps a larger region with a specific secondary structure.

Replacement of Gly 640 for Asp produces an H-NUC temperature-sensitive mutant that has a lower RB binding ability at non-permissive temperature

To confirm the physiological significance of the binding of H-NUC to the RB protein, a mutant H-NUC protein was constructed with a single point mutation that caused a Gly 640 exchange for Asp. A similar change in Igly 504 to Asp) in nuc2 is responsible for the temperature-sensitive phenotype that stops the cell cycle progression in metaphase in S. pombe (Hirano, TY, Hiaoka and M. Yanagida, J. Cell Biol. 106: 1171-1183 (1988) )). Gly is conserved in H-NUC, as well as in its yeast homologue, it would be possible to test whether a mutation which replaced Gly with Asp would cause defects in binding to the RB protein at a non-permissive temperature. According to Fig. 6, the HNUC protein with the Gly 604 mutation at non-permissive temperature (37 ° C) is unable to bind, but at the permissive temperature (22 ° C) this ability is restored. These data show the relationship between the temperature-sensitive phenotype of the presumed cell cycle progression in metaphase and the ability to bind RB protein.

Preparation of anti-H-NUC antibody and identification of H-NUC protein An anti-H-NUC antibody was prepared to identify H-NUC protein in protein gels and Western blots. GST-C-49 was expressed in E. coli (Smith and Johnson, 1988, supra, Shan et al, 1992, supra), purified using gl utathion beads and used as an antigen that induced an antibody response in mice. The serum contained a polyclonal anti-H-NUC antibody. The erythroleukemic cell line (K562) was metabolically labeled with ^3S S-methionine and used to prepare cell lysates. These lysates were immunoprecipitated with a polyclonal antibody. As can be seen in Fig. 6A, a specific protein of 95 kD molecular weight (lane 2) was precipitated by the immune serum, with no similar response with the pre-immune serum. The 95 kD protein was also identified when a GST-fusion protein was used, but not in the case of GST alone. However, the parent antigen is capable of competing with endogenous cellular proteins and the 95 kD protein passage becomes unidentifiable (lanes 3 and 4). The specificity of the antibody was further confirmed when the first immunoprecipitates were subjected to denaturation and subsequent re-immunoprecipitation. As shown in Fig. 6B, the 95 kD protein is the only detectable protein band and the background is clear. All immunological evidence suggests that the 95 kD protein is the product of the H-NUC gene.

The H-NUC protein has DNA binding activity

Approximately 1x10 ⁷ cells labeled with ³⁵ S-methionine were lysed in Lysis 250 buffer (250 mM NaCl, 5 mM methionine, 50 mM Tris (pH 8.0), 0.1% NP40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 8 ng / ml leupeptin, 8 μΐ / ml antipain). The lysates were clarified by centrifugation and diluted with two volumes of loading buffer (10 mM KH 2 PO 4, pH 6.2, 1 mM MgCl 2, 0.5% NP40, 1 mM DTT, 10% glycerol). Diluted lysates were loaded onto a DNA-loaded cellulose column (veal thymus DNA, Pharmacia, Poscantawas, NJ) and incubated for 1 hour at 4 ° C with gentle shaking. The column was then washed with 5 volumes of loading buffer and eluted with the same solution with increasing NaCl concentration.

Fractionation of each eluted sample was analyzed by immunoprecipitation with antibody to retinoblastoma protein (11D7, Figure 7A), against H-NUC (oor. 7B) or glutathione (GST) beads (Figure 7C). Aliquots from each well were also incubated with GST beads to detect glutathione transferase. The RB protein has DNA binding activity and serves as a positive control. The H-NUC protein has similar DNA binding activity, whereas glutathione transferase alone did not show any similar activity. Sequence homology analysis suggests that the DNA binding region of the H-NUC protein lies outside the TRP region.

H-NUC lies on chromosome 17q21-22

In situ hybridization with the ³ H-labeled probe (3.3 kb H-NUC cDNA) on human chromosomes showed specific labeling of the q21-22 region on chromosome 17 (Fig. 9a, 320 positive signals were evaluated on 150 cells, of which 42 and 13, respectively). 1) found chromosome 17 in the region q21-22. Since part of the probe used contains sequences homologous to its pseudogenes, multiple hybridizations to the short arms of the acrocentric nucleosomes were detected in each cell tested. These results were not analyzed. Similar results were obtained by hybridization of somatic cells, where H-NUC was also localized to the chromosome

17. The localization of H-NUC is interesting because the known breast cancer gene was *

mapped to the same area.

Tumor suppressor activity of H-NUC

Tumor suppressor activity of H-NUC was tested both in vitro in cell culture conditions and in animal models (mice). The following cell lines were used: MDA-MB-231, which contains one functional allele of H-NUC, and T-47D, which is a homozygous mutant at the H-NUC locus.

The effect of H-NUC on the proliferation of the above cell lines was tested by expression of H-NUC using an adenoviral expression vector. ACN is a control adenoviral vector that does not contain a cDNA insert, AC-H-NUC is an adenoviral vector expressing H-NUC under the control of the human CMV promoter.

Aaenovirus vector containing H-NUC

To construct an adenoviral expression vector, it was necessary to amplify a fragment (2520 bp) comprising total H-NUC cDNA by PCR from Quick Clone d with placental cDNA (Clontech). The primers used for amplification added a ηρη I restriction site to the 5 'end of the fragment and an Xho I restriction site to the 3' end. These restriction sites allowed direct cloning into the multiple cloning site of plasmids pBluescript II KS + (5 primers).

5CGCGGTACCATGACGGTGCTGCAGGAA3 ', 3 primer

ATCGGCTCGAGCAGAAGTTAAAATTCATC3 '). PCR cycles were run as follows: 1 cycle 94 ° C 1 minute, 30 cycles 94 ° C 1 minute, 53 ° C 11.5 minutes, 72 ° C 2 minutes, 1 cycle 72 ° C 7 minutes. The clones were tested for their ability to produce KD protein in the TIIT reticulocyte lysis system (Promega). The T3 promoter in the Bluescript vector allowed transcription and translation of the H-NUC coding sequence in rabbit reticulocytes. 1 mg minilyzate DNA was added per reticulocyte reaction and incubated for 1 hour at 30 ° C. To the 10 μΐ reaction mixture, loading buffer was added and the sample was loaded onto a 10% polyacrylamide gel (Novex) and separated at 165V for 1.5 hours. The gel was dried, the film was applied and exposed overnight. Four complete protein clones were sequenced. The H-NUC insert was excised from the vector by Κρη I and Hind II and subcloned into the Kpn I-Bgl II site of the plasmid vector pAdCMV (Bgl II forms blunt ends). All 4 clones contained some mutations, therefore the correct wild-type sequence was generated by ligating fragments from two clones.

To construct a recombinant adenovirus, the above plasmid was linearized with Nru I and cotransfected with a large fragment of Cla I cleaved dl309 mutants (Jones and Shenk, Cell 17: 683-689 (1979) using the CaPC> 4 transfection system (Stratagene)). and recombinant forms were identified by both digestion analysis and PCR using primers against the H-NUC cDNA sequence. The recombinant virus was further purified and titrated by standard methods (Graham and van der Erb, Virology, 52: 456-457 (1973), Graham and Prevec, manipulation of adenovirus vectors In: Methods in Molecular Biology Vol. 7, GeneTransfer and Expression Protocols, Murray EJ, (ed.) The Humana Press, Inc., Clifton NJ, 7: 109-128 (1991)).

To determine whether the H-NUC vector above expresses a protein of the appropriate size, T-49 cells were infected with either a control or recombinant adenoviral vector at an interval of 24 hours with increasing infection rate (MOI, plaque forming unit / cell number). The cells were washed once in PBS and lysed in lysis buffer (50 mM tris-HCl, pH 7.5, 250 mA NaCl, 0.1% NP40, 50 mM NaF, 5 mM EDTA, 10 pg / ml aprotinin, 10 μΐ (g leupeptin, 1 mM PMSF). Cell proteins were resolved by SDS-PAGE by electrophoresis and transferred to a nitrocellulose membrane. Membranes were incubated with anti-HNUC antibody and then with sheep anti-mouse IgG conjugated with horseradish peroxidase. H-NUC protein expression was visualized by chemiluminescence (ECL kit, Amersham) on Kodak XAR-5 film.

1ti vitro

Breast tumor cells of MDA-MB-231 and T-47D lines were seeded at approximately 1x10 ⁶ cells per 100 mm dish in Kaighn F12 / DME medium (Irvine Scientific) supplemented with 10% FBS and 0.2 IU insulin (Sigma). for T-47D cells. The plates were incubated for 24 hours at 37 ° C in 7% CO 2. The following day, cells were overlaid with 10 ml of 1 leaf medium and infected with either ACN control virus lysate (MOI 10) or ACH-H-NUC virus lysate (MOI 10) and incubated at 37 ° C. After three days, the medium was removed and the cells were fixed with a 1: 5 oesic acid / methanol solution. Cells were stained with 20% methanol / 0.5% crystal violet for 30 minutes and then washed with water to remove excess dye.

Infection of T-47D cells with ACN-H-NUC resulted in inhibition of the growth of these cells caused by expression of the H-NUC protein. Direct observation of crystal violet stained ACN-H-NUC infected T-47D cells showed a decreasing p./count of cells (approximately 50%) compared to control cells infected with ACN. There was also a change in the morphology of T-47D cells. Cells became more condensed and lost their growth characteristics. No such changes occurred when the cells were infected with ACN. Heterozygous cells of MDA-MB-231 showed no obvious effect on either ACN or ACN-H-NUC infection in vitro.

Furthermore, thymidine incorporation was used to estimate the effect of H-NUC on cell proliferation. Approximately 3x10 ³ MDA-MB-231 and T-47D cells were plated per well in 96-well plates (Costar) and incubated for 24 hours at 3.1% in 7% CO ₂ . The ACN or ACN-H-NUC dilution series was prepared in DME: F12 / 15% ΓC1 / 1% glutamine and cells were infected with a multiplicity of 10 and 100 infection (4 wells at each MOI). Half of the volume of the medium was changed 24 hours after infection and every 48 hours until the end of incubation. 18 hours before the end of incubation, 1pC ³ H-thymidine (Amersham) was added to each well. 5 days after infection, cells were captured on glass filters and ³ H-thymidine incorporated into nucleic acids was detected by liquid scintillation (TopCount, Packard Instruments). The degree of cell proliferation (cpm / well) was expressed as a percentage of the average proliferation of untreated control cells.

The results obtained suggest that proliferation of both MDA-MB-231 cells and non-heterozygous for H-NUC) was similar after infection with both ACN and ACN-H-NUC (Fig. 12). However, in T-47D cells (H-NUC deletion), there was a specific response to ACN-H-NUC infection, which increased with increasing MOI. These data show the antiparasitic effect induced by ade newspaper vector mediated H-NUC gene transfer into mutant H-NUC cells.

