KR20030064271A - Nucleic acids encoding a novel regulator of G protein signaling, RGS18, and uses thereof - Google Patents

Abstract

The present invention relates to nucleic acids encoding the RGS18 polypeptide, a novel G protein signaling regulator. RGS18 polypeptides are expressed in abundance in platelets and include a novel RGS domain (RGS18 domain). The invention also relates to an RGS18 polypeptide. The invention also relates to means for detecting RGS18 nucleic acids and RGS18 polypeptides. The invention also relates to a method for detecting an activator or inhibitor of an RGS18 polypeptide. Finally, the present invention relates to a method for preventing and / or treating a disorder or disease associated with platelet activation dysfunction.

Description

Nucleic acids encoding a novel regulator of G protein signaling, RGS18, and uses algorithm}

Multicellular organisms have evolved depending on the ability of cells to communicate with each other and their ability to communicate with their environment. Membrane bound receptors have been found to play a critical role in this communication. They can recognize intercellular messenger molecules such as hormones, neurotransmitters, growth and developmental factors as well as sensory messengers such as odorants, taste and light. These receptors belong to approximately five protein families; The most common family is the G protein-coupled receptor family (GPCR). GPCRs are involved in recognizing various messages such as small molecules, including amino acid residues, nucleotides and peptides, light, odorants, calcium, and the like. After binding this message to the GPCR, signal delivery begins through the recruitment of G-proteins, activated by binding and hydrolysis of GTP to intracellular levels. The biological action of GPCRs is to control vesicle transport activity, intracellular enzyme activity and ion channel activity through GDP-GTP exchange catalysis on hetero-trimeric G protein (Gα-βγ) (1-4). .

The major structural feature of the GPCR is the central core domain encompassing seven transmembrane helices (TMI-VI) with three intracellular loops (IPI-III) and three extracellular loops (ECI-III) spaced apart. These three core domains differ in sequence and function among GPCR superfamily members in their N-terminal extracellular domain, C-terminal intracellular domain and their intracellular loops.

Some platelet agonists act through activation of cell surface GPCR initiating intracellular signaling cascades resulting in platelet aggregation. Signaling through G protein-coupled receptors such as thrombin, thromboxane A ₂ and adenosine diphosphate (ADP) is partially involved in platelet activation events such as fibrinogen receptor exposure, granule secretion and aggregation (5). Although multiple intracellular signaling pathways have a close influence on platelet activation events, the exact order of these events and the subjects of intracellular signaling molecules are still unknown.

G protein signaling regulators (RGSs) represent a family of proteins that act on braking signals generated upon stimulation of cell surface G protein-coupled receptors. RGS, first identified in the genetic screens of yeast (6,7) and nematode Caenorhabditis elegans (8), was first discovered based on their ability to modulate behavioral responses. By some methods, including yeast two-hybrid (9), homologous cloning (10), database investigation (8) or subtractive cloning, or expression methods (11-13), the mammalian homologs of these prokaryotic RGS I was quickly identified. A feature of this family is that there are 120 highly homologous amino acid regions, termed RGS domains. Currently, there are more than 30 mammalian proteins or partial sequences thereof containing putative RGS domains (14). Some RGS family members are relatively low molecular weight proteins, consisting primarily of RGS domains flanked by short amino and carboxy-terminal regions, while other members are putative functional domains that affect them in scaffolding reactions. [E.g., the pleckstrin homology (PH) domain, the Db1 domain homologous to the db1 one-tumor gene domain, the DEP domain present in scattered, egl-10 and flextrin domains, and the G protein γ-like (GGL) subunit domain].

RGS proteins are believed to regulate GPCR signaling by interacting with the alpha subunits of hetero-trimeric GTP binding proteins. Hetero-trimeric G proteins act as molecular switches in the process of GPCR-mediated signal delivery, which controls the rate of activation and activation of effectors (see 15 for a review of hetero-trimeric G proteins). Upon stimulation of the receptor with an agonist, GDP is rapidly dissociated from the α subunit and exchanged for GTP. While forming a complex with GTP, the alpha subunit maintains its active state, interacting with downstream effectors. Hydrolysis of GTP changes the alpha subunit to its GDP-bound or inactive state. RGS proteins weaken signaling through GPCRs by acting as GTPase activating protein (GAP) (13, 16, 17). By accelerating GTP hydrolysis, the RGS protein limits the time for which the G _α subunit lasts in its active state. Structural studies indicate that RGS binds to the transition state of alpha subunits to stabilize it and accelerate GTP hydrolysis (18, 19). The transition state of the G _α subunits can be simulated in vitro by treating such alpha subunits with aluminum tetrafluoride (AlF ₄ ⁻ ). So far, G _αi family _{(G αi1, G αi2, G} αi3, G αz, G αo, G αt), G αq / 11 and G _{α12 / 13} Relatively for members and cross but act to enable them to G _αs members of A failed RGS was identified (14). In addition to their GAP activity, RGS can also block signaling by acting as effector antagonists (20, 21). RGS protein regulates adenylyl cyclase (22), MAP kinase activity (10,20), inisitol triphosphate and Ca ²⁺ signaling (21-23), K ⁺ channel conductance (24) and visible Many GPCR-stimulated intracellular effectors have been identified in a variety of cell types and tissues, including signal transduction processes (25, 26).

Since some of these signaling cascades are related to platelet activation, one or more members of the RGS superfamily may be present in platelets, which is believed to be involved in regulating signaling pathways critical for platelet activation. In platelets, receptors for ADP, thromboxane A ₂ and thrombin are coupled with hetero-trimeric GTP binding proteins that deliver signals as intracellular effectors, thereby inhibiting adenylyl cyclase and phospholipase C is activated, causing intracellular calcium to migrate (5). All three of these receptors appear to couple with one or more alpha subunits in platelets. In the case of ADP, at least two receptors are present on the platelet surface coupled with the hetero-trimeric G protein. P2T _AC putative is coupled with G _αi (27), P2Y1 is ring G _{αq / 11} and coupling 28. Thrombin receptor is believed to G _αi, G _{αq / 11,} and G _{α12 / 13} family members and the coupling (29-31). Thromboxane A ₂ receptor has been shown to interact with the _{G αq / 11 (32-35),} G α13 (31,36) and G _αi (33) the same type. More recently, in platelets, G _αi - _αq and G - is the fact that it is crucial to platelet aggregation due to ADP to activate all associated paths at the same time it turned out to be (37,38). G _αq rust - because out (knock-out) mice indicated a marked bleeding tendency to die from bleeding too much on the labor front and rear, but G is _αq have had a close influence as a unified regulator of hemostasis in a mouse is not surprising.

The references cited herein are not limited to the ones in which such references have been approved as available as the "prior art" of the present application.

Summary of the Invention

The present invention relates to a nucleic acid encoding RGS18, a novel G protein signaling regulator (RGS) protein. Thus, a first subject matter of the invention is a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Its complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or its complementary polynucleotide Nucleotide sequence, e) a polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof g) the nucleotide of SEQ ID NO: 19 Nucleic acid comprising the polynucleotide sequence of 418-658, or a complementary polynucleotide sequence thereof.

The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of the nucleic acid according to the invention. Preferably, the nucleic acid according to the invention comprises 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 sequences of the nucleic acid according to the invention. Nucleotides to be included.

The invention also relates to a nucleic acid which exhibits at least 80% nucleotide identity with a nucleic acid according to the invention. The invention also relates to a nucleic acid which exhibits at least 85%, preferably 90%, more preferably 95%, even more preferably at least 98% nucleotide identity with a nucleic acid according to the invention.

The invention also relates to a nucleic acid which hybridizes with the polynucleotide sequence of a nucleic acid according to the invention under high stringent conditions.

The invention also relates to nucleic acids encoding polypeptides comprising the novel RGS18 domain. Accordingly, a second subject matter of the invention is a) a polynucleotide sequence of SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof, b) a nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or c ) Nucleotides 418-768, or their complementary polynucleotide sequences of SEQ ID NO: 19.

The invention also relates to nucleic acids, in particular cDNA molecules, encoding full length human RGS18 protein. The present invention also relates to cDNA molecules encoding novel full length RGS18 proteins. Accordingly, the present invention relates to a nucleic acid comprising a) a polynucleotide sequence of SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof, or b) a nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof will be.

According to the present invention, a nucleic acid comprising a polynucleotide sequence of SEQ ID NO: 18 or 19 encodes a full length RGS18 domain polypeptide of 235 amino acids comprising the amino acid sequence of SEQ ID NO: 20. The invention also relates to a nucleic acid encoding a polypeptide comprising the amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the nucleic acid according to the invention encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 20.

The invention also relates to a polypeptide comprising the novel RGS18 domain according to the invention. In a preferred embodiment, the polypeptide according to the invention comprises the amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the polypeptide according to the invention comprises the amino acid sequence of SEQ ID NO: 20.

The invention also relates to a) an amino acid sequence of SEQ ID NO: 12 or 20, b) an amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, c) an amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, d) of SEQ ID NO: 20 An amino acid sequence of amino acids 86-202, or e) a polypeptide comprising an amino acid sequence exhibiting at least 80% amino acid identity with a polypeptide comprising an amino acid sequence of amino acids 86-166 of SEQ ID NO: 20.

In certain embodiments, the present invention relates to a polypeptide exhibiting at least 85%, preferably 90%, more preferably 95%, even more preferably 98% amino acid identity with a polypeptide according to the invention.

The invention also provides nucleotide probes and primers which hybridize with the nucleic acid sequences of the nucleic acids according to the invention. A nucleotide probe or primer according to the present invention comprises a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complement thereof Red polynucleotide sequence, c) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, or d) the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide thereof At least 8 contiguous nucleotides of a nucleic acid comprising a sequence. Preferably, the nucleotide probes or primers according to the invention are 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 of the nucleic acid according to the invention. Will be two consecutive nucleotides in length.

The present invention also provides

a) a pair of nucleotides having hybridization sites localized on the 5 'side and 3' side of the target nucleic acid region to be amplified, in the presence of the reagents required for the amplification reaction, in the sample where the target nucleic acid is expected Contacting the primer; And

b) detecting the nucleic acid thus amplified

It relates to a method for amplifying a nucleic acid according to the present invention contained in the sample.

The present invention also provides

1) contacting one or more nucleotide probes according to the invention with a sample to be tested; And

2) detecting a complex that may be formed between the nucleic acid present in the sample and the probe (s)

It relates to a method for detecting the presence of a nucleic acid according to the invention in the sample, comprising.

Another subject of the invention is

1) a pair of nucleotide primers according to the invention localized on the 5 'and 3' sides of the target nucleic acid to be amplified, respectively; And optionally

2) Reagents Required for Amplification Reaction

Box or kit for amplifying all or part of the nucleic acid according to the invention, including.

The present invention also provides

a) at least one nucleotide probe according to the invention; And

b) optionally a reagent required for the hybridization reaction

It relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample.

The invention also relates to a recombinant vector comprising a nucleic acid according to the invention.

The invention also relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 polypeptide. In a preferred embodiment, the defective recombinant virus comprises a cDNA molecule encoding a RGS18 polypeptide. In another preferred embodiment of the invention, said defective recombinant virus comprises a gDNA molecule encoding a RGS18 polypeptide. Preferably, the RGS18 polypeptide so encoded comprises amino acids 86-166 of SEQ ID NO: 20. More preferably, the encoded RGS18 polypeptide comprises amino acids 86-202 of SEQ ID NO: 20. Even more preferably, the encoded RGS18 polypeptide comprises the amino acid sequence of SEQ ID NO: 20.

In another preferred embodiment, the invention is a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein under the control of a promoter selected from a Raus sarcoma virus-long terminal repeat sequence (RSV-LTR) or cytomegalovirus (CMV) early promoter. It is about.

The invention also relates to a composition comprising a nucleic acid placed under the control of a suitable regulatory element, which encodes a polypeptide according to the invention.

The invention also relates to the use of a nucleic acid, polypeptide or recombinant vector according to the invention for the manufacture of a medicament for the treatment and / or prevention of disorders or diseases associated with platelet activation dysfunction.

The invention also relates to the use of a nucleic acid, polypeptide or recombinant vector according to the invention for the manufacture of a pharmaceutical composition for the treatment and / or prevention of a disorder or disease associated with platelet activation dysfunction.

The present invention therefore also relates to pharmaceutical compositions comprising a nucleic acid, polypeptide or recombinant vector according to the invention in combination with one or more physiologically compatible vehicles and / or excipients.

The invention also provides for the use of recombinant vector-producing cells, or cells genetically modified ex vivo with a nucleic acid or recombinant vector according to the invention, transplanted in vivo, for the long term effective expression of a biologically active RGS18 polypeptide in vivo. It is about.

Accordingly, the present invention also encompasses nucleic acids encoding RGS18 polypeptides according to the invention for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction, more particularly for the treatment of a subject having such a disorder or disease. To a use of a recombinant host cell according to the invention.

The invention also relates to the use of a recombinant host cell according to the invention for the manufacture of a pharmaceutical composition for the treatment and / or prevention of a pathological condition associated with a disorder or disease associated with platelet activation dysfunction.

The invention also relates to the use of a defective recombinant virus according to the invention for the manufacture of a pharmaceutical composition for treating and / or preventing a disorder or disease associated with platelet activation dysfunction. The present invention therefore also relates to pharmaceutical compositions comprising a defective recombinant virus according to the invention in combination with one or more physiologically compatible vehicles and / or excipients.

The invention also relates to a cell that has been genetically modified ex vivo with a defective recombinant virus according to the present invention, or a cell producing such a virus, which has been transplanted in vivo to effectively express a biologically active RGS18 protein in vivo for a long time effectively. It is about a use. Particular embodiments of the invention are isolated mammalian cells infected with one or more defective recombinant viruses according to the invention.

Another subject of the invention relates to an implant comprising an isolated mammalian cell or recombinant virus infected with one or more defective recombinant viruses according to the invention, and an extracellular matrix. More particularly, the extracellular matrix in the implant of the present invention comprises a gelling compound and optionally comprises a support to immobilize the cells.

The invention also relates to an isolated and recombinant host cell comprising a nucleic acid of the invention.

According to another aspect, the invention also relates to an isolated recombinant host cell comprising the recombinant vector according to the invention. Thus, the present invention also relates to recombinant host cells comprising a recombinant vector comprising a nucleic acid of the invention.

The present invention also provides

a) inserting a nucleic acid encoding a polypeptide according to the invention into a suitable vector;

b) culturing the previously transformed host cell in a suitable culture medium or transfecting the host cell with the recombinant vector of step a);

c) recovering the conditioned culture medium conditioned as above, or lysing the host cell, for example by sonication or osmotic shock;

d) separating and purifying the polypeptide from the culture medium or the cell lysate obtained in step a); And

e) optionally identifying the resulting recombinant polypeptide

It relates to a method for producing a polypeptide according to the present invention, including.

The invention also relates to the antibodies directed against the polypeptides according to the invention.

Thus, another subject of the present invention is

a) contacting the sample to be tested with the antibody directed against the polypeptide according to the invention; And

b) detecting the antigen / antibody complexes thus formed

A method of detecting the presence of a polypeptide according to the invention in a particular sample, comprising.

The present invention also provides

a) an antibody directed against a polypeptide according to the invention; And

b) reagents that allow detection of the formed antigen / antibody complex

It relates to a box or kit for diagnosing or detecting the presence of a polypeptide according to the invention in a particular sample, comprising.

The present invention also provides a novel method for treating a pathological condition associated with a disorder or disease associated with platelet activation dysfunction comprising the delivery and expression of a nucleic acid, a recombinant vector, or a defective recombinant virus according to the invention in vivo. One therapeutic approach is concerned. Specifically, the present invention provides novel therapeutic approaches for treating and / or preventing disorders or diseases associated with platelet activation dysfunction.

According to another aspect, the subject matter further comprises administering to a particular patient a therapeutically effective amount of an RGS18 polypeptide according to the invention, optionally in combination with one or more physiologically compatible vehicles and / or excipients. It is a prophylactic or therapeutic method for treating a disease caused by abnormal platelet activation, including.

The invention also relates to a method for detecting an activator or inhibitor of an RGS18 protein and a polypeptide comprising an RGS18 domain.

The present invention also provides methods for screening small molecules and compounds that act on RGS18 proteins to identify agonists and antagonists of RGS18 polypeptides that can enhance, decrease or inhibit platelet activation from a therapeutic standpoint. These methods are useful for identifying small molecules and compounds for therapeutic use in treating diseases caused by platelet activation deficiency.

Accordingly, the invention also relates to the use of a polypeptide according to the invention or a cell expressing a polypeptide according to the invention for screening for an active ingredient for preventing or treating a disorder or disease associated with platelet activation dysfunction. The present invention also relates to methods of screening compounds or small molecules that act as agonists or antagonists of the RGS18 polypeptide.

The present invention relates to a nucleic acid encoding RGS18, a novel G protein signaling regulator (RGS) protein. RGS18 is expressed in abundance in platelets and contains a novel RGS domain (RGS18 domain). The invention also relates to nucleic acids encoding polypeptides comprising the novel RGS18 domain. The invention also relates to cDNA encoding the novel full length RGS18 protein. The invention also relates to RGS18 proteins and polypeptides comprising the novel RGS18 domains. The invention also relates to a recombinant vector comprising a nucleic acid according to the invention. The invention also relates to means for detecting RGS18 nucleic acids, proteins, and polypeptides comprising an RGS18 domain. The invention also relates to a method for detecting an activator or inhibitor of a RGS18 protein and a polypeptide comprising a RGS18 domain. Finally, the present invention relates to a method for preventing and / or treating a disorder or disease associated with platelet activation dysfunction.

Figure 1. Cloning and sequence information of full length cDNA for novel RGS, RGS18. Panel A, diagrammatically showing full length cloning of new platelet RGS. A schematic of cDNA for RGS18 is shown at the bottom, the boxed region represents the open expected reading frame, and the single line represents the 5 'and 3' non-dock regions. The relative positions of the initial RT-PCR product, the Incyte EST cDNA (clone 435706H1) and the 5 ′ RACE amplification product are shown above. Panel B, nucleotides of RGS18 and inferred amino acid sequences. The 5 'and 3' non-toxic regions are shown in lowercase letters and the expected amino acid sequences are shown in uppercase letters with single letter abbreviations. Initial RT-PCR products from platelet RNA are shown in bold. The 5 'and 3' ends of the Incyte EST cDNA are marked with diamond "◆". The oligonucleotide sequence of the primers in the 3 'untranslated region used for the 5' RACE is underlined. Putative CAAX motifs are indicated by double-underline (⑨) and cAMP / cGMP-dependent protein kinase consensus sites are indicated by triple-underline (=).

Figure 2. Alignment of RGS18 with other RGS family members. The expected amino acid sequence of RGS18 is aligned with six other RGS protein sequences using GCG's PILEUP program. Homology between RGS18 and these other RGS protein sequences is shaded. Amino acids conserved between RGS18 and two or more other RGSs are also shaded. Dark lines above the sequence indicate conserved RGS domains amplified by PCR. An asterisk (*) means the position of two amino acids that are conserved within the members of family B. The down arrow (↓) indicates amino acids in RGS4 that are expected to contact the G _α subunit. Boxed regions indicate peptide sequences synthesized for the production of peptide directed antisera.

3. Tissue distribution map of RGS18 by northern blotting. Panel A: Northern blot of total RNA 10 mg from human platelets, human leukocytes, DAMI, HEL and MEG-01 cells, probed with 3 ′ non-toxic region probe of RGS18 as described in the experimental procedure. The blot is exposed to Kodak Biomax MR film for 6 hours at −70 ° C. Panel B: Hybridization with the same RGS18 probe as human multiple tissue Northern. The blot is exposed to Kodak Biomax film for 6 hours at −70 ° C. The shift of molecular weight standards on each gel is shown on the left. After removing the probe, hybridize with β-actin to normalize each blot, shown below the corresponding blot.

4. Western blotting of platelets, leukocytes and megakaryocyte cell line lysates. Panel A: Specificity of anti-RGS18 antiserum. Nitrocellulose strips containing 50 mg of platelet lysate performed on 15% SDS-PAGE are incubated with a 1: 500 dilution of antiserum 3NRGS-12 or a 1: 1000 dilution of 5NRGS-13. Immunoreactive bands moving to approximately 30 kDa are detected with sheep serum (lane 1 for each blot). The same strip is also probed with antisera pre-incubated with the corresponding immunized peptide or unrelated peptide (in these studies, 5NRGS-peptide was used for antiserum # 12 and 3NRGS-peptide was used for antiserum # 13). . The shift of the 30 kDa molecular weight standard is shown on the left and the shift of RGS18 is shown on the right. Panel B: Detection of RGS18 expression in platelets, white blood cells and megakaryocytes . Lysates (50 mg) from human platelets, leukocytes, DAMI HEL and MEG-01 cells were electrophoresed on 15% SDS-PAGE, transferred to nitrocellulose, and then antibodies to RGS18 and RGS10 (Santa Cruz Biotechnology, Santa Cruz, Blot). The top blot shows the reactivity of each lysate with anti-RGS18 antiserum (5NRGS- # 13), and the downstream blot shows the reactivity with anti-RGS10 antiserum. As suggested above, RGS18 moves with a 30kDa MW marker. A much smaller protein, RGS10, moves closer to the 21 kDa MW marker.

5. Determination of Gα subunit specificity of RGS18. Platelet lysate, as indicated by processing GDP or GDP + AlF ₄ ^_ and, as described in experimental procedures, and incubated with Sepharose 4B coupled with GST-RGS18. By targeting the binding proteins, perform a 12% SDS-PAGE, and it transferred to nitrocellulose, and then antiserum for G _{αi1 / αi2,} G _{αo / i3,} G _{αq / 11,} G _αz, G _α12 or G _αs To detect. Lanes labeled “lysate” are 7.7% or 35 mg of the influent lysate in each reaction carried out side by side to show the reactivity of each antiserum with platelet lysate.

General definition

The present invention contemplates the isolation of genes encoding the RGS18 polypeptides of the invention, including RGS18 in full length or natural form, and all antigenic fragments thereof from any animal, particularly mammal or bird, more particularly human source.

In accordance with the present invention, conventional molecular biology, microbiology and recombinant DNA techniques within the art can be used. Such techniques are described in detail in the literature (see references 40-47).

Thus, when presented herein, the following terms represent the following definitions.

The term “gene” as used herein refers to the assembly of nucleotides encoding a polypeptide, including cDNA and genomic DNA nucleic acids.

For the purposes of the present invention, the term "isolated" refers to a biological material (nucleic acid or protein) that has been removed from its original environment (naturally existing environment).

For example, polynucleotides that exist naturally in plants or animals are not isolated. Identical polynucleotides isolated from adjacent nucleic acids naturally inserted into the genome of a plant or animal are considered to be “isolated”.

Such polynucleotides may be included in a vector and / or the polynucleotides may be included in a composition and nevertheless remain separated, due to the fact that the vector and / or composition do not constitute its natural environment. .

The term "purified" does not require that the substance be present in a form that exhibits absolute purity, excluding the presence of other compounds. This is rather a relative definition.

The polynucleotides are present in a "purified" state after purifying the starting material or natural material by at least one order, preferably two or three orders, more preferably four or five orders.

For the purposes of the present invention, the expression "nucleotide sequence" can be used to name a polynucleotide or nucleic acid. The expression “nucleotide sequence” encompasses the genetic material itself and is therefore not limited to information relating to its sequence.

The term “nucleic acid”, “polynucleotide”, “oligonucleotide” or “nucleotide sequence” refers to an RNA, DNA, gDNA or cDNA sequence or RNA / DNA hybrid sequence of one or more nucleotides, in single-chain form or double-stranded form. Comprehensive

A “nucleic acid” is a polymeric compound composed of covalently linked subunits called nucleotides. Nucleic acids include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), which may be single or double stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semisynthetic DNA. The sequence of nucleotides encoding a protein is termed a sense sequence or coding sequence.

The term “nucleotide” refers to both natural nucleotides (A, T, G, C) as well as modified nucleotides including one or more modifications such as (1) homologues of purines, (2) homologues of pyrimidines, or (3) similar sugars. Examples of such modified nucleotides are described, for example, in PCT Publication WO 95/04064.

For the purposes of the present invention, a first polynucleotide is "complementary" to a second polynucleotide when each base of the first nucleotide is paired with a complementary base of its second polynucleotide, the orientation of which is reversed. Is considered to be. Complementary bases are A and T (or A and U), or C and G.

"Heterologous" DNA refers to DNA that is not originally localized in a cell or chromosomal sites of such cells.

As used herein, the term “homology” in all of its grammatical forms and spelling variations refers to proteins from superfamily (eg immunoglobulin superfamily) and homologous proteins from different species (eg myosin light chain, etc.). ), The relationship between the proteins possessing a "common evolutionary origin" (48). Such proteins (and their coding sequences) have sequence homology, as reflected by their high sequence similarity.

Thus, the term “sequence similarity” in all its grammatical forms refers to the identity or correspondence between amino acid sequences or nucleic acids of proteins that may or may not share a common evolutionary origin (48). However, in common applications and herein, the term "homology" appended with an adverb such as "altitude" may refer to sequence similarity but is not a common evolutionary origin.

In certain embodiments, when at least about 50% (preferably at least about 70%, more preferably at least about 90 or 95%) of the nucleotides are matched throughout the DNA sequence of defined length, the two DNA sequences are " Substantially homologous "or" substantially similar. " Substantially homologous sequences can be identified by comparing the sequences using standard software available in the sequence data bank, for example, in Southern hybridization experiments under stringent conditions, or as defined for a particular system. have. Suitable hybridization conditions as defined are in the art [see 41, 43 and 49].

Similarly, in certain embodiments, when at least 30% of the amino acids are identical, or at least about 60% are similar (functionally identical), the two amino acid sequences are "substantially homologous" or "substantially similar." Preferably, such similar or homologous sequences are identified by aligning using, for example, a Genetic Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin (pileup) pileup program.

For purposes of the present invention, the "% identity" between two nucleotide or amino acid sequences can be determined by comparing two optimally aligned sequences through a comparison window.

Thus, a portion of the nucleotide or polypeptide sequence in the comparison window may contain an adduct or deletion relative to the reference sequence (not including the following adduct or deletion) to obtain an optimal alignment between the two sequences. For example, “gap”).

The percent identity determines the number of positions at which identical nucleic acid bases or identical amino acid residues are observed for the two sequences compared (nucleic acid or peptide) and then compares the number of identical positions between the two bases or amino acid residues. After dividing by the number of positions in the dragon window, the result is calculated by multiplying the result by 100 to obtain sequence identity.

Optimal sequence alignment for comparison can be achieved using a computer with the aid of known algorithms contained in a package from the company [WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN]. have.

By way of example, only sequence parameters are used to calculate sequence identity with the aid of BLAST software (versions BLAST 1.4.9 (1996. 3), BLAST 2.0.4 (1998. 2) and BLAST 2.0.6 (1998. 9)). It would be possible (50, 51). BLAST examines sequences that are similar / homologous to reference “lookup” sequences, with the aid of Altschul et al. The query sequence and the database used may be of peptide or nucleic acid type, any combination is possible.

The term “corresponding” is used herein to refer to a similar or homologous sequence, whether the exact position is the same as or different from the molecule measuring similarity or homology. Nucleic acid or amino acid sequence alignments can include spaces. Thus, the term "corresponding" refers to sequence similarity, not to numbering of amino acid residues or nucleotide bases.

The gene encoding the RGS18 polypeptide of the invention can be isolated from any source, in particular human cDNA or genomic libraries, whether genomic DNA or cDNA. Methods of obtaining genes are well known in the art as described in the literature (see 40).

