MXPA02010414A - Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof. - Google Patents

Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof.

Info

Publication number
MXPA02010414A
MXPA02010414A MXPA02010414A MXPA02010414A MXPA02010414A MX PA02010414 A MXPA02010414 A MX PA02010414A MX PA02010414 A MXPA02010414 A MX PA02010414A MX PA02010414 A MXPA02010414 A MX PA02010414A MX PA02010414 A MXPA02010414 A MX PA02010414A
Authority
MX
Mexico
Prior art keywords
seq
polynucleotide sequence
polypeptide
complementary polynucleotide
nucleic acid
Prior art date
Application number
MXPA02010414A
Other languages
Spanish (es)
Inventor
Alison W Gagnon
Original Assignee
Aventis Pharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0018833A external-priority patent/GB0018833D0/en
Application filed by Aventis Pharma Inc filed Critical Aventis Pharma Inc
Publication of MXPA02010414A publication Critical patent/MXPA02010414A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Abstract

The present invention relates to nucleic acids that encode novel Regulator of G protein Signaling RGS18 polypeptides. RGS18 polypeptides are abundantly expressed in platelets and comprise a novel RGS domain (RGS18 domain). The present invention also relates to RGS18 polypeptides. The invention also relates to means for the detection of RGS18 nucleic acids and RGS18 polypeptides. The invention also relates to methods for the detection of activators or inhibitors of RGS18 polypeptides. Finally, the present invention relates to methods of prevention and or treatment of disorders or conditions associated with platelet activation dysfunction.