Ex vivo gene therapy

In order to determine the effect of H-NUC expression on tumorigenicity, the above tumor cell lines were tested for their ability to form tumors in a model organism (mouse). Approximately 2x10 ⁷ T-47D cells were treated with sucrose buffer containing ACN or ACN-H-NUC at an MOI of 3 or 30. After about 12 hours of infection, 10 'cells were injected subcutaneously into the left and right flanks of BALB / c mice previously received subcutaneously pellets of 17β-estradiol. One flank was injected with ACN-treated flasks, the other with ACN-H-NUC-treated cells; each organism thus served as its own control. Animals receiving bilaterally untreated cells served as an additional control for tumor growth. Tumor dimensions (length, width, height) and weight were measured twice a week. Tumor volume was estimated using spherical geometry with a radius corresponding to one-half the diameter of the measured tumor sizes.

The results of this experiment are shown in Figure 13 and suggest a significant tumor growth rate in cells expressing H-NUC. 21 days after cell inoculation tumors were measured for all ^seven živočichů.Tumory arising from cells treated with AC-H-NUC (MOI = 30? Were smaller than the tumors from cells treated with ACN (MOI = 30> in 4 cases of 4 Average tumor size for ACN-H-NUC (MOI = 30 treated cells remained smaller compared to ACN (MOI = 30) treated cells for 21 days period (see Fig. 3). These data further confirm the tumor suppressor activity of the H-NUC protein presented in the present invention.

In Vivo tumor suppression of H-NUC

T-47D human breast cancer cells were injected subcutaneously into female BALB / c mice. Tumors developed for 32 days. Then, either the ACN adenoviral vector (as a control) or the ACN-H-NUC adenoviral vector (containing the H-NUC gene) was injected into the peritumoral space surrounding the tumor. Tumors were then harvested either on the second or seventh day after the adenoviral infection and poly-A + RNA was isolated from each tumor. The rCR reaction with reverse transcriptase (RT-PCR) was used to detect H-NUC RNA in treated tumors using H-NUC specific pdmer. As an RT-PCR control, amplification with actin primers served, a plasmid containing the recombinant H-NUC sequence provided a positive control of the position of the recombinant H-NUC band.

• X ·

In a separate experiment, T-47D cells are injected subcutaneously into the right flank of mice and the tumors are allowed to grow for two weeks. Mice receive p mitumoral injections of buffer or recombinant virus twice a week for a total of 8 doses. Tumor growth is monitored in control organisms that only received ACN and buffer and in organisms that received ACN-H-NUC. Further, their body weight and survival are monitored.

Expression of Exogenous H-NUC in T-47D Breast Cancer Cells

Cancer cells of the T-47D line, which contain no endogenous H-NUC fats by homozygous mutation, provide clear control for the functional study of H-NUC. Ί-4 / D cells infect at a comparable titer with either ACN-H-NUC or a control ACN vector. Most colonies develop individually into tissue culture.

Infected cells are metabolically labeled with ³⁵ S-methionine and used to prepare lysates to assess the amount of protein produced. ACN-H-NUC infected cultures are compared to control cells for morphology, growth rate (ie, doubling time), saturation density, agar colony formation, and tumorigenicity.

Industrial applicability

The invention provides diagnostic methods using a nucleic acid encoding an H-NUC protein and an H-NUC protein. The present invention relates to the administration of a Q-type H-NUC tumor suppressor gene or protein capable of suppressing, destroying or reversing a neoplastic phenotype in cancer cells that do not themselves produce the H-NUC protein. The invention provides vectors encoding the HXt ^T C protein and H-NUC proteins that can be used in the treatment of cancer and methods for preparing the H-NUC protein and vectors suitable for such use.

- 3b Sequence jr Data ^: Applicant: Lee, Wen-Hwa

Chen, Phang-Lang ii) Title of the invention: New tumor suppressor gene iii) Number of sequences: 35 t · Mailing address:

Also address: Campbell and Flores

Ej Street: 4370 La Jolla Village Drive, Suit 700

Ci City: San Diego

Di state: California

£) country: USA

Fi code: 92122 vi computer unit

And the media: floppy disk Ei computer: IBM PC

Ci operating system: PC-DOS / MS-DOS

Di software: PatentIn Release 41.0, version # 1.25 in; current application data

A. Application No .: US 94/14813 E Date of performance: 20.12. 1994 C h revaluation · in: i! previous application details

AND; Application Number: US 08 / 170,586 iii Date of performance: 20.12. 1992 also a representative

A) Name: Campbell, Cathryn A.

B) Registration number: 31,815 ix) Phone: (619) 535-9001 Fax: (619, 535-89 2> SEQ ID No: 1:

(i) sequence characteristics:

A.Length: 3320 bp E, type: nucleic acid (A strands: double-stranded l), topology: linear ii) molecular type: cDNA iii) other characteristics:

location: 101 .... 2572 iv. .-.- May: SEQ ID No _: L cgcaattcg: ggccgcgttt aaatgagctg gggctggccg ggccggagcc gctacagggg ι (V

GGGCCTGAGG CACTGCAGAA AGTGGGCCTG AGCCTCGAGG ATG Met

GAA CCC Glu Pro

GTC CAG GCT ATA TGG Val Gin Ala Ala Ile Trp

CAA GCA Gin Ala

CTA AAC Leu Asn

ACG GTG Thr Val

CAC

KL3 *

Γγ

CTG CAG Leu Glr.

GCT

Ala

CGA GAT GCG GTT TTC CTC GCA GAA CGC CTT TAT GCA GAA GTA CAC <T> <· » 211 Arg Asp Ala wall Phe Leu Ala Glu Arg Leu Tyr Ala Glu Wall His Ser 25 30 35 GAA GAA GCC TTG TTT TTA CTG GCA ACC TGT TAT TRAY CGC TCA GGA AAG 2 of? Glu Glu Ala Leu Phe Leu Leu Aiá. Thr Cys Tyr Tyr A-rg Ser Gly Lys 40 45 50 GCA MELT AAA GCA MELT AGA CTC TTG AAA GGA CAC AGT TGT ACT ACA CCC 207 ' Ala Tyr Lys Ala Tyr Arg Leu Leu Lys Gly His Ser Cys Thr Thr ? rc 55 60 65 CAA TGC AAA TRAY CTG CTT GCA AAA TGT TGT GTT GAT CTC AGC AAG cc? -22 Gin cys Lys Tyr Leu Leu Ala Lys Cys Cys Val Asp Leu ser Lys Lč'- 70 75 20 May • 2 GCA GAA GGG GAA CAA ATC TTA GGT GGA GTG TTT AA.T AA.G CAG AAA ί U 2 Ala Glu Gly Glu Gin Ile Leu Ser Gly Gly Val Phe Asn Lys Gin Lv s 90 95 100 ALIGN! AGC CAT GAT GAT ATT GTT ACT GAG TTT GGT GAT TCA GCT TGC TTT AC - τ 2. Ser His Asp Asd Ile Wall Thr GiU Phe Gly Asp Ser Ala cys Phe Tr.r 105 110 115 CTT TCA TTG TTG GGA CAT GTjx MELT TGC AAG ACA GAT CGG CTT GCC 2 5 5 Leu Ser Leu Leu Gly His wall Tvr cys Lys Thr Asp Arg Leu Ala Lys 120 12 5 130 GGA TCA GAA TGT TRAY CAA AAG AGC CTT AGT TTA AAT CCT TTC CTC OF .· Gly Ser Glu Cys Tyr Gin Lys Ser Leu Ser Leu A3n For Phe Leu Trr 135 140 145 TCT CCC TTT GAA TCA TTA TGT GAA ATA GGT GAA AAG CCA GAT CCT GAC 555 Ser For Phe Glu Ser Leu Cys C-lu Ile Gly Glu Lys For Asp For Asr 150 155 ISO 5 CAA ACA TTT AAA TTC ACA TCT TTA CAG AAC TTT AGC AAC TGT CTG CCC í i 2 Gin Thr Phe Lys Phe Thr ser Leu Gin Asn Phe Ser Asn Cys Leu ? rr 170 175 180 AAC TCT TGC ACA ACA CAA GTA CCT AAT CAT AGT TTA TCT CAC AGA CAC 5 5 1 Asn ser Cys Thr Thr Gin Wall ? ro Asn His ser Leu ser His Aurg Glr. 185 190 195 CCT GAG ACA GTT CTT ACG GAA ACA CCC CAG G .-. C ACA ATT GAA TTA AA. C '2 5 For Glu Thr Wall Leu Thr Glu Ttir For Glr. Asp Thr Ile Glu Leu Aer. 200 *> - * C 210 AGA TTG AAT TTA GAA TCT TCC AAT TCA AAG TAC TCC TTG AAT ACA GAC 7 2 Arg Leu Asn Leu Glu Ser Ser Asn Ser Lys Tyr Ser Leu A.s n Thr A.s r 215 220 225 TCC TCA GTG TCT MELT ATT GAT TCA GCT GTA ATT TCA CCT GAT ACT GC 2 2 2: Ser Ser Wall Ser Tyr Ile Asp Sec Ala Val; _e ser For A. 5 n Thr 230 235 ;O CCA CTG GGA ACA GGA ACT TCC AND. TTA TCT AAA CAG GTT C.AA. AAT 2 21 For Leu Gly- Tt * Gly Thr ser 2 1 · Lou Ser Lys Gin Wall Gin Asn C ‘. J