Thus, any animal cell can potentially serve as a nucleic acid source for molecular cloning of the RGS18 gene. The DNA can be obtained from cloned DNA (eg, a DNA "library") by standard procedures known in the art, and preferably is chemical synthesis, cDNA cloning, or genomic DNA purified from a cell of interest or its Cloning of the fragments results from cDNA libraries prepared from tissues that express high levels of the protein of interest (see, eg, 40,41). Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; Clones derived from cDNA will not contain intron sequences. Whatever the source, the gene must be molecularly cloned into a vector suitable for propagation of such gene.

In molecular cloning a gene from genomic DNA, DNA fragments are generated, some of which will encode the gene of interest. The DNA can be cleaved at specific sites using various restriction enzymes. On the other hand, DNAase may be used in the presence of manganese to fragment the DNA, or may be physically sheared, such as by sonication. The linear DNA fragments can then be separated by size by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis and column chromatography.

Once the DNA fragments are generated, a number of methods can be used to identify specific DNA fragments containing the desired RGS18 gene. For example, if an amount of a portion of the RGS18 gene or a specific RNA thereof, or a fragment thereof can be used, and can be purified and labeled, the nucleic acid hybridization with a labeled probe may generate DNA fragments can be screened (52, 53). For example, one set of oligonucleotides corresponding to the partial amino acid sequence information obtained for the RGS18 protein can be prepared and used as a probe for DNA encoding RGS18, as performed in the specific examples below. Or as a primer for cDNA or mRNA (eg, used in combination with a poly-T primer for RT-PCR). Preferably, highly unique fragments are selected for the RGS18 nucleic acid or polypeptide of the invention. DNA fragments substantially homologous to the probe will hybridize. As noted above, the greater the homology, the more stringent hybridization conditions can be used. In certain embodiments, stringent hybridization conditions are used to identify homologous RGS18 genes.

For example, if the gene encodes a protein product having an isoelectric, electrophoretic, amino acid composition or partial amino acid sequence of the RGS18 protein as described herein, further selection will be performed based on the nature of that gene. Can be. Thus, the presence of the gene can be detected by an assay based on the physical, chemical or immunological properties of its expressed product. For example, hybrid cDNA clones or suitable mRNAs that produce proteins with similar or identical electrophoretic migration, isoelectric electrophoresis or non-equilibrium pH gel electrophoresis behavior, proteolytic map or antigenic properties as known for RGS18. CDNA can be selected for selection.

The RGS18 gene of the present invention may also be identified by mRNA selection, ie nucleic acid hybridization followed by in vitro translation. In this process, nucleotide fragments are used to separate complementary mRNA by hybridization. The DNA fragment may represent purified RGS18 DNA available, or it may be a synthetic oligonucleotide designed from partial amino acid sequence information. Immunoprecipitation assays or functional assays (e.g., tyrosine phosphatase activity) on the in vitro translation products of the products of the isolated mRNA can be used to identify complementary DNA fragments containing the desired sequence. have. Specific mRNAs can also be selected by adsorbing polysomes isolated from cells to immobilized antibodies specifically directed against the RGS18 polypeptide of the invention.

Radiolabeled RGS18 cDNA can be synthesized using mRNAs selected as above (from adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA can then be used as a probe to identify homologous RGS18 DNA fragments from other genomic DNA fragments.

A “variant” of a nucleic acid according to the invention will be understood to mean a nucleic acid which differs by one or more bases relative to a reference polynucleotide. Variant nucleic acids may be allelic variants of natural origin, eg, naturally occurring, or may be non-natural variants, eg, obtained by mutation techniques.

In general, the difference between a reference (generally wild-type) nucleic acid and a variant nucleic acid is small so that the nucleotide sequence of the reference nucleic acid and the nucleotide sequence of the variant nucleic acid are extremely similar and are identical in many regions. Nucleotide modifications present in variant nucleic acids may be silent, meaning that they do not change the amino acid sequence encoded by the variant nucleic acid.

However, nucleotide changes in variant nucleic acids may result in substitutions, additions, or deletions within the polypeptide encoded by the variant nucleic acid relative to the polypeptide encoded by the reference nucleic acid. In addition, nucleotide modifications in the coding region can result in conservative or non-conservative substitutions within the amino acid sequence of the polypeptide.

Preferably, the variant nucleic acid according to the present invention substantially preserves the same function or biological activity as the polypeptide of the reference nucleic acid or substantially reduces the ability to be recognized by the antibody directed against the polypeptide encoded by the initial reference nucleic acid. Encodes the conserved polypeptide.

Thus, some variant nucleic acids will encode mutated forms of polypeptides, and classification studies have made it possible to infer the structure-activity relationships of the proteins in question. Knowledge of these variants is essential in relation to the disease studied, because it is possible to understand the molecular cause of the pathology.

A “fragment” is to be understood to mean a nucleotide sequence of the same length as the reference nucleic acid and with reduced length relative to the reference nucleic acid throughout the consensus. Such nucleic acid “fragments” according to the present invention may optionally be included as a component in larger polynucleotides. The fragment is at least 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides in length of the nucleic acid according to the present invention. Or consists of oligonucleotides that range.

A “nucleic acid molecule” is a ribonucleoside (adenine, guanosine, uridine or cytidine; “RNA molecule”) or deoxyribonucleoside (de Oxycyanosine, deoxyguanosine, deoxythymidine or deoxycytidine; "DNA molecule"), or all phosphoester analogs thereof, such as phosphorothioate and thioester. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and especially DNA or RNA molecule, refers only to the primary and secondary structures of such molecules, and is not limited to any particular tertiary form. Thus, the term includes double-stranded DNA found particularly in linear or cyclic DNA molecules (eg, restriction fragments), plasmids and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences are conventional that provide only sequences in the 5 'to 3' direction along a non-transcribed chain of DNA (ie, a chain having a sequence homologous to mRNA). It may be described herein according to convention. A "recombinant DNA molecule" is a DNA molecule on which molecular biological manipulations have been performed.

Where a single stranded nucleic acid molecule can be annealed to other nucleic acid molecules under conditions of suitable temperature and solution ionic strength, the nucleic acid molecule can be "hybridized" with another nucleic acid molecule, such as cDNA, genomic DNA or RNA. "(See 40). Temperature and ionic strength conditions determine the "stringency" of hybridization. For prescreening homologous nucleic acids, low stringency hybridization conditions corresponding to T _m of 55 ° C., such as 5 × SSC, 0.1% SDS, 0.25% milk, and no formamide; Or 30% formamide, 5x SSC, 0.5% SDS. Moderately stringent hybridization conditions correspond to higher T _m , for example 40% formamide, 5x or 6x SCC. Highly stringent hybridization conditions correspond to the highest T _m , for example 50% formamide, 5x or 6x SCC. In order to hybridize, two nucleic acids must contain complementary sequences, but mismatches between bases are possible depending on the stringency of the hybridization. Suitable stringency for hybridizing nucleic acids depends on the length and degree of complementarity of the nucleic acids, which are well known in the art. The greater the similarity or homology between two nucleotide sequences, the greater the T _m value for hybrids of nucleic acids having these sequences. The relative stability of nucleic acid hybridization (corresponding to higher T _m ) is lowered in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids greater than 100 nucleotides in length, an equation for calculating T _m was derived (see 40, 9.50-0.51). In the case of shorter nucleic acids, ie oligonucleotides, the location of mismatches becomes more important and the length of such oligonucleotides determines their specificity (Sambrook et al., 11.7-11.8). Preferably, the minimum length for the hybridizable nucleic acid is at least about 10, preferably at least about 15, more preferably at least about 20 nucleotides.

In certain embodiments, the term “standard hybridization conditions” refers to a T _m of 55 ° C. and utilizes the conditions as mentioned above. In a preferred embodiment, T _m is 60 ° C., and in a more preferred embodiment, T _m is 65 ° C.

For the purposes of the present invention, "highly stringent hybridization conditions" will be understood to mean the following conditions:

1- Membrane Competition and Prehybridization:

Mix: 40 μl salmon sperm DNA (10 mg / ml) +40 μl human placental DNA (10 mg / ml).

Degenerate at 96 ° C. for 5 min, and then impregnate the mixture in ice.

Remove 2X SSC and pour 4 ml of formamide mixture into the hybridization tube containing the membrane.

Add a mixture of two degenerate DNAs.

Incubate at 42 ° C. for 5 or 6 hours with rotation.

2- labeled probe competition:

To the labeled and purified probe, add 10-50 μl Cot I DNA depending on the amount of repeat sequence.

Degenerate at 95 ° C. for 7 to 10 minutes.

Incubate at 65 ° C. for 2-5 hours.

3- Hybridization:

Remove the prehybridization mixture.

Mix 40 μl salmon sperm DNA + 40 μl human placental DNA; After degeneracy for 5 min at 96 ° C., the mixture is impregnated in ice.

To the hybridization tube add 4 ml of a formamide mixture, a mixture of two DNAs and a degenerate labeled probe / Cot I DNA.

Incubate at 42 ° C. for 15 or 20 hours with rotation.

4- washing and exposure

Wash once by washing in 2X SSC at room temperature.

Wash twice for 5 minutes with 2X SSC at room temperature and 0.1% SDS at 65 ° C.

Wash twice for 15 minutes with 1 × SSC at 65 ° C. and 0.1% SDS at 65 ° C.

The membrane is wrapped in a clean plastic wrap and exposed.

The above-mentioned hybridization conditions are adapted to hybridize nucleic acid molecules of various lengths from 20 nucleotides to hundreds of nucleotides under highly stringent conditions. It goes without saying that the above mentioned hybridization conditions can be adjusted as a function of the length of the nucleic acid to be hybridized or the type of label selected according to techniques known to those skilled in the art. Suitable hybridization conditions can be adjusted, for example, according to the teachings set forth in Ref. 43 or 47.

As used herein, the term “oligonucleotide” refers to a nucleic acid, generally 15 or more nucleotides in length, that is hybridizable with the nucleic acid according to the invention. Oligonucleotides can be labeled, for example, with nucleotides covalently conjugated with labels such as ³² P-nucleotides, or biotin. In one embodiment, labeled oligonucleotides can be used as probes to detect the presence or absence of a nucleic acid encoding an RGS18 polypeptide of the invention. In another embodiment, oligonucleotides (which can label one or both of them) can be used as PCR primers to clone the full-length RGS18 nucleic acid or fragment thereof or to detect the presence of a nucleic acid encoding RGS18. have. In a further embodiment, the oligonucleotides of the invention may form triple helices with the RGS18 DNA molecule. In general, oligonucleotides are prepared synthetically, preferably on nucleic acid synthesizers. Thus, oligonucleotides can be prepared using non-natural phosphoester homologue bonds such as thioester bonds and the like.

"Homologous recombination" refers to the insertion of a foreign DNA molecule of a vector into a chromosome. Preferably, the vector targets a chromosomal site specific for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions homologous to the chromosomal sequence to allow complementary binding and to incorporate the vector into the chromosome. Longer homology regions and higher sequence similarity can increase the efficiency of homologous recombination.

DNA “coding sequences” are double-stranded DNA sequences that are transcribed in cells in vitro or in vivo and translated into polypeptides when placed under the control of appropriate regulatory sequences. The boundaries of this coding sequence are determined by the start codon at the 5 '(amino) terminus and the translation stop codon at the 3' (carboxyl) terminus. Coding sequences may include, but are not limited to, prokaryotic sequences, cDNAs from eukaryotic mRNAs, genomic DNA sequences from eukaryotic (eg mammalian) DNAs, and even synthetic DNA sequences. If the coding sequence is used for expression in eukaryotic cells, the polyadenylation signal and transcription termination sequence will normally be localized to 3 'of this coding sequence.

Transcriptional and translational regulatory sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, etc. that provide for expression of coding sequences in a host cell. In eukaryotic cells, the polyadenylation signal is a regulatory sequence.

"Regulatory region" refers to a nucleic acid sequence that regulates the expression of a nucleic acid. Regulatory regions may include sequences that are originally involved in the expression of a particular nucleic acid (homologous region), or may include sequences of different origin (involved in the expression of different proteins or even synthetic proteins). In particular, the sequence may be a sequence or derived sequence of a eukaryotic or viral gene that stimulates or inhibits transcription of a particular gene in a specific or non-specific manner and inducible or non-inducible manner. Regulatory regions include replication origins, RNA splice sites, enhancers, transcription termination sequences, signal sequences that direct polypeptides into the secretory pathway of target cells, and promoters.

Regulatory regions from “heterologous sources” are regulatory regions that are not naturally associated with expressed nucleic acids. Heterologous regulatory regions include regulatory regions from different species, regulatory regions from different genes, hybrid regulatory regions, and regulatory regions not present in nature but designed by one of ordinary skill in the art.

"Cassette" refers to a segment of DNA that can be inserted into a vector at certain restriction sites. This fragment of DNA encodes the polypeptide of interest, and the cassette and restriction site are designed such that the cassette can be inserted into a reading frame suitable for transcription and translation.

A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of downstream (3 ′ direction) coding sequences. For the purposes of the present invention, the promoter sequence is bound to its 3 'end by a transcription initiation site and is top (5' direction) to contain the minimum number of elements or bases necessary to initiate transcription to a detectable level above the background value. Extends. Within this promoter sequence, there will be a protein initiation domain (consensus sequence) that is involved in the binding of the RNA polymerase as well as the transcription initiation site (eg, typically defined by mapping with nuclease S1).

The coding sequence refers to the "regulation of transcriptional and translational regulatory sequences in cells when an RNA polymerase transcribs the coding sequence into mRNA and then trans-RNA splices and then translates into a protein encoded by said coding sequence. Is under ".

A "signal sequence" is included at the beginning of the coding sequence of a protein to be expressed on the surface of a cell. This sequence encodes a signal peptide, ie, the N-terminus, to a mature polypeptide that directs the host cell to translocate the polypeptide. The term “translocation signal sequence” is used herein to refer to a signal sequence of this kind. Translocation signal sequences can be found in association with a variety of prokaryotic and eukaryotic native proteins and are often functional in both types of organisms.

A "polypeptide" is a polymeric compound consisting of covalently linked amino acid residues. Amino acids have the following structure:

Amino acids are classified into seven groups based on side chain R: (1) aliphatic side chains, (2) side chains containing hydroxyl (OH) groups, (3) side chains containing sulfur atoms, (4) acidic Or proline, wherein the side chain contains an amide group, (5) a side chain containing a basic group, (6) a side chain containing an aromatic ring, and (7) the side chain is imino acid fused with an amino group.

A "protein" is a polypeptide that plays a structural or functional role in living cells.

Polypeptides and proteins of the invention may or may not be glycosylated.

"Homologousity" refers to similarity of sequences that reflect a common evolutionary origin. Polypeptides or proteins are considered to have homology or similarity when a significant number of their amino acids are (1) identical or (2) chemically similar R side chains. Nucleic acids are considered to be homologous when a significant number of their nucleotides are identical.

An "isolated polypeptide" or "isolated protein" refers to a polypeptide that is substantially free of compounds (eg, other proteins or polypeptides, nucleic acids, carbohydrates, lipids) that are normally associated with them in their natural state or Protein. The term “isolated” does not exclude artificial or synthetic mixtures with other compounds, or does not interfere with biological activity, for example, incomplete tablets, addition of stabilizers or compounding into pharmaceutically acceptable formulations. This does not exclude the presence of impurities that may be present.

By “fragment” of a polypeptide according to the invention is meant a polypeptide whose amino acid sequence is shorter than the amino acid sequence of the reference polypeptide and comprises the same amino acid sequence throughout the entire portion of these reference polypeptides. Such fragments may optionally be included in larger polypeptides in which they are present in part. Fragments of polypeptides according to the invention may be 10, 15, 20, 30 to 40, 50, 100, 200 or 300 amino acids in length.

A “variant” of a polypeptide according to the invention mainly means a polypeptide whose amino acid sequence contains one or more substitutions, additions or deletions of one or more amino acid residues relative to the amino acid sequence of the reference polypeptide, such amino acid Substitutions can be conservative or non-conservative.

A “variant” of a polypeptide or protein is any homolog, fragment, derivative or mutant derived from a polypeptide or protein and retaining one or more biological properties of such polypeptide or protein. Different variants of the polypeptide or protein may exist naturally. These variants may be allelic variants characterized by differences in the nucleotide sequence of the structural gene encoding the protein, or may include different splicing or post-translational modifications. Variants also include related proteins that have been obtained from different species but have substantially the same biological activity.

One skilled in the art can generate variants with single or multiple amino acid substitutions, deletions, additions or substitutions. These variants include, in particular, (a) variants in which one or more amino acid residues are replaced with conservative or non-conservative amino acids, (b) variants in which one or more amino acid residues are added to a polypeptide or protein, (c) one or more amino acid residues Variants comprising a divalent substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide (eg, serum albumin). Techniques for obtaining these variants, including genetic (inhibition, deletion, mutation, etc.), chemical and enzymatic techniques, are known to those skilled in the art.

The allelic variants, homologues, fragments, derivatives, mutants and modifications, including selective mRNA splicing forms and selective post-translational modifications, result in a polypeptide having any biological activity of that polypeptide. When derivatives are produced, these are also considered to be within the scope of the present invention.

A "vector" is a replicon, for example, a plasmid, virus, phage or cosmid, to which another DNA fragment may be attached to cause replication of the attached fragment. A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that acts as an autonomous unit of DNA replication in vivo, ie that can replicate under its control.

The invention also relates to cloning vectors containing genes encoding homologues and derivatives of the RGS18 polypeptides of the invention, which have the same or homologous functional activity as the RGS18 polypeptides and homologs thereof from other species. The production and use of derivatives and homologues related to RGS18 are within the scope of the present invention. In certain embodiments, such derivatives or homologues may exhibit functional activity, ie, one or more functional activities associated with the full length wild-type RGS18 polypeptide of the invention.

RGS18 derivatives can be made by changing the coding amino acids by substitutions, additions or deletions which provide functionally equivalent molecules. Preferably, derivatives are produced that have enhanced or increased functional activity over the original RGS18.

Due to the degeneracy of the nucleotide coding sequence, other DNA sequences encoding amino acid sequences substantially identical to the RGS18 gene can be used in the practice of the present invention. These include nucleotide sequences, allelic genes, and homologs from other species, including all or part of the RGS18 gene, which are altered by substitution of different codons encoding the same amino acid residues in the sequence, resulting in silent changes. It is not limited to this. Similarly, the RGS18 derivative of the present invention contains, as a primary amino acid sequence, all or part of the amino acid sequence of the RGS18 protein, including a changed sequence in which functionally equivalent amino acid residues are substituted by residues in the sequence that result in conservative amino acid substitutions. And the like, but not limited thereto. For example, one or more amino acid residues in a sequence may be substituted with another amino acid of similar polarity, acting as a functional equivalent resulting in a silent change. Substituents for amino acids in the sequence may be selected from other members of the class to which they belong. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids containing an aromatic ring structure are phenylalanine, tryptophan and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. This change will not affect the apparent molecular weight as determined by polyacrylamide gel electrophoresis or isoelectric point.

Particularly preferred substitutions are as follows:

-Replace Arg with Lys or Lys with Arg so that a positive charge can be maintained;

Replacing Asp with Glu or replacing Glu with Asp so that a negative charge can be maintained;

Substituting Thr for Ser or Ser for Thr so that free -OH can be maintained;

-Replace Asn with Gln or Gln with Asn so that free CONH ₂ is maintained.

Amino acid substitutions can be introduced to replace amino acids with particularly desirable properties. For example, Cys can be introduced at a potential site for forming a disulfide bridge with another Cys. His can be introduced in particular as a “catalytic” site (ie His can act as an acid or base, which is the most common amino acid in biochemical catalysis). Pro can be introduced due to its specific planar structure, which induces b-turns in the protein structure.

Genes encoding the RGS18 derivatives and homologues of the invention can be produced by a variety of methods known in the art. Their production manipulations can be made at the gene or protein level. For example, the cloned RGS18 gene sequence can be modified by a number of strategies known in the art (40). This sequence can be cleaved with restriction endonuclease (s) at appropriate sites and then optionally further enzymatically modified, isolated and then linked in vitro. In generating genes encoding derivatives or homologues of RGS18, care should be taken to ensure that such modified genes are maintained in the same translational reading frame as the RGS18 gene without being interrupted by the translational termination signal in the gene region encoding the desired activity. Should be.

Additionally, the RGS18-encoding nucleic acid is mutated in vitro or in vivo to generate and / or disrupt translation, initiation and / or termination sequences, generate mutations in the coding region, and / or create new restriction endogenes. Breaking up the formation or pre-existing cleases promotes further in vitro modification. Preferably such mutations enhance the functional activity of the mutated RGS18 gene product as described above. Any mutagenesis technique known in the art can be used, including, but not limited to, the use of a TAB ^R linker (Pharmacia) for in vitro site-directed mutagenesis (54-58). PCR techniques are preferred for site directed mutagenesis (see 59).

The genes identified and isolated as above can then be inserted into a suitable cloning vector. Many vector-host systems known in the art can be used. Possible vectors include, but are not limited to, plasmids or modified viruses, and the vector system must match the host cell used. Examples of vectors include Escherichia coli , bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives such as pGEX vectors, pmal-c, pFLAG and the like. There is, but is not limited to this. Insertion into the cloning vector can be performed, for example, by linking the DNA fragment into a cloning vector with complementary cohesive ends. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. On the other hand, by linking a nucleotide sequence (linker) on the corresponding DNA end, any site of interest can be generated; These linked linkers may comprise chemically synthesized specific oligonucleotides encoding restriction endonuclease recognition sequences. Recombinant molecules can be introduced into host cells through transformation, transfection, infection, electroporation, and the like, such that many copies of the gene sequence are produced. Preferably, such cloned genes provide shuttles in cloning cells (eg Escherichia coli) and optionally provide for easy purification for subsequent insertion into appropriate expression cell lines. Contain on vector plasmid. For example, shuttle vectors, which are vectors that can be replicated in one or more types of organisms, connect the sequences from the Escherichia coli plasmid with the sequences from the yeast 2m plasmid, thereby escalating Escherichia coli and Saccharomyces se. It can be prepared for replication in both Saccharomyces cerevisiae .

Alternatively, the gene of interest can be identified and separated after insertion into a suitable cloning vector in a "shot gun" approach. For example, enrichment of the gene of interest by fractionation by size can be performed prior to insertion into the cloning vector.

The nucleotide sequence encoding the RGS18 polypeptide, or antigenic fragments, derivatives or homologs thereof, or functionally active derivatives thereof (including chimeric genes) contain elements necessary for the transcription and translation of an appropriate expression vector, i.e., the inserted protein coding sequence. Can be inserted into a vector. Such elements are referred to herein as "promoters." Thus, the nucleic acid encoding the RGS18 polypeptide of the invention is operably associated with a promoter in the expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under the control of these regulatory sequences. The expression vector preferably also includes a replication origin.

Essential transcriptional and translational signals can be provided on recombinant expression vectors, or they can be supplied by native genes encoding RGS18 and / or flanking regions thereof.

Efficacy host-vector systems include mammalian cell systems infected with viruses (eg vaccinia virus, adenovirus, etc.); Insect cell systems infected with viruses (eg, baculovirus); Microorganisms such as yeast containing yeast vectors; Or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of the vector vary in their strength and specificity. Depending on the host-vector system employed, any of a number of suitable transcription and translation elements can be used.

The recombinant RGS18 protein of the invention, or functional fragments, derivatives, chimeric constructs or homologues thereof, can be chromosomally expressed after incorporation of the coding sequence by recombination. In this regard, a number of amplification systems can be used to achieve high levels of stable gene expression (40).

Cells incorporating a recombinant vector comprising a nucleic acid encoding an RGS18 polypeptide according to the present invention are cultured in a suitable cell culture medium under conditions that provide expression of the RGS18 polypeptide by such cells.

Prior art methods for inserting DNA fragments into cloning vectors can be used to construct expression vectors containing genes consisting of appropriate transcriptional / translational regulatory signals and protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination).

Expression of the RGS18 polypeptide may also be regulated by all promoter / enhancer elements known in the art, but these regulatory elements must be functional in the host selected for expression. Promoters that can be used to regulate RGS18 gene expression include the SV40 early promoter region 60, the promoter contained within the 3 'long terminal repeat sequence of the Raus sarcoma virus, the herpes thymidine kinase promoter 62, and the metallothione Regulatory sequence 63 of the phosphorus gene; Prokaryotic expression vectors such as the b-lactamase promoter 64 or the tac promoter 65 ("Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94); Promoter elements from yeast or other fungi, such as the Gal 4 promoter, ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; And animal transcriptional regulatory regions that exhibit tissue specificity and have been used in transgenic animals; Elastase I gene regulatory regions (66-68) active in pancreatic acinar cells; Insulin gene regulatory region active in pancreatic beta cells (69), immunoglobulin gene regulatory region active in lymphoid cells (70-72), mouse breast tumor virus regulatory region active in testes, breast, lymphatic and mast cells (73) , Albumin gene regulatory region (74) active in liver, alpha-fetoprotein gene regulatory region (75,76) active in liver, alpha 1-antitrypsin gene regulatory region (77) active in liver, active in bone marrow cells In beta-globin gene regulatory region (78,79), myelin basic protein gene regulatory region (80) active in oligodendrocytes in the brain, myosin light chain-2 gene regulatory region (81) active in skeletal muscle, and in the hypothalamus Active gonadotropin releasing hormone gene regulatory regions 82 are included, but are not limited to these.

Expression vectors comprising nucleic acids encoding RGS18 polypeptides of the invention can be identified by four general approaches: (a) polymerase chain reaction (PCR) amplification of the desired plasmid DNA or specific mRNA, ( b) nucleic acid hybridization, (c) presence or absence of selectable marker gene function, (d) analysis with appropriate restriction endonucleases, and (e) expression of inserted sequences. In a first approach, nucleic acids can be amplified by PCR to provide for detection of such amplified products. In a second approach, nucleic acid hybridization using a probe comprising a sequence homologous to an inserted marker gene can detect the presence of a foreign gene inserted into the expression vector. In a third approach, certain "screening marker" gene actions (e.g., β-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, baculo) caused by foreign gene insertion in the vector Recombinant vector / host systems can be identified and selected based on the presence or absence of occlusal formation in viruses, etc.). In another example, when a nucleic acid encoding an RGS18 polypeptide is inserted into the "selection marker" gene sequence of the vector, a recombinant comprising the RGS18 nucleic acid insert can be identified as lacking the "selection marker" gene function. have. In a fourth approach, recombinant expression vectors can be identified by digestion with appropriate restriction enzymes. In a fifth approach, recombinant expression vectors can be identified by assaying the activity, biochemical or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein must have a functionally active conformation.

A wide variety of host / expression vector combinations can be used to express nucleic acids of the invention. Useful expression vectors can, for example, consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids such as Escherichia coli plasmid col E1, pCR1, pBR322, pMal-C2, pET, pGEX (83), pMB9 and derivatives, plasmids thereof, for example , RP4; Phage DNA such as phage 1, such as NM989, and many other phage DNA such as M13 and filamentary single-chain phage DNA; Yeast plasmids such as 2m plasmids or derivatives thereof; Vectors useful for eukaryotic cells, such as vectors useful for insect or mammalian cells; Vectors derived from a combination of plasmid and phage DNA, such as plasmids modified to utilize phage DNA or other expression control sequences, and the like.