Description

NUCLEIC ACIDS THAT CODIFY A NOVEDOUS REGULATOR OF SIGNALIZATION OF PROTEIN G, RGS18, AND THEIR USES FIELD OF THE INVENTION The present invention relates to nucleic acids encoding a novel protein G protein signaling (RGS) regulator, RGS18. RGS18 is abundantly expressed in platelets and comprises a novel RGS domain (domain RGS18). The present invention also relates to nucleic acids encoding a polypeptide comprising the novel RGS18 domain. The present invention also relates to a cDNA encoding the new full-length RGS18 protein- In addition, the present invention relates to the RGS18 protein and polypeptides comprising the novel RGS18 domain. The invention also relates to a recombinant vector comprising a nucleic acid according to the present invention. The invention also relates to a means for the detection of nucleic acids of RGS18, protein, and polypeptide comprising the RGS18 domain. The invention also relates to methods for the detection of RGS18 protein activators or inhibitors and polypeptides comprising RGS18 domain. Finally, the invention relates to methods for the prevention and / or treatment of disorders or conditions associated with the dysfunction of platelet activation. BACKGROUND OF THE INVENTION The evolution of multicellular organisms has depended on the ability of cells to communicate with each other and with their immediate environment. Membrane-bound receptors play a crucial role in such communication. They can recognize intercellular messenger molecules such as hormones, neurotransmitters, growth and development factors, as well as sensory messengers such as smell, taste and light. These receptors belong to approximately 5 protein families; the most common family is the family of G-protein coupled receptors (GPCR). GPCRs are involved in the recognition of messages as diverse as light, odor, calcium, small molecules, including amino acid residues, nucleotides and peptides. After binding of such messages with GPCRs, signal transduction is effected through the recruitment of G proteins, activated by the binding and hydrolysis of GTP intracellularly. Biological actions of GPCR include the control of the activity of intracellular enzymes, ion channels and vesicle transport through the catalysis of the GDP-GTP exchange in heterotrimeric G proteins (Ga-ß?) (Bourne (1997) Curr. Opin. Cell Biol., 9: 134-142, Wess (1997) FASEB J., 11: 346-354, Bockaert and Pin (1999) Embo J., 18: 1723-1729, Ha m (1998) J. Biol Chem ., 273: 669-672). A major feature of the GPC structure is a core-core domain that spans seven helixes transmembrane (TMI-VI), spaced by three intracellular loops (IPI-III) and three extracellular loops (ECI-III). These three core domains differ in sequence and function between members of the GPCR superfamily, in their N-terminal extracellular domain, C-terminal intracellular domain and intracellular loops. Several platelet agonists act through the activation of cell surface GPCRs that initiate intracellular signaling cascades that culminate in platelet aggregation. Signaling via G-protein-coupled receptors such as thrombin, thromboxane A2 and adenosine diphosphate (ADP) is responsible in part for platelet activation events, for example fibrinogen receptor exposure, granule secretion and aggregation (Brass, LF , Manning, DR, Cichowski, K., and Abra s, CS (1997) Thromb, Haemost, 78, 581-9). Multiple intracellular signaling pathways have been implicated in platelet activation events even when the exact sequence of events and host signaling and intracellular molecules remain undefined. G protein signaling regulators (RGS) represent a family of proteins that function to dampen signals generated by stimulating receptors coupled to G-cell surface proteins. Identified first in yeast genetic screens (Dohlman H. G., Song J., Ma D., Courchesne W.E., Thorner J. (1996) Mol. Cell. Biol. 16, 5194-209, Yu J.H., ieser J., Adams T.H. (1996) EMBO. J. 15: 5184-90) and nematode Caenorhabdi tis elegans (Koelle M.R. and Horvitz H.R. (1996) Cell 84: 115-25), RGSs were first discovered based on their ability to modulate behavioral responses. Mammalian homologs of these lower eukaryotic RGSs were rapidly identified through several methods including two yeast hybrids (De Vries L, Mousli M., Wurmser A., Farquhar MG (1995) Proc. Nati. Acad. Sci USA 92: 11916 - 20), cloning by homology (Druey KM, Blumer KJ Kang VH, Kehrl JH (1996) Nature 379: 742-6), search in database (Koelle MR and Horvitz HR (1996) Cell 84: 115-25) either subtractive cloning or expression methods (Newton JS, Deed RW, Mitchell EL, Murphy JJ, Norton JD (1993 Biochim, Biophys, Acta 1216: 314-6, Wu HK, Heng HH, Shi XM, Forsdy e DR, Tsui LC, Mak TW, Minden MD, Siderovski DP (1995) Leukemia 9: 1291-8, Hong JX, Wilson GL, Fox CH, Kehrl JH (1993) J. Immunol 150: 3895-904). characteristics of this family is a region of 120 highly homologous amino acids that is known as RGS domain.There are currently more than 30 mammalian proteins or secuence partial features containing a putative RGS domain (Hepler J.R. (1999) Pharmacol. Sci. 20: 376-82). Some members of the RGS family are weight proteins relatively low molecular cells consisting