253 255 '260

- 3 · / -

AAA ACT GGT CGA Arg AGT TTA Ser Leu TTA Leu GGA GGA CCA GCA Ala GCT Ala CTT 275 AGT Ser CCA ? 73 931 For Lys Thr Gly Gly 270 Gly For TTA ACC CCA AGT TTT GGG ATT TTG CCA TTA GAA ACC CCA rvGT CCT O-CA 979 Leu Thr For Ser 230 Phe Gly Ile Leu 235 For Leu GlU Thr For 290 Set For cly GAT GGA TCC TAT TTA CAA AAC TRAY ACT AAT ACA CCT CCT GTA. ATT r. i 1027 Asp Gly 295 Ser Tyr Leu Gin Asn 300 Tyr Thr As π Thr For 305 For Wall Ile Ar? GTG CCA TCC ACC GGA GCC CCT TCA AAA AAG TCT GTT GCC A.GA ATC C-OT 1075 Wall 310 For Ser Thr Gly Ala Pro 315 Ser Lys Lys ser 320 Wall Ala Arg Ile C-1 v J „j CAA ACT GGA ACA AAG TCT GTC TTC TCA CAG AGT GGA AAT AGC CGA. r. ”J 1123 Gin Thr Gly Thr Lys 330 Ser Val Phe Ser Gin 335 Ser Gly Asn ser Arg 340 - - - GTA ACT CCA ATT CTT GCA CAA ACA CAA AGT TCT GGT CCA CAA ACA ACT 1171 Wall Thr For Ile 345 Leu Ala Gin Thr Gin 350 Ser ser Gly For Gin 355 Thr - - - ACA ACA CCT CAG GTA TTG AGC ccc ACT ATT ACA TCT ccc CCA. AAC GCA 1219 Thr Thr For Gin 363 Wall Leu Ser For 3 6 5 Thr Ile Thr Ser For 370 Prc As n Al2 CTG CCT CGA AGA AGT TCA CGA CTC TTT ACT AGT GAC AGC TCC ACA ACC 1267 Leu For 375 Ar g Ser Ser Arg 380 Leu Phe Thr ser Asp 385 Ser Ser Thr AAG GAG AAT AGC AAA AAA. TTA AAA ATG AA.G CCA CCT AAA. ATC CCA 1315 Lys 390 Glu Asn ser Lys Lvs Leu Lys Met Lys Phe 400 For For Lys Ile 425 AAC AGA AAA ACA AAA A.GT AAA ACT AAT AAA GGA GGA ATA ACT CAA CCT 1363 Asn Arg Lys Thr Lys 410 Ser Lys Thr Asn Lys 415 c-iy Gly Ile Thr Gin 420 - - ^w AAC ATA AAT GAT AGC CTG GAA ATT ACA AAA TTG GAC TCT TCC ATC ACT 1411 Asn Ile Asn Asp 425 Ser Leu Glu Ile Thr 430 Lys Leu Asp Ser Ser 435 Ile TCA GAA GGG AAA ATA TCC ACA ATC ACA CCT CAG ATT CAG GCC TTT AND--. AND 1459 ser Glu Glv Lys Ile Ser Thr Ile 445 Thr For Tin Ile Gin 450 Ala Phe / *. 2 Γ. CTA CAA AAA. GCA GCA GCA GAA GGT TTG ATG AGC CTT CTT CGT GAA A. - - 1507 Leu Gin 455 Lys Ala Ala Ala Glu 460 Gly Leu Met ser Leu 465 Leu Arg Glu Ur - GGG AAA GGT TAT TTA GCT TTG TGT TCA TRAY AAC TGC AAA G / \ rt GCT ACA. 1555 Gly 470 Lys Gly Tyr Leu Ala Leu Cys ser Tyr Asn 430 Cys Lys Glu Ala i 2 AAT ATT TTG AGC CAT CTA CCT TCT CAC CAC TRAY AAT ACT GGT TGG GCA 1502 Asn Ile Leu Ser His 490 Leu pro ser His His 495 Tyr Asn Thr Gly Trp 5 00 - r, - CTG TGC CAA ATT GGA A.řXC GCC ΤΛΤ TTT GAA ctt TCA UnG TRAY ATG CAA 16 51 Leu CV3 Gin Ile Gly Ar g Ala Tyr Phe 510 Glu Leu ser Glu Tyr 5 * · c ~ GCT GAA AGA ATA TTC TCA GAG GTT AGA AGG ATT o AG AAT MELT GCC 16 91- Ala Glu Ar o Ile 523 Phe ser Glu Wall 525. AX Arg ile Glu Asn 5 30 Tyr AT c

2? 7

GAA Glu GGC Gly 535 ATG Met GAG Glu ATC Ile TRAY Tyr TCT Ser 540 ACA ACA CTT Leu TGG Trp CAT Kis 545 GTT Leu CAA Gin AAA Lys GAT Asp 1747 Thr Thr GTT GCT CTT TCA GTT CTG TCA AAA GAC TTA ACA GAC rtib GAT AAA AAT 1795 Wall Ala Leu Ser Wall Leu Ser Lys Asp Leu Thr ASC Me t Asp Lys Asn 550 555 560 565 TCG CCA GAG GCC TGG TGT GCT GCA GGG AAC TGT AGT CTG CAA CGG 1343 Ser For Glu Ala Trp cys Ala Ala Gly Asn Cys Ger Leu Gin Arg 570 575 530 GAA CAT GAT ATT GCA ATT AAA TTC TTC CAG AGA GCT ATC CAA GTT GAT 1391 Glu HÍS Asp Ile Ala Ile Lys ?No Phe Gin Arg Ala tle Gin Wall AS p 535 590 595 CCA AAT TRAY GCT MELT GCC MELT ACT CTA TTA GGG CAT GAG TTT GTC TTA 1939 For Asn Tyr Ala Tyr Ala Tyr Thr Leu Leu Gly His Glu Phe Wall Leu 600 605 610 ACT GAA GAA TTG GAC AAA GCA TTA GCT TGT TTT? CGA AAT GCT ATC AGA 1987 Thr Glu Glu Leu Asp Lys Ala Leu Ala Cys Phe Are Α3Π Ala Ile Aurg 615 620 625 GTC AAT CCT AGA CAT MELT AAT GCA TGG MELT GGT TTA G' ATG ATT ^ AT 2035 wall Asn For Arg His Tyr Asn Ala Trp Tyr Gly Leu Gly Met Ile Tyr 630 635 640 '345 TRAY AAG CAA GAA AAA ITirT »£ AGC Qřprp GCA GAA ATG CAT TTC CAA AAA. CCG 2 0 2 3 Tyr Lys Gin GlU Lys Phe Ser Leu Ala Glu Met Eis ? re Gin Lys Ala 650 655 660 CTT GAT ATC AAC CCT CAA AGT TCA GTT TTA CTT TGC CAC ATT GGA GTA 2131 Leu Asp Ile Asn For Gin Ser Ser Wall Leu Leu Cys n i. S Ile Gly Wall 665 670 675 GTT CAA CAT GCA CTG AAA AAA TCA GAG AAG GCT TTG Q {\ λ ACC CTA AAC 2179 Wall Gin His Ala Leu Lys Lys Ser Glu Lys Ala Leu AS o Thr Leu Asn 680 635 690 AAA GCC ATT GTC ATT GAT CCC AAG AAC CCT CTA TGC AAA TTT CAC AGA 2227 Lys Ala Ile Wall Ile Asp for Lys Asn For Leu cys Lys Phe His Arg 695 700 705 GCC TCA GTT TTA TTT GCA AAT GAA AAA MELT AAG TCT GCT TTA CAA GAA 2275 Ala Ser Wall Leu Phe Ala Asn Glu Lys Tyr Lys Ser Ala Leu Gin Glu 710 715 720 725 CTT Gx ^ rt GAA TTG AAA CAA ATT GTT CCC AAA GAA TCC GTC GTT TRAY TTC 2322 Leu Glu Glu Leu Lys Gin Ile Wall For Lys Glu Ser Leu Wall Tyr Phe 730 735 740 TTA ATA GGA AAG GTT TRAY AAG AAG TTA GGT CAA ACG CAC CTC GCC CTG 2 371 Leu Ile Gly Lys wall Tyr Lys Lys Leu Gly Gin Thr “LS Leu Ala Leu 745 750 755 ATG AAT TTC TCT TGG GCT ATG GAT TTA GAT CCT AAA Gujfi GCC AAT AAC - · i r. Met Asn Phe Ser Trp Ala Me t Asp Leu Asp For Ly s Gly Ala Asn Asn 760 7 5 5 7 7 '] CAG ATT AAA GAG GCA ATT GAT AAG CGT MELT CTT CCA GAT GAT GAG uAG 2 4 5 6 Gin Ile Lys Glu Ala Ile ASO Lys Are Tyr Leu ? rc As p P3 p Glu Glu 775 7 30 7 3 5 CCA ATA ACC CAA GAA GAA CAG ATC ATG GGA ACA GAT CAA TCC CAG GAG 2 5 15 For Ile Thr Gin Glu Glu Gin τ Met Gly A5p Ger Gin Glu 790 795 300 3 35

2563

AGC AGC ATG ACA GAT GCG GAT Ser Ser Met Thr Aso Ala asd Asp

810

ACA CAA CTT GCA G 'Thr Gin Leu His Ala Ai

315

GAA AGT Glu Ser 320

GAT GAA TTT Asp Glu Phe

TAACTTCTGG AAATCAGACT TTTACAACTG GATGTGTGA3

2512

T * A G G G C G G C GTGTTTCTTG TCCCTCTGTA TACTGAGTCT TTACTCTTGA GCTGGCGGTG 2 5 72 TCATGGTCCG TCACTTATAC CATGAGTGTG CCACTTTCAT TGGACCCTGA CTGTATACAG 2732 AATGAAAGGC AGTGCAATAT TTAGCTGCTA ACAAGACTGG CTCTTTTACC AGTATGAATG 2792 ACAATTTATG GGGGGTAGGG TGGGGAACTT TCTTTTCTGT TTTTCTTTAA TCTCCCTTTG 2352 TTGGAAAGTA TCATGAAGGA AGAGTTATGC TTTATCTTGA AGGAACCATT AGATATGGAA 2912 AATAGTGATG AACCAGAGTT TCTTGGTTGC TTTTTCAAAA ATTTGTTTTT ATTTGGTTCT 2972 GTTCCAGATA AACAGAGTz- ^ i CTGACCTTCA TTTCTAGGTT CTTCAAGAAT GGTGTTTGCA 3032 AGTGCCAGAT GGAACAAT AA AAGACGTTGC CTATAACAGT GACTTGATTG CCAAGGAATG 3092 TAAATTACCT TAAACTTCGA. TGATCTCCCA TAAACAAATG TA-ATGGGCz * .T c .TGinGACTC 3152 GTATGTAGGA AT C AAATAT C CCTCCATACA GTGTACTCTT ATTCTTGGCA AGAATGCTTT 3212 AA - GTAT AA.C. CAAGAATTTT AATTTATTCA T CTTGCTTCA. AAGTGTTG / - .T CATTGTTGTC 3 2 7 2 TTGGTATTGC AAA T T T AAA A.TTGTTTCTT ACCAGCGGCC GCGAATTC 3320

i 'sequence characteristics:

A) length: 824 amino acids 3) type: amino acid chain C) topology: linear ii) molecular type: protein .ti, sequence: SEQ ID No ‘2:

u -EQ ID No: 1 ·

(i) sequence characteristics:

Ai length: 824 amino acids type: amino acid chain

C) topology: linear ii) molecular type: protein

Met .ti, sequence: SEQ ID No 2: Thr Wall Leu Gin 5 Glu For wall A 3 y. His Tyr Ala 20 May Tyr Arg Asp Ala Ala Glu wall 35 His Ser Glu Glu Ala 40 Tyr Arg 50 Ser Glv Lys A.la Tvr 55 Lys Ser ς 3 cys Thr 4 · » Prc ⁵ : ΐ Cys Lys Ar? Leu Ser Lys Leu 35 Ala Glu Gly ? r. β Asn Lys (j n 2 0 0 Lys S..r His As p Ser Aía Cys 115 ? r. * 2 Thr Leu Ser Leu 11 0