For example, in the baculovirus expression system, non-fusion transition vectors such as pVL941 (BamH1 cloning site; Summers), pVL1393 (BamH1, SmaI, XbaI, EcoRI, NotI, XmaIII, BglII and PstI cloning Site; Invitrogen), pVL1392 (BglII, PstI, NotI, XmaIII, EcoRI, XbaI, SmaI and BamH1 cloning site; Summers and Invitrogen), and pBlueBacIII (BamH1, BglII, PstI, NcoI and HindIII cloning site, blue / White recombinant screening is possible, but not limited to: Invitrogen; And fusion transfer vectors such as pAc700 (BamH1 and KpnI cloning sites; wherein the BamH1 recognition site starts with an initiation codon; Summers), pAc701 and pAc702 (same as pAc700, but with different reading frames) 3 different reading frames with pAc360 (36 base pairs downstream of the BamH1 cloning site of the polyhedrin initiation codon; Invitrogen (195)), and pBlueBacHisA, B, C (BamH1, PstI, NcoI and HindIII cloning sites, ProBond tablets Blue / white recombinant screening of N-terminal peptides for, and plaques from Invitrogen (220)) can all be used.

Mammalian expression vectors contemplated for use in the present invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, such as DHFR expression vectors, or DHFR / methotrexate co-amplification factors, For example, all expression vectors with pEDs (PstI, SalI, SbaI, SmaI and EcoRI cloning sites) are included, which express both the cloned gene and DHFR (84). On the other hand, glutamine synthetase / methionine sulfoximine co-amplification factors such as pEE14 [HindIII, XbaI, SmaI, SbaI, EcoRI and BclI cloning sites, wherein the vector expresses glutamine synthase and cloned genes do); Manufacturer: Celltech]. In another embodiment, vectors that direct episomal expression under the control of Epstein Barr virus (EBV), such as pREP4 (BamH1, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning sites, constructs) Sex RSV-LTR promoter, hygromycin selectable marker; Invitrogen), pCEP4 (BamH1, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning sites, constitutive hCMV immediate early genes, Hygromycin selectable markers; Invitrogen), pMEP4 (KpnI, PvuII, NheI, HindIII, NotI, XhoI, SfiI, BamH1 cloning site, inducible metallothionein IIa gene promoter, hygromycin selectable marker; manufacturer: Invitrogen ), pREP8 (BamH1, XhoI, NotI, HindIII, NheI and KpnI cloning sites, RSV-LTR promoter, histidinol selectable marker; Invitrogen), pREP9 (KpnI, NheI, HindIII, NotI, XhoI, SfiI, BamH1 cloning Site, RSV-LTR promoter, G418 selectable marker; : Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selectable marker, N-terminal peptide purified by ProBond resin and cleaved by enterokinase; Invitrogen) can be used. Selective mammalian expression vectors for use in the present invention include pRc / CMV (HindIII, BstXI, NotI, SbaI and ApaI cloning sites, G418 selection; Invitrogen), pRc / RSV (HindIII, SpeI, BstXI, NotI, XbaI cloning sites , G418 screening, Invitrogen) and the like. Vaccinia virus mammalian expression vectors 84 for use in accordance with the present invention include pSC11 (SmaI cloning site, TK- and b-gal selection), pMJ601 (SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII, KpnI and HindIII cloning sites; TK- and b-gal selection), and pTKgptF1S (EcoRI, PstI, SalI, AccI, HindII, SbaI, BamHI and Hpa cloning sites, TK or XPRT selection) It is not.

Yeast expression systems expressing the RGS18 polypeptide may also be used in accordance with the present invention. For example, to mention only two, non-fused pYES2 vectors (XbaI, SphI, ShoI, NotI, GstXI, EcoRI, BstXI, BamHI, SacI, KpnI, and HindIII cloning sites; Invitrogen) or fused pYESHisA, B, C (XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BamHI, SacI, KpnI and HindIII cloning sites, N-terminal peptides purified through ProBond resin and cleaved by enterokinase; manufactured by Invitrogen) in accordance with the present invention Can be used.

Once a particular recombinant DNA molecule has been identified and isolated, it can be propagated using several methods known in the art. Once suitable host systems and growth conditions are established, recombinant expression vectors can be quantitatively grown and prepared. As described above, expression vectors that may be used include, but are not limited to, the following vectors or derivatives thereof: human or animal viruses such as vaccinia virus or adenovirus; Insect viruses such as baculovirus; Yeast vectors; Bacteriophage vectors such as lambda and plasmid and cosmid DNA vectors.

In addition, host cell strains can be selected that modulate the expression of the inserted sequences or modify and process the gene product in a specific, desired manner. Different host cells have mechanisms that are characteristic and specific for translation and post-translational processing and modification of proteins (eg, glycosylation, cleavage (eg, of signal sequences)). Appropriate cell lines or host systems can be selected to ensure the desired modification and processing of the expressed foreign protein. For example, expression in bacterial systems can be used to produce non-glycosylated core protein products. However, RGS18 protein expressed in bacteria may not be properly folded. Expression in yeast can produce glycosylation products. Expression in eukaryotic cells can increase the likelihood of "natural" glycosylation and folding of heterologous proteins. Moreover, expression in mammalian cells can provide a tool for reconfiguring or configuring RGS18 activity. In addition, different vector / host expression systems can affect processing reactions, for example, to varying degrees, proteolytic cleavage.

Vectors are known in the art such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection, use of gene guns, or DNA By the use of a vector transporter, it is introduced into the host cell of interest (see 85-87).

When introducing the DNA inside the cell, the cell was "transfected" by exogenous or heterologous DNA. When such transfected DNA exhibited a phenotypic change, the cells were "transformed" by exogenous or heterologous DNA. Preferably, the transgenic DNA should be integrated into the chromosomal DNA making up the genome of the cell in question.

Recombinant marker proteins expressed as inner membrane proteins can be isolated and purified by standard methods. Generally, the incorporating membrane proteins clean such membranes, for example, sodium dodecyl sulfate (SDS), Triton X-100 polyoxyethylene ether, Ipagel / nonidet P-40 (NP-40). It can be obtained by dissolving with (octylphenoxy) -polyethoxyethanol, digoxin, sodium deoxycholate and the like, including but not limited to these. Solubilization can be enhanced by sonicating the suspension. Soluble forms of the protein can be obtained by collecting the culture fluid, for example by treating with a detergent and solubilizing the inclusion body, optionally by sonication or by other mechanical processes as mentioned above. Such solubilized or soluble proteins can be prepared by various techniques such as polyacrylamide gel electrophoresis (PAGE), isoelectric point electrophoresis, two-dimensional gel electrophoresis, chromatography (eg ion exchange, affinity, immunoaffinity and sizing column chromatography). Chromatography), centrifugation, different solubility, immunoprecipitation, or other standard techniques for purifying proteins.

Alternatively, nucleic acids or vectors according to the invention can be introduced in vivo by lipofection. Over the past decade, the use of liposomes to encapsulate and transfect nucleic acids in vitro has been increasing. Synthetic cationic lipids designed to limit the difficulties and risks encountered in liposome mediated transfection can be used to prepare liposomes for in vivo transfection of genes encoding markers (88-90). The use of cationic lipids can increase the encapsulation of negatively charged nucleic acids and can also enhance fusion with negatively charged cell membranes (91). Particularly useful lipid compounds and compositions for transferring nucleic acids are described in WO 95/18863 and WO 96/17823, and US Pat. No. 5,459,127. The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one advantage. It is clear that directing transfection to specific cell types will be particularly desirable in tissues with cellular heterogeneity, such as the pancreas, liver, kidney and brain. For targeting, the lipid can be chemically coupled to other molecules (89). Targeted peptides, such as hormones or neurotransmitters, and proteins, such as antibodies or non-peptide molecules, can be chemically coupled to liposomes.

Other molecules are also useful for facilitating transfection of nucleic acids in vivo and include, for example, cationic oligopeptides (eg WO 95/21931), peptides derived from DNA binding proteins (eg international publication). Publication WO 96/25508) or cationic polymers such as WO 95/21931.

It is also possible to introduce these vectors as explanted DNA plasmids in vivo (see US Pat. Nos. 5,693,622, 5,589,466 and 5,580,859). Extracted DNA vectors for gene therapy are well known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, the use of gene guns. Or by the use of a DNA vector transporter, it can be introduced into the host cell of interest (see 85-87, 92). Receptor-mediated DNA delivery approaches may also be used (93,94).

"Pharmaceutically acceptable vehicle or excipient" includes pharmaceutically acceptable diluents and fillers in the method of administration, which may be sterile and aqueous or oleaginous suspensions formulated with suitable dispersing or wetting agents and suspending agents. . The pharmaceutically acceptable carrier and the ratio of the active compound to the carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration and standard pharmaceutical practice.

Any nucleic acid, polypeptide, vector or host cell of the invention will preferably be incorporated into a pharmaceutically acceptable vehicle or excipient in vivo. The expression “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerated and do not cause an allergic or similar undesirable reaction, such as vomiting, dizziness, etc. when administered to a human. Refer. Preferably, the term "pharmaceutically acceptable" as used herein refers to a US pharmacopoeia or other generally recognized pharmacopoeia that has been approved by federal or state officials for use in animals, more particularly humans. It means. The term “excipient” refers to a diluent, adjuvant, excipient, or vehicle with which the compound can be administered. Such pharmaceutical carriers can be sterile liquids such as water and oils, including oils of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous saline and aqueous dextrose and glycerol solutions are particularly preferably used as excipients for injection solvents. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Science" by E.W. Martin].

Originally, the present invention contemplates delivery of a vector that will express a therapeutically effective amount of RGS18 polypeptide for gene therapy applications. A "therapeutically effective amount" means an amount sufficient to reduce clinically significant deficiencies in the activity, function and response of the host by at least about 15%, preferably at least 50%, more preferably at least 90%, even more preferably. Means sufficient amount to prevent this. On the other hand, the therapeutically effective amount is an amount sufficient to bring clinically significant disease improvement in the host.

Nucleic Acids Encoding RGS18 Polypeptides

As part of a better understanding of the coordination of GPCR mediated signaling in platelets, we sought to identify G protein signaling regulator proteins (RGSs) present in human platelets and some megakaryocyte cell lines. RT-PCR was performed using degenerate oligonucleotides based on conserved regions of the highly homologous RGS domain, using human platelet RNA as well as RNA from several megakaryocyte cell lines. In addition to confirming the presence of some known RGS transcripts, novel RGS domain containing transcripts have been found in platelet RNA. Northern blot analysis of multiple human tissues indicates that the new transcript is expressed in the highest amount in platelets compared to other tissues examined. These RGS transcripts are expressed in large amounts in platelets, but at fairly low levels in other tissues, mainly hematopoietic system tissues. The transcript is expressed at moderate levels in three megakaryocyte cell lines and tissues of hematopoietic origin, such as white blood cells, bone marrow and spleen, and low levels of expression have also been detected in other tissues. The full length cloning of the novel RGS, named RGS18, demonstrates that the transcript encodes a 235 amino acid protein. RGS18 is the closest (46% identity) with RGS5 and shows about 30-40% identity with other RGS proteins. Peptide directed antiserum against RGS18 detects expression of about 30 kDa protein in platelet, leukocyte and megakaryocyte cell line lysates. Not binding than G _αz, G _αs or G _α12 from the lysate treated ^{platelet-vitro} RGS18 is an endogenous G _αi2, G _αi3 than binding and G _αq but, GDP + AlF ₄ -. RGS18 may be partly involved in the regulation of pathways critical for platelet activation, since the aggregation of platelets requires the activation of receptors coupled with G _αq and / or one or more forms of G _{α i} .

The present invention relates to a nucleic acid encoding RGS18, a novel G protein signaling regulator (RGS) protein. Thus, a first subject matter of the invention is a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Its complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or its complementary polynucleotide Nucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof g) the nucleotide of SEQ ID NO: 19 A nucleic acid comprising a polynucleotide sequence, or a complementary polynucleotide sequence of 418-658.

The invention also relates to a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof c) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) the polynucleotide sequence of nucleotide 418-658 of SEQ ID NO: 19, or 8 of its complementary polynucleotide sequence It relates to a nucleic acid comprising the above consecutive nucleotides.

Preferably, the nucleic acid according to the present invention comprises a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or Its complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, or d) the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or complementary thereof At least 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, or 500 consecutive nucleotides of the polynucleotide sequence.

The invention also provides a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary poly thereof Nucleotide sequence, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof A) the polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) SEQ ID NO: 19 nucleotides 418-658 poles It relates to a nucleic acid that represents the nucleotide sequence, or its complementary poly-nucleic acid material containing a nucleotide sequence and nucleotide identity of 80% or more.

The invention also provides a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary poly thereof Nucleotide sequence, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof A) the polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) SEQ ID NO: 19 nucleotides 418-658 poles The nucleotide sequence, or a nucleic acid material containing a complementary polynucleotide sequence thereof, and at least 85%, preferably 90%, more preferably 95%, even more preferably, to a nucleic acid that represents a nucleotide identity of 98%.

The present invention also provides, under a highly stringent condition, a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11. Or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complement thereof Red polynucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Or g) of SEQ ID NO: 19 A nucleic acid that hybridizes with the polynucleotide sequence of nucleotides 418-658, or its complementary polynucleotide sequence.

The invention also relates to nucleic acids encoding polypeptides comprising the novel RGS18 domain. Accordingly, a second subject of the invention is a) a polynucleotide sequence of SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide thereof A nucleic acid comprising a sequence, or c) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof.

The invention also relates to nucleic acids, in particular cDNA molecules, encoding full length human RGS18 protein. The present invention also relates to cDNA molecules encoding novel full length RGS18 proteins. Accordingly, the present invention encompasses a) a polynucleotide sequence of SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof, or b) a polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof It relates to a nucleic acid.

The invention also includes a) a polynucleotide sequence of SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof, or b) a polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof It relates to a nucleic acid.

According to the present invention, a nucleic acid comprising a polynucleotide sequence of SEQ ID NO: 18 or 19 encodes a full length RGS18 domain polypeptide of 235 amino acids comprising the amino acid sequence of SEQ ID NO: 20.

The invention also relates to nucleic acids encoding polypeptides comprising the novel RGS18 domain. In a preferred embodiment, the invention relates to a nucleic acid encoding a polypeptide comprising the amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the nucleic acid according to the invention encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 20.

RGS18 polypeptide

The invention also relates to a polypeptide comprising the novel RGS18 domain according to the invention.

Thus, the present invention relates to hexanes encoding polypeptides comprising the amino acid sequences of amino acids 86-202 of SEQ ID NO: 20.

The present invention also relates to polypeptides comprising the novel RGS18 domain. In a preferred embodiment, the polypeptide according to the invention comprises the amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the polypeptide according to the invention comprises the amino acid sequence of SEQ ID NO: 20.

The invention also relates to a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 20.

The invention also relates to a polypeptide comprising an amino acid sequence comprising amino acids 86-202 of SEQ ID NO: 20.

The invention also relates to a) an amino acid sequence of SEQ ID NO: 12 or 20, b) an amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, c) an amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, d) of SEQ ID NO: 20 An amino acid sequence of amino acids 86-202, or e) a polypeptide comprising an amino acid sequence exhibiting at least 80% amino acid identity with a polypeptide comprising an amino acid sequence of amino acids 86-166 of SEQ ID NO: 20.

The invention also relates to a) an amino acid sequence of SEQ ID NO: 12 or 20, b) an amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, c) an amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, d) of SEQ ID NO: 20 E) at least 85%, preferably 90%, more preferably 95%, even more preferably an amino acid sequence of amino acids 86-202, or e) a polypeptide comprising an amino acid sequence of amino acids 86-166 of SEQ ID NO: 20 It relates to a polypeptide exhibiting 98% amino acid identity.

Preferably, the polypeptide according to the invention is a polypeptide according to the invention, in particular a) an amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, b) an amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, or c) 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100 or 200 contiguous amino acids of the polypeptide comprising the amino acid sequences of amino acids 86-166 of SEQ ID NO: 20.

On the other hand, a polypeptide according to the invention is a polypeptide according to the invention, more particularly a) an amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, b) an amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, or c ) 15, 18, 20, 25, 35, 40, 50, 100 or 200 contiguous amino acid lengths of the polypeptide comprising the amino acid sequences of amino acids 86-166 of SEQ ID NO: 20.

Nucleotide Probes and Primers

Nucleotide probes and primers that hybridize with the nucleic acids according to the invention (genomic DNA, messenger RNA, cDNA) also form part of the invention. Thus, the definition of a nucleotide probe or primer according to the present invention encompasses an oligonucleotide that hybridizes with the polynucleotide sequence of the nucleic acid according to the present invention or its complementary polynucleotide sequence under the highly stringent hybridization conditions mentioned above. .

According to the present invention, nucleic acid fragments derived from polynucleotides according to the invention are useful for detecting the presence of one or more copies of the nucleotide sequences of RGS18 nucleic acids or fragments or variants thereof (containing mutations or polymorphisms) in a sample.

According to the present invention, a nucleic acid fragment derived from a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 and 19, or a complementary polynucleotide sequence thereof, may be incorporated into a sample, containing a RGS18 gene or fragment or variant thereof (containing a mutation or polymorphism). Useful for detecting the presence of one or more copies of a nucleotide sequence. Thus, nucleotide probes and primers that hybridize with the nucleic acid sequences of nucleic acids encoding the RGS18 domain (genomic DNA, messenger RNA, cDNA) also form part of the present invention.

A nucleotide probe or primer according to the present invention comprises a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complement thereof Red polynucleotide sequence, c) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, or d) the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide thereof At least 8 contiguous nucleotides of a nucleic acid comprising a sequence.

Preferably, the nucleotide probe or primer according to the invention comprises a nucleic acid according to the invention, in particular a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a nucleotide of SEQ ID NO: 19 A polynucleotide sequence of 1-658, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) a nucleotide 418-658 of SEQ ID NO: 19 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 sequences of nucleic acids comprising the polynucleotide sequence of, or a complementary polynucleotide sequence thereof Will be nucleotides long.

On the other hand, a nucleotide probe or primer according to the present invention may comprise a nucleic acid according to the present invention, more particularly a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) of SEQ ID NO: 19 The polynucleotide sequence of nucleotides 1-658, or its complementary polynucleotide sequence, c) the nucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, or d) the nucleotide 418- of SEQ ID NO: 19 10, 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, or 1500 contiguous nucleotides in length of a nucleic acid comprising 658 polynucleotide sequences, or complementary polynucleotide sequences thereof And / or will comprise fragments with

Preferred probes and primers according to the invention are a) a polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35 or 36, or complementary thereof. A polynucleotide sequence, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or all or part of a complementary polynucleotide sequence thereof It includes.

Nucleotide primers according to the invention are nucleic acids according to the invention, more particularly a) the polynucleotide sequence of any one of SEQ ID NO: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) nucleotides 1-169 of SEQ ID NO: 11. The polynucleotide sequence of, or its complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19 Or a complementary polynucleotide sequence thereof, e) a polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complement thereof Red polynucleo A tide sequence, or g) a nucleic acid comprising a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof.

On the other hand, the nucleotide primers according to the invention comprise a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: Or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complement thereof Red polynucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof , Or g) It can be used to amplify a nucleic acid fragment or variant of a nucleic acid comprising the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence.

Thus, the definition of a nucleotide probe or primer according to the present invention encompasses an oligonucleotide that hybridizes with a nucleic acid according to the present invention or its complementary polynucleotide sequence under the highly stringent hybridization conditions mentioned above.

According to a preferred embodiment, the nucleotide primers according to the invention are nucleotide sequences of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35 or 36, or complementary thereof. Nucleic acid sequences.

Nucleotide probes or primers according to the present invention can be used for the cloning and action of restriction enzymes, or phosphodiester methods by Narang et al. (95) or Brown et al. (96), Beaucage et al. 97)] or any suitable method well known to those skilled in the art, including the direct chemical synthesis method according to the technique on solid support as described in EP 0,707,592 or the like.

Each nucleic acid according to the present invention, including the above-mentioned oligonucleotide probes and primers, may be labeled by incorporating markers, which may optionally be detected by spectrometer, photochemical, biochemical, immunochemical or chemical means. have. For example, such markers may be radioisotopes ( ³² P, ³³ P, ³ H, ³⁵ S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or ligands (Eg biotin). Labeling the probe is preferably performed by incorporating the labeled molecule into the corresponding polynucleotide by primer extension or addition to the 5 'or 3' end. Examples of non-radioactive labeling of nucleic acid fragments are described in particular in French Patent No. 78 109 75 or in Urdea et al. (98) or Sanchez-Pescador et al. (99).

Preferably, nucleotide probes and primers according to the invention may have structural features of the type that allow for amplification of the signal, for example in Urdea et al. (100) or EP-0,225,807 (CHIRON). There is a probe described.

Oligonucleotides according to the invention can be used to hybridize with the corresponding messenger RNA or Southern type hybridization, in particular if one wishes to express the corresponding transcript in the sample.

Probes and primers according to the invention can also be used to detect PCR amplification products or to detect mismatches.

Nucleotide probes or primers according to the invention can be immobilized on a solid support. Such solid supports are well known to those skilled in the art and include well surfaces of microtiter plates, polystyrene beads, magnetic beads, nitrocellulose bands or microparticles such as latex particles.

Nucleic Acids Encoding RGS18 Polypeptides and Methods of Detecting RGS18 Polypeptides

The invention also relates to means for detecting RGS18 nucleic acids, proteins, and polypeptides comprising an RGS18 domain.

Preferred embodiments of the present invention

a) a pair of nucleotides localized on the 5 'side and 3' side of the target nucleic acid region to be amplified, in the presence of the reagents required for the amplification reaction, of the sample suspected of having the target nucleic acid; Contacting the primer; And

b) detecting the nucleic acid thus amplified

A nucleic acid according to the invention contained in said sample, more particularly a) a polynucleotide sequence of any one of SEQ ID NO: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) the nucleotide 1 of SEQ ID NO: 11 -169 polynucleotide sequence, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide of nucleotides 163-870 of SEQ ID NO: 19 Nucleotide sequence, or its complementary polynucleotide sequence, e) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, f) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or Its complementary polynucleotide standing Column, or g) a nucleic acid comprising a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or a nucleic acid fragment or variant thereof.

The present invention also provides

1) contacting one or more nucleotide probes according to the invention with a sample to be tested; And

2) detecting a complex that may be formed between the nucleic acid present in the sample and the probe (s)

In the sample, comprising: a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a Complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide thereof E) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g ) The nucleotide of SEQ ID NO: 19 A nucleic acid comprising a polynucleotide sequence, or a complementary polynucleotide sequence of 418-658, or to a method of detecting nucleic acid fragments thereof or whether variants are present.

According to a particular embodiment of the detection method according to the invention, said oligonucleotide probe and primer are immobilized on a support.

According to another aspect, the oligonucleotide probes and primers comprise a detectable marker.

The present invention also provides

a) one or more nucleotide probe (s) or primer (s) as mentioned above;

b) optionally a reagent required for the hybridization reaction

It relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample.

According to a first aspect, the detection box or kit is characterized in that the probe (s) and primer (s) are immobilized on a support.

According to a second aspect, the detection box or kit is characterized in that the oligonucleotide probe comprises a marker that can be detected.

According to certain embodiments of the aforementioned detection kits, such kits can be used for detecting a target nucleic acid of interest or for detecting a mutation in a coding or non-coding region of a nucleic acid according to the invention. It will include multiple oligonucleotide probes and / or primers.

Another subject of the invention is

1) a pair of nucleotide primers according to the invention localized on the 5 'and 3' sides of the target nucleic acid to be amplified, respectively; And optionally

2) Reagents Required for Amplification Reaction

A) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide thereof C) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, e) Polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) SEQ ID NO: 19 Polynucleotides of Nucleotide 418-658 Box or kit for amplifying all or part of a nucleic acid comprising a nucleotide sequence, or a complementary polynucleotide sequence thereof.

Such amplification boxes or kits will preferably comprise one or more pairs of nucleotide primers as mentioned above.

The present invention also provides

a) at least one nucleotide probe according to the invention;

b) optionally a reagent required for the hybridization reaction

It relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample.

According to a first aspect, the detection box or kit is characterized in that the nucleotide probe (s) and primer (s) are immobilized on a support.

According to a second aspect, the detection box or kit is characterized in that the nucleotide probe (s) and primer (s) comprise a marker that can be detected.

According to certain embodiments of the aforementioned detection kits, such kits will comprise a plurality of oligonucleotide probes and / or primers according to the invention, which can be used to detect target nucleic acids of interest.

According to a preferred embodiment of the invention, the target nucleic acid comprises a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide of nucleotides 1-169 of SEQ ID NO: Sequence, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a Complementary polynucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide thereof Sequence, or g) sequence Of nucleotides 418-658 of the arc 19 comprises a polynucleotide sequence, or a complementary polynucleotide sequence.

Alternatively, the target nucleic acid may be a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide thereof E) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g ) The nucleotide of SEQ ID NO: 19 It is a nucleic acid fragment or variant of a nucleic acid comprising a polynucleotide sequence, or a complementary polynucleotide sequence of de 418-658.

According to a preferred embodiment, the two primers according to the invention comprise all or part of SEQ ID NOs: 9 and 10, thereby enabling to amplify a nucleic acid having the region of nucleotide 163-870 or the complementary polynucleotide sequence of SEQ ID NO: 19. Do it.

According to a preferred embodiment, the two primers according to the invention comprise all or part of SEQ ID NOs: 14 and 15, thereby enabling to amplify a nucleic acid having the region or complementary polynucleotide sequence of nucleotides 510-839 of SEQ ID NO: 19. Do it.

According to a preferred embodiment, the two primers according to the invention comprise all or part of SEQ ID NOs: 14 and 16, thereby enabling to amplify a nucleic acid having the region or complementary polynucleotide sequence of nucleotides 510-885 of SEQ ID NO: 19. Do it.

According to a preferred embodiment, the two primers according to the invention comprise all or part of SEQ ID NOs: 14 and 17, thereby enabling to amplify a nucleic acid having the region or complementary polynucleotide sequence of nucleotides 510-923 of SEQ ID NO: 19. Do it.

According to another preferred embodiment, the primers according to the invention generally comprise a nucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35 or 36, Or all or part of its complementary sequence.

Thus, the probes according to the invention immobilized on a support can be arranged into a matrix such as a "DNA chip". The matrix thus arranged is described in particular in US Pat. No. 5,143,854, PCT Publications WO 90/15070 and WO 92/10092.

The support matrix onto which the oligonucleotide probes are immobilized at high density is described, for example, in US Pat. No. 5,412,087 and PCT International Publication WO 95/11995.

Nucleotide primers according to the invention can be used to amplify any one or complementary polynucleotide sequences of nucleic acids according to the invention. On the other hand, nucleotide primers according to the invention can be used to amplify nucleic acid fragments or variants of nucleic acids according to the invention, or their complementary polynucleotide sequences.

Another subject of the invention is

a) a pair of nucleotides localized on the 5 'side and 3' side of the target nucleic acid region to be amplified, in the presence of the reagents required for the amplification reaction, of the sample suspected of having the target nucleic acid; Contacting the primer; And

b) detecting the nucleic acid thus amplified

It relates to a method for amplifying a nucleic acid, or a complementary polynucleotide sequence thereof, according to the invention contained in the sample, comprising.

In order to carry out the amplification method as mentioned above, it will be preferable to use any of the nucleotide primers mentioned above.

The subject matter of the present invention is also

a) a pair of nucleotide primers according to the invention localized on the 5 'and 3' sides of the target nucleic acid to be amplified, respectively; And optionally

b) reagents required for the amplification reaction

A box or kit for amplifying all or part of a nucleic acid or its complementary polynucleotide sequence according to the invention, comprising a.

Such amplification boxes or kits will preferably comprise one or more pairs of nucleotide primers as mentioned above.

The present invention also provides

a) at least one nucleotide probe according to the invention;

b) optionally a reagent required for the hybridization reaction

It relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample.

According to a first aspect, the detection box or kit is characterized in that the nucleotide probe (s) and primer (s) are immobilized on a support.

According to a second aspect, the detection box or kit is characterized in that the nucleotide probe (s) and primer (s) comprise a marker that can be detected.

According to certain embodiments of the aforementioned detection kits, such kits can be used to detect a target nucleic acid of interest or to detect mutations in the coding or non-coding regions of a nucleic acid according to the invention. It will include multiple oligonucleotide probes and / or primers that follow.

According to a preferred embodiment of the invention, the target nucleic acid comprises a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide of nucleotides 1-169 of SEQ ID NO: Sequence, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a Complementary polynucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide thereof Sequence, or g) sequence Of nucleotides 418-658 of the arc 19 comprises a polynucleotide sequence, or a complementary polynucleotide sequence.

Alternatively, the target nucleic acid may be a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide thereof E) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g ) The nucleotide of SEQ ID NO: 19 It is a nucleic acid fragment or variant of a nucleic acid comprising a polynucleotide sequence, or a complementary polynucleotide sequence of de 418-658.

According to a preferred embodiment, the primers according to the invention are generally nucleotide sequences of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35 or 36, or It includes all or part of the complementary sequence.

Recombinant vector

The invention also relates to a recombinant vector comprising a nucleic acid according to the invention. For the purposes of the present invention "vector" means a circular or linear DNA or RNA molecule, in single- or double-stranded form.

Preferably, such recombinant vector is

a) 1) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, 2) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, 3) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 4) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 5) SEQ ID NO: The polynucleotide sequence of nucleotide 163-658 of 19, or its complementary polynucleotide sequence, 6) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, or 7) the nucleotide of SEQ ID NO: 19 418-658 Polynucleotides Nucleic acid comprising a nucleotide sequence, or a complementary polynucleotide sequence thereof;

b) a nucleic acid comprising a polynucleotide sequence as set forth in any one of SEQ ID NOs: 18 or 19, or a complementary polynucleotide sequence thereof;

c) 1) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or its complementary polynucleotide sequence, 2) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, 3) 8) of a nucleic acid comprising a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or 4) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleic acids having two or more consecutive nucleotides;

e) 1) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, 2) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, 3) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 4) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 5) SEQ ID NO: The polynucleotide sequence of nucleotide 163-658 of 19, or its complementary polynucleotide sequence, 6) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, or 7) the nucleotide of SEQ ID NO: 19 418-658 Polynucleotides Nucleic acids exhibiting at least 80% nucleotide identity with a nucleic acid comprising a nucleotide sequence, or a complementary polynucleotide sequence thereof;

f) 1) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, 2) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, 3) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 4) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, 5) SEQ ID NO: The polynucleotide sequence of nucleotide 163-658 of 19, or its complementary polynucleotide sequence, 6) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, or 7) the nucleotide of SEQ ID NO: 19 418-658 Polynucleotides Nucleic acids exhibiting at least 85%, 90%, 95%, or 98% nucleotide identity with a nucleic acid comprising a nucleotide sequence, or a complementary polynucleotide sequence thereof;

g) under highly stringent hybridization conditions: 1) the polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, 2) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Its complementary polynucleotide sequence, 3) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, 4) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or its complementary polynucleotide Nucleotide sequence, 5) the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, 6) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or 7) of SEQ ID NO: 19 Nucleic acids hybridizing with nucleic acids comprising the polynucleotide sequence of nucleotides 418-658, or a complementary polynucleotide sequence thereof;

h) a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 20; And

i) 1) amino acids 1-58 of SEQ ID NO: 12, 2) amino acids 1-166 of SEQ ID NO: 20, 3) amino acids 86-202 of SEQ ID NO: 20, or 4) polys comprising amino acids 86-166 of SEQ ID NO: 20 Nucleic Acids Encoding Peptides

It will include a nucleic acid selected from the group consisting of.

According to a first aspect, the recombinant vector according to the present invention is used to amplify a nucleic acid inserted herein and to perform transformation or transfection of a desired cellular host.

According to a second aspect, the recombinant vector according to the invention corresponds to an expression vector comprising a nucleotide sequence or a regulatory signal which directs or regulates the transcription and / or translation of the nucleic acid or its encoded mRNA, in addition to the nucleic acid according to the invention. do.

According to a preferred embodiment, the recombinant vector according to the invention will in particular comprise the following components:

(1) elements or signals for regulating the expression of the nucleic acid to be inserted, eg, promoter and / or enhancer sequences;

(2) a nucleotide coding region contained within a nucleic acid according to the invention to be inserted into said vector, said coding region being located in the same phase as the regulatory element or signal described in (1); And

(3) A nucleic acid suitable for initiating and terminating transcription of the nucleotide coding region of the nucleic acid according to (2).

In addition, recombinant vectors according to the invention may comprise one or more replication origins, markers or selectable markers in the cellular host to which they are to be amplified or expressed.

For example, the bacterial promoter can be a LacI or LacZ promoter, a T3 or T7 bacteriophage RNA polymerase promoter, a lambda phage PR or PL promoter.

Promoters for eukaryotic cells will include the herpes simplex virus (HSV) virus thymidine kinase promoter or the mouse metallothionein-L promoter.

In general, to select a suitable promoter, one of ordinary skill in the art can first refer to the teachings of Sambrook et al. (40) or Fuller et al. (101) cited above.

If one wishes to express the genomic sequence of the RGS18 gene, it would be desirable to use a vector that can contain large insertion sequences. In certain embodiments, bacteriophage vectors, such as the P1 bacteriophage vectors, such as the vector p158 or the vector p158 / neo8, described by Sternberg (102, 103), will preferably be used.

Preferred bacterial vectors according to the invention are, for example, vectors pBR322 (ATCC37017) or pAA223-3 (Pharmacia, Uppsala, Sweden) and pGEM1 (Promega Biotech, Madison, WI, UNITED STATES) .

Other commercially available vectors, such as the vectors pQE70, pQ60, pQE9 (Qiagen), psiX174, pBluescript SA, pNH8A, pNH16A, pNH18A, pNH46A, pWLNEO, pSV2CAT, pOG44, pXT1, pSG (manufacture) It may be.

They may also be vectors of the baculovirus type, such as the vector pVL1392 / 1393, used to transfect Sf9 cell line (ATCC No. CRL 1711) derived from Spodoptera frugiperda .

The invention also relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 polypeptide. In a preferred embodiment, the defective recombinant virus comprises a cDNA molecule encoding a RGS18 polypeptide. In another preferred embodiment of the invention, said defective recombinant virus comprises a gDNA molecule encoding a RGS18 polypeptide. Preferably, the RGS18 polypeptide so encoded comprises amino acids 86-166 of SEQ ID NO: 20. More preferably, the encoded RGS18 polypeptide comprises amino acids 86-202 of SEQ ID NO: 20. Even more preferably, the encoded RGS18 polypeptide comprises the amino acid sequence of SEQ ID NO: 20.

In another preferred embodiment, the invention is a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein under the control of a promoter selected from a Raus sarcoma virus-long terminal repeat sequence (RSV-LTR) or cytomegalovirus (CMV) early promoter. It is about.

They may also be adenovirus vectors, for example human adenovirus of type 2 or 5.

The recombinant vector according to the invention may also be a retroviral vector or adeno-associated vector (AAV). Such adeno-related vectors are described, for example, in references 104-106.

In order to express the polynucleotides according to the invention, the latter must be introduced into the host cell. Introduction of the polynucleotides according to the invention into host cells can be carried out in vitro according to techniques well known to those skilled in the art in order to transform or transfect cells into primer cultures or in the form of cell lines. In order to prevent or treat diseases associated with the reverse transport deficiency of cholesterol, it is also possible to introduce the polynucleotides according to the invention in vivo or ex vivo.

In order to introduce polynucleotides or vectors according to the invention into host cells, those skilled in the art will appreciate various techniques, such as calcium phosphate precipitation techniques (107, 108), DEAE dextran 109, electroporation (110, 111), direct microinjection ( 112), a method of liposomes 113 and 114 filled with DNA may be referred to preferentially.

Once the polynucleotide is introduced into a host cell, it can be stably integrated into the genome of the cell. Such integration can be achieved at the exact location of the genome by homologous recombination or can be integrated randomly. In some embodiments, the polynucleotides can be stably maintained in the form of episomal fragments within the host cell, which episomal comprises sequences that permit maintenance and replication of the host cell independently or simultaneously with the cell cycle.

According to a particular embodiment, the method of introducing a polynucleotide according to the invention into a host cell, in particular a host cell obtained from a mammal in vivo, comprises a pharmaceutically compatible vector and an "extracted" polynucleotide according to the invention. While the agent is left under the control of an appropriate regulatory sequence, the agent is introduced by topical injection at the level of selected tissues, such as smooth muscle tissue, wherein the “extracted” polynucleotides are introduced into cells of the tissue. Is absorbed by.

Compositions for in vitro and in vivo use, including "extracted" polynucleotides, are described, for example, in PCT publication WO 95/11307 (Institut Pasteur, Inserm, University of Ottawa) and Tacson et al. 115) and Huygen et al. (58).

According to certain embodiments of the present invention, a composition for producing in vivo a RGS18 protein is provided. The composition comprises, in solution in a physiologically acceptable vehicle or excipient, a polynucleotide encoding an RGS18 polypeptide placed under the control of an appropriate regulatory sequence.

As a result, the invention also includes a medicament for preventing or treating a patient or subject suffering from a disorder or disease associated with platelet activation dysfunction comprising a nucleic acid encoding a RGS18 protein in combination with one or more physiologically compatible excipients. To a pharmaceutical composition.

Preferably, such a composition is a) a polynucleotide sequence of any one of SEQ ID NO: 11, 18 or 19, or a complementary polynucleotide sequence thereof, placed under the control of an appropriate regulatory element or signal, b) the nucleotide of SEQ ID NO: 11 A polynucleotide sequence of 1-169, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a nucleotide 163-870 of SEQ ID NO: 19 A polynucleotide sequence, or a complementary polynucleotide sequence thereof, e) a polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, Or a complementary polynumeric thereof Leo Tide sequence, or g) a nucleotide 418-658 of SEQ ID NO: 19 polynucleotide sequence, or may comprise a nucleic acid material containing a complementary polynucleotide sequence thereof.

Subject of the invention is also a pharmaceutical for preventing or treating a patient or subject with a disorder or disease associated with platelet activation dysfunction comprising a recombinant vector according to the invention in combination with one or more physiologically compatible excipients. Composition.

The amount of vector injected into the selected host organism will vary depending on the site of injection. As a guide, about 0.1 to about 100 μg of a polynucleotide encoding an RGS18 polypeptide is injected into an animal body, preferably in a patient who is likely to develop a disorder or disease associated with platelet activation dysfunction or a patient already suffering from such disorder or disease. can do.

The present invention also relates to a pattern for encoding a RGS18 protein for the manufacture of a medicament for preventing a disorder or disease associated with various forms of platelet activation dysfunction, or more particularly for treating a subject having a disorder or disease associated with platelet activation dysfunction. It relates to the use of a nucleic acid according to the invention.

The invention also includes a nucleic acid encoding a RGS18 protein for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction, or more particularly for treating a subject having a disorder or disease associated with platelet activation dysfunction. And to the use of the recombinant vector according to the invention.

Accordingly, the subject of the present invention is also a recombinant vector comprising a nucleic acid according to the invention encoding an RGS18 protein or polypeptide associated with platelet activation.

The invention also relates to the use of said recombinant vector for the manufacture of a pharmaceutical composition for the treatment and / or prophylaxis of disorders or diseases associated with platelet activation dysfunction.

The invention also relates to the use of cells genetically modified ex vivo with a recombinant vector according to the invention, or recombinant vector producing cells, transplanted in vivo, for the long term effective expression of a biologically active RGS18 polypeptide in vivo. will be.

The invention also relates to the use of a nucleic acid according to the invention encoding a RGS18 protein for the manufacture of a medicament for the prophylaxis or treatment of a subject suffering from a disorder or disease associated with platelet activation dysfunction.

The invention also encodes an RGS18 polypeptide according to the invention for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction, or more particularly for treating a subject having a disorder or disease associated with platelet activation dysfunction. It relates to the use of a recombinant vector according to the invention, comprising a nucleic acid.

The present invention also provides a medicament comprising a nucleic acid encoding an RGS18 polypeptide according to the invention for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction, more particularly for treating a subject having such a disorder or disease. The use of a recombinant host cell according to the invention.

The invention also relates to the use of a recombinant vector, preferably a defective recombinant vector, according to the invention for the manufacture of a pharmaceutical composition for treating and / or preventing pathological conditions associated with platelet activation dysfunction.

The invention also relates to the use of said recombinant vector or defective recombinant virus for the manufacture of a pharmaceutical composition for treating and / or preventing a disorder or disease associated with platelet activation dysfunction. The present invention therefore also relates to a pharmaceutical composition comprising a defective recombinant virus or one or more recombinant vectors according to the invention.

The present invention also relates to novel therapeutic approaches for preventing and / or treating pathological conditions associated with platelet activation dysfunction. This advantageously solves the shortcomings of the prior art by demonstrating the possibility of treating pathological conditions associated with platelet activation dysfunction by in vivo transfer and expression of nucleic acids encoding RGS18 polypeptides related to gene therapy, platelet activation. Thus, the present invention is not only a simple means to specifically and effectively treat related pathological conditions, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism But also provides its use in invasive cardiac processes for anti-coagulation purposes.

Gene therapy consists in introducing genetic information into diseased cells or organs, thereby correcting for defects or abnormalities (mutations, abnormal expressions, etc.) and expressing the protein of therapeutic interest. The genetic information can be introduced ex vivo into cells extracted from the organ, and then such modified cells can be reintroduced into the body or introduced directly into the tissue in vivo. In the second case, various techniques, including various complexes of DNA and DEAE-dextran 116, complexes of DNA and nuclear proteins 117, complexes of DNA and lipids 87, use of liposomes 118, etc. Transfection techniques exist. More recently, the use of viruses as gene transfer vectors has emerged as an excellent alternative to these physical transfection techniques. In this regard, various viruses were tested to determine their ability to infect specific cell populations. In particular, retroviruses (RSV, HMS, MMS, etc.), HSV viruses, adeno-associated viruses and adenoviruses were tested.

Accordingly, the present invention also relates to a novel therapeutic approach for treating a disorder or disease associated with platelet activation dysfunction, comprising in vivo metastasis and expression of a gene encoding RGS18. Specifically, the present invention relates to disorders or diseases associated with platelet activation dysfunction, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism New therapeutic approaches to treat and / or prevent, as well as their use in invasive cardiac processes for anti-coagulant purposes. In a particularly preferred manner, Applicants can construct recombinant vectors comprising nucleic acids encoding RGS18 polypeptides related to platelet activation, and administer these recombinant vectors in vivo, resulting in no cytopathological effects. Without showing, it has been found by the present invention that it is possible to stably and effectively express biologically active RGS18 polypeptides.

The invention also comes from demonstrating that adenoviruses constitute a particularly efficient vector for the transfer and expression of the RGS18 nucleic acids of the invention. In particular, the present invention shows that the use of recombinant adenovirus as a vector enables expression of the gene at a high enough level to produce the desired therapeutic effect. Other viral vectors that have been found to stably express genes, such as retroviruses or adeno-associated viruses (AAV), are also claimed.

Thus, the present invention confers new approaches for treating and preventing disorders or diseases associated with platelet activation dysfunction.

Accordingly, the subject of the invention is also a defective recombinant virus comprising a nucleic acid according to the invention encoding a RGS18 protein or polypeptide associated with platelet activation.

The invention also provides for the treatment of disorders or diseases associated with platelet activation dysfunction, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism and And / or to the use of said defective recombinant virus for the preparation of a pharmaceutical composition for prophylactic as well as its use in invasive cardiac processes for anti-coagulation purposes.

The present invention also provides a cell that has been genetically modified ex vivo with a defective recombinant virus according to the present invention, or a defective recombinant virus producing cell, which has been implanted in the body for long-term effective expression of a biologically active RGS18 polypeptide in vivo. It relates to the use of.

The present invention shows that nucleic acids encoding RGS18 can be incorporated into viral vectors and that these vectors can effectively express mature forms of biological activity. More particularly, the present invention shows that RGS18 can be expressed in vivo by either direct injection of adenovirus or by transplanting cells or production cells genetically modified by retroviruses or adenoviruses in which the nucleic acid is incorporated.

The present invention is particularly advantageous because in organs not normally involved in the expression of the protein, it is possible to induce regulated expression of RGS18 without deleterious effects. In particular, by grafting cells producing the vector of the invention or infected cells ex vivo with the vector of the invention, significant release of the RGS18 polypeptide is obtained.

Nucleic acid sequences used in the context of the present invention include cDNA; Genomic DNA (gDNA), RNA (for retroviruses); Or, for example, it may be a hybrid construct consisting of cDNA into which one or more introns (gDNA) can be inserted. It may also include synthetic or semisynthetic sequences. In a particularly advantageous manner, cDNA or gDNA is used. In particular, the use of gDNA can achieve better expression in human cells. In order to incorporate them into the viral vectors according to the invention, it is preferred to modify these sequences, for example by site directed mutagenesis, for the insertion of particularly suitable restriction sites.

In the context of the present invention, preference is given to using nucleic acids encoding human RGS18 protein. Moreover, it is possible to use constructs encoding derivatives of these RGS18 proteins. Derivatives of these RGS18 proteins include any sequence encoding, for example, a product obtained by mutation, deletion and / or addition relative to the original sequence and retaining biological activity. These modifications can be made by techniques known to those skilled in the art (see the following general molecular biology techniques). The biological activity of the derivatives thus obtained can then be readily determined, especially as indicated in the following examples. Derivatives for the purposes of the present invention can also be obtained by hybridization from nucleic acid libraries, using the original sequence or fragment thereof as a probe.

These derivatives are, in particular, molecules having a high degree of substitution for their binding sites, molecules with higher resistance to proteases, molecules with higher therapeutic efficacy or fewer side effects, or optionally new biological properties. Such derivatives also include modified DNA molecules that can improve expression in vivo.

Thus, the present invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 polypeptide. In a first aspect, the invention relates to a defective recombinant virus comprising a cDNA encoding a RGS18 polypeptide. In another preferred embodiment of the invention, the defective recombinant virus comprises genomic DNA (gDNA) encoding a RGS18 polypeptide. Preferably, such encoded RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) SEQ ID NO: 20 Amino acids 86-166. More preferably, the encoded RGS18 polypeptide comprises the amino acid sequence of SEQ ID NO: 20.

Vectors of the invention can be prepared from various types of viruses. Preferably, vectors derived from adenoviruses, adeno-associated viruses (AAV), herpes virus (HSV) or retroviruses are used. For direct administration or for ex vivo modification of the cells to be transplanted, it is preferred to use adenoviruses or retroviruses for the transplantation of production cells.

The virus according to the invention is defective; That is, they cannot autonomously replicate in target cells. In general, the genome of a defective virus used in the context of the present invention lacks at least the sequence necessary for replication of the virus in infected cells. These regions may be removed (completely or partially), made nonfunctional, or substituted with other sequences, particularly nucleic acid sequences encoding RGS18 polypeptides. Preferably, the defective virus nevertheless retains in its genome the sequence necessary for the encapsidation of the viral particles.

Referring to more specific adenoviruses, various sera with varying structures and properties have been identified. Among these serotypes, human adenoviruses of type 2 or 5 (Ad2 or Ad5) or adenoviruses of animal origin (see WO 94/26914) are preferably used in the context of the present invention. Among the adenoviruses of animal origin that may be used in the context of the present invention, mention may be made of adenoviruses of dog, cow, rat (eg Mav1,119), sheep, pig, avian or monkey (eg SVV) origin. Preferably, the adenovirus of animal origin is canine adenovirus, more preferably CAV2 adenovirus (eg, Manhattan or A26 / 61 strain (ATCC VR-800)). Preferably, adenoviruses of human or dog, or mixed origin, are used in the context of the present invention. Preferably, the defective adenovirus of the present invention comprises IRTs, i.e., sequences that allow for encapsidation and sequences encoding RGS18 polypeptides. Preferably, in the genome of the adenovirus of the invention, at least the El region is made nonfunctional. Even more preferably, in the genome of the adenoviruses of the invention, the E1 gene and at least one of E2, E4 and L1-15 are nonfunctional. The viral genes contemplated can be made nonfunctional by inhibiting, replacing, partially deleting or adding all of the techniques known to those skilled in the art, in particular one or more bases in the contemplated gene (s). Such modifications can be obtained in vitro (performed on isolated DNA) or in situ, for example, by genetic engineering techniques or treatment via mutants. Other regions may be modified, in particular the E3 (WO 95/02697), E2 (WO 94/28938), E4 (WO 94/28152, WO 94/12649, WO 95/02697) and L5 (WO 95/02697) regions. have. According to a preferred embodiment, the adenovirus according to the invention comprises deletions in the E1 and E4 regions, and the sequence encoding RGS18 is inserted at the level of the inactivated E1 region as above. According to another preferred embodiment, this comprises a deletion in the El region, at which level the E4 region and the RGS18 coding sequence (FR94 13355) are inserted.

Defective recombinant adenoviruses according to the invention can be prepared by any technique known to those skilled in the art (EP 185 573; and 120,121). In particular, they can be produced by homologous recombination between adenoviruses and plasmids carrying nucleic acids encoding RGS18 protein. This homologous recombination occurs after co-transfection of the adenovirus and plasmid into a suitable cell line. The cell line used is preferably a sequence which can (i) be transformable by said element and (ii) complement a portion of the defective adenovirus genome, preferably in an integrated form to avoid the risk of recombination. It must contain For example, a human embryonic kidney cell line 293 (122) containing the left portion (12%) of the Ad5 adenovirus genome integrated into its genome, or in particular E1 as described in WO 94/26914 and WO 95/02697. And cell lines capable of complementing E4 action.

The propagated adenovirus is then recovered and purified according to conventional molecular biology techniques as exemplified in this example.

With reference to adeno-associated viruses (AAV), they are relatively small sized DNA viruses that integrate in a stable site specific manner into the genome of the cells they infect. They can infect a broad spectrum of cells without inducing any effect on cell growth, morphology or differentiation. Moreover, they do not appear to be associated with pathogens in humans. The genome of AAV was cloned, sequenced and confirmed. It contains about 4700 bases and at each end contains a reverse repeat sequence region (ITR) of about 145 bases that acts as the origin of replication of the virus. The rest of the genome is divided into two essential regions involving capsidization functions: the left side of the genome containing the rep gene, which is involved in viral replication and expression of viral genes; And the right side of the genome containing a cap gene encoding a viral capsid protein.

The use of vectors derived from AAV for transferring genes in vitro and in vivo is described in particular in WO 91/18088; WO 93/09239; US 4,797,368, US 5,139,941, EP 488 528. These specifications include various constructs derived from AAV, in which the rep and / or cap genes have been deleted and replaced with the genes of interest, and in vitro (performed on cells in cultures) or in vivo (direct transfer into organisms). Are described for their use for transition. However, none of these documents describe or describe the use of recombinant AAV, or the benefits of such transfer, for transferring and expressing RGS18 protein in vivo or ex vivo. Defective recombinant AAV according to the invention comprises a plasmid containing a sequence encoding a RGS18 protein surrounded by two AAV reverse repeat sequence regions (ITRs) and a plasmid carrying AAV capsiding genes (rep and cap genes), It can be prepared by co-transfection into cell lines infected with human helper virus (eg adenovirus). The resulting recombinant AAV is then purified by conventional techniques.

With reference to herpes viruses and retroviruses, the construction of recombinant vectors is extensively described in the following documents (see in particular WO 94/21807, WO 92/05263, EP 453242, EP 178220 and 123-125, etc.).

In particular, retroviruses are integrating viruses that infect dividing cells. The genome of a retrovirus consists essentially of two long terminal repeat sequences (LTRs), capsidization sequences and three coding regions (gag, pol and env). In recombinant vectors derived from retroviruses, the gag, pol and env genes are generally completely or partially deleted and replaced with heterologous nucleic acid sequences of interest. These vectors include various types of retroviruses, in particular MoMuLV ("rat Molecular Leukemia Virus", also referred to as MoMLV), MSV ("rat Molecular Sarcoma Virus"), HaSV ("Harvest Sarcoma Virus"), SNV ("Splenic necrosis virus"), RSV ("laus sarcoma virus") or Friend virus.

In order to construct a recombinant retrovirus containing a sequence encoding a RGS18 protein according to the invention, in particular the LTR, the capsidized sequence and the plasmid containing the coding sequence are generally constructed and then used to deplete the plasmid. It is transfected with so-called capsidated cell lines that can provide retroviral function as trans. In general, the encapsidation strain can express gag, pol and env genes. Such encapsidated strains, in particular PA317 strain (US Pat. No. 4,861,719), PsiCRIP strain (WO 90/02806) and GP + envAm-12 strain (WO 89/07150) are described in the prior art literature. Moreover, recombinant retroviruses may contain modifications of LTR levels to inhibit transcriptional activity, as well as contain extended capsidation sequences containing portions of the gag gene (126). The recombinant retrovirus thus prepared is then purified by conventional techniques.

For carrying out the invention, it is preferred to use defective recombinant adenoviruses. Particularly advantageous properties of adenoviruses are desirable for in vivo expression of proteins with cholesterol transport activity. The adenovirus vectors according to the invention are preferred for ex vivo transformation of cells, in particular autologous cells, or for direct administration of purified suspending agents in vivo from the point of view of their transplantation. In addition, the adenoviral vectors according to the invention also exhibit significant advantages, such as extremely high infection efficacy, which makes it possible to carry out infections with small volumes of viral suspending agents.

According to another particularly preferred aspect of the invention, a strain producing a retroviral vector containing a sequence encoding a RGS18 protein is used for in vivo transplantation. States that can be used for this purpose are in particular modified PA317 strains (US 4,861,719), PsiCRIP strains (WO 90/02806) and GP + envAm −, which are modified to produce retroviruses containing nucleic acid sequences encoding the RGS18 protein according to the invention. 12 weeks (US 5,278,056).

Preferably, in the vectors of the invention, the nucleic acid encoding the RGS18 protein is placed under the control of a signal that allows its expression in infected cells. They may be expression signals that are homologous or heterologous, ie may be different from those originally involved in expression of the RGS18 protein. They may also be specific sequences involved in the expression of other proteins, or synthetic sequences. In particular, they may be sequences of or derived from eukaryotic or viral genes that stimulate or inhibit transcription of the gene in a specific and inducible manner. For example, they may be promoter sequences derived from the genome of the cell to be infected or derived from the genome of the virus, in particular the promoter of the E1A or major late promoter (MLP) gene of the adenovirus, cytomegalovirus (CMV) promoter, RSV- LTR and the like. Among eukaryotic promoters, ubiquitous promoters (HPRT, bimethine, α-actin, tubulin, etc.), promoters of intermediate filaments (desmin, neurofilament, keratin, GFAP, etc.), promoters of therapeutic genes (MDR, CFTR or factors) Promoters of type VIII), tissue specific promoters (pyruvate kinases, borrowers, promoters of fatty acid binding enteric proteins, promoters of smooth muscle cell α-actin, promoters specific to the liver; Apo AI, Apo AII, human albumin, etc.) or stimulation Promoters corresponding to (steroid hormone receptors, retinoic acid receptors, etc.) may be mentioned. In addition, these expression sequences can be modified by adding an enhancer or a regulatory sequence. Moreover, if the inserted gene does not contain an expression sequence, it can be inserted into the genome downstream of the defective virus of that sequence.