Git Ala Ala Ile p 15

Val Phe Leu Glu A Leu Tyr

Leu Leu Leu Ala Thr Cys Tyr

Ala Tvr Arg Leu Leu Lva Glv Kas 5 0

Tvr Leu Leu Ala Lys cs Cys Val 7 5 '3 0

Gl. Gin Ile Leu Ser. Gly Gly Val .90 '95

Aut Ile Val Thr Glu?:. <· Gly Aur 10 5 11)

ASD Asn -45 Arg 130 For Leu Phe Ala Leu Lys Trp Gly ser 150 ser 135 For Glu Phe Cys Glu Tyr Ser Gin Leu 155 Lys 140 Cys Ser Glu Ser Gly Leu Glu 150 Lys For Asp For ASD 165 Gin Thr Phe Lys Pne 170 Thr ser Leu Gin Asn 175 Phe Sar Asn cys Leu 130 For Asn ser Cys Thr 135 φ’π * · Gin Wall For A 3Γ. L 15 c - w • c - Leu Ser His 195 Arg Gin For Glu Thr 200 Wall Leu Thr Glu Thr 205 ? ΓΥ (j í u As? to. Thr Ile 210 Glu Leu Asn Arg Leu 215 Asn Leu Glu ser Ser 220 Asn Ser Lys Tyr ser 225 Leu Asn Thr Asp Ser 230 Ser Wall Ser Tyr Ile 235 Asp ser Ala. Wall Ile 240 Ser For Asp Thr Wall 245 For Leu Gly Thr Gly 250 Thr Ser Ile Leu 255 Lys Gin Wall Gin Asn Lys For Lys Thr Gly Arg Ser Leu Leu Gly . GI y For

250 25 5 27 '.

Ala Ala Leu 275 Ser For Leu Thr For 230 Ser Phe Gly Ile Leu 235 Breast Glu For 290 Ser For Gly As o C-ly 295 Ser Tvr Leu Gin Asn 300 Tyr Th r AG Γ. Thr For 225 For Wall Ile Asp Val Pro 310 Ser Thr Gly ’A - a 3 · 5 For Ser Lyu Ly 3 Ser 320 Wall Ala Arg Ile Gly 325 Gin Thr Gly Thr Lvs Ser 330 wall Phe ser G1 n Ser Gly Asn Ser Arg 340 Glu Val Thr For Ile 345 Leu Ala Gin Thr Gin 250 Ser Ser Gly For Gin 355 Thr Ser Thr Thr For 360 Gin Val Leu Ser For 365 Thr Le Thr Ser For 370 For Asn Ala Leu Pro 375 Arg λΓ g Ser Ser Arg 380 Leu Phe Thr Ser r.SO 235 Ser Ser Thr Thr Lys Glu Asn Ser Lys Lys 355 Leu Lys í <e r Lys Phe 3 00 For For Lys Ile For 405 As n Ar et al Lys Thr Lys Ser 410 Lys Thr L 3 and L5 Gly Gly Ile Thr Gin 420 For Asr. ile Asn Asp 42 5 Ser Leu GLu Ile 4 3 3 L y s Leu Asp Ser Ser 435 Ile Ile Ser Glu Gly 4 3 0 Lys Ile Ser Thr Ile 445 Tr. Γ ? ro Gin 2 le Gin 450 Ala Phe As n. Leu Gin Lys Ala Ala Ala Glu 460 Gly L «: at,. r ser Leu • i i 5 Leu Arg Glu Me C G1v Lys 47 9 Gly Tyr Leu Ala Leu Cys Tyr A 3 Γ. • 1 2 3

-é z ~

Cys Lys Glu Ala Ile Asn Ile Leu Ser His Leu For Se r ? Í 1 Σ H3 Tyr 435 490 495 Asn Thr Gly TCD Wall Leu Cys Gin T l <a Gly Arg Ala TV Z G lU Leu 500 505 Ser Glu Tvr Met Gin Ala Glu Arg τ Le Phe Ser Glu Wall AT S Arg Ile 515 520 525 Glu Asn Tyr Arg Wall Glu Gly Met Glu Ile Tyr Ser Thr Thr Leu Trp 530 535 540 His Leu Gin Lys Asp wall Ala Leu Ser Wall Leu Ser Lys A S Σ Leu 'nr 545 550 5 5 5 560 Asp Met Asp Lys Asn Ser For Glu Ala Trp Cys Ala Ala Gly Asn Cys 565 570 575 Phe Ser Leu Gin Arg Glu His Asp Ile Ala Ile Lys Phe Phe Gin Arg 530 535 551 But Ile Gin wall Asp For Asn Tyr Ala Tyr Ala Tvr Thr Le: Leu Gly 595 600 605 His Glu Phe Wall Leu Thr Glu Glu Leu Asp Lys Ala Leu A.l i You with Phe 610 615 520 Ar: Asn Ala 1 le Ar <3 Wall Asn For nX D His Tyr Asn Ala Trr. Tyr Glv 625 630 635 640 Leu Gly Hec * le Tyr Tyr Lys Gin GlC L '/ S ? he Ser Γ t ’ Tlu Met 645 650 6 55 His Phe Gin Lys Ala Leu Aso Ile Asn For Gin Ser Ser 7 'U. - Leu Leu 660 665 6 71 Cys His Ile Gly Wall Wall Gin His Ala Leu Lvs LV3 Ser G1 Lys Ala 675 630 625 Leu Asp Thr Leu Asn Lys Ala Ile Wall Ile Asp For Lys Asn For Leu 690 695 700 Cys Ly3 Phe His Arg Ala ser wall Leu Phe Ala Asn Glu Lvs Tvr Lys 705 710 715 720 Ssi Ala Leu Glr. Glu Leu Glu Glu Leu Lys Gin Z le Wall Breast Lys Glu 725 730 '35 Ser Leu Wall Tyr Phe Leu Ile Gly Lys Wall Tyr Lys Lys Leu Tly Gin 740 745 7 5 '. Thr His Leu Ala Leu Met Asn Phe Ser ? ro Ala Met Asd Le » asd For 755 760 765 Ly3 Gly Ala AS Π Asn Gin Ile LVS Glu Ala Ile A.S □ Lys A.rs Tvr Leu 770 775 790 Pro Aso Asp Glu Glu For Ile Thr Glr. Glu Glu Gin Wf. - - • ly Thr 735 .790 7 5 5 800 A3p Glu Ser ^! j «- Γ» Glu Ser Ser Met Asd Ala ASD Asn Trr 3 Ln Leu 305 5 10 5 15 his λΙη Ala Glu Ser Asp Glu Phe

Sequence and sequence characteristics:

Délka) length: 212 amino acids

11) type: amino acid chain C) topology: linear

iii molecular type: peptide <i i <equivalence: SEQ ID NO: 3: Leu 1 Thr Asp Met Asd 5 ‘ Lys Asn Ser For Glu 10 Ala Trp Cys Ala Ala 15 Dec Giy Asn Cys Phe ser 20 May Leu Gin Arg Glu His 25 Asp Xle Ala Ile Lvs 3 0 Phe Phe Gin Arg Ala 35 xle Gin Wall Asp For 40 Asn Tyr Ala Tyr Ala. 45 Tyr Thr Leu Leu Gly 50 His Giu Phe Wall Leu 55 Thr Glu Glu Leu Asp 60 Lys Ala Leu Ala Cys 65 Phe Arg AS Ω Ala Ile 70 Arg Wall Asn For Auro 75 ’ His Tvr AS ' Ala Trt 80 * Tyr Gly Leu Gly Met 35 Ile Tyr Tvr Lys Gin 90 Gxu V Ξ Pne □ 07 Leu 95 Ala Glu Met His Phe Gin Lys A.la Leu ASp 105 Xle Γ. ? TQ Gin Ser 110 ser wall Leu Leu Cys 115 His Ile Gly Wall Wall 120 Gin KÍS Ala Leu Lys 125 Lvs Ser Glu Lys Ala 130 Leu Asp Thr Leu Asn 135 LV3 Ala Xle wall Ile 140 Asp For Lys Asn For 145 Leu cys Lys Phe His 150 Arg Ala ser Wall Leu 155 Phe Ala Asn Glu Lys 160 Tyr Lys ser Ala Leu 165 Gin Glu Leu Glu Glu 170 Leu Lys Gin Ile Wall 175 For Lys Glu Ser Leu 130 Wall Tyr Phe Leu xle 195 Giy Lys wall Tvr Lys L 9 Q Lys Leu Gly Gin Thr 195 His Leu Ala Leu Met 200 Asn Phe Ser Trp Ala 205 Met Asp Leu

Asp Pro Lys Glv 210

SEQ. 4:

i 'flow characteristics

Λ) length: 34 amino acids .1) type of amino acid chain ´ 'i single-stranded chain l) i topology linear molecular thy peptide

-4 * 1 .ti) sequence: SEQ ID NO: 4:

Leu Leu Lys Leu Phe Gly Lys Gly Wall Tyr Leu Leu Ala Gin Tyr Lys 1 5 10 15 Dec Leu Arg Glu Ala Leu Asn Cys Phe Gin Ser Leu Pro lle Glu Gin Gin 20 May 25 30

Asn Thr

SEQ ID NO: 5:

Sequence characteristics:

A) length: 34 amino acids

3) type: amino acid chain

C) chains: single-stranded

D) topology: linear i; molecular type: peptide xi · sequence: SEQ ID No: 5:

Leu Leu Arg Glu Met Gly Lys Gly Tyr Leu Ala Leu Cvs Ser Tvr Asn 1 5 10 ‘15 Cys Lys Glu Ala lle Asn lle Leu Ser Kis Leu Pro Ser His His Tyr 20 May 25 30

Asn Thr

SEQ ID No: 7:

Sequence characteristics:

A) length: 34 amino acids 3) type: amino acid C, chains: single chain D) topology: linear u type: peptide: k sequence: SEQ ID No: 6:

Leu 1 Phe Phe Ly s lle 5 Ala Ser Gly Tyr Phe 10 Cys Leu Ser Arg Tyr Lys Cys Ser Asp Ala 20 May lle Gin lle Phe Ser 25 Ser Leu Ser Gin Gly Gin Arg

Glu Thr

SEQ ID No: 6:

; ί -.- Frequency characteristics:

In length. 34 amino acids 3) type: amino acid chain of O chain: single chain.)) Topology: linear li molecular type peptide x; sequence·. SEQ ID No: 6:

Wall 1 Lys Asp Met Glu 5 Wall Phe Ser Thr Ala IQ Leu Tr? His Leu Gin 15 Dec Lys ser Wall ? ro Leu 20 May Ser Tyr Leu Ais. His 25 Glu Thr Leu Clu Thr 30 Α3Π For

Tyr ser

SEQ ID No: 7:

i .'Άνβηόηί characteristics:

A) length: 34 amino acids 3) type: amino acid chain C) chains: single chain 3) topology: linear ii. molecular type: peptide, sequence: SEQ ID No: S:

Val Glu Met Glu Ile Ile Ser Th * Thr 10 Leu Trp Hus Leu Gin Lys 1 5 Asp Wall But. Leu Ser Val Leu Ser Lvs Asp Leu Thr Asn Met Asp Lys 2 3 2 5 '30

Asn Ser

SEQ 13 No: 9:

and; s-.Quickness characteristics:

A) length: 34 amino acids 31 type: amino acid aminokysel chain, single chain J) topology: linear u: molecular type: peptide sequence: SEQ ID No: 9:

Leu Glu Asp Met Glu Ile Tvr Ser Le Th Tru Leu Lvs Asn

5 10 15

Asp Glu Leu Ala Tyr Glu Leu His Glu Leu Met Asp Val Asp Are

25 '30

Leu Ser

SEQ ID NO: 10:

It has a scent characteristic.

¹ length: 04 amino acids

3> type: amino acid

A chain single stranded topology: dnearn: molecular molecule: peptide equivalence: SEQ ID No: 10 '

Glu 1 Tyr Al a Tyr ípu V- 5 Leu Glti Gly His Glu His Ser Ala 10 Asn Glu Glu Tyr Glu Ly3 Ser 20 May Lys Thr Ser Phe Arg Lys Ala Lle Arg Val Asn ý Λ Wall

Arg His

SEQ ID NO: 11:

i · Si.-Avenieni characteristics:

AND; length: 34 amino acids 3) type: amino acid chain

C) chains: single-stranded

D) topology: linear H molecular type: peptide xi-equivalence: SEQ ID No: 11:;

Ala Tyr Ala Tyr Thr Leu Glu His Glu Phe Val Leu Thr Glu '5 10 15

Le L Asp Ala Le L Ala Cys Phe Arg Asn Ala lle Are Val Asn Pro

- 25 'i:

Arg His

SEQ ID No: 12:

i i frequency response:

A) length: 34 amino acids 3) type: amino acid chain 1) chains: single chain D) topology: linear; molecular type: peptide

. <11; equivalence: SEQ ID No: 12: Ala Tyr Gly? He Thr Leu Gin Gly His Glu Tyr Val Ala Asn Glu 1 5 10 15 Dec Tyr Asp Lys Ala Leu Asn Ala Tyr Arg ser Gly lle Asr. Ala Asp Ser 20 May 25 j 3 Arg His

s 1. · K e n i c h e r h e r t th e rs \) length: 34 amino acids ι '. type of amino acid chain · single chain;

· Topology lineami

- Zy / ': molecule type: peptide / sequence: SEQ ID No: 13:

Ser 1 Wall Leu lle Thr 5 Cys lle Gly Met lle 10 Tyr Glu Arg Cys Lvs 15 Dec Asp Tyr Lys Lys Ala Leu Asp Phe Tyr ASQ Arg ALs. Cys Lys Leu Asp Glu 20 May 2 5 ' 30

Lys ser

SEQ ID No: 13:

:. sequence characteristics:

AND; length; 34 amino acids.

D type: amino acid chain • i chains. single chain t topology: linear: molecular type: peptide

- May: SEQ ID No: 14:

Ser 1. Wall Leu Leys Cys Kis Tle Gly Val val Cvs Kia Aia Leu Lys Lys 10 15 Dec Ser Glu Lys Ala Leu Asn Thr Leu Asr. Lys 25 Ala Tle Val lle Aso For

Lys Asn

SEQ ID NO; 15:

Sequence characteristics:

AND; length: 34 amino acids • i type: amino acid chain of the N chain. single-chain Ji topology: linear iii molecular type: peptide x: · sequence: SEQ ID No: 15:

Ala Wall Leu Tle cys Cys Tle Gly Leu wall Leu GLu Lys Met Asn Asn 1 5 10 15 Dec For Lys Ser Ala Leu I Le Gin Tyr A13 Ω Arg Aru Cvs Thr Leu Ala For 2 0 2 5 30

KI3 Ser

-h * '

SEQ ID NO: 16:

. Characteristic characteristics:

A) length: 66 amino acids 3) typ. amino acid chain 3) single stranded chain topology: linear. molecular type: peptide - equivalence: SEQ ID No 16:

Ala 1 Asn Wall His Phe Leu Leu Gly Lys Ile 10 Phe Lys Gin He * V2 ^g Lys lú in p Asn Leu Al and 20 Leu Lys His Phe Thr 25 Ile Ala Trp As n Leu 2 0 Asp Gly i-V 3 Xaa Ala 3 5 ' Thr His Ile Ile Lys 40 Glu Ser ile Glu Asn 4 i_.eu Asp 1 le For Glu 50 Glu A S Π L <sU Leu Thr 55 Glu Thr dy Glu I le 60 Tyr Are Asn Leu

Glu Thr

SEQ ID No: 17:

• - · <smell characteristics:

% length: 88 amino acids:>. type: amino acid chain of the chain: single chain topology: linear.

Ser Leu Wall / T »y y. Phe 5 Leu Ile Gly Lys Wall 10 Tyr Lys Lys Leu Giv Gin Thr His Leu Ala 20 May Leu He c Α3Π Phe Ser 25 Trp Ala Met Asp Leu Asd For Lys Gly Ala 35 Asn Asn Gin Ile Lys 40 Phe Ala Ile Asp Lys 4 5 Aru Tyr Leu ? rc Asp 50 Asp Glu Glu ' ° ro I Le 55 Thr Gin Glu Glu Gin 60 r Met Gly T5. r As ρ GlU Ser Gin Glu ser Ser Met T · íq »- Asp Ala 75 AS p Thr Gin Leu 2 0 Η1S Ala Ala Clu Ser Asp Glu Phe

5

2 'SLQ ID No: 17:

:: · ai-KVenza characteristics:

A, length: 5 amino acids 3i type: amino acid chain; chain: single-stranded topology: linear _; moleku Molecular Cyp: Peptide: i-kvenee: SEQ ID No: 18.

Ala 1 Asn Wall His Tyr 5 Leu. Leu Gly Lys Leu 10 Tyr Lys Met Leu Arg 15 Dec As p Lys Gly Asn Ala 20 May Ile Lys His Phe Thr 25 Thr Ala Leu Ann Leu 30 Asp For Lys Ala Ala 35 Gin Tyr Ile Lys Aso 40 ' Ala Met Glu Ala Leu 45 A 3 3 Asp ASO Glu Glu 50 Asp Glu Glu Asp Met 55 Ala

SEQ ID NO: 19:

: <-Feature characteristics:

A- dclka. 34 amino acids> type: amino acid chain

Řetězce .. 'j chains: single-stranded >> topology: linear: i: molecular type: peptide xi; . ~.; May: SEQ ID No: 19:

For 1 Phe Val Leu Ala 5 Lys Leu Gly Ile Thr Tyr Phe Glu Leu Wall 15 Dec Tyr Glu Lys Ser Glu Glu Wall Phe Gin Ly3 Leu Arg Asp Leu Ser 20 May 25 3C

Ser Arg

2-SEQ ID No: 20:

and; · Characteristic characteristics:

A) length: 34 amino acids iyp: amino acid chains:

chain: single-stranded topology: linear o, > l &quot; ball &quot; y type peptide: &gt;

Gly Trp Val Leu G3 Gin Ile Gly .Arg Ala Tyr? Hu Glu Leu Ser Gl 1 5 10 15

-S0 ~

Tyr Met Gin Ala Glu Arg lle Phe ser Glu val Arg Arg lle Glu Asn 20 25 30.

Tyr Arg · SEQ ID No: 22:

(i) frequency characteristics:

A) length: 34 amino acids type: amino acid chain

A i chains: single chain hive topology: linear dl molecular type: peptide ni) sequence: SEQ ID No: 21:

For 1 Trp Wall Leu Ala Gin lle Gly Arg Ala 10 Tyr Tyr Glu Gin Ala Met Tyr Thr Glu Ala 20 May Glu Lys Tyr Phe Wall 25 Arg Wall Lys Ala Met 20 May Ala Pro

Ser Arg

SEQ ID No: 23:

; Frequency characteristics:

A ¹ length: 34 amino acids 3; type: amino acid chain '; chains: single-stranded or topology: linear * molecular type: peptide ii sequence: SEQ ID No: 22:

For 1 Glu ser Trp Cys 5 Iie Leu Ai Art Asn Trp 10 Phe Ser Leu Gin Arg 15 Dec Glu His Ser Gin Ala 20 May Leu ty 3 Cys lle Asn 25 Arg Ala lle Gin Leu 20 May Asp For

Thr Phe oEQ 10

- performance characteristics:

v length: 34 amino acids type: amino acid chain ‘chain; single-stranded >> topology: linear lII molecular type: peptide xi).-equivalence: SEQ [D No: 23:

For Glu. Ala Trp Cys Ala Ala Gly Asn Cys Phe ser Leu Gin Arg Glu AND 5 10 15 Dec His Asp Ile Ala Ile Lys Phe Phe Gin Arg Ala Ile Gin Wall As p For 20 May 25 30

Asn Tyr

SEQ ID No: 25:

venční sequence characteristics:

A) length: 34 amino acids o) type: amino acid chain O chain: single chain D) topology: linear ii) molecular type: peptide xi) j-equivalence: SEQ ID No: 24:

For Glu Ala Trp Cys Ala Wall Gly Asn Ser Phe Ser His Glr. Arg 1 5 10 15 Dec His Asp Glr. Ala Leu Lys cys Phe Lys Arg Ala Thr Gin Leu .-. 3 p 20 May 25 30

His Phe

2. SEQ ID No: 26:

(i) sexual characteristics:

AND; length: 34 amino acids Si type: amino acid chain. chains: single chain D1 topology: linear ii) molecular i.yp: peptide xii sequence: SEQ ID No: 25:

E Tyr Asn Ala Trp Tyr Gly Leu Gly Met Wall Tyr Leu Lys Thr GLy 1 5 10 15 Dec Asn Asp Gin Ala Asp Phe His Phe Gin Arg Ala Ala Gíu Ile Asn 20 May 25 30

Asn Asn

2; SEQ ID Nc: 2 is:

'., _Λ ν ·.-Ηύηι ca.iraktenstiky:

'-. d ílka. 3, amino acids. ρ · aini .-. ý Acid chain. ·· .- "éi.c ·: y.-string-chain. · .Poios! · - linear .i. The peptide of '52 -ii · sokvonee: SEQ ID No: 26:

Tyr 1 Asn Ala Trp Tyr Gly 5 Leu Gly Phe ser Leu Ala 20 May Glu Met His Phe Gin Ser

Met Ile 10 Tyr Tyr Lys Gin Glu 15 Dec Lys Gin Lys Ala Leu Asp Ile Asn For

SEQ ID Nc 27:

II with <:. <·. ··. · ηςηί characteristics:

dc \ a: 3 amino acids r

type: aminoityseine chain L) chain: single chain. topology: linear ii i molecular type: peptide xi).