In certain embodiments, the invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein that is placed under or operably linked to a promoter selected from an RSV-LTR or CMV early promoter.

As indicated above, the present invention also relates to all uses of the virus as mentioned above for the manufacture of a pharmaceutical composition for treating and / or preventing a disorder or disease associated with platelet activation dysfunction.

The invention also relates to pharmaceutical compositions comprising one or more defective recombinant viruses as mentioned above. These pharmaceutical compositions can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular or transdermal administration. Preferably, the pharmaceutical composition of the present invention comprises an pharmaceutically acceptable vehicle or physiologically compatible excipient in an injectable formulation, in particular an intravenous injectable formulation, eg, a formulation for injection into the patient's context. do. These may in particular be directed to dry, in particular lyophilized compositions or isotonic sterile solvents which allow the preparation of injectable solutions when sterile water or physiological saline is optionally added. Injection directly into the patient's context is desirable because it can target infections at the liver level to focus therapeutic effects at the level of these organs.

The dose of defective recombinant virus used in the injection can be adjusted as a function of various parameters of the mode of administration administered, the pathological condition involved or the desired duration of treatment, in particular as a function of the viral vector. In general, the recombinant adenovirus according to the invention is formulated and administered in a dosage form of 10 ⁴ to 10 ¹⁴ pfu / ml, preferably 10 ⁶ to 10 ¹⁰ pfu / ml. The term “pfu” (plaque forming unit) corresponds to the infectivity of the viral solution, which is determined by infecting the appropriate cell culture, usually 48 hours later, by measuring the number of plaques generated from the infected cell lysate. Techniques for determining the pfu titer of viral solutions are widely described in the literature.

With reference to retroviruses, the compositions according to the invention may contain these producing cells directly, in terms of their transplantation.

In this regard, another subject of the invention is all isolated mammalian cells infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to all populations of human cells infected with such viruses. These may be certain cells of blood origin (pluripotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.

Cells according to the invention can be derived from primary cultures. They can be collected by any technique known to those skilled in the art, and then cultured under conditions that propagate them. More specifically referring to fibroblasts, they can be readily obtained from biopsies, for example according to the techniques described in Ham (1980). These cells can be used directly for infection with the virus or can be stored by freezing them for the establishment of a self-library in terms of subsequent use. The cells according to the invention can be, for example, secondary cultures obtained from pre-established libraries (see EP 228458, EP289034, EP400047, EP456640).

The cells in culture are then infected with the recombinant virus according to the present invention, giving them the ability to produce biologically active RGS18 protein. Such infections are performed in vitro according to techniques known to those skilled in the art. In particular, depending on the type of cells used and the number of virus copies desired per cell, one skilled in the art can adjust the multiplicity of infection and, optionally, the number of infection cycles generated. If cells are to be administered in vivo, it should be recognized that these steps must be performed under appropriate sterile conditions. The dose of recombinant virus used for infection of the cells can be adjusted by one skilled in the art depending on the intended use. By in vivo administration, the above-mentioned conditions can be applied to in vitro infection. In the case of infection with retroviruses, it is also possible to culture the cells producing the recombinant retroviruses according to the invention with the cells to be infected. As a result, purification of the retrovirus can be omitted.

Another subject of the invention relates to an implant comprising an isolated mammalian cell or recombinant virus infected with one or more defective recombinant viruses according to the invention, and an extracellular matrix. Preferably, the implant according to the invention comprises 10 ⁵ to 10 ¹⁰ cells. More preferably, 10 ⁶ to 10 ⁸ cells.

More particularly, the extracellular matrix in the implant of the present invention comprises a gelling compound and optionally comprises a support to immobilize the cells.

In order to prepare the implants according to the invention, various types of gelling agents can be used. Such gelling agents can be used to enclose cells in a matrix having components of the gel, and optionally to enhance the immobilization of cells on the support. Thus, various cell adhesives, for example collagen, gelatin, glycosaminoglycans, fibronectin, lectins and the like can be used as the gelling agent. Preferably, collagen is used in the context of the present invention. It may be collagen of human, bovine or rat origin. More preferably, type I collagen is used.

As indicated above, the composition according to the invention preferably comprises a support for immobilizing the cells. The term "fixed" refers to any form of biological and / or chemical and / or physical interaction that adheres and / or adheres cells to a support. Furthermore, the cells may cover the support used, penetrate into the support, or both. In the context of the present invention, preference is given to using solid, nontoxic and / or biocompatible supports. In particular, it is possible to use polytetrafluoroethylene (PTFE) fibers or supports of biological origin.

Accordingly, the present invention provides extremely effective means for treating or preventing disorders or diseases associated with platelet activation dysfunction.

The treatment may also be applied to humans and all animals, such as sheep, cattle, livestock (dogs, cats, etc.), horses, fish, and the like.

Recombinant host cell

The invention also relates to the use of the virus-producing cells, or cells genetically modified in vitro with the virus according to the invention, implanted in the body, for the long-term effective expression of biologically active RGS18 protein in vivo.

The present invention shows that nucleic acids encoding RGS18 polypeptides according to the present invention can be incorporated into viral vectors and that these vectors can effectively express biologically active mature polypeptides. More particularly, the present invention shows that RGS18 can be expressed in vivo by either direct injection of adenovirus or by transplanting cells or production cells genetically modified by retroviruses or adenoviruses in which the nucleic acid is incorporated.

In this regard, another subject of the invention relates to all isolated mammalian cells infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to all populations of human cells infected with such viruses. These may be certain cells of blood origin (pluripotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.

Another subject of the invention relates to an implant comprising an isolated mammalian cell or recombinant virus infected with one or more defective recombinant viruses according to the invention, and an extracellular matrix. Preferably, the implant according to the invention comprises 10 ⁵ to 10 ¹⁰ cells. More preferably, 10 ⁶ to 10 ⁸ cells.

More particularly, the extracellular matrix in the implant of the present invention comprises a gelling compound and optionally comprises a support to immobilize the cells.

The invention also relates to a nucleic acid of the invention, more particularly a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide of nucleotides 1-169 of SEQ ID NO: Sequence, or a complementary polynucleotide sequence thereof, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a Complementary polynucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide thereof Sequence, or g) of SEQ ID NO: 19 It relates to an isolated recombinant host cell comprising a nucleic acid comprising a polynucleotide sequence, or a complementary polynucleotide sequence of nucleoside Tide 418-658.

The invention also relates to an isolated recombinant host cell comprising a nucleic acid of the invention, more particularly a nucleic acid comprising a nucleotide sequence as set forth in SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof.

The invention also relates to an isolated and recombinant host cell comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 20. The invention also relates to a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) amino acids 86-166 of SEQ ID NO: 20 A recombinant host cell comprising a nucleic acid encoding a polypeptide comprising.

According to another aspect, the invention also relates to an isolated recombinant host cell comprising the recombinant vector according to the invention. Thus, the present invention also relates to recombinant host cells comprising a recombinant vector comprising a nucleic acid of the invention.

Specifically, the invention relates to a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide thereof E) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g ) The nucleotide of SEQ ID NO: 19 DE 418-658 polynucleotide sequence, or relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid material containing a complementary polynucleotide sequence thereof.

The invention also relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence as set forth in SEQ ID NO: 18 or 19, or a complementary polynucleotide sequence thereof.

The invention also relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 20. The invention also relates to a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) amino acids 86-166 of SEQ ID NO: 20 An isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising.

Preferred host cells according to the invention are, for example:

a) prokaryotic host cells: Escherichia coli strains (strain DH5-α), Bacillus subtilis (Bacillus subtilis) strain, aged Nella typhimurium genus Streptomyces (Salmonella typhimurium) strain, or Pseudomonas (Pseudomonas) ( Strains such as Streptomyces ) and Staphylococus ;

b) Eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No. CCL70), COS cells (ATCC No. CRL 1650), Sf-9 cells (ATCC No. CRL 1711), CHO cells (ATCC No. CCL-61) or 3T3 cells (ATCC No. CRL-6361).

Methods of Generation of RGS18 Polypeptides

The present invention also provides

a) inserting a nucleic acid encoding a polypeptide mentioned below into a suitable vector;

b) culturing the previously transformed host cell in a suitable culture medium or transfecting the host cell with the recombinant vector of step a);

c) recovering the conditioned culture medium conditioned as above, or lysing the host cell, for example by sonication or osmotic shock;

d) separating and purifying the polypeptide from the culture medium or the cell lysate obtained in step a); And

e) optionally identifying the resulting recombinant polypeptide

A polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 12 or 20, or a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) of SEQ ID NO: 20 Amino acid 86-202 or d) a method of producing a polypeptide or variant thereof comprising amino acids 86-166 of SEQ ID NO: 20.

Certain embodiments of the invention relate to a method of producing a polypeptide comprising the amino acid sequence of amino acids 86-202 of SEQ ID NO: 20.

a) the amino acid sequence of any one of SEQ ID NOs: 12 or 20, b) the amino acid sequence of amino acids 1-58 of SEQ ID NO: 12, c) the amino acid sequence of amino acids 1-166 of SEQ ID NO: 20, d) amino acid 86 of SEQ ID NO: 86 A polypeptide “homologous” to a polypeptide having an amino acid sequence of −202, or e) amino acids 86-166 of SEQ ID NO: 20 also forms part of the present invention. Such homologous polypeptides may be a) any one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) relative to each of amino acids 86-166 of SEQ ID NO: 20, comprises an amino acid sequence in which one amino acid is substituted one or more times with an equivalent amino acid.

RGS18 polypeptides according to the invention in particular include:

1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 12 or 20,

2) a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) polypeptides amino acids 86-166 of SEQ ID NO: 20 ,

3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant is a) amino acids 1-58 of SEQ ID NO: 12, b) SEQ ID NO: 20 C) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20;

4) a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) SEQ ID NO: A polypeptide that is "homologous" with a polypeptide comprising 20 amino acids 86-166.

Polypeptides according to the invention can be characterized by binding the antibodies directed against such polypeptides or fragments or variants thereof onto immobilized immunoaffinity chromatography columns.

According to another aspect, recombinant polypeptides according to the present invention are known to those skilled in the art and according to the methods described, for example, in F. Ausubel et al. Purification may be by passing over a chromatography column.

Polypeptides according to the invention can also be prepared by conventional chemical synthesis techniques in homogeneous solution or solid phase. For example, polypeptides according to the present invention can be prepared by homogeneous solution techniques described in Houben Weyl (127) or solid phase synthesis techniques described in Merrifield (128,129).

"Equivalent amino acid" according to the present invention means, for example, that a residue of the L form is replaced by a residue of the D form, or glutamic acid (E) is replaced by pyro-glutamic acid, according to techniques well known to those skilled in the art. something to do. For example, the synthesis of peptides containing one or more D-type residues is described in Koch 130. According to another aspect, two amino acids belonging to the same class, ie two uncharged polar, nonpolar, basic or acidic amino acids, are also considered equivalent amino acids.

Polypeptides comprising one or more non-peptide bonds, such as retro-inverse bonds (NHCO), carba bonds (CH ₂ CH ₂ ) or ketomethylene bonds (CO-CH ₂ ), are also described herein. To form part of.

Preferably, polypeptides according to the invention comprising one or more additions, deletions, substitutions of one or more amino acids will retain their ability to be recognized by the antibodies directed against the unmodified polypeptide.

Antibodies

The RGS18 polypeptides according to the invention can be used to prepare antibodies, in particular for detecting whether normal or altered forms of the RGS18 polypeptide are produced in a patient.

Accordingly, the present invention also relates to antibodies directed against the RGS18 polypeptide. In certain embodiments, antibodies according to the invention are directed against:

1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 7, 8, 12 or 20,

2) a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) polypeptides amino acids 86-166 of SEQ ID NO: 20 ,

3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant is a) amino acids 1-58 of SEQ ID NO: 12, b) SEQ ID NO: 20 C) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20;

4) a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) SEQ ID NO: A polypeptide that is "homologous" with a polypeptide comprising 20 amino acids 86-166.

The invention also relates to antibodies directed against RGS18 polypeptides, as produced by the hybridoma technology or trioma technology described in Kozbor et al. (131).

Antibodies directed against polypeptides "homologous" to the polypeptides according to the invention also form part of the invention. Such antibodies may comprise a) any one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) sequence Compared to polypeptides according to the invention comprising amino acids 86-166 of No. 20, homologous polypeptides comprising an amino acid sequence in which one amino acid is substituted one or more times with an equivalent amino acid are indicated.

For the purposes of the present invention an "antibody" recognizes a specific polyclonal or monoclonal antibody or fragment (eg F (ab) ' ₂ and Fab fragment), or a target polypeptide or polypeptide fragment according to the present invention. Will mean all polypeptides comprising the domain of the initial antibody.

Monoclonal antibodies can be prepared from hybridomas according to the techniques described in Kohler and Milstein (132).

According to the present invention, polypeptides produced recombinantly or by chemical synthesis, and fragments or other derivatives or homologues thereof (including fusion proteins), are used as immunogens for generating antibodies that recognize the polypeptides according to the invention. Can be used. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and Fab expression libraries. Anti-RGS18 antibodies of the invention can be cross reactive, for example, they can recognize RGS18 polypeptides from different species. Polyclonal antibodies are more likely to be cross reactive. Alternatively, the antibodies of the invention can be specific for a single form of RGS18. Preferably such antibodies are specific for human RGS18.

Various procedures known in the art can be used to prepare polyclonal antibodies against the RGS18 polypeptide or derivatives or homologues thereof. To prepare antibodies, various host animals, including but not limited to rabbits, mice, rats, sheep, goats, and the like, can be immunized by injecting with RGS18 polypeptides or derivatives thereof (eg, fragments or fusion proteins). . In one embodiment, the RGS18 polypeptide or fragment thereof can be conjugated to an immunogenic carrier such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Freund (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lyso lecithin, polyhydric polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, di Nitrophenols, and potentially useful human adjuvants, such as, but not limited to, various adjuvants, including but not limited to bacille Calmette-Guerin (BCG) and Corynebacterium parvum , Depending on the host species, the immunological response may be enhanced.

In order to prepare the monoclonal antibodies directed against the RGS18 polypeptide, or fragments, homologs or derivatives thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture can be used. These include trioma technology, human B-cell hybridoma technology, as well as hybridoma technology first developed by Kohler and Milstein 132 [133; Cote et al. (134), and EBV-hybridoma technique 135 for generating human monoclonal antibodies. In a further aspect of the invention, monoclonal antibodies can be produced in germ-free animals [1989. 12. International Publication WO 89/12690 published 28 characters. Indeed, according to the present invention, a technique developed to generate a "chimeric antibody" by splicing a gene from a mouse antibody molecule specific for an RGS18 polypeptide, along with a gene from a human antibody molecule of suitable biological activity ( 136-138); Such antibodies fall within the scope of the present invention. Such human or humanized chimeric antibodies are preferred for use in the treatment of human diseases or disorders (described below), in which the human or humanized antibodies themselves have far more immune responses, especially allergic reactions than heterologous antibodies. This is because it can lead to less.

According to the present invention, techniques for preparing single chain antibodies [US Pat. Nos. 5,476,786 and 5,132,405 (Huston); US Patent No. 4,946,778 can be adapted to prepare RGS18 polypeptide-specific single chain antibodies. Additional aspects of the present invention provide a technique (139) described for the construction of Fab expression libraries to quickly and easily identify monoclonal Fab fragments having the desired specificity for RGS18 polypeptides, or derivatives or homologues thereof. To utilize.

Antibody fragments containing genotypes of antibody molecules can be produced by known techniques. For example, such fragments include F (ab ') ₂ fragments that can be prepared by pepsin digesting antibody molecules; Fab 'fragments that can be produced by reducing the disulfide bridges of F (ab') ₂ fragments; And Fab fragments that can be produced by treating antibody molecules with papain and a reducing agent.

In preparing antibodies, screening for the desired antibody can be performed using techniques known in the art, such as radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), "sandwich" immunoassays, immunoradiometric assays, gels. Diffusion precipitated antibody reactions, immunodiffusion assays, in situ immunoassays (eg using colloidal gold, enzymes or radioisotope labels), western blots, precipitation reactions, aggregation assays (eg gel aggregation assays, hemagglutination) Reaction assays), complement fixation assays, immunofluorescence assays, Protein A assays, immunoelectrophoresis assays, and the like. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of the secondary antibody or reagent to the primary antibody. In further embodiments, the secondary antibody is labeled. Many means for detecting binding in immunoassays are known in the art and are within the scope of the present invention. For example, to screen for antibodies that recognize specific epitopes of RGS18 polypeptides, hybridomas generated can be assayed for products that bind RGS18 polypeptide fragments containing these epitopes. To select antibodies specific for RGS18 polypeptides from certain species of animals, the selection may be based on positive binding to RGS18 polypeptides isolated from or expressed by cells of animals of that species.

The above-described antibodies can be used to determine the level of the RGS18 polypeptide, etc. in a suitable physiological sample using methods known in the art regarding the localization and activity of the RGS18 polypeptide, such as the detection techniques mentioned above or known in the art. RGS18 polypeptides can be used for Western blotting in situ.

In certain embodiments, antibodies can be produced that enhance or antagonize the activity of the RGS18 polypeptide. Such antibodies can be tested using the assays described below to identify ligands.

The present invention relates to antibodies directed against the following polypeptides, as prepared by hybridoma technology or trioma technology described in Kozbor et al. (131), which also form part of the invention. do:

1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 7, 8, 12 or 20,

2) a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) polypeptides amino acids 86-166 of SEQ ID NO: 20 ,

3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant is a) amino acids 1-58 of SEQ ID NO: 12, b) SEQ ID NO: 20 C) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20;

4) a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) SEQ ID NO: A polypeptide that is “homologous” to a polypeptide comprising an amino acid sequence of amino acids 86-166 of 20.

The invention also relates to single-chain Fv antibody fragments (ScFv) as described in US Pat. No. 4,946,778 or in Martinau et al. (1998).

Antibodies according to the invention also include antibody fragments obtained with the help of phage library 140 or humanized antibodies 142, 143.

Antibody preparations according to the invention are useful for immunological detection tests to confirm the presence and / or amount of antigen present in a sample.

Antibodies according to the invention may also comprise detectable markers which are radioisotope or non-radioisotope, eg fluorescent, or are coupled with molecules such as biotin, according to techniques well known to those skilled in the art. Can be.

Thus, another subject of the present invention is

a) the sample to be tested,

1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 7, 8, 12 or 20,

2) a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) polypeptides amino acids 86-166 of SEQ ID NO: 20 ,

3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant is a) amino acids 1-58 of SEQ ID NO: 12, b) SEQ ID NO: 20 C) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20;

4) a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) SEQ ID NO: A polypeptide “homologous” to a polypeptide comprising the amino acid sequence of amino acids 86-166 of 20

Contacting with the antibody directed against; And

b) detecting the antigen / antibody complexes thus formed

A method of detecting the presence of a polypeptide according to the invention in a particular sample, comprising.

The present invention also provides

a) 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 7, 8, 12 or 20,

2) a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) polypeptides amino acids 86-166 of SEQ ID NO: 20 ,

3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant is a) amino acids 1-58 of SEQ ID NO: 12, b) SEQ ID NO: 20 C) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20;

4) a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) SEQ ID NO: A polypeptide “homologous” to a polypeptide comprising the amino acid sequence of amino acids 86-166 of 20

Antibodies directed against; And

b) reagents that allow detection of the formed antigen / antibody complex

It relates to a box or kit for diagnosing or detecting the presence of a polypeptide according to the invention in a particular sample, comprising.

Pharmaceutical Compositions and Methods of Treatment

The invention also relates to a pharmaceutical composition comprising the nucleic acid according to the invention.

The invention also provides a pharmaceutical composition comprising a nucleic acid encoding a RGS18 polypeptide according to the invention, and a pharmaceutical comprising a RGS18 polypeptide according to the invention for treating a disorder or disease associated with platelet activation dysfunction. It relates to a composition.

The present invention also relates to a novel therapeutic approach for treating disorders or diseases associated with platelet activation dysfunction comprising in vivo transferring and expressing a nucleic acid encoding a RGS18 protein according to the invention. Specifically, the present invention provides novel therapeutic approaches for treating and / or preventing disorders or diseases associated with platelet activation dysfunction.

Thus, the present invention confers a novel approach for treating and preventing disorders or diseases associated with platelet activation dysfunction. Specifically stated, the present invention provides a method for repairing or enhancing improved platelet activation in a patient or subject.

The subject matter of the invention also provides a therapeutically effective amount of a normal RGS18 polypeptide, in particular a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) a pharmaceutical composition for preventing or treating a disorder or disease associated with platelet activation dysfunction comprising a polypeptide comprising the amino acid sequence of a polypeptide comprising amino acids 86-166 of SEQ ID NO: 20 . In a preferred embodiment, the RGS18 polypeptide comprises the amino acid sequence of SEQ ID NO: 20.

The invention also provides a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) of SEQ ID NO: 20 for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction Amino acids 1-166, d) amino acids 86-202 of SEQ ID NO: 20 or e) an RGS18 polypeptide comprising the amino acid sequence of amino acids 86-166 of SEQ ID NO: 20.

The invention also provides a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 or e of SEQ ID NO: 20 ) A pharmaceutical composition for treating or preventing a subject having a disorder or disease associated with platelet activation dysfunction comprising a therapeutically effective amount of a polypeptide having an amino acid sequence of amino acids 86-166 of SEQ ID NO: 20.

According to another aspect, the subject matter also includes administering to a particular patient a therapeutically effective amount of the RGS18 polypeptide of interest, optionally in combination with one or more physiologically compatible vehicles and / or excipients. , Prophylactic or therapeutic methods for treating disorders or diseases associated with platelet activation dysfunction.

Preferably, a pharmaceutical composition comprising a polypeptide according to the invention will be administered to a patient. Accordingly, the present invention also provides an effective amount of a normal RGS18 polypeptide, in particular a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166, d) of SEQ ID NO: 20 Platelet activation function, characterized in that it comprises a therapeutically effective amount of a polynucleotide capable of causing production of a polypeptide having an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20 or e) amino acids 86-166 of SEQ ID NO: 20 A pharmaceutical composition for preventing or treating a disorder or disease associated with failure.

Subject of the invention is also a therapeutically effective amount of a normal RGS18 polypeptide, in particular a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) preventing or treating a disorder or disease associated with platelet activation dysfunction, comprising a polypeptide having an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20 or e) amino acids 86-166 of SEQ ID NO: 20 Pharmaceutical compositions.

Such pharmaceutical compositions may comprise RGS18 polypeptides in amounts ranging from 1 μg / kg / day to 10 mg / kg / day, preferably 0.01 mg / kg / day or more, more preferably 0.01 to 1 mg / kg / day, For example, it will preferably be suitable for administration by the parenteral route.

The invention also provides a pharmaceutical composition comprising a nucleic acid encoding an RGS18 polypeptide according to the invention, and a disorder or disease associated with platelet activation dysfunction, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, A medicament comprising an RGS18 polypeptide according to the invention for the treatment or prevention of cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism, as well as for its use in invasive cardiac processes for anticoagulant purposes. To provide a pharmaceutical composition.

The present invention also relates to a novel therapeutic approach for treating disorders or diseases associated with platelet activation dysfunction comprising in vivo transferring and expressing a nucleic acid encoding a RGS18 protein according to the invention. Specifically, the present invention relates to disorders or diseases associated with platelet activation dysfunction, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism It provides a novel therapeutic approach for treatment and / or prophylaxis as well as for its use in invasive cardiac processes for anti-coagulation purposes.

Thus, the present invention confers a novel approach for treating and preventing disorders or diseases associated with abnormal platelet activation. Specifically, the present invention provides a method of increasing, decreasing or inhibiting platelet activation in a patient or subject.

As a result, the present invention also provides for the prevention or prevention of a patient or subject with a disorder or disease associated with platelet activation dysfunction comprising a nucleic acid encoding a RGS18 protein in combination with one or more physiologically compatible vehicles and / or excipients. It relates to a pharmaceutical composition for treatment.

According to certain embodiments of the present invention, a composition for producing in vivo a RGS18 protein is provided. The composition comprises a nucleic acid encoding an RGS18 polypeptide placed under control of an appropriate regulatory sequence, in solution in a physiologically acceptable vehicle and / or excipient.

Accordingly, the present invention also relates to a composition comprising a nucleic acid placed under the control of an appropriate regulatory element, which encodes a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 12 or 20.

The invention also includes a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86-166 of SEQ ID NO: 20 To a composition comprising a nucleic acid placed under the control of an appropriate regulatory element, encoding a polypeptide.

Preferably, such compositions will comprise nucleic acids comprising the polynucleotide sequence of SEQ ID NO: 18 or SEQ ID NO: 19, placed under the control of appropriate regulatory elements. More preferably, the composition will comprise a nucleic acid comprising the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, placed under the control of an appropriate regulatory element.

According to another aspect, the subject matter also comprises administering to a particular patient a nucleic acid encoding an RGS18 polypeptide according to the invention, optionally in combination with one or more physiologically compatible vehicles or excipients. Is a prophylactic or therapeutic method of treating a disorder or disease associated with platelet activation dysfunction.

The invention also provides a pharmaceutical composition for preventing or treating a subject suffering from a disorder or disease associated with platelet activation dysfunction comprising the recombinant vector according to the invention in combination with one or more physiologically compatible vehicles or excipients. It is about.

In certain embodiments, a method for introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained from a mammal in vivo, comprises a formulation comprising a pharmaceutically compatible vector and a "extracted" nucleic acid according to the invention. While leaving under the control of an appropriate regulatory sequence, the agent is introduced by topical injection at the level of selected tissue, eg, smooth muscle tissue, wherein the “extracted” nucleic acid is taken up by cells of the tissue. do.

The present invention also relates to a present invention encoding a RGS18 protein for the manufacture of a medicament for preventing or treating a disorder or disease associated with platelet activation dysfunction, or more particularly for treating a subject having a disorder or disease associated with platelet activation dysfunction. It relates to the use of a nucleic acid according to the invention.

The invention also includes a nucleic acid encoding a RGS18 protein for the manufacture of a medicament for preventing a disorder or disease associated with platelet activation dysfunction, or more particularly for treating a subject having a disorder or disease associated with platelet activation dysfunction. And to the use of the recombinant vector according to the invention.

As indicated above, the present invention also relates to the use of the defective recombinant virus according to the present invention for the manufacture of a pharmaceutical composition for treating and / or preventing a disorder or disease associated with platelet activation dysfunction.

The invention also relates to the use of said defective recombinant virus for the manufacture of a pharmaceutical composition for treating and / or preventing a disorder or disease associated with platelet activation dysfunction. Accordingly, the present invention relates to pharmaceutical compositions comprising one or more defective recombinant viruses according to the present invention.

The invention also relates to the use of the virus-producing cells, or cells genetically modified in vitro with the virus according to the invention, implanted in the body, for the long-term effective expression of biologically active RGS18 protein in vivo.

The present invention shows that nucleic acids encoding RGS18 polypeptides can be incorporated into viral vectors and that these vectors can effectively express mature forms of biological activity. More particularly, the present invention shows that RGS18 can be expressed in vivo by either direct injection of adenovirus or by transplanting cells or production cells genetically modified by retroviruses or adenoviruses in which the nucleic acid is incorporated.