Tyr

Leu

Ser

Asn Ala Trp Tyr 5 Gly Leu Glv Thr Val Tyr Asp Lys M.et Gly Lys Asp Phe Ala Glu Gin His Phe Arg Asn But But i-ys Asie Prc 20 May 25 30

Asn

SEQ ID No 28:

:) Sequence characteristics:

A) Scale: 34 amino acids or type: amino acid chain · -> chains: single chain J) topology: linear ii) molecular type: peptide xi) sequences: SEQ ID No: 28:

Ser 1 Leu Ala A-rg Phe 5 Lys Lys Ala Lys Wall 10 Leu Ile Leu Leu His Asp His Asp Lys Ala 20 May Leu Wall Glu Leu Glu Gin Leu Lys Ala Ile Ala Pro 30

Asp Glu

2. SEQ ID NO: 29):

The amino acid is a 3-amino acid chain, i.e., an amino-chain. SEQ ID NO: 29:

For 1 Leu Cys Lys Phe 5 His Arg Ala Ser wall 10 Leu Phe Ala Asn Glu j.5 Ly Tyr Lys Ser Ala 20 May Leu Gin Glu Leu Glu 25 Glu Leu Lys Gin Ile 30 Wall ? r

Lys Glu

SEQ ID NO: 30:

(t) Frequency characteristics:

length: 34 amino acids, j> type: amino acid chain chain: single chain> - topology: linear

molecular type: peptide; i-equivalence: SEQ ID No: 30:

Val Leu Ala Are Phe 5 Arg Lys Ala Arg Ala Leu Met Lys Leu LQ Leu Lys Ser ALa Leu Thr Glu Leu Lys Val Leu Lys Asn Met 20 May 25 30

Asp Glu

2: SEQ ID NO: 31:

i.:; ·. ··. · ηόηί characteristics:

length: 27 amino acids 3, type: amino acid chain i chains: single chain Dz topology; linear ii molecular type: peptide: sequence: SEQ ID No: 31:

Phe Arg Lys Ala Ile

Gly Leu Gly Met Gly Arg 20 25

2 of SEQ ID No: 32:

.. read the yeast characteristics:

’·. length: 27 amino acids .. typ. amino acid chains of the chain: single chain topology: linear type of peptide: sequence: SEQ ID No: 32:

Phe Arg Asn Are Ile Arg val Asn For Arg H3 Tyr Asn Ala Trp Tyr 1 5 10 15 Dec Gly Leu Gly Met Ile Tyr Tyr Lys Gin Glu Lys 20 May 23

2i of SEQ ID No: 33:

Sequence characteristics:

AND? length: 27 amino acids her type: amino acid chain ·; chain: single-stranded .ji topology: linear ii ·· hi-type: peptide

- <b SEQ ID NO: 33: Phe Arg Asn Ala Ile Arg Wall Asn For Arg H3 Tyr Asn Ala Tro Tyr 1 5 10 15 Dec Asp Gly Met Ile Tyr Tyr Lys Gin Glu Lys 2 0 25

SEQ ID NO: 0: 34:

:. 5 · <·. · «Ηύηί characteristics:

length: 3320 cp .i · type: nucleic acid strands: double stranded) .i topology: linear iii n molecule type: cDNA ixi c different characteristics:

• name / code: CDS in position: 101 ... 2372 xii · equivalence: SEQ ID No: 34:

CGGAATTCGC GGCCGCGTTT AAATGAGCTG GGGCTGGCCG GGCCGGAGCC GCTACAGGGG 60

GGGCCTGAGG CACTGCAGAA AGTGGGCCTG AGCCTCGAGG ATG ACG Thr GTG Wall CTG Leu CAG Gin 5 115 Met 1 GAA CCC GTC CAG GCT GCT ATA TGG CAA GCA CTA AAC CAC MELT GCT TRAY 163 Glu Pro Val Gin Ala Ala Ile His Tyr Ala 20 May Tyr CGA GAT GCG GTT TTC CTC GCA GAA GTA CAC TCA 211 Arg Asp Ala Val Phe Leu Glu Wall 3 5 Hrs ser GAA GAA GCC TTG TTT TAT CTG GCA ACC TGT TAT TAC CGC TCA GGA r \ AG 259 Glu Glu Ala Leu Phe Leu Ala Thr Cys Tyr Tyr 40 45 Arg 50 Gly Lys GCA TAT AAA GCA TAT AGA CTC TTG TGT ACT AC A CCG 307 Ala Tyr Lys Ala Tvr Arg. Leu Leu Lys Glv His Ser 60 ‘65 Cys Th ^r Thr For

CAA TGC AAA TRAY .- • ΗΊ / · '· <- X U CTT GCA ruA_A TGT TGT GTT GAT CTC AGC 2 t G CTT 355 Gin Cys L · y p Ty r Leu Leu Ala Lys Cys cys Wall As p Γ p; 1 Ser In 2 Leu 70 75 8 0 85 GC A GAA i .-. G G.AA. C AA A.T C TTA rpQrn GGT GuA. GTG TTT AAT AAG CAG AAA. 4 0 3 Ala Glu Gly Glu G ^{! n} ile Leu S e r Gly Gly Wall p H .j í ^ s n l. y 3 G. n Lys 50 9 5 i o o AGC CAT GAT GAT ATT GTT ACT GAG TTT GA.T GCT TGC TTT ACT 451 Ser Kis AS 0 Asp lle Wall· Th r Gin Phe Gly As p Ser A .i. and u y 3 Pne T hr 1 S; 1 10 1.2 CTT TCA TTG . "C c - GTA. n AT TGC AAG ACA GAT CGG CTT C-CC ΑλΑ 495 Leu Ser Leu Just Gly HÍS Wall Tyr CVS Lys m c, T- As o Arg Leu 2. ’ Lys 120 125 130 GGA TCA GAA TGT TRAY CAA AA.G AGC CTT AGT TTA AAT CCT TTC CTC TGG '5 4 7 Gly Ser Glu CVS Tyr Gin Lys Ser Leu Ser Leu As n For Phe Leu Tm 135 140 145 TCT ccc TTT Gzxza TCA TTA TGT GAA ATA GGT GAA AAG CCA GAT CCT GAC 595 Ser For Phe Glu Ser Leu. Cys Giu ΐ le Gly Glu Lys For ASp ? 0 Asp 150 155 160 16 5

CAA Gin A.CA in Phe Lys 17 0 ACA rp U. v- TCT ser TTA Leu CAG Gin AAC Asn TTT Phe AGC Ser A \ C A.s n Cys CTC CCC Only.? Ro 5 4 3 AAC r-z — rp TGC - CAA GTA. CCT AAT CAT AGT TTA. TCT CAC AGA. CAG κ M ' Asn Ser c y s * ^? · - C-lr. Ve 1 For 19 0 r 1 S Ser Ser 19 5 Aru Gin CCT C-AG ACA AC <j GAA A.CA CCC C Λ u Gr.L A.CA. ATT GAA TTA AAC 739 ? ro Glu «U 200 '- - _eU i iLT Glu Thr 205 For Gin A.sp Thr lle 210 Glu Leu Asn AGA TTG AAT TTA. GAA TCT ^ CC AAT TCA AAG TRAY TCC TTG AAT - - »/ - · m νιΛί 737 AUT g Leu 215 Asn - ~ - Ser Ser 22 0 λ3 n Ser Lys Tyr Ser 225 Leu A 3 n Tnr Asp TCC TCA GTG TCT MELT ATT GAT TCA GCT GTA ATT TCA CCT GAT AGT GTC 335 Ser 230 Ser Wall C3 - - yc lle 235 Asp Ser Ala Wall lle 240 Ser For Asp Thr Val 245 CCA CTG GGA A. C A. AND ACT TCC ATA TTA AAA CA.G GTT CAA AA.T AAA 833 For Leu Gly ir·'. in- Gly 2 Thr Ser Tle Leu Ser -Ί ς ζ Lys Gin wall Glr. Asn Lys CCA λλΑ ACT GGT L- A. AGT TTA TTA GGz \ GGA CCA GCA GCT £ · rprp AGT CCA 931 For Lys T nr Gly? - - Purg Ser Leu Leu Gly 270 G ly for Ala Ala Leu 275 ser Pro TTA. ACC CCA r *. · j. TTT GvjG_j ATT TTG CCA TTA GAA ACC CCA AGT __T G \ jA. 9 7 5 Leu - * · * " For 2 3 C Ser τ> e Gly lle Leu 235 For Leu Glu rp U v- Dec 29 0 Ser s with Gly u AT GGA TCC MELT TTA CAA AA.C TRAY ACT AA 7 ACA CCT CCT GTA ATT GAT 10 2 7 As p Glv 295 Ser -; - -en Glu Asn 300 Tyr Th r A \ s n Thr Dec 3 0 5 For ^'R .1' lle Asp GTG CCA TCC A. C C CGA Gc C CCT TCA AAA AA G TCT GTT GCC AG A ATG GGC  e 7 - Val 3 ? ro Ser .... Ala. 3 ¹ 5 for uer r, .. y 3 g p r * 320 Wall Ala Purg lle G1y G25 CAA ACT GGA A. C A. AAG TCT GTG TTC TCA. CA.G AGT GGA AAT ^ GC .A bA'j 11 z s

G ¹ g!