Preferably, the pharmaceutical composition of the present invention comprises an pharmaceutically acceptable vehicle or physiologically compatible excipient in an injectable formulation, in particular an intravenous injectable formulation, eg, a formulation for injection into the patient's context. do. These may in particular be directed to dry, in particular lyophilized compositions or isotonic sterile solvents which allow the preparation of injectable solutions when sterile water or physiological saline is optionally added. Injection directly into the patient's context is desirable because it can target infections at the liver level to focus therapeutic effects at the level of these organs.

"Pharmaceutically acceptable vehicle or excipient" includes pharmaceutically acceptable diluents and fillers in the method of administration, which may be sterile and aqueous or oleaginous suspensions formulated with suitable dispersing or wetting agents and suspending agents. . The pharmaceutically acceptable carrier and the ratio of the active compound to the carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration and standard pharmaceutical practice.

Any nucleic acid, polypeptide, vector or host cell of the invention will preferably be incorporated into a pharmaceutically acceptable vehicle or excipient in vivo. The expression “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerated and that when administered to humans do not cause allergic reactions or similar undesirable reactions such as vomiting, dizziness, and the like. Refer. Preferably, the term "pharmaceutically acceptable" as used herein refers to a US pharmacopoeia or other generally recognized pharmacopoeia that has been approved by federal or state officials for use in animals, more particularly humans. It means. The term “excipient” refers to a diluent, adjuvant, excipient, or vehicle with which the compound can be administered. Such pharmaceutical carriers can be sterile liquids such as water and oils, including oils of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous saline and aqueous dextrose and glycerol solutions are particularly preferably used as excipients for injection solvents. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Science" by E.W. Martin].

The pharmaceutical compositions according to the invention may be administered equally by the oral, rectal, vaginal, parenteral, intravenous, subcutaneous or intradermal route.

The invention also provides a medicament for preventing a disorder or disease associated with platelet activation dysfunction, or more particularly for treating a patient or subject suffering from a disorder or disease associated with platelet activation dysfunction, a) SEQ ID NO: 12 or 20 Any one of b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acid sequences of amino acids 86-166 of SEQ ID NO: 20 And to the use of an RGS18 polypeptide.

The present invention finally provides for a) any one of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) in a disorder or disease associated with platelet activation dysfunction comprising a therapeutically effective amount of a polypeptide having an amino acid sequence of amino acids 86-166 of SEQ ID NO: 20 in combination with one or more physiologically compatible vehicles and / or excipients A pharmaceutical composition for treating or preventing a patient or subject with a disorder.

According to another aspect, the subject matter also includes administering a nucleic acid encoding an RGS18 polypeptide to a particular patient or subject, optionally in combination with one or more physiologically compatible vehicles and / or excipients. Is a prophylactic or therapeutic method of treating a disorder or disease associated with platelet activation dysfunction.

According to another aspect, the subject matter also administers to a particular patient or subject a therapeutically effective amount of an RGS18 polypeptide according to the invention, optionally in combination with one or more physiologically compatible vehicles and / or excipients. A prophylactic or therapeutic method of treating a disorder or disease associated with platelet activation dysfunction, comprising

The present invention provides a polypeptide having an amino acid sequence of any one of SEQ ID NOs: 12 or 20, or a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86 of SEQ ID NO: 20 -202 or d) a patient or subject having platelet activation dysfunction comprising a therapeutically effective amount of a polypeptide comprising amino acids 86-166 of SEQ ID NO: 20 in combination with one or more physiologically compatible vehicles and / or excipients It relates to a pharmaceutical composition for treating or preventing.

In certain embodiments, a method for introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained from a mammal in vivo, comprises a formulation comprising a pharmaceutically compatible vector and a "extracted" nucleic acid according to the invention. While leaving under the control of an appropriate regulatory sequence, the agent is introduced by topical injection at the level of selected tissue, eg, smooth muscle tissue, wherein the “extracted” nucleic acid is taken up by cells of the tissue. do.

According to another aspect, the subject matter further comprises administering to a particular patient a therapeutically effective amount of an RGS18 polypeptide according to the invention, optionally in combination with one or more physiologically compatible vehicles and / or excipients. It is a prophylactic or therapeutic method for treating a disorder or disease associated with platelet activation dysfunction, including.

Preferably, a pharmaceutical composition comprising the RGS18 polypeptide according to the invention will be administered to a patient. Accordingly, the present invention also relates to RGS18 polypeptides, in particular associated with platelet activation dysfunction, characterized in that they comprise a therapeutically effective amount of nucleic acid encoding an RGS18 polypeptide having the amino acid sequence of any of SEQ ID NOs: 12 or 20. A pharmaceutical composition for preventing or treating a disorder or disease. In certain embodiments, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86 of SEQ ID NO: 20 Contains -166.

The subject matter of the present invention also encompasses a disorder or disease associated with platelet activation dysfunction, characterized in that it comprises a therapeutically effective amount of an RGS18 polypeptide, in particular a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 12 or 20. It relates to a pharmaceutical composition for preventing or treating. In certain embodiments, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20 or d) amino acids 86 of SEQ ID NO: 20 Contains -166.

In another embodiment, nucleic acids, polypeptides, recombinant vectors and compositions according to the invention can be delivered in vesicles, in particular liposomes (see 144-146).

In another embodiment, nucleic acids, polypeptides, recombinant vectors and compositions according to the invention can be delivered to a release control system. For example, the polypeptide can be administered using intravenous infusion, implantable osmotic pumps, transdermal patches, liposomes, or other modes of administration. In one aspect, pumps may be used (see 144 and 147-149). In another embodiment, polymeric materials can be used (150-155). In another embodiment, only a portion of the systemic dose is required by placing the release control system in close proximity to the target tissue or organ, ie the cardiovascular system (see 156). Other emission control systems that can be used are discussed in Langer (144).

In a further aspect, recombinant cells transformed with the nucleic acids according to the invention and expressing high levels of the RGS18 polypeptide according to the invention can be transplanted into a subject in need of the RGS18 polypeptide. Preferably, autologous cells transformed with the RGS18 encoding nucleic acid according to the present invention are implanted to avoid rejection; Alternatively, one can use techniques to mask bar-self cells that produce soluble factors in the polymer matrix that prevent immune recognition and rejection.

Thus, the RGS18 polypeptide can be delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous route of administration. Alternatively, suitably formulated RGS18 polypeptides can be administered by intranasal or oral route of administration. By providing a therapeutically effective dose (ie, a dose effective to induce metabolic changes in a subject) at the required intervals, such as daily, every 12 hours, etc., a continuous supply of RGS18 can be ensured. These parameters depend on the severity of the disease state to be treated, other actions to be performed, such as dietary modifications, the weight, age and sex of the subject, and other criteria that can be readily determined by one of ordinary skill in the art in accordance with good medical practice of the standard. Will be influenced.

The subject to which the nucleic acid, polypeptide, recombinant vector, recombinant host cell and composition according to the invention is administered is preferably human, but may be any animal. Thus, as will be readily appreciated by those skilled in the art, the methods and pharmaceutical compositions of the present invention are suitable for all animals, in particular livestock, for example cat or dog subjects, for breeding animals, for example cattle, horses, goats, sheep and Pigs and subjects, wild animals (whether in the wild or in the zoo), research animals such as mice, rats, rabbits, goats, sheep, pigs, dogs, cats, etc., bird species, for example chickens , Turkey, songbird, and the like, which are particularly suitable for administration to mammals, including but not limited to, ie, particularly suitable for veterinary use.

Preferably, a pharmaceutical composition comprising a nucleic acid, a recombinant vector, a polypeptide or a recombinant host cell as mentioned above will be administered to said patient or subject.

How to screen for agonist or antagonist compounds for RGS18 polypeptide

The invention also relates to a method for detecting an activator or inhibitor of an RGS18 protein and a polypeptide comprising an RGS18 domain.

The present invention also provides methods for screening small molecules and compounds that act on RGS18 proteins to identify agonists and antagonists of RGS18 polypeptides that can enhance, decrease or inhibit platelet activation from a therapeutic standpoint. These methods are useful for identifying small molecules and compounds for therapeutic use in treating disorders or diseases associated with platelet activation dysfunction.

According to another aspect, the invention also relates to a disorder or disease associated with platelet activation dysfunction, such as arterial thrombosis, myocardial infarction, coronary artery disease, seizures, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic Therapeutic uses useful for treating thromboembolism as well as various methods for screening small molecules and compounds for use in invasive cardiac processes for anticoagulant purposes.

Accordingly, the present invention also relates to the use of a cell expressing an RGS18 polypeptide according to the present invention or an RGS18 polypeptide according to the present invention for screening an active ingredient for preventing or treating a disorder or disease associated with platelet activation dysfunction. will be. The catalytic sites of the RGS18 polypeptide and oligopeptides or immunogenic fragments can serve to screen product libraries by a full range of existing techniques. The polypeptide fragments used for this type of screening may be free in solution, bound to a solid support, on the cell surface or within the cell. The formation of the binding complex between the RGS18 polypeptide fragment and the tested agent can then be measured.

Another product screening technique is described in WO 84/03564 that can be used for high-flow screening that allows to obtain a product showing affinity for the protein of interest. In this method, various products applied to the RGS18 protein are synthesized on a solid surface. These products react with the RGS18 protein or fragments thereof, washing these complexes. The product that binds to the RGS18 protein is then detected by methods known to those skilled in the art. Non-neutralizing antibodies can also be used to capture the peptide and immobilize it on a support.

Another possibility is to perform product screening methods using products that bind RGS18 neutralizing antibody competition, RGS18 protein and potentially RGS18 protein. In this manner, the antibody can be used to detect the presence of a peptide having an antigenic unit in common with the RGS18 polypeptide or protein.

Accordingly, the present invention is directed to screening products of mammalian, insect, bacterial or yeast origin, i.e. compounds, small molecules, etc., constitutively expressing or incorporating all synthetic or molecular type products, ie human RGS18 encoding nucleic acids. It relates to the use of all methods.

The invention also relates to the use of said system for screening molecules for modulating the activity of RGS18 protein. Accordingly, the present invention relates to methods for screening and identifying modulators, agonists or antagonists of RGS18 polypeptides in certain samples.

The present invention

a) incubating the labeled GTP-loaded G protein polypeptide with the RGS18 polypeptide and the specific sample;

b) measuring the GTP hydrolysis rate or degree of hydrolysis; And

c) GTP hydrolysis determined with the reconstituted labeled GTP-loaded G protein polypeptide / RGS18 polypeptide mixture, which was not previously incubated in the presence of the sample, with the GTP hydrolysis rate or degree of hydrolysis determined in step b) Comparing the rate or hydrolysis degree

In the sample, comprising a method for identifying a modulator, agonist or antagonist of RGS18 polypeptide.

In certain embodiments, the labeled GTP-loaded G protein polypeptide of step a) is loaded with γ- ³² P-GTP and the GTP hydrolysis rate or degree of hydrolysis of step b) is determined by the amount of free ³² P _i released. Measure by decision.

In another specific embodiment, the RGS18 polypeptide comprises SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and SEQ ID NO: 20 Amino acid sequences selected from the group consisting of amino acids 86-166.

In particular, the present invention

a) loading γ- ³² P-GTP on the purified G protein polypeptide;

b) incubating the γ- ³² P-GTP-loaded G protein polypeptide of step a) with the purified RGS18 polypeptide and a candidate modulator, agonist or antagonist compound for such RGS18 polypeptide;

c) determining the rate of GTP hydrolysis or degree of hydrolysis by determining the amount of free ³² P _i released; And

d) reconstituted γ- ³² P-GTP-loaded G, wherein the GTP hydrolysis rate or degree of hydrolysis determined in step c) was not previously incubated in the presence of a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide. Comparing GTP hydrolysis rate or degree of hydrolysis measured with protein polypeptide / purified RGS18 polypeptide mixture

To a method of identifying a modulator, agonist or antagonist of an RGS18 polypeptide, in a particular sample, comprising.

Reconstitution of purified RGS18 polypeptides with purified G protein polypeptides within the methods of the invention can be performed according to all techniques, in particular Berman et al. (157).

In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NOs: 12 or 20.

In a second specific embodiment, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) SEQ ID NO: 20 Amino acids 86-166.

RGS18 modulator compounds identified by the methods of the present invention can reduce or increase the GTP hydrolysis rate or degree of hydrolysis by the RGS18 polypeptide according to the present invention.

The present invention

a) incubating the cell membrane fraction expressing the RGS18 polypeptide with labeled GTP and a specific sample;

b) measuring the GTP hydrolysis rate or degree of hydrolysis; And

c) comparing the GTP hydrolysis rate or degree of hydrolysis determined in step b) with the GTP hydrolysis rate or degree of hydrolysis measured with a cell membrane fraction expressing an RGS18 polypeptide that was not previously incubated in the presence of the sample.

In the sample, comprising a method for identifying a modulator, agonist or antagonist of RGS18 polypeptide.

In certain embodiments, the cell membrane fraction is obtained from natural cells or by transfecting the cells with RGS18 encoding nucleic acids to obtain cells expressing the RGS18 polypeptide and by separating the membranes of these cells.

In another specific embodiment, the labeled GTP of step a) is labeled with γ- ³² P, and the GTP hydrolysis rate or degree of hydrolysis of step b) is determined by determining the amount of free ³² P _i released.

In another specific embodiment, the RGS18 polypeptide comprises SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and SEQ ID NO: 20 Amino acid sequences selected from the group consisting of amino acids 86-166.

In particular, the present invention

a) obtaining a natural cell or a cell expressing an RGS18 polypeptide (eg, a cell line) after transfecting with a RGS18 encoding nucleic acid and isolating the membrane of such cell;

b) incubating the cell membrane of step a) with γ- ³² P-GTP and a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide;

c) determining the rate of GTP hydrolysis or degree of hydrolysis by determining the amount of free ³² P _i released; And

d) the GTP hydrolysis rate or degree of hydrolysis determined with the cell membrane, not previously incubated in the presence of a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide, determined in step c). Comparing steps

To a method of identifying a modulator, agonist or antagonist of an RGS18 polypeptide, in a particular sample, comprising.

Cell membrane fractions within the methods of the invention can be prepared according to all techniques, in particular, Denecke et al. (158).

In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NOs: 12 or 20.

In a second specific embodiment, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) SEQ ID NO: 20 Amino acids 86-166.

RGS18 modulator compounds identified by the methods of the present invention can reduce (inhibitor) or increase (activator) the GTP hydrolysis rate or degree of hydrolysis by the RGS18 polypeptide according to the present invention.

The invention also relates to a method of identifying modulators, agonists or antagonists of an RGS18 polypeptide, comprising determining a downstream effect of the RGS18 polypeptide or the effect of a modulator, agonist or antagonist on the effector molecule. .

Therefore, the present invention

a) incubating the cell expressing the RGS18 polypeptide with labeled adenine and a specific sample;

b) measuring the amount of labeled cyclic AMP (cAMP) thus produced; And

c) comparing the amount of labeled cAMP measured in step b) with the amount of labeled cAMP measured with cells expressing RGS18 polypeptide, which was not previously incubated in the presence of the sample.

In the sample, comprising a method for identifying a modulator, agonist or antagonist of RGS18 polypeptide.

In certain embodiments, cells expressing an RGS18 polypeptide are transfected with an RGS18 encoding nucleic acid.

In another specific embodiment, the labeled adenine of step a) is ³ H-adenine.

In another specific embodiment, the RGS18 polypeptide comprises SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and SEQ ID NO: 20 Amino acid sequences selected from the group consisting of amino acids 86-166.

In particular, the present invention

a) obtaining a natural cell or a cell (eg, a cell line) expressing an RGS18 polypeptide after transfecting the cell with an RGS18 encoding nucleic acid;

b) incubating the cells of step a) with ³ H-adenine and a candidate modulator compound for said RGS18 polypeptide;

c) determining the amount of radiolabeled cyclic AMP (cAMP) thus produced; And

d) comparing the amount of radiolabeled cAMP measured in step c) with the amount of radiolabeled cAMP measured in cells that were not previously incubated in the presence of a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide. step

It relates to a method of identifying modulators, agonists or antagonists of RGS18 polypeptide, comprising.

The amount of radiolabeled cAMP can be determined according to all techniques, in particular Huang et al. (159).

In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NOs: 12 or 20.

In a second specific embodiment, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) SEQ ID NO: 20 Amino acids 86-166.

RGS18 modulator compounds identified by the methods of the invention may reduce or increase the amount of cAMP produced by the RGS18 polypeptide according to the invention.

The present invention also provides

a) incubating the cell expressing the RGS18 polypeptide with labeled inositol and a specific sample;

b) measuring the amount of labeled inositol triphosphate produced thereby; And

c) comparing the amount of labeled inositol triphosphate measured in step b) with the amount of labeled inositol triphosphate measured with cells expressing an RGS18 polypeptide that was not previously incubated in the presence of the sample.

In the sample, comprising a method for identifying a modulator, agonist or antagonist of RGS18 polypeptide.

In certain embodiments, cells expressing an RGS18 polypeptide are transfected with an RGS18 encoding nucleic acid.

In another specific embodiment, the labeled inositol of step a) is ³ H-inositol.

In another specific embodiment, the RGS18 polypeptide comprises SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and SEQ ID NO: 20 Amino acid sequences selected from the group consisting of amino acids 86-166.

In particular, the present invention

a) obtaining a natural cell or a cell (eg, a cell line) expressing an RGS18 polypeptide after transfecting the cell with an RGS18 encoding nucleic acid;

b) incubating the cells of step a) with ³ H-inositol and a candidate modulator compound for the RGS18 polypeptide;

c) measuring the amount of radiolabeled inositol triphosphate produced thereby; And

d) Radiolabeled inositol triphosphate measured in cells, wherein the amount of radiolabeled inositol triphosphate measured in step c) was not previously incubated in the presence of a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide. Compare with the amount of

In the sample, comprising a method for identifying a modulator, agonist or antagonist of RGS18 polypeptide.

The amount of radiolabeled inositol triphosphate can be determined according to all techniques, in particular Huang et al. (159).

In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NOs: 12 or 20.

In a second specific embodiment, the RGS18 polypeptide comprises a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO: 20, or d) SEQ ID NO: 20 Amino acids 86-166.

RGS18 modulator compounds identified by the methods of the invention may reduce or increase the amount of inositol triphosphate produced by the RGS18 polypeptide according to the invention.

According to a first aspect of the screening method, the cells used are natural cells expressing the RGS18 polypeptide. These may be human platelets in primary cultures purified from human blood mononuclear cell populations. They may also be human megakaryocyte cell lines such as HEL cells, Meg-01 and Dami cells.

According to a second aspect, the cells used in the above-mentioned screening methods may be cells that do not naturally express or express low levels of the RGS18 polypeptide, which cells direct the expression of nucleic acids expressing the RGS18 polypeptide. And transfection with the recombinant vector according to the invention.

According to a third aspect of the screening method, the RGS18 polypeptide may be a recombinant RGS18 polypeptide.

The invention can be better understood with reference to the following non-limiting examples, which are provided as examples of the invention.

As part of a better understanding of the coordination of GPCR mediated signaling in platelets, we sought to identify G protein signaling regulator proteins (RGSs) present in human platelets and some megakaryocyte cell lines. RT-PCR was performed using degenerate oligonucleotides based on conserved regions of the highly homologous RGS domain, using human platelet RNA as well as RNA from several megakaryocyte cell lines. In addition to confirming the presence of some known RGS transcripts, novel RGS domain containing transcripts have been found in platelet RNA. Northern blot analysis of multiple human tissues indicates that the new transcript is expressed in the highest amount in platelets compared to other tissues examined. These RGS transcripts are expressed in large amounts in platelets, but at fairly low levels in other tissues, mainly hematopoietic system tissues. The transcript is expressed at moderate levels in three megakaryocyte cell lines and tissues of hematopoietic origin, such as white blood cells, bone marrow and spleen, and low levels of expression have also been detected in other tissues. The full length cloning of the novel RGS, named RGS18, demonstrates that the transcript encodes a 235 amino acid protein. RGS18 is the closest (46% identity) with RGS5 and shows about 30-40% identity with other RGS proteins. Peptide directed antiserum against RGS18 detects expression of about 30 kDa protein in platelet, leukocyte and megakaryocyte cell line lysates. Not binding than G _αz, G _αs or G _α12 from the lysate treated ^{platelet-vitro} RGS18 is an endogenous G _αi2, G _αi3 than binding and G _αq but, GDP + AlF ₄ -. RGS18 may be partly involved in the regulation of pathways important for platelet activation, since the aggregation of platelets requires the activation of receptors coupled with G _αq and / or one or more forms of G _{α i} .

Reagents were purchased from Sigma (Sigma, St. Louis, Mo.) unless otherwise noted. Reagents for GST fusion protein expression and purification, including pGEX-5X-1 and glutathione-Sepharose 4B, were purchased from Amersham / Pharmacia (Piscataway, NJ). Oligonucleotides and peptides were prepared by the following suppliers: Core Biotechnologies Department at Rhone-Poulenc Rorer. Double-stranded cDNAs from human leukocytes and human bone marrow were obtained from Clontech (Palo Alto, Calif.). Advantage PCR kits for marathon cDNA from human peripheral blood leukocytes and bone marrow, and the 5 'race, were obtained from Clontech (Palo Alto, Calif.). All reagents for cell culture were obtained from the following sources (Gibco / BRL (Rockville, MD)). Reagents for western blotting, including goat anti-rabbit IgG coupled with HRP, were purchased from BioRad (Herculus, Calif.). SuperSignalPico reagents were purchased from Source (Pierce (Rockford, IL)). The complete EDTA-free protease inhibitor cocktail was purchased from Roche Biochemicals (Indianapolis, Ind.). Cell lines were obtained from ATCC (Manassas, VA).

Example 1 RT-PCR Amplification and Cloning of Nucleic Acids Encoding RGS Domain

Preparation of Platelets, Leukocytes and Cell Lines : HEL cells and Meg-01 cells are maintained in RPMI supplemented with 10% fetal bovine serum, 0.3 mg / ml L-glutamine and 100 U / ml penicillin G / 100 mg / ml streptomycin sulfate . Dami cells were grown in Iscove's Modified Dulbecco's Medium supplemented with 10% heat inactivated horse serum, 0.3 mg / ml L-glutamine and 100 U / ml penicillin G / 100 mg / ml streptomycin sulfate Let's do it. Human platelets are obtained in concentrated form from the Interstate Blood Bank (Memphis, TN) and used the next day (2 days) after they are collected. If necessary for functional studies, fresh platelets are taken from the donor using 0.38% citrate as an anticoagulant. For both, platelets are spun at 120 X g for 15 minutes to collect erythrocytes and recover platelet rich plasma (PRP). Prostaglandin E ₁ (0.5 mg / ml) is added to the PRP to prevent activation and the platelets are pelleted at 800 × g for 15 minutes. The platelet pellets T load buffer (137mM NaCl, 2.7mM KCl, 1mM MgCl 2 · 6H 2 O, 5.5mM _{glucose, 11.9mM NaHCO 3, 0.36mM NaH 2} PO 4 · H 2 O, 10mM HEPES pH 7.35) + 0.35 Wash once in% human serum albumin (HSA; this decreases to 0.1% HSA for protein lysate that reduces albumin protein carryover) +0.25 mg / ml prostaglandin E ₁ . Platelets are pelleted at 800 X g and resuspended in appropriate buffer (trizol for RNA, lysis buffer for protein lysate). Leukocytes are freshly obtained from the donor of copper and separated during platelet preparation. Briefly, after removing the PRP for platelet separation, the white layer of cells forming the interface between platelet-rich plasma and pelleted red blood cells is removed, which is made up to 15 ml with platelet defective plasma, Dilute 1: 1 using PBS. 15 ml of this is carefully layered over the top of 15 ml of Hipaque. It is spun at 400 X g for 30 minutes at room temperature. Bands containing human leukocytes are separated, diluted 1: 1 in PBS, and spun at 400 × g for 10 minutes to separate cells. The cell pellet is then resuspended in a suitable lysis buffer (trizol or protein lysis buffer).

RT-PCR cloning strategy : Four degenerate oligonucleotides, previously used to isolate RGS transcripts, were synthesized, which are designed in highly homologous regions flanking the RGS domain of several members of the RGS superfamily. (8). These four oligonucleotides provided in the IUB code are as follows: RGS1: GRIGARAAYHTIGARTTYTGG (SEQ ID NO: 1), RGS2: GRIGARAAYHTIMGITTYTGG (SEQ ID NO: 2), RGS3: GRTAIGARTYITTYTYCAT (SEQ ID NO: 3) and RGS4: GRTARCTRTYITTYTY (SEQ ID NO: 4). Total RNA is prepared from human platelets, HEL cells, DAMI cells and MEG-01 cells using Trizol reagent (Gibco / BRL, Rockville, MD) according to the manufacturer's instructions. Human platelets (Interstate Blood Bank, Memphis, TN) obtained from platelet concentrates on day 2 are prepared as above, pelletized and dissolved in 5 ml Trizol reagent. Pellet counts vary in cell pellets, but typical values range from 0.9 to 5 × 10 ¹⁰ platelets and yield of total RNA is 25 to 100 mg. Single stranded cDNA was reverse transcribed using Superscript II (Gibco / BRL, Rockville, MD), 2-5 mg total RNA and 160 ng random hexamer (Roche Biochemicals, Indianapolis, IN) according to the manufacturer's instructions. Manufacture. In 50 μl reaction volume containing oligonucleotides RGS1, RGS2, RGS3 and RGS4, 300 ng, 400 mM dNTP, 1.5 mM MgCl ₂ , respectively, 1 × PCR buffer and 1 μl of Taq polymerase (Gibco / BRL, Rockville, MD) PCR was performed using 1/8 of cDNA reaction, typically 5 μL. In some studies, 1 μl of human bone marrow human peripheral blood leukocyte cDNA was used for amplification. Amplification was carried out in PCRSprint Thermocycler (Hybaid, Franklin, Mass.) Using the following cycle conditions: 2 minutes at 94 ° C. (1 cycle), 30 seconds at 94 ° C., 1 at 42 ° C. For 2 minutes (72 cycles) at 72 ° C., followed by 7 minutes at 72 ° C. To increase the yield of colonies, a second cycle of amplification is performed using 1-5 μl of initial PCR reaction product. The reaction product (about 230 bp) is separated by agarose gel electrophoresis and purified using a Qiaquick gel extraction kit (Qiagen, Chatsworth, Calif.). The resulting purified PCR reactions are cloned into pCR2.1 using TA cloning kit (Invitrogen, Carlsbad, Calif.) And transformed into INVαF-cells. Single colonies are replicated in fresh plates, numbered for reference, and grown for DNA purification. Using universal primers complementary to the cloning vector sequence (M13 forward primer, SEQ ID NO: 37 and M13 reverse primer, SEQ ID NO: 38), all colonies (50 colonies, one rotation if two amplifications were performed) Cases were subjected to automated plasmid purification and sequencing on 25 colonies). Sequence analysis was performed using an automated sequence analysis system (ABI). The identity of each PCR product was determined by comparing sequence data with data from known RGS, using the Seqman and Megalign programs of Lagergene software, and the BESTFIT, GAP and PILEUP of GCG programs.