Ser Val?

ser c

5 ~ 5 ~ 6 ~

ACT Thr GAA Glu 6 15 GAA TTG GAC A-AA. GCA TTA GCT ΤΓΤ ΦΦ'Τ ’ cys Phe CGA AAT GCT Ar o A. s n A. i a 625 ATC Ile AGA 1937 GTíl Leu Asp Lys Ala Leu Ala 620 -iTG AAT GCT AGA CAT TAT AAT GCA TGG TAT GGT TGA GGA ATG ATT MELT 2 0 3 5 And a 530 Asn For Arg Kis Tyr Asn Ala Trp Tyr Gly 6 4 0 Leu Gly Met ^x No. 4 0 TRAY AAG CAA GAA AAA. TTC AGC CTT GCA GAA ATG CAT TTC C. '·.' ·. AAA. GCC 2 0 3 3 - y - Lys Gin Glu uys Pne 6 50 Ser Leu Ala Glu Met 6 5 5 His Phe Gin Ly s 6 6 7 - - - - —-Τ «φ GAT ATC AAC CCT CAA AGT TCA. GTT TTA CTT TGC CAC ATT GGA. G-TA 2 131 Leu Asp Ile Asn 665 Prc Gin ser ser Val 670 Leu Leu Cys Piece ile 675 Gly “*” GTT CAA CAT GCA CTG-uiA AAA TCA GAG AAG GCT TTG GAT ACC CTA. AAC 2179 Wall· Gin Kis 680 Ala Leu Lys Lvs Ser Glu 634 Lys Ala Leu Asp Thr 690 Leu - ** - AAA. GCC ATT GTC ATT GAT CCC AAG AAC CCT CTA TGC AAA TTT CAC .-.sausage 2 2 2 7 Lys Ala 695 Ile Wall Ile Asp For Lys Asn 700 Pro Leu Cys Lys Phe His - ggc TCA GTT TTA TTT GCA AAT GAA AAA TAT AAG TCT GCT TTA CAA 5 AA 2 2 7 4 A l · a 7 LQ Ser Wall Leu Phe Ala Asn Glu Lys Tyr Lys 720 Ser A. ~ and Leu Gin - CTT GAA GAA. TTG AAA C AA ATT GTT CCC .-_-AND. G-A TCC CTC GTT TRAY TTC 2 32 3 - - v Glu Glu Leu Lys Gin 730 Tle val Pro Lys C-lu Ser Leu Val Tyr 74C “· * - TT A AT A. GGA AAG GTT TAC AAG AAG TTA. C-GT CAA ACG CAC CTC GCC CTG 2 i 1 Tle civ Lv 3,745 Val Tyr Lvs Lvs Leu 750 Gly C-ln Thr His Leu Ala Lea .ATG AAT TTC TCT TGG GCT ATG GAT TTA GAT CCT AAA. C-.-/-. GCC A_r \ T 2 7 29 y r. * 2 Asn Phe 7 0 0 Ser Trp n. _ A Bush. As of Leu 765 Asp Pro Lys Gly Ala 7 Asn • * * CAG ATT A-AA GAG GCA ATT GAT ^ rtG CGT TAT CTT CCA GAT GAT GAG í— * - J.-Vj 2 7 7 6 cTn Ile 775 Lys Glu Ala Ile Asn Lvs Arg 7 Tyr Leu For A.sn Asp 785 Glu - CCA ATA A.CC CAA GA / GAA CAG ATC ATG GGA ACA GAT GAA TCC CAG VJ A <7 2:13 Dec 7 90 Ile Thr Gin Glu Glu 796 Gin Ile Met Gly Thr 800 Asp Glu Ser Gin AGC AGC ATG ACA GAT GCG GAT GAC ACA CAA CTT CAT GCA GCT G.-v. AGT 2363 Ser Ser Ke t Thr Asp Ala 8 Asn Asn Thr Gin Leu His Ala Ala Glu 820 se:

TAACT ^by TG GATGTGTGAC

ACT TTTA.

GAT As □

GAA. TTT Glu Pne

TAGTGCTGA.C GTGTTTCTTC TCCCTC TGTA TACTGA.GTCT TTA.CTCTTGA GCTGC-CC-C 15 72 TCATCGTCCG TCACTTATA.C CA.TGA.C- ' TGTG CCACTTTCAT TGGACCCTGA CTGTATACAG i 7 2 AA.TGAAAGGC AkuTCCrAV. _ t \. TT AG and - *. ¹ GCTA AC AAG AC G G CTCTTTTACC ACTATIVAh - nj 2 9 2 A. C AA Τ Τ T A T G GGGGGTAGGG TGGGGA. ACTT TGTTTTGTGT TTTTCTTTA-A TCTCCCTTTG 2 5 5 2 TTGGAAAGTA. TCATGAAGGA / - \ lur \ G 4. G'_ TTTATCTTC-A AGG AAC C A Τ T AG AT AT ^; j · - · -J 1 AAT rvGTG A7G AACCAGA.GTT TCTTG-G -. jk. 1 i 4. 4. 4. C Avcn «, M rp 4-p '« -r <yr »ί ^- ' - '« Τ' / 11-1--71 ---- .ATTTGG. 7 - - ~ Ό

GTA Wall ACT Thr CCA For ATT CTT GCA. Ile Leu Ala 345 CAA Gin ACA Thr CAA AGT Gin Ser 350 TCT Ser GGT Gly CCA For CAA Gin 355 z \ CA. AGT Ser 1171 ACA ACA CCT CAG GTA TTG AGC CCC ACT ATT ACA T '' T CCC CCA. AA C GCA 1219 Thr Thr For Gin Vel Leu Ger For Thr 2Le Thr Ser Breast Pna 5 7. ALa 36 0 365 2 7 0 CTG CCT CGA AGA AGT TCA CGA CTG rprprr. · _ £ AGT GAC AGC ACA G 1257 Leu ? rc Arg Arg Ser ser Arg Leu Phe Thr Ser As? o e r Ser Thr Thr 2 7 5 330 335 AAG GAG AAT AGC ATT. AAA TTA AAA ATG AAG TTT CCA CCT AAA ATC CCA. L 2 L 5 Lys Glu As π Ser u v s y s Leu Lvs Ker Lvs Phe Pna ? rc Lys ”7 & Pl-r ·. 390 2 9 5 400 405 AAC AGA AAA ACA AAA AGT AAA ACT AAT AAA GGA GGA. ATA ACT C I CCT 1363 Asn Ar g Lvs Thr Lvs Ser Lvs Thr Asn Lvs Gly Glv 2 Le Thr Gin. For 4 10 415 4 2 G AAC AT A AAT GAT AGC CTG C-AA ATT ACA AAA TTG GAC TCT TCC ATC ATT 1411 Asn Ile Asn Asp Ser Leu Glu Ile Thr Lys Leu r.SO Ser Ser 21 e γ- 1 _ 425 430 435 TCA GAA GGG AAA ATA ICC ζ-.ν_Λ ATC ACA CCT CAG A.TT CAG GCC TTT A-AT L 4 5 2 Ser Glu Gly Lys Ile Ser Tur Ile Thr Pro Gin 2 L e Gin Ala ? 7. e AS 7. 440 445 450 CTA C AA AAA GCA GCA GCA G AA GGT TTG ATG AGC CTT CTT CGT GAG. ATG 15 0 7 Leu Gin Lvs Ala Ala Ala C-lu Glv Leu Her Ser Leu Leu Auru G Lu H.e T 455 450 46 5 GGG Ζ * «λΑ GGT TAT TTA GCT . - u TGT TCA TAC AAC TGC AAA GAA GCT ATA 1555 Gly Lys Gly Tyr Leu Ala Leu Cvs Ser Tvr Asn CVS Lys Glu ALa Ile 470 4 7 5 480 435 AAT ATT TTG AGC CAT CTA. rp ^ rp CAC CAC TRAY AA.T »/ -» m Z *. GGT TCG GTA. 1603 Asn Ile Leu Ser His Leu For Ser His H L Ξ Tyr A.S 7. Thr Gly 'T · - r- Wall 49 0 495 5 0 0 CTG TGC CAA ATT GGr c-cc MELT TTT GAA Qrprp GAG TRAY A. TG CAA L 5 5 1 Leu Cys Gin Ile Gly Ar Ala Tyr Phe Glu Leu Dream Glu Tvr Met Gin 505 510 515 GCT GAA AGA ATA TTG TCA C-AG GTT AGA AGG ATT GAG AAT tjí p A.GA GTT 16 9 9 Ala Glu Arg Ile Phe ser G Lu Wall Arg Arg Ile Glu Asn Tyr Are wall 520 525 530 GAA GGC ATG GAG ATC TAC TCT ACA ACA CTT TGG CAT CTT CAA. AGG *. 7.1 'Τ ’ 1747 Glu Gly Met Glu Ile Tvr Ser ^ hr Thr Leu Trp Els Leu Gin Lys Asd 535 540 5 4 ú GTT GCT CTT TCA GTT CTG TCA AAA GAC TTA ACA GAC ATG GAT A-AT 1795 Wall Ala. Leu ser val Leu Ger LVS Asr Leu Thr A.s o Her A.SO Lvs r.5? i 550 555 560 2 2 5 TCG CCA GAG GCC TGG TGT GCT CA GGG AAC TGT TTC . z- r-p ZVVJ l C ^ G CPA cGg ί N 4 2 Ser For Glu Ala Tro CV3 A _ a ALa Glv Asn Cvs A 7 ser Leu G L 7. Aru 570 575 2 2 GAA CAT C-AT ATT GCA ATT AAG. TTC TTC CAG AGA GCT ATC CAA GTT GAT L 9 9 L Glu fit 3 AS? Ile A.la Ile L v 3 Phe Phe Gin. Ar o A. L ί E L e Gin V. i _ ASD 535 590 595 CCA AAT TRAY GCT t / t GCT MELT CTA TTA OgjYj CAT GriU GTC TTA L 9 2 9 For Asn. Tv r Ala Tyr Ala Tvr Thr Leu Leu Glv : iu: Glu Phe v. i L at 6 0 0 6 05 3 10

- od-

TTCCAGATA AACAGAGTAA CTGACCTTCA TTTCTAGGTT CTTCAAGAAT GGTGTTTGCA 3032 .GTGCCAGAT GG / AC A_AT AA. AAGACGTTGC CTATAACAGT GACTTGATTG u G ΛΑ GG AA T G 3092 LAAATTACCT TλΑΑciTCGa TGATCTCCCA TAAACAAATG T.AATGGGCA7 ATTGGGACTC 3 152 iTATGTAGGA ATCAAATATC CGTCCATACA GTGTACTCTT ATTCTTGGCA AGAATGCTTT 3212 ATGTATAAC CAAGAATTTT AA7TTATTCA TCTTGCTTCA AAGTGTTGAT SATTGTTGTC 3272 'TGGTATTGC oEy \ (l: AAACTTTAAA (i) '·'): ATTGTTTCTT u —GzvATT G 3320

Characteristic characteristics: ύ; dcika. n'24 amino acids -is type: amino acid chain. . strings: single-strand -i topology: linear