RT-PCR Results of RGS from Human Platelets and Megakaryocytes

Reverse transcription-polymerase chain reaction (RT-PCR) strategies were used to identify RGS family members expressed in human platelets and several megakaryocyte cell lines. Degenerate primers were designed and synthesized based on highly homologous regions in several previously identified RGS proteins (8). These primers were used to amplify total RNA from human platelets (Plt) and three megakaryocyte cell lines, DAMI, HEL and MEG-01 cells. Amplification of RNA from all four tissues yields about 240 base pair bands, which are purified, cloned into pCR2.1, and transformed into soluble Escherichia coli. Fifty colonies from each PCR reaction are picked out, grown, then plasmids are isolated from each and sequenced. The resulting sequence data was analyzed by comparing it with known RGS proteins, the results of which are summarized in Table 1. The most predominant amplification product in all three megakaryocyte cell lines is RGS16, an RGS that was first identified in the mouse retina (160) but also present in lymphocytes and many other tissues (161,162). However, unlike the cell line, the most predominant PCR product from platelet RNA (SEQ ID NO: 11) encodes a novel partial RGS domain that is not present in the published domain database (coded by nucleotides 1-241 of SEQ ID NO: 11). SEQ ID NO: 12). Among the 50 tested in DAMI cells, a single colony also encoded this novel RGS domain. The novel partial RGS domain comprises amino acids 1-81 of SEQ ID NO: 12 and is shown in FIG. 1, which is slightly smaller due to the location of the degenerate oligonucleotide probe. The novel RGS domain exhibits 30-46% homology with known RGS, with the highest homology with RGS5. In addition, platelets contain transcripts for RGS10 and MEG-01 cells contain RGS4. It is not surprising that all tissues tested contain ubiquitous expressed RGS2.

Identification of RGS isoforms by degenerate RT-PCR of total RNA from human platelets and three megakaryocyte cell lines Plt RNA DAMI RNA HEL RNA MEG RNA RGS2 3 One One 3 RGS10 One RGS16 4 33 37 20 RGS4 3 New RGS18 17 One vector/? 12/2 4/4 7/2 14/0 ND 11 7 3 10 Degenerate oligonucleotide primers designed for conserved regions of the RGS domain are used to amplify RNA from human platelets, DAMI, HEL and MEG-01 cells as mentioned above. This amplification product is smoothly linked to pCR2.1 and transformed into soluble Escherichia coli. Fifty colonies are picked out, plasmid DNA is isolated and sequenced. Sequence data generated from each colony was compared with the coding region of known RGS and tabulated. In some cases where plasmids reconnected to themselves do not produce any inserts, they are referred to as "vectors". Plasmids containing inserts but not showing any visible homology with known genes are marked with “?”, Which is expected to be an artifact of the PCR reaction. Sequencing reactions (many unknown nucleotides) that produce qualitatively poor data have been referred to as "ND", which has not been determined.

Example 2: Full Length Cloning of RGS18 cDNA

The new PCR product was compared to EST's LIFESEQ proprietary Insight database. Only one match was found. The EST is from a human thyroid library and the 5'most end of the EST is substantially identical to the last 72 base pairs of the applicant's clone. The EST clones were purchased from Insight, grown and analyzed to determine if these two transcripts were indeed relevant. Full sequencing using the M13 forward and M13 reverse primers (SEQ ID NOs 37 and 38, respectively) confirmed that there was a 72 bp overlap and sequence information for the carboxy terminal portion of the protein and the 1274 bp 3 ′ non-toxic region. Provided.

5 'race was used to obtain full length sequence information. Marathon cDNAs from human bone marrow and peripheral blood leukocytes (Clontech, Palo Alto, Calif.) Were used in the 5 'race strategy. According to the manufacturer's instructions for the 5 'race, antisense primers from the 3' non-toxic region [5'-cgctagggccttagactccttgcttcttcc] using marathon ready cDNA coupled with advantage cDNA polymerase (Clontech, Palo Alto, CA) 5 'race was performed using -3', SEQ ID NO: 5]. The reaction product from the race procedure was acloned into pCR2.1, transformed into a soluble INVαF ^- Escherichia coli, and 20 colonies were subjected to nRGS11-nRGS19 sequencing primers (SEQ ID NOs: 30-36, respectively). And restriction analysis and sequencing using M13 forward and M13 reverse primers (SEQ ID NOs: 37 and 38, respectively). Table 2 lists the positions of these primers within SEQ ID NO: 19, the nRGS11-nRGS19 sequencing primers used to determine the nucleic acid sequence of the 5 'race clone, and the cDNA encoding the full-length RGS18 polypeptide. .

Primer for 5 'race RGS18-specific sequencing primer Sequence (5 '→ 3') Sequence number Position on SEQ ID NO: 19 nRGS11 CTACTATGTATATGTATGGAATAG 30 77-100 nRGS12 GAATTTTGGATAGCCTGTGAAG 31 502 to 523 nRGS13 CGATCACGCTCATTTACCTGCAAT 32 805 to 828 nRGS14 CTGAAATATGTCATGTGAAATTAT 33 964 to 987 nRGS17 CATAAACATGCATATGTTAG 34 918 to 938 nRGS18 TGGGGCATCAGTCTGTATAAA 35 586 to 606 nRGS19 CCTGAACCATGTATTAACTTG 36 228 to 248

Full Length Cloning Results of Novel Platelet RGS

To identify the full length sequence of the partial clones, an electronic survey of the EST database was performed. No identical hit was found in the published domain EST database. The new PCR product was compared to the LIFESEQ proprietary insight database of EST. Only one hit was found, and EST (SEQ ID NO: 6) was from the human thyroid library. Nucleotide 1-59 of SEQ ID NO: 6 shows complete identity with nucleotides 170-228 of SEQ ID NO: 11, and nucleotides 60-72 of SEQ ID NO: 6 show partial identity with nucleotides 229-241 of SEQ ID NO: 11. Since the library is initiated with oligos (dT), it is expected that the EST will comprise the carboxy terminal region of the novel RGS18 transcript and the 3 ′ non-toxic domain. The clones were purchased from Insight and analyzed by restriction analysis and sequencing. The insight clone is a novel PCR product (nucleotides 170-228 of SEQ ID NO: 11) at the 5 'end (nucleotides 1-59 of SEQ ID NO: 6) and a poly (at nucleotides 1471-1486 of the SEQ ID NO: 6) at the 3' end (SEQ ID NO: 6). A) ⁺ 1468 bp cDNA insert (SEQ ID NO: 6) showing identity with residue extension. When translated, the EST domain comprises a partially open reading frame (nucleotide 3-209 of SEQ ID NO: 6) encoding a 69 amino acid polypeptide (SEQ ID NO: 13). The partially open reading frame of the EST is adjacent to that of the novel PCR product (SEQ ID NO: 11), wherein amino acids 1-23 of SEQ ID NO: 13 are identical to amino acids 59-81 of SEQ ID NO: 12, except that Amino acid 20 (amino acid 78 of SEQ ID NO: 12) is excluded. Based on homology with other known RGS domain containing proteins that extend beyond 72 bp overlaps of EST and PCR products, nucleic acid lends indicate that the EST represents the 3 'end of the novel RGS18 PCR product. Support. To further confirm that these two cDNAs are from substantially the same transcript, sense primers (5'-ATAGCCTGTGAAGATTTCAAG-3 '; SEQ ID NO: 14 designed for near 5' sequence information from Applicants' platelet PCR products) ), And three antisense primers (5'-TGGCAACATCTGATTGTACAT-3 '; SEQ ID NO: 15, 5'-AAGTTTGTCATAAAAATGAGC-3'; SEQ ID NO: 16, selected from three different sites in the Insight EST outside the overlapping region with the initial PCR clone) And 5'-TTAACATAAACATGCGATATG-3 '; SEQ ID NO: 17), RT-PCR analysis of platelet RNA was performed. From each of these reactions confirming the fact that the novel PCR clone and the Insight EST cDNA are actually part of adjacent transcripts in platelet RNA (data not shown), PCR products of the expected size were obtained.

Using sequence information from the 3 'non-translated region of the insight clone (SEQ ID NO: 6), a 5' race was performed to isolate the entire coding region of the novel RGS18. Because platelets do not contain high levels of high quality RNA, cDNAs from human bone marrow and peripheral blood leukocytes were specifically designed and used for 5 'races. Preliminary Northern blot data demonstrates that new RGS18 transcripts are present at low levels in both tissues. Primers (SEQ ID NO: 5) were designed in distant 3 ′ non-toxic regions, and the positions of these primers were indicated by underlined sequence information in FIG. 1, Panel B. FIG. Using the 3 'non-toxic region primer (SEQ ID NO: 5) and cDNA of both bone marrow and peripheral blood leukocytes, a 5' race was performed using the Advantage PCR kit according to the manufacturer's instructions. This 5 'race PCR reaction product was analyzed by acloning into pCR2.1 and restriction mapping. The longest insert (about 2 kB) was selected for sequencing. Sequence analysis as mentioned above determined that these 5 'race PCR products included 1840 nucleotides (SEQ ID NO: 18). The 5 'race PCR product was constructed with a full predicted open reading frame encoding a novel full-length RGS18 polypeptide (SEQ ID NO: 20) and a short extension of the 5' untranslated region (nucleotides 1-162 of SEQ ID NO: 18). Nucleotide 163-870 of SEQ ID NO: 18). Sequence data was compiled from 5 'race clones (SEQ ID NO: 18), Insight EST cDNA (SEQ ID NO: 6), and initial PCR clones (SEQ ID NO: 11), and a schematic of the relative positions of each of these duplicate clones is shown in FIG. 1, panel B shows the nucleotide sequence of the edited nucleic acid (SEQ ID NO: 19) and the expected amino acid sequence of the novel full-length RGS18 polypeptide encoding it (SEQ ID NO: 20). . Nucleotide 163-870 of SEQ ID NO: 19 shows a full length open reading frame that encodes a full length RGS18 polypeptide (SEQ ID NO: 20).

RGS18 cDNA (SEQ ID NO: 19) is 2144 base pairs in length and encodes a protein of 235 amino acids (SEQ ID NO: 20). Theoretical pi of the protein is 7.73 and the molecular weight is 27,582.22 daltons. Scanning protein sequence motifs using a Prosite database revealed a presumed consensus site for the protein to be phosphorylated by several protein kinases as well as the RGS domain (residues 86 to 202 of SEQ ID NO: 20). Confirm that it contains. The residues 213 to 216 of SEQ ID NO: 20 form a consensus site (underlined in FIG. 1, panel B) for phosphorylation by cAMP and cGMP-dependent protein kinases. There are four potential sites for protein kinase C phosphorylation and five potential sites for casein kinase II (CKII) phosphorylation (for PKC, residues 28-30, 33-35, 63-65 and 92-94; and residues 28-31, 33-36, 76-79, 92-95 and 220-223 of SEQ ID NO: 20 for CKII. Amino acids 221-224 of SEQ ID NO: 20 in the carboxy terminus of the protein encode a putative CAAX motif that acts as a site of modification by fatty acylation and modulates the activity of RGS18.

Example 3: Tissue Distribution of RGS18 Nucleic Acids and Polypeptides

Total RNA Isolation and Northern Blot Analysis : Preparation of total RNA from human platelets, white blood cells, HEL cells, Dami cells and Meg-01 cells was performed as mentioned above. Multi-human tissue Northern blot was purchased from Clontech (Palo Alto, Calif.). To Northern blot human platelets, human leukocytes and megakaryocyte cell lines, 10 mg of total RNA was added to 1.5% agarose in 1 × MOPS buffer (20 mM 3-N-morpholinopropanesulfonic acid, pH 7.0, 5 mM sodium acetate, 1 mM EDTA). /5.8% formaldehyde gels. RNA was transferred to nylon membrane in 20X SSC (0.3 mM NaCl, 0.3 mM sodium citrate) using a turboblotter system (Schleicher and Schull, Keene, NH), and stratagene, La Jolla, UV crosslinking to the membrane using CA). Multiple tissue northern blots using 1 mg of poly (A) ⁺ RNA from each of 12 different tissues were purchased from Clontech (Palo Alto, Calif.). Both of these blots were prehybridized in 10 ml ExpressHyb solution (Clontech (Palo Alto, Calif.)) For 1 hour at 68 ° C. For each blot, approximately 25 ng of the 1486 base-pair insight clone EST (SEQ ID NO: 6) encoding the 3 'end of the coding region and the 3' untranslated region was obtained from P-α [dCTP] and the high prime kit (Roche Biochemicals, Indianapolis). , NJ) and purified on a microspin S-200 column (Amersham / Pharmacia, Piscataway, NJ). The two labeled probe batches are mixed and added to 20 ml ExpressHyb. Each blot is hybridized with 10 ml of the probe mixture at 68 ° C. for 2 hours. Due to this process, the blots each hybridized with probes of the same specific activity, and the results were easier to compare. The blot was washed for 40 minutes in 2X SSC / 0.05% SDS at room temperature and then subjected to a high stringency in 0.1X SSC / 0.1% SDS for 40 minutes at 50 ° C. and exposed to Kodak Biomax film at −70 ° C. Let's do it. After removal of the probe using 0.5% SDS at 100 ° C., the labeled β-actin probe was manufactured by Clontech (Palo Alto, Calif.); Catalog # SO130] was used to normalize the blots as mentioned above.

Generation of polyclonal antiserum, Western blot analysis and cell lysate preparation : To make polyclonal antiserum KLIHGSGEETSKEAKIR (SEQ ID NO: 7) from the amino terminal portion of RGS18 and to make QRPTNLRRRSRSFTCNEFQ (SEQ ID NO: 8) from the carboxy terminal region, 2 Peptides were selected. These peptides are synthesized in-house by PRP Core Biotechnologies Department and conjugated to keyhole limpet hemocyanin (KLH) for injection into rabbits. Conventional polyclonal antiserum is produced from the conjugated peptides by Rockland Immunochemicals (Gilbertsville, Pa.) According to standard procedures. The specificity of the antiserum was characterized using recombinant RGS18 and platelet lysates produced by coupled in vitro transcription / detoxification (TNT reticulolysate system; Promega, Madison, Wis.). Typically, antiserum is diluted in 1: 500 (3NRGS-12) or 1: 1,000 (5NRGS-13) dilution in 5% skim milk powder in TBST (20 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.05% Tween-20). Used for western blotting. To demonstrate that the observed immune reactivity was specific for RGS18, peptide inhibition studies were conducted. For peptide inhibition studies, the antiserum was quenched at 100 ° C. for 2 hours or overnight at 4 ° C., with or without 100 mg / ml of immunized or unrelated peptide, 100 mM Tris, pH 7.5 + 1 × EDTA-free Complete ™ mini protease inhibitor. Incubated in a cocktail (Roche Biochemicals, catalog # 183-6170). This is then diluted to an operating concentration in blocking buffer (5% skim milk powder in TBST) (1: 500 or 1: 1000) and incubated with nitrocellulose strips for 1 hour at room temperature (RT), followed by Deploy as shown. Lysing cells in 50 mM HEPES, pH 8.0, 6 mM MgCl ₂ , 300 mM NaCl, 1 mM DTT, 1% Triton X-100 and 1X EDTA-Free Complete ™ Mini Protease Inhibitor Cocktail from Roche Biochemicals, Catalog # 183-6170 This results in complete cell lysates for western blotting from platelets, leukocytes and three megakaryocyte cell lines. Cells are lysed on ice and spun at 13,000 × g for 10 minutes at 4 ° C. to pellet insoluble material and transfer the supernatant to a fresh tube. Protein determinations are performed using the Bradford assay using BSA to generate a standard curve. 50 μg of each lysate is run on 15% reducing SDS-PAGE, transferred to a 0.2 mM nitrocellulose membrane and blotted as mentioned above. To detect RGS10 in cell lysate, SDS-PAGE was performed as mentioned above, and the resulting nitrocellulose strips were blocked in 2% BSA / TBST and blocking buffer for 2 hours at RT or overnight at 4 ° C. Incubate with 1: 500 dilution of anti-RGS10 antibody in Santa Cruz Biotechnology, Santa Cruz, CA. Using mouse anti-goat IgG coupled to horseradish peroxidase (HRP: Pierce, Rockford, IL) and Supersignal West Pico ECL reagent (Pierce, Rockford, IL) Bound antibody was detected.

Tissue Distribution Results of RGS18 Nucleic Acids and Polypeptides in Human Tissues

To determine the relative tissue distribution of RGS18, two Northern blots are hybridized with a 3 ′ non-dock region probe from RGS18 (SEQ ID NO: 6). The first blot contains 10 mg / lane of total RNA from human platelets, human leukocytes, DAMI cells, HEL cells and MEG-01 cells. The second blot is a commercial human multiple tissue Northern (Clontech; Palo Alto, CA) containing 1 μg of poly (A) ⁺ mRNA from 12 human tissues, one lane of which contains RNA from polymorphonuclear leukocytes. It contains. To perform a fair comparison, the labeled probes were divided into two and used to probe both blots simultaneously. RGS18 probe hybridizes with a majority species of about 2.75 Kb and a minor species of about 4.2 Kb in platelet RNA, but to a lesser extent in DAMI cells, HEL cells and MEG-01 cells (FIG. 3, Panel A). Human leukocyte RNA also expresses these transcripts at the same or slightly less levels than in MEG-01 cells. No matter when evaluating the level of expression of transcripts in platelet RNA, the complete separation of platelets and leukocytes is difficult, so the skilled person has to correlate the contamination levels of platelet RNA with richer leukocyte RNA. The fact that leukocytes have lower expression levels of RGS18 compared to platelet RNA indicates that this is not a concern for the transcript. Thus, platelets express a message for a significant amount of RGS18 compared to leukocytes, and are expressed at moderate levels in megakaryocyte cell lines.

Results from human multiple tissue northern blots are shown in FIG. 3, panel B. FIG. Overall hybridization signals require much lower and much longer exposures than those observed with the platelet northern blot. For example, if both blots hybridize with the same probe and the same specific activity, platelet northern blots require 6 hours to self-radiate exposure, whereas human multiple tissue northern requires 6 days. On multiple tissue blots, the darkest band is consistently in the leukocyte lane, followed by the spleen, heart and liver, and extremely low levels in skeletal muscle, colon, kidney, small intestine, pancreas and lung. Hybridization of multiple tissue northern containing RNA from other human tissues has demonstrated that RGS18 is expressed at moderate levels in human bone marrow, which is comparable to the level observed in the spleen (data not shown). . These northern blots are repeated two more times on fresh blots to ensure consistent results. Using this data to compare the expression levels of RGS18, it is believed that the expression level of the message in platelets significantly exceeds the expression level in leukocytes, which expresses RGS18 in the excess of other tissues examined. Based on this conclusion, we used white blood cells and bone marrow cDNA in the degenerate RT-PCR strategy to find RGS transcripts, as performed for platelets, none of which sequenced colonies contained RGS18. . As can be expected from previous studies, the amplification products abundant in leukocytes and bone marrow in these studies are hRGS2 and hRGS16 (data not shown).

Western Blot Assay of RGS18 Expression in Human Platelets

One generates polyclonal anti-RGS18 antiserum for two peptides, one at the amino terminus of RGS18 (SEQ ID NO: 7) and the other at the carboxy terminus (SEQ ID NO: 8). The position and sequence of these peptides are shown in the boxed region of FIG. 2. These regions were selected because of their divergence from similar regions of other known RGS. The serum thus generated was tested in Western blot using platelet lysates to determine reactivity and specificity. Previous studies suggest that these polyclonal antibodies also react with recombinant RGS18 synthesized by coupled transcription / detoxification (data not shown). Antisera directed against both the carboxy terminal peptide and the amino terminal peptide reacts with about 30 kDa bands in platelet lysate. Preincubation of each antiserum with its corresponding immunized peptide, except for other peptides, results in no antibody reactivity with the 30 kDa protein, indicating that each antibody is indeed specific for RGS18 (FIG. 4, Panel A). . Antiserum 5NRGS-13 (indicated for amino terminal peptides comprising SEQ ID NO: 7) has a higher titer than 3NRGS-12 (indicated for carboxy terminal peptides containing SEQ ID NO: 8), which adds protein expression levels Used to evaluate Western analyzes were performed on platelets, leukocytes, and lysates prepared from DAMI, HEL and MEG-01 cells to compare the relative protein expression levels of RGS18. FIG. 4, Panel B shows representative experimental results using antisera against the amino terminal peptide 5NRGS-13. Consistent with northern expression data, RGS18 protein is significantly richer in platelets than in white blood cells, DAMI cells, HEL cells or MEG-01 cells. Although immunoreactive bands in the MEG-01 lanes are not visible in FIG. 4, Panel B, longer exposures actually demonstrate expression of RGS18 in these cells. Northern expression data suggests that RGS18 expression levels in MEG-01 cells may be similar to leukocytes, but this was not observed in Western blot analysis. This is due to the presence of contaminating platelets in the leukocyte preparation, which may overestimate RGS18 expression in white blood cells. Indeed, Western blots using antibodies against platelet specific protein α _2b (GPIIb, CD41) demonstrate reactivity with leukocyte lysates, indicating that some contaminating platelets are present in the leukocyte preparation (data not shown). ).

Since the presence of hRGS10 is detected by RT-PCR and hRGS10 antibodies are available, hRGS10 expression levels were examined by Western blotting. Using these anti-hRGS10 antibodies, Western blotting of platelet, leukocyte and megakaryocyte cell lysates was performed as mentioned above, where hRGS10 is expressed at nearly equal levels in platelets, leukocytes and DAMI cells, and the other two. In megakaryocyte cell lines, they are expressed at low levels (FIG. 4, Panel B). hRGS10 has also been reported to be expressed in the brain (163). Combined, these data indicate that hRGS18 and hRGS10 are both expressed in platelets and hRGS18 is preferentially expressed in platelets over leukocytes, but hRGS10 is not. Based on northern blotting data, expression of hRGS18 in other human tissues is expected to be at or below the level observed in white blood cells, indicating that hRGS18 may have a limited tissue distribution, preferentially expressed in platelets. Suggest

Example 4: Expression and Purification of GST-Fusion Proteins

To generate the in-frame GST fusion protein using the BamHI and XhoI sites of plasmid pGEX-5X-1, most of the 5 'with the XhoI site following the stop codon in the 3' primer and the BamHI site in the same frame on the 5 'primer Oligonucleotides were synthesized from the coding region and 3 ′ mostly coding region. These oligonucleotides, ie sense (5'-gttcggatccgagagaagatggaaacaacattgcttttc-3 '; SEQ ID NO: 9) and antisense (5'-gtgctcgagttaacataaacatgcgatatg-3'; SEQ ID NO: 10), are used for RT-PCR to amplify platelet RNA. The resulting PCR amplification product was subjected to complete sequencing to determine the fidelity of the PCR reaction, which was then cloned into pGEX-5X-1 and then subjected to capacity BL-21 (DE3) from Novagen, San Diego. , CA). Expression and purification of the resulting fusion protein was performed as described in the manufacturer's instructions. In essence, overnight cultures were diluted 1: 100 in Luria broth containing 100 mg / ml ampicillin (typically 500 ml to 1 liter) and shaken at 30 ° C. until OD ₆₀₀ = 0.6. To grow. The culture is then induced with 0.5 mM IPTG at 30 ° C. for 2 hours. Cells are pelleted, washed once in cold PBS, lysozyme (ICN, Costa Mesa, CA) 100 mg / ml, DNAase (Gibco / BRL, Rockville, MD) 50 mg / ml and 1X EDTA-free Resuspend in PBS containing the Complete ™ Mini Protease Inhibitor Cocktail (Roche Biochemicals, Catalog # 183-6170). The cells thus suspended are sonicated on ice and Triton X-100 is added to a final concentration of 1%. Cell lysates are mixed at 4 ° C. for 30 minutes and then centrifuged at 12,000 × g for 10 minutes at 4 ° C. The supernatant is transferred to a fresh tube, 2 ml of a 50% slurry of washed glutathione-sepharose 4B is added and then incubated at 4 ° C. for 1 hour. The matrix was then washed batchwise 5-8 times in ice cold PBS and resuspended in 50% slurry and aliquots in 50 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM DTT, 10% glycerol and protease inhibitors, Store frozen at 70 ° C. Prior to use, the matrix is thawed, washed 2-3 times in PBS or lysis buffer and resuspended in 50% slurry. If necessary, elution of GST-RGS18 was performed by loading the Sepharose 4B bound fusion protein into the column and eluting with 20 mM reduced glutathione in 100 mM Tris pH 8.0, 120 mM NaCl.

Example 5: G Protein Alpha Subunit Binding Assay

The method of determining the G protein alpha subunit binding specificity of RGS18 was performed by slightly modifying the content described in Beadling et al. (164). Washed platelets from concentrate on day 2 were prepared using 50 mM HEPES, pH 8.0, 300 mM NaCl, 1 mM DTT, 6 mM MgCl ₂ , 1% Triton X-100 and 1X EDTA-free Complete ™ mini protease inhibitor cocktail from Roche Biochemicals, Catalog # 183-6170). Protein determinations were performed using the Bradford assay (BioRad, Hercules, Calif.) Using BSA as a standard curve, and prior to use, the lysates were adjusted to 1 mg / ml in lysis buffer. Cell lysates (450 ml) are activated with 30 mM GDP or 30 mM GDP + 30 mM AlCl ₃ and 100 mM NaF at 30 ° C. for 30 minutes. After incubation, the lysate was rapidly spun into a microcentrifuge to pellet actin, which became insoluble upon activation of platelet lysate. The lysate was transferred to a fresh tube and incubated for 1 hour at 4 ° C. with 20 ml (typically about 10 mg RGS18 polypeptide) of 50% slurry of GST-RGS18 coupled to glutathione-Sepharose 4B beads. The beads were washed with 1 ml of wash buffer [50 mM HEPES, pH 8.0, 300 mM NaCl, 1 mM DTT, 6 mM MgCl ₂ , 0.025% C ₁₂ E ₁₀ and 1X EDTA-free Complete ™ mini protease inhibitor cocktail from Roche Biochemicals, Catalog # 183-6170) twice. The bound protein is eluted in two rounds of boiling in reducing Laemmli buffer (50 mM Tris-HCl pH 6.8, 1% SDS, 0.008% bromophenol blue, 5% glycerol), targeting 12 SDS-PAGE on% gel, transfer to 0.45 mM nitrocellulose, G _{αi1 / 2} (Calbiochem, San Diego, CA), G _{αi3 / O} (Calbiochem, San Diego, CA), G _αz (manufacturer) : Santa Cruz Biotechnology, Santa Cruz, CA), G αq / 11 ( manufactured by: Santa Cruz Biotechnology, Santa Cruz, CA), G α12 ( manufacturer: Santa Cruz Biotechnology, Santa Cruz, CA), or G _αs (manufactured by: Calbiochem , San Diego, CA and Santa Cruz Biotechnology, Santa Cruz, CA). Bound antibodies were detected using goat anti-rabbit-HRP (BioRad, Hercules, Calif.) And SuperSignal West Pico ECL reagent (Pierce, Rockford, IL).

Binding Assay of RGS18 to Endogenous G Protein Alpha Subunits in Human Platelets

To determine the target alpha subunit of RGS18, binding experiments were performed using GST-RGS18 as prepared in Example 4 and lysate of human platelets. Similar methods have been used to determine the binding specificity of hRGS16 using Jurkat cells (164). Previous studies have demonstrated that the RGS protein studied so far binds to the G protein alpha subunit only when the alpha subunit is in its transitional state or "activated" state (165). For these experiments, platelets are dissolved in Triton X-100 containing buffer and resuspended at 1 mg / ml. The lysate was then treated with GDP to keep the alpha subunit in a GDP-bound “inactivated” state, or with GDP + AlF ₄ ⁻ , which mimics the transition state of the G _α subunit. Recombinant GST-RGS18 bound to -4 beads was added to the lysate treated as above, incubated and washed several times. Bound proteins are eluted in Laemry buffer and subjected to SDS-PAGE followed by Western blot analysis. A panel of G protein alpha subunit specific antibodies was used to determine the alpha subunit binding to RGS18. 5 shows representative experimental results. If all alpha subunits are in an inactive GDP-bound state, they rarely bind to RGS18 (middle lanes in each panel). In contrast, in lysates treated with GDP + AlF ₄ ⁻ , RGS18 _binds to a significant amount of alpha subunits detected by antibodies directed against G _{αi1 / 2} , G _{αo / i3} and G _αq11 . This interaction is believed to be of I-specific, since this was not RGS18 binding than G _αz, G _α12, or G _αs. Neither GST nor Sepharose 4B alone combine with these alpha subunits in GDP or GDP + AlF ₄ ⁻ treated platelet lysates (data not shown). Binding selectivity of RGS18 is consistent with those found for the other RGS protein binding to a member of the G _αi family and selectively and / or G _αq Family 14.

Example 6: Homology Comparison of RGS18 with Other RGS Proteins

The expected amino acid sequence of RGS18 (SEQ ID NO: 20) was compared with the amino acid sequence of several other closely related RGS proteins. Figure 2 shows human RGS18 protein (SEQ ID NO: 20) and human (h) RGS4 (SEQ ID NO: 21), hRGS5 (SEQ ID NO: 22), hRGS16 (SEQ ID NO: 23), hRGS2 generated using a pileup program from GCG. (SEQ ID NO: 24), hRGS1 (SEQ ID NO: 25), and hRGS10 (SEQ ID NO: 26) are shown. The shaded regions represent amino acids that are conserved between RGS18 and two or more other RGSs. The RGS18 domain region initially isolated by RT-PCR, ie amino acids 1-77 and 79-81 of SEQ ID NO: 12, corresponding to amino acids 109-185 and 187-189 of SEQ ID NO: 20, are indicated by lines over the amino acids of FIG. It is. Human RGS18 is most homologous to human RGS5 (47% identity), followed by rat RGS8 (SEQ ID NO: 27; 44%), hRGS2 (41%), hRGS4 and hRGS16 (40%), hRGS1 (37%) , hRGS10 and hRGS3 (SEQ ID NO: 28; 36%) and hRGS13 (SEQ ID NO: 29; 34%). Human RGS18 shows 20-30% identity with other known RGS proteins. Recent phylogenetic studies of the RGS superfamily indicate that there are six or more unique superfamily members (166). RGS18 is most closely associated with family B. The RGS protein in family B contains the characteristic short amino and carboxy terminal domains (except RGS3) and two conservative amino acids (positioned with an asterisk over the residues in FIG. 2). The first is an asparagine (ASN) residue at position 128 in hRGS4 (SEQ ID NO: 21) found in families B, C and D and is conserved in hRGS18 (amino acid 152 of SEQ ID NO: 20). Family B is the most divergent group and contains only one superfamily specific residue. Serine is conserved between known RGS family members (Ser 103 in hRGS4 (SEQ ID NO: 21)), but the residue is not conserved in hRGS18 (glycine at amino acid 127 of SEQ ID NO: 20). All residues except one residue in hRGS4 found to be in contact with the G _α subunit are conserved between hRGS18 and hRGS4 (indicated as ↑ in FIG. 2).

Argument

Traditionally, G protein signal transduction cascades consist of integrative membrane receptors, hetero-trimeric GTP-binding proteins, and downstream effectors. More recently, the complexity of these signaling pathways has been visualized by identifying additional signaling molecules that control the unique aspects of these signaling pathways. Several families of molecules have been identified that act to attenuate receptor-mediated signaling at the receptor and / or G protein levels (167). G protein signaling regulator (RGS) is a novel family of proteins identified in the genetic studies of yeasts and worms (nematodes) as negative G protein signaling regulators, and many mammalian homologs have been identified so far (14). . RGS is believed to accelerate GTP hydrolysis by regulating signaling through interaction with one or more G _α subunits, thereby stabilizing the transition state of such G _α subunits (19). As part of a better understanding of GPCR mediated signaling in human platelets, studies were conducted to examine the isomorphism of the RGS family present in platelets. Applicants have identified in the present invention a nucleic acid encoding RGS18, a novel G protein signaling regulator that is abundantly expressed in human platelets.

Platelets are enucleate cells, but they contain small amounts of residual cytoplasmic RNA carried over from megakaryocyte cells, perhaps their precursor cells. Several groups have taken advantage of the presence of these residual RNAs to identify platelet proteins molecularly and biologically (168). Degenerate RT-PCR analysis is particularly suitable for the study of transcript expression in platelets, since this technique requires minimal RNA. RGS transcripts expressed in platelet RNA were identified using degenerate primers (SEQ ID NOs: 1-4) designed based on the amino acids of the RGS domain and conserved amino acids in the carboxy terminal region. Surprisingly, most of the amplification products encoded a novel partial RGS domain (amino acids 1-81 of SEQ ID NO: 12 corresponding to amino acids 109-189 of SEQ ID NO: 20; amino acids 78 of SEQ ID NO: 12). Platelets also appear to contain transcripts for other previously known RGS proteins, including hRGS2, hRGS16 and hRGS10. In addition, RNA from three megakaryocyte cell lines, DAMI, HEL and MEG-01 cells, were analyzed using the same method, unlike the one found in platelet RNA, the most abundant amplification product in each of these cells was hRGS16. . One colony out of 50 analyzed in DAMI cells contained a PCR product containing a novel partial RGS domain, indicating that these cells also express new RGS. These cells are expected to differ from platelets in their RGS expression due to the fact that they are not differentiated and are naturally leukemia cells. This is an unexpected result, as some studies have demonstrated modulation of RGS expression in several different cell types. Both expression levels of hRGS1 and hRGS2 can be regulated by stimulatory factors in lymphocytes (11, 12), and hRGS16 is regulated by IL-1 (164) in lymphocytes and p53 (161), a tumor suppressor in colon carcinoma cell lines. Can be adjusted. Although these cell lines exhibit many aspects of the megakaryocyte lineage (ie, the expression of GPIIb / IIIa and other platelet specific genes) (169-171) and have proven useful for the identification of platelet specific genes, they are involved in the process of platelet signal transduction. Not a perfect model. Most importantly, these cells are not considered to have inherent signal transduction pathways that stimulate the binding of soluble fibrinogen to GPIIb / IIIa, where their signal transduction pathways or complement of signaling proteins differ from platelets. (172). The most abundant RGS isoform in human bone marrow and peripheral blood leukocyte RNA detected by degenerate RT-PCR is hRGS2 (data not shown), which further points to the difference between platelets and other hematopoietic cells. The fact that each tissue exhibits a different transcript profile indicates that the primers are not biased to only one RGS isoform relative to the other isoforms, and that the proportional expression observed by the applicant using this method reflects the relative RNA expression levels. It is a good indication that you can.

Although RGS18 was not detected in human peripheral blood leukocyte RNA by the degenerate RT-PCR, the transcript was virtually not amplified from platelet RNA, but can be amplified from contaminating leukocyte RNA. Since platelets contain little RNA, small amounts of leukocyte contaminants can cause unbalanced contamination of platelet RNA by leukocyte RNA. Northern blot analysis of human platelet and leukocyte RNA indicates that this is not the case, because platelet RNA expresses RGS18 at significantly higher levels than leukocytes. Megakaryocyte cell lines express RGS18 at intermediate levels of platelets and white blood cells. Examination of RGS18 expression by Northern blotting in a wide range of human tissues revealed that RGS18 is most abundantly expressed in platelets, followed by leukocytes, other tissues of the hematopoietic system: the spleen and bone marrow, as well as the heart and liver. Instruct Extremely low levels of expression can be detected in skeletal muscle, colon, kidney, small intestine, pancreas and other tissues, including lungs, but it is still a question to determine whether these levels translate to the actual expression of proteins in these tissues. to be. Two transcripts for RGS18, namely the majority species of 2.75 Kb and a few species of 4.2 Kb, are expressed in platelet RNA as well as other tissues examined. The presence of two mRNA species on the northern blot indicates that, like others, selective splicing and / or different polyadenylation is applied to the transcript.

Full length cloning of RGS18 was sequenced from the initial PCR product (SEQ ID NO: 11) of the RGS domain, which is an overlapping insight EST cDNA (SEQ ID NO: 6) comprising a 3 'non-toxic region and a 5' race cDNA (SEQ ID NO: 18). Achievement by combining the information yields the complete cryptographic region of RGS18 and some 5 ′ non-toxic regions (SEQ ID NO: 19). The open reading frame (SEQ ID NO: 19) of the RGS18 cDNA encodes a 235 amino acid protein (SEQ ID NO: 20) having a putative RGS domain (amino acids 86-202 of SEQ ID NO: 20). RGS18 has extremely short carboxy and amino terminal domains flanking the internal RGS domain and does not appear to contain functional domains for scaffolding (ie, PH, Dbl, GGL, or DEP). However, it has one putative CAAX motif that may act as an acylation site and allow membrane fixation. RGS18 also contains several consensus sites for phosphorylation by enzymes cAMP / cGMP dependent protein kinase, protein kinase C and casein kinase II. This indicates the regulatory potential of RGS18 by other signaling cascade amplification reactions.

Recently, a phylogenetic analysis of the family demonstrated that the RGS superfamily could be divided into six or more subfamily (A to F) (166). RGS18 is most likely a member of subfamily B, since it is most closely associated with these RGS, and subfamily B members also contain amino and carboxy terminal domains as short as RGS18. RGS18 contains a highly conserved asparagine residue at position 152 of SEQ ID NO: 20 (hRGS4; relative position 128 in SEQ ID NO: 21), which is conserved in three of the six families above. Structural studies of RGS4 indicate that these residues are critical for stabilizing GAP activity and the transition state of G _α (18,173). Unlike some other subfamily, subfamily B is a diverse group and only one amino acid, the Ser residue (hRGS4; position 103 in SEQ ID NO: 21), is conserved among all members of family B. However, the corresponding residue in RGS18 (position 127 in SEQ ID NO: 20) is glycine, which disputes whether RGS18 is in fact a member of subfamily B. Interestingly, hRGS10 cannot be classified as one of the subfamily due to its divergence from other known RGSs. Recently, a sequence of a novel RGS named RGS17, isolated from the chicken dorsal ganglion cDNA library, has been reported that is distinct from platelet hRGS18 (31% amino acid identity) and is in fact believed to be a member of subfamily A (174). ). It is not yet confirmed whether RGS18 belongs to family B, and further functional and structural properties confirmation is expected. Seven of the eight human RGSs in family B appear to be concentrated on chromosome 1, probably due to gene duplication events (166). It will be interesting to determine if RGS18 is also localized on the chromosome. As additional members of the RGS subfamily are identified and more information about the functional groups of each RGS is obtained, it will become clearer to characterize the various RGS subfamily.

Since RNA expression levels do not always reflect protein expression levels, we thought it was important to monitor the expression of RGS18 in western blot using specific antiserum. One produces directed antisera against two peptides, one at the amino terminus of RGS18 and the other at the carboxy terminus. RGS18 migrates on SDS-PAGE with an apparent molecular weight of 30 kDa, is abundantly expressed in platelets, and significantly less in leukocytes and three megakaryocyte cell lines. This reactivity can be neutralized by preincubation of the antiserum with the immunized peptide, demonstrating that the reactivity of this 30kDa band is specific for RGS18. The presence of RGS18 in commercial lysates (Clontech, Palo Alto, Calif.) Was not detected from human brain, liver or lung (data not shown). If RGS18 is expressed in both of these tissues, its expression level is probably too low to be detected by commercial tools.

Platelets are known to express various G _α subunits. Predecessor result, platelets are members of the G _αi family, that is containing G _αi1, G _αi2, G _αi3, G _αz, G _{α12 / 13,} G _α16, G _αs (5) and G _αq However, G _α11 are not contain Turned out to be. Since no source of recombinant G protein alpha subunit is available, the endogenous platelet G protein was used to analyze the G protein alpha subunit selectivity of RGS18. This strategy was used by Beadling et al., Using Jurkat cell lysate and recombinant hRGS16, to determine the binding specificity of hRGS16 (164). The GST-tagged fusion protein of _RGS18 is a G _α subunit detected by antibodies to G _{αi1 / 2} , G _{αi3 / o} , and G _{αq / 11} in platelet lysates that are activated by treatment with GDP + AlF ₄ ⁻ Combined with. In these same experiments, the RGS18 does not interact with the G _αz, G _α12, or G _αs. The antiserum is somewhat Although has the overlapping specificities, but the platelets are so contained the levels of G _αi1 impossible to detect immunologically 177, of the detected majority with the first antiserum G _α subunits of the G _αi subunit _Will be G _αi3 . G _αo is because it was not reported in platelets, and is most likely that these antibodies to detect the interaction with G _αi3. G _α11 is because it is not expressed in the platelets (175,176), G _{αq / 11} antibody detects the presence of G _αq. Taken together, these data indicate that RGS18 can interact with G _αq , G _αi2 and / or G _αi3 and regulate one or more pathways mediated by these G _α subunits in platelets.

The G _α subunit specificity is in the same line as has been demonstrated for other _{RGSs that} typically interact with G _{α i} and / or members of the G _{α q} family. RGS interacting with G _αs was not identified at all. P115RhoGEF, an RGS protein from subfamily F, is believed to be the only member identified to interact with the G α12 _{/ 13} subunit (178,179). Despite the fact that G _αz is abundantly expressed in platelets (180), RGS18 is not considered to interact with this alpha subunit. Interestingly, hRGS10 is expressed on platelets at both RNA and protein levels. hRGS10 has been reported to interact not only come G _αz G _αi3 (181). This is probably because RGS10 and RGS18 may act to regulate different signaling pathways in platelets because their G _α preferences are somewhat unique.

The exact function of RGS18 in platelet signal transduction is not clear. Vitro G _α subunit binding specificity, indicating that RGS18 allows the G _αi and G _αq adjustable path-mediated through the activation of the associated path. In platelets, coagulation is a positive G _αi - _αq and G - is considered to be a coupling dependent on concurrent activation of the receptor ring (37). The platelet agonists thrombin, thromboxane A ₂ and ADP are all associated with signaling pathways through these G _α subunits. Blockade of signaling via G _α in mice results in platelets becoming unresponsive to various agonists, resulting in a bleeding-sensitive phenotype (39). Because of the ubiquitous expression of G _α , these mice also exhibit other poor phenotypes, including dysfunction, making G _αq an inferior target for anti-platelet therapy. Due to the fact that RGS18 has the potential to regulate G protein mediated pathways in platelets critical for platelet activation and that it is abundant in platelets relative to tissues, yet unknown proteins that regulate RGS18 or RGS18 aim to regulate platelet activation. It will be an excellent target for the treatment. Further studies focusing on the regulation of individual GPCRs and their signaling pathways by RGS18 and other RGS present in platelets will better understand the role of RGS in platelet activation events.

The scope of the invention is not limited to the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will be apparent to those skilled in the art from the foregoing description and the accompanying drawings. Such modifications also fall within the scope of the appended claims.

It should further be appreciated that all base sizes or amino acid sizes, and all molecular weight or molecular weight values presented for a nucleic acid or polypeptide, are approximations and are provided for the description.

Various publications are referenced herein, the entire contents of which are incorporated herein by reference.

Cited References

Claims (77)

a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) The polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, e) of SEQ ID NO: 19 Polynucleotide sequence of nucleotides 163-658, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) nucleotide 418- of SEQ ID NO: 19 658 polynucleotides An isolated nucleic acid comprising a sequence, or a complementary polynucleotide sequence thereof. a) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, c) sequence number A polynucleotide sequence of 19 nucleotides 163-658, or a complementary polynucleotide sequence thereof, or d) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or 8 or more consecutive nucleotides of its complementary polynucleotides Isolated nucleic acid. a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) The polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the polynucleotide sequence of nucleotide 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, e) of SEQ ID NO: 19 Polynucleotide sequence of nucleotides 163-658, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) nucleotide 418- of SEQ ID NO: 19 658 polynucleotides An isolated nucleic acid that exhibits at least 80% nucleotide identity with a nucleic acid comprising a sequence, or a complementary polynucleotide sequence thereof. The nucleic acid of claim 3, wherein the nucleic acid is a) a polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or Its complementary polynucleotide sequence, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or its complementary polynucleotide Nucleotide sequence, e) a polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) a polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof g) nucleotide 418-6 of SEQ ID NO: 19 An isolated nucleic acid that exhibits 85%, 90%, 95% or 98% nucleotide identity with a nucleic acid comprising the polynucleotide sequence of 58, or a complementary polynucleotide sequence thereof. Under highly stringent conditions, a) the polynucleotide sequence of any one of SEQ ID NOs: 11, 18 or 19, or its complementary polynucleotide sequence, b) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or its complementary poly Nucleotide sequence, c) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) a polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof A) the polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, f) the polynucleotide sequence of nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or g) SEQ ID NO: 19 nucleotides An isolated nucleic acid that hybridizes with a nucleic acid comprising the polynucleotide sequence of 418-658, or a complementary polynucleotide sequence thereof. An isolated nucleic acid comprising a polynucleotide sequence as set forth in any one of SEQ ID NOs: 18 or 19, or a complementary polynucleotide sequence thereof. a) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, c) sequence number A polynucleotide sequence of 19 nucleotides 163-658, or a complementary polynucleotide sequence thereof, or d) 15 or more consecutive nucleotides of the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof A nucleotide probe or primer specific for an RGS18 nucleic acid, comprising. 8. The nucleotide probe or primer of claim 7 comprising a marker compound. a) the polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary polynucleotide sequence thereof, b) SEQ ID NO: 11 The polynucleotide sequence of nucleotides 1-169 of, or its complementary polynucleotide sequence, c) the nucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence, d) the nucleotide 163- of SEQ ID NO: 19 Nucleotide probe or primer specific for an RGS18 nucleic acid comprising a polynucleotide sequence of 658, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof . The nucleotide probe or primer of claim 9 comprising a marker compound. a) contacting the nucleic acid with a first nucleotide primer hybridized at the 5 'position of the nucleic acid region and a second nucleotide primer hybridized at the 3' position of the nucleic acid region, in the presence of a reagent required for the amplification reaction ; And b) detecting the amplified nucleic acid region A method for amplifying a nucleic acid region according to claim 1 comprising a. The method of claim 11, wherein the two nucleotide primers are A) a) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or its complementary polynucleotide sequence, b) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, c) A polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) at least 15 contiguous sequences of the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleotide primers, including nucleotides; And B) a) a polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary polynucleotide sequence thereof, b) sequence The polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the nucleotide of SEQ ID NO: 19 Nucleotide primer comprising a polynucleotide sequence of 163-658, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Method selected from the group consisting of. a) two nucleotide primers, each having a hybridization position at 5 'and 3' of the nucleic acid region of interest; And 2) optionally, reagents required for the amplification reaction Kit comprising amplifying the nucleic acid according to claim 1. The method of claim 13, wherein the two nucleotide primers are A) a) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or its complementary polynucleotide sequence, b) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, c) A polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) at least 15 contiguous sequences of the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleotide primers, including nucleotides; And B) a) a polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary polynucleotide sequence thereof, b) sequence The polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the nucleotide of SEQ ID NO: 19 Nucleotide primer comprising a polynucleotide sequence of 163-658, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Kit selected from the group consisting of. A) the nucleic acid, 1) a) the polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or its complementary polynucleotide sequence, b) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or its complementary polynucleotide sequence thereof, c) A polynucleotide sequence of nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) at least 15 contiguous sequences of the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleotide probes including nucleotides; And 2) a) a polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary polynucleotide sequence thereof, b) sequence The polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the nucleotide of SEQ ID NO: 19 A nucleotide probe comprising a polynucleotide sequence of 163-658, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Contacting with a nucleotide probe selected from the group consisting of; And B) detecting the complex formed between the nucleic acid and the probe Including, the method of detecting a nucleic acid according to claim 1. The method of claim 15, wherein the probe is immobilized on a support. A) 1) a) a polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, b) a polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, c) at least 15 of the polynucleotide sequence of nucleotide 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, or d) the polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleotide probes comprising consecutive nucleotides; And 2) a) a polynucleotide sequence of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary polynucleotide sequence thereof, b) sequence The polynucleotide sequence of nucleotides 1-169 of SEQ ID NO: 11, or a complementary polynucleotide sequence thereof, c) the polynucleotide sequence of nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof, d) the nucleotide of SEQ ID NO: 19 A nucleotide probe comprising a polynucleotide sequence of 163-658, or a complementary polynucleotide sequence thereof, or e) a polynucleotide sequence of nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence thereof Nucleotide probes selected from the group consisting of; And B) optionally, the reagents required for the hybridization reaction A kit for detecting a nucleic acid according to claim 1 comprising a. The kit of claim 17 wherein the probe is immobilized on a support. A recombinant vector comprising the nucleic acid according to claim 1. The recombinant vector of claim 19, wherein the recombinant vector is adenovirus. A recombinant vector comprising the nucleic acid according to claim 6. The recombinant vector of claim 21, wherein the recombinant vector is adenovirus. A recombinant host cell comprising the nucleic acid according to claim 1. A recombinant host cell comprising the nucleic acid according to claim 6. Recombinant host cell comprising the recombinant vector according to claim 19. Recombinant host cell comprising the recombinant vector according to claim 21. a) any one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) of SEQ ID NO: 20 An isolated nucleic acid encoding a polypeptide comprising an amino acid sequence of amino acids 86-166. A recombinant vector comprising a nucleic acid according to claim 27. A recombinant host cell comprising the recombinant vector according to claim 28. A recombinant host cell comprising the nucleic acid according to claim 27. a) any one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) of SEQ ID NO: 20 An isolated polypeptide comprising the amino acid sequence of amino acids 86-166. An antibody directed against an isolated polypeptide according to claim 31. 33. The antibody of claim 32 comprising a detectable compound. An isolated polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 20. An antibody directed against an isolated polypeptide according to claim 34. 36. The antibody of claim 35 comprising a detectable compound. a) contacting said polypeptide with an antibody according to claim 32; And b) detecting the antigen / antibody complex formed between the polypeptide and the antibody Including, the detection method of the polypeptide. a) an antibody according to claim 32; And b) reagents that allow detection of antigen / antibody complexes formed between the polypeptide and antibody Including, diagnostic kit for detecting the polypeptide. A pharmaceutical composition comprising an excipient physiologically compatible with the nucleic acid according to claim 1. A pharmaceutical composition comprising an excipient which is physiologically compatible with the nucleic acid according to claim 6. A pharmaceutical composition comprising an excipient physiologically compatible with the recombinant vector according to claim 19. A pharmaceutical composition comprising an excipient physiologically compatible with the recombinant vector according to claim 21. A pharmaceutical composition comprising an excipient which is physiologically compatible with the nucleic acid according to claim 27. A pharmaceutical composition comprising an excipient which is physiologically compatible with the recombinant vector according to claim 28. A pharmaceutical composition comprising an excipient physiologically compatible with a recombinant host cell according to claim 29. A pharmaceutical composition comprising an excipient physiologically compatible with a recombinant host cell according to claim 30. A pharmaceutical composition comprising an excipient that is physiologically compatible with the polypeptide of claim 31. A pharmaceutical composition comprising an excipient which is physiologically compatible with the polypeptide according to claim 34. Use of a nucleic acid according to claim 1 for the manufacture of a medicament for preventing or treating platelet activation dysfunction. Use of a nucleic acid according to claim 6 for the manufacture of a medicament for preventing or treating platelet activation dysfunction. Use of a recombinant vector according to claim 19 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a recombinant vector according to claim 21 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of the nucleic acid according to claim 27 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a recombinant vector according to claim 28 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a recombinant host cell according to claim 29 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a recombinant host cell according to claim 30 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a polypeptide according to claim 31 for the manufacture of a medicament for the prevention or treatment of platelet activation dysfunction. Use of a polypeptide according to claim 31 for screening active ingredients for preventing or treating platelet activation dysfunction. Use of a recombinant host cell expressing a polypeptide according to claim 31 for screening active ingredients for preventing or treating platelet activation dysfunction. An implant comprising a recombinant host cell according to claim 23. An implant comprising a recombinant host cell according to claim 25. An implant comprising a recombinant host cell according to claim 29. a) incubating the labeled GTP-loaded G protein polypeptide with the RGS18 polypeptide and the specific sample; b) measuring the GTP hydrolysis rate or degree of hydrolysis; And c) GTP hydrolysis determined with the reconstituted labeled GTP-loaded G protein polypeptide / RGS18 polypeptide mixture, which was not previously incubated in the presence of the sample, with the GTP hydrolysis rate or degree of hydrolysis determined in step b) Comparing the rate or hydrolysis degree A method of identifying a modulator, agonist or antagonist of RGS18 polypeptide in a sample comprising a. The free ³² P _i of claim 63, wherein the labeled GTP-loaded G protein polypeptide of step a) is loaded with γ- ³² P-GTP and the GTP hydrolysis rate or degree of hydrolysis of step b) is released. The method measured by determining the amount. The polypeptide of claim 63, wherein the RGS18 polypeptide is SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acid of SEQ ID NO: 20 A method comprising an amino acid sequence selected from the group consisting of 86-166. a) incubating the cell membrane fraction expressing the RGS18 polypeptide with labeled GTP and a specific sample; b) measuring the GTP hydrolysis rate or degree of hydrolysis; And c) comparing the GTP hydrolysis rate or degree of hydrolysis determined in step b) with the GTP hydrolysis rate or degree of hydrolysis measured with a cell membrane fraction expressing an RGS18 polypeptide that was not previously incubated in the presence of the sample. A method of identifying a modulator, agonist or antagonist of RGS18 polypeptide in a sample comprising a. 67. The method of claim 66, wherein the cell membrane fraction is obtained from natural cells or obtained by transfecting the cells with an RGS18 encoding nucleic acid to obtain cells expressing the RGS18 polypeptide and separating the membranes of such cells. 67. The method of claim 66, wherein the labeled GTP of step a) is labeled with γ- ³² P and the GTP hydrolysis rate or degree of hydrolysis of step b) is measured by determining the amount of free ³² P _i released. 67. The polypeptide of claim 66, wherein the RGS18 polypeptide is SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids of SEQ ID NO: 20 A method comprising an amino acid sequence selected from the group consisting of 86-166. a) incubating the cell expressing the RGS18 polypeptide with labeled adenine and a specific sample; b) measuring the amount of labeled cyclic AMP (cAMP) thus produced; And c) comparing the amount of labeled cAMP measured in step b) with the amount of labeled cAMP measured with cells expressing RGS18 polypeptide, which was not previously incubated in the presence of the sample. A method of identifying a modulator, agonist or antagonist of RGS18 polypeptide in a sample comprising a. The method of claim 70, wherein the cell expressing the RGS18 polypeptide is transfected with an RGS18 encoding nucleic acid. The method of claim 70, wherein the labeled adenine of step a) is ³ H-adenine. The polypeptide of claim 70, wherein the RGS18 polypeptide is SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acid of SEQ ID NO: 20 A method comprising an amino acid sequence selected from the group consisting of 86-166. a) incubating the cell expressing the RGS18 polypeptide with labeled inositol and a specific sample; b) measuring the amount of labeled inositol triphosphate produced thereby; And c) comparing the amount of labeled inositol triphosphate measured in step b) with the amount of labeled inositol triphosphate measured with cells expressing an RGS18 polypeptide that was not previously incubated in the presence of the sample. A method of identifying a modulator, agonist or antagonist of RGS18 polypeptide in a sample comprising a. The method of claim 74, wherein the cell expressing the RGS18 polypeptide is transfected with an RGS18 encoding nucleic acid. 75. The method of claim 74, wherein the labeled inositol of step a) is ³ H-inositol. The polypeptide of claim 74, wherein the RGS18 polypeptide comprises SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acid of SEQ ID NO: 20 A method comprising an amino acid sequence selected from the group consisting of 86-166.