: ir.oieKul ovy cy-p: protein íe L 1. :: - iv / ence: Thr Val Leu Qin No: 3 Gin Glu For Val Gin Ala 10 Ala 7 «e Trp Gin Ala Leu -s n His Tyr Ala 2 0 Tyr Arg Asp Ala Val Phe 2 5 Leu A-A Glu ATC 3 0 Lnu Ty r ila Glu val 3 5 Eis Ser C-lu Glu Ala Leu Phe 40 Leu Leu Ala 45 Thr Sys Tvr ? vr Arg Ser 50 Gly Lys Ala Tyr Lys Ala Tyr 5 5 - v z 0 Leu Lys oly • Ls > er Ě5 Cys Thr Thr For Gin 70 Cys Lys Tyr Leu Leu 7 5 Ala LV3 Cy s 0 ³ f ’3 1 30 Vsp Leu Ser Lys Leu Ala G us o y y G i 90 lle Leu Ser Gly - ly Wall ? he Asn Lys Gin 100 ALIGN! Lys Ser Hus Asp Asp lle wall rr · 'r. - Glu Phe 110 c- - '/ AS O 5er Ala Cys Phe Thr Leu Ser Leu Leu Glv 120 His wall Tyr 125 Cys - / ³ Tur \ s r Arg Leu Ala Lv3 Gly Ger Glu Cys Gin 14: ser Leu Ser Lnu Asn 145 Pro Phe Leu Trp Ser 150 Pro Phe Glu Ser Leu 15 5 Cys GlU Lle 15 0 Lys For Asp For Asp Gin Thr Phe Lys Phe T h r L r Leu Gin Asn T Le Ser Asn Cys Leu 130 Pro Asn Ser Cys Thr Thr Gin For Aan 190 H.s uer Gene Ser Krs Arg Gin Pro Glu Thr Val Leu Thr Gl. Thr 205 For G1 n A 5 U T 'g lle Glu 2 Leu ri 3 Π ri_T Leu Asn u e u Glu 2 '' Ser Ser Asn Ser IN- Tv r

~ s / ~

Ser 225 Leu Asn Thr Asp Ser Ser 230 Wall Ser Tyr Tle 235 Asp Ser Ala Val Tle 240 Ser For As O Thr val Pro Leu 245 Gly Thr Gly 250 Ser Tle L6U u '/ 3 Gin Wall Gin Asn Lys Pro Lvs 25 0 Thr Gly Arrg Se r Leu Leu Gly Glv Pro 2 7 0 Ala Ala Leu 275 Ser Pro Leu Thr For 230 Ser Phe cly Tle Leu 235 For Leu Glu Thr For 290 Ser For Gly Aso Gly 295 ser Tvr Leu Gin Asn Tyr 300 Thr Asn Thr For 305 For Wall lle Aso Val Pro 310 ser Thr Gly Ala 315 Pro ser Lys Lys Ser 220 Wall Ala Arg Tle Gly Gin Thr 325 Gly Thr Lys 330 Ser val Phe Ser C-1 Ser Gly Asn ser Arg Glu Val Thr 340 For Tle Leu 345 Ala Gin Thr Gin Ser Ser 3 5 0 Gly For Gin 355 Thr Ser Thr Thr For 360 Gin Val Leu Ser Pro 365 Thr '' D · Ser ? ro 370 For Asn Aia Leu Pro Ax g Arg Ser Ser Arg Leu ? he Thr s- ^ r Asp 335 ser Ser Thr Thr Lys Glu 40 0 Asn Ser Lys Lvs 38 5 Leu Ly3 Met Lvs Phe 4 0 0 For For Lys Tle Pro Asn Arg 405 Lys Thr Lys 410 Ser Lys Thr Asn Lys Gly Gly Tle Thr Gin Pro Asn Tle 420 Asn Asn Seχ 43 5 Leu c-lu Tle Thr L7 2 L 430 Asp Ser ser 435 lle tle ser glu Gly 440 Lys lle Ser Thr lle Thr Pro Gin lle Gin 450 Ala Phe Asn Leu Gin 456 Lys Ala Ala Ala Glu Gly 460 Leu Met. Ser Leu 465 Leu Arg Glu Met Gly Lvs 4 6 0 Gly Tyr Leu Ala 475 Leu Cys Ser Tvr Asn 4 3 0 Cys Lys Glu Ala Tle Asn Tle Leu Ser His 490 Leu Pro Ser 4 9 5 Asn Thr Gly Val Leu Cvs 500 Gin lle Gly Arg Ala Tyr Phe Glu Leu 510 ser Glu <n 11 v i * X, 515 Met Gin Ala Glu Arg 520 lle Phe Ser Glu val 525 Arg Arg lle Glu Asn 530 rp », - Arg Val Glu Gly 5 Met Glu Tle Tyr 2 q - Thr Leu Trp Kis 545 Leu Gin Lys Aso Val Ala Leu Ser Val Leu 5 5 5 ser Lys Asp Leu Thr Asp Met Asp Lys Asn Ser Pro Glu Ala Trp cys A i. I A L 3. G1 y A s n cv p

565 570

Phe ser Leu Gin 530 Arg Glu His Asp Ile 535 Ala I l · e Xi3 Phe Phe 590 Gin nT Ala Ile Gin Wall ASp For Asn Tyr Ala f t- * J - Ax a Tyr Thr Leu ίιθ'ΰ Gly 595 6 * 00 605 ais Glu Phe wall Leu Ttir Glu Glu Leu Asp Lys Ar a Leu Ala Cys Phe 610 615 620 Arg Asn Ala Ile ·**-G Wall Asn ? ro Ouch? G His Tyr Asn Axa Trp Tyr Gly 625 530 6 3 5 6 4 * 0 Leu Gly Met Ile Tyr Tyr Lys Gin Glu Lys Phe Ser Leu Ala Glu He t 645 650 655 His Phe Gin Lys Al · a Leu Asp Ile Asn For Gin Ser ser Wall Leu Leu 660 66 5 670 Cys His Ile Gly Wall· Wall Gin His Ala Leu Lys Lys ser Glu Lys ALa 675 680 685 Leu Asd Thr Leu Asn Lys Ala Ile Wall Ile Asd For Lys Asn For Leu 690 695 700 Cvs Lys Phe His Are; Ala Ser Wall Leu Phe Ala Asn (from Lu Lys Tyr Lys 7 * 05 710 715 .7 2 0 Ser Al. and Leu Gin C ^ u Leu Glu Glu Leu Lys Gin Ile 7a l · For Lys Gíu 725 730 735 Ser Leu Wall Tyr Phe Leu Ile Giv Lys Wall Tyr Lys Lvs Leu Gly Gin 740 7 * 45 750 Thr Kis Leu Ala Leu Met Asn Phe Ser Trp Ala Met As p Leu Asp For 755 760 7 6 * 5 Lys Gly Ala Asn As r. Gin Ile Lys Glu A.la Ile A3p L ’/ 5 m? G Tyr Leu 770 775 7 80 For ASp Asp Glu Gxu For Ile Thr Gin Glu GlU Gin Lie Met Gly Thr 735 790 795 300 ASO Glu Ser Gin Gl · ^ Ser Ser Met Thr Asp Ala Asp Asp Thr Glr. Leu 805 810 815 His Ala Ala Glu Ser Asd Glu Phe

320

Claims (25)

PATENT CLAIMS 1 an isolated and purified DNA sequence coding for an RB binding protein that c1 ^; has a subsequence having at least 60% homology to the nine tt A atricopepptide repeats in the C-terminal region, provided that the sequence r. it encodes neither S. pombe yeast nuc2 protein, Aspergillus rdudulans bimA protein, or S. cerevisiae yeast CDC27 protein. An isolated and purified DNA sequence encoding the RB binding protein of claim 1 having 60% homology to amino acids 465 to 770 of the I.D. No 1. An isolated and purified DNA sequence according to claim 1 which encodes amino acids 465 to 770 of the I.D. No 1. and an isolated and purified DNA sequence according to claim 1 which encodes H-NUC according to sex I.D. No 1. A recombinant vector comprising the isolated, purified DNA of claims 1, 2, 5 or 4. The recombinant vector of claim 5, wherein the vector is a cosmid, plasmid or is derived from a viral particle. An expression vector comprising a DNA molecule according to claims 1, 2, 3 or 4, capable of carrying the DNA molecule into a mammalian host cell and expressing it in the cell. The expression vector of claim 7, wherein the vector is selected from the group of plasmid or viral vectors. The expression vector of claim 8, wherein the viral vector is selected from the group of rs U ovarian and adenoviral vectors. The expression vector of claim 9, wherein the expression vector is ACN-H-NUC. A host vector system for producing a polypeptide or protein having the biological activity of an H-NUC protein, or biologically active derivatives thereof; Which comprises the vector of claims 7, 8, 9 or 10 in a suitable host cell. The host vector system of claim 11, wherein the host cell is a? -Ocaryotic cell. I ď. The host vector system of claim 11, wherein the host cell is a xaryotic cell. 14. A pharmaceutical composition comprising the vector of claim 7 and a pharmaceutically acceptable carrier. lo. A pharmaceutical composition comprising the vector of claim 8 and a pharmaceutically acceptable carrier. Ιϋ. A pharmaceutical composition comprising the vector aCN-H-NUC and a pharmaceutically acceptable carrier. 17. A DNA probe consisting of at least 27 nucleotides complementary to the sequence of claim 1. l ^s . The DNA probe of claim 17, wherein the nucleotide sequence is complementary to the DNa sequence of ID No 1. 19. An isolated and purified RB protein binding mammalian protein comprising at least six tetratricopeptide repeats in c of the svc amino acid sequence. ·. with the proviso that this protein is not a nuc2 protein! i _ P. - ζζχ, ¹ S. pombe yeast, bimA protein Aspe r rgi 1 lust nidulans31ηi fm ί -ζ, CDC27 protein in yeast S. cerevis s and e. - ^w > - i The isolated and purified mammalian protein of claim 19, which comprises nine tetratricopepetide repeats in its C-terminal region of the molecule in its amino acid sequence. The isolated and purified mammalian protein of claim 20, wherein the H-NUC has the amino acid sequence of I.D. No 2. 22. A method of preparing a protein according to claim 19, wherein the protein is produced a) introducing into a host cell a compatible expression vector comprising the gene encoding the protein of claim 19 b) expressing the protein in a host cell. 23. The method of claim 22 wherein the host cell is selected from the group of prokaryotic and eukaryotic host cells. 24. The method of claim 23, wherein said mammalian cell is compatible with said host cell. that the host cell expression vector is A pharmaceutical neoplastic phenotype of an endogenous H-NUC protein. a composition for suppressing a cancer cell having no; 4. m comprising a DNA sequence according to claim 1, 2, 3 or 3 26. A pharmaceutical composition according to claim 25, comprising H-NUC DNA inserted into the recombinant vector. 27. The pharmaceutical neoplastic phenotype of an endogenous H-NUC protein, a cancer cell preparation, characterized in that it comprises a protein according to claim 19, 20 of a non-self-suppressing or 21. 28. An antibody that binds an RB binding protein whose amino acid sequence comprises at least six tetratricopeptode repeats in the C-terminal region of the molecule, with the proviso that said protein is not a S. pombe yeast nuc2 protein, Aspergillus niger bimA protein or S. cerevisiae yeast CDC27 protein. The antibody of claim 28, which binds to an H-NUC protein having the amino acid sequence of I.D. No 2. A hybridoma that produces a monoclonal antibody that binds to an H-NUC protein having the amino acid sequence of I.D. No 2. 31. A method for detecting the in vitro absence of H-NUC protein in tumor cells, comprising: a) prepare tissue sections from the tumor b) contacting the antibodies of claims 26 or 27 with said tissue sections c) detecting the presence or absence of binding of said antibody to tissue sections.