primarily of the RGS domain flanked by short amino and carboxy terminal regions, and others are fairly broad with putative functional domains that involve them in scaffolding reactions [eg, pleckstrin homology domain (PH), dbl domain which is homologous to the dbl protooncogene domain, DEP domain present in egl-10 and pleckstrin domain, and G-protein subunit domain and] (Hepler JR (1999) Pharmacol. Sci. 20: 376-82) . It is believed that RGS proteins regulate GPCR signaling by interacting with the alpha subunits of the heterotrimeric GTP binding proteins. The heterotrimeric G proteins act as molecular switches in the transduction of signals mediated by GTCR controlling the speed and magnitude of activation of the effectors (for a review of the heterotrimeric G proteins, see Gil an AG (1987) Annu Rev. Biochem. : 615-49). The stimulation of receptors by agonists causes a rapid dissociation of GDP from the subunit and change by GTP. While forming into a GTP complex, the alpha sub-unit remains in its active state and results in a downstream effector interaction. The hydrolysis of GTP returns the alpha subunit to its GTP-linked or inactive state. RGS proteins attenuate signaling through GPCRs through the action of GTPase activation proteins (GAPs) (Hong J.X., Wilson G.L., Fox C.H., Kehrl J.H. (1993) J. Immunol. 150: 3895-904, Berman D.M., Wilkie T.M., Gilman A.G. (1996) Cell 86: 445-52, Watson N., Linder M.E., Druey K.M., Kehrl J.H., Blumer K.J. (1996) Nature 383: 172-5). By accelerating the hydrolysis of GTP, the RGS protein limits the time during which the subunit Ga is in its active state. Structural studies indicate that RGSs bind to the transition state of the alpha subunit, stabilizing it in this way and accelerating the hydrolysis of GTP (Tesmer JJ, Berman DM, Gilman AG, Sprang SR (1997) Cell 89: 251-61, Berman DM, Kozasa T., Gilman AG (1996) J. Biol. Chem. 271: 27209-12). The transition state of the Ga subunit can be imitated in vi tro through treatment of alpha subunits with aluminum tetrafluoride (A1F4 ~). This has identified RGSs that interact and activate members of the Gai family (Gaii, Gaí2, Gai3, Gaz, Gao, Gat> Gaqn and Ga? 2i3 but not Gas (Hepler JR (1999) Pharmacol. Sci. 20: 376- 82) In addition to their GAP activity, RGS can also block signaling by acting as antagonists of effectors (Hepler JR, Berman DM, Gilman AG, Kozasa T. (1997 Proc. Nati. Acad. Sci. U.S.A. 94: 428-32), Yan Y., Chi P.P., Bourne H.R. (1997) J. Biol. Chem. 272: 11924-7).
RGS proteins have been identified in several of the types of cells and tissues that profoundly alter many intracellular effectors stimulated by GPCR, including the Regulation of adenylyl cyclase (Huang C, Hepler JR, Gilman AG, Mu by SM (1997) Proc. Nati, Acad Sci USA 94: 6159-63), MPA kinase activity (Druey KM, Blumer KJ Kang VH, Kehrl JH (1996) Nature 379: 742-6, Hepler JR, Berman DM, Gilman AG, Kozasa T. (1997 Proc. Nati, Acad. Sci. USA 94: 428-32)), inositol triphosphate and Ca2 + signaling (Yan Y ., Chi PP, Bourne HR (1997) J. Biol. Chem. 272: 11924-7, Huang C, Hepler JR, Gilma-a AG, Mumby SM (1997) Proc. Nati. Acad. Sci. USA 94: 6159 -63, Nelly JD, Duck LW, Sellers JC, Musgrove LC, Scheschonka A, Druey KM, Kehrl JH (1997) Endocrinology 138: 843-6), conductances of K + channels (Saugstad JA, Marino MJ, Folk JA, Helper JR, Conn PJ (1998) J. Neurosci.18: 905-13) and transduction of visual signals (Makino ER, Handy JW, Li T., Arshavsky VY (1999) Proc. Nati, Acad. Sci. USA 96: 1947 -52, Nekrasova ER, Berman DM, Rustandi RR, Ha HE, Gilman AG, Arshavsky VY (1997) Bi ochemistry 36: 7638-43). Since several of these signaling cascades are involved in the activation of platelets, it is likely that one or more members of the RGS superfamily may be present in platelets and be responsible for the regulation of critical signaling pathways for platelet activation. In platelets, receptors for ADP, thromboxane A2 and thrombin are coupled to binding proteins of Heterotrimeric GTPs that transduce signals into intracellular effectors, resulting in the inhibition of adenylyl cyclase, the activation of phospholipase C, and intracellular calcium mobilization (Brass, LF, Manning, DR, Cichowski, K., and Abrams, CS (1997) Thromb. Haemost, 78, 581-9). These three receptors seem to be coupled to one or several alpha subunits in platelets. For ADP, there are at least two receptors on the surface of the platelets coupled to heterotrimeric G proteins. The putative P2TAc is coupled to Gai (Daniel JL, Dangelmaier C, Jin J., Ashby B., Smith JB, Kunapuli SP (1998) Molecular basis for ADP-induced platelet activation. [Molecular Base for ADP-induced Platelet Activation] J. Biol. Chem. 273: 2024-9) and P2Y1 is coupled to Gaq / ?, (Jin J., Daniel JL, Kunapuli SP (1998 J. Biol. Chem. 273: 2030-4). of thrombin appear to be coupled to members of the Gai, Gaq? and Ga? 2? 3 families (Benka ML, Lee M., Huang GR, Buckman S., Burlacu A., Cole L., DePina A., Days P. , Granger A., Grant B., et al. (1995) FEBS Lett 363: 49-52, Brass LF, Laposata M., Banga HS, Rittenhouse SE (1986) J. Biol. Chem. 261: 16838-47, Offermanns S., Laugwitz KL, Spicher K., Schultz G. (1994) Proc. Nati, Acad. Sci. USA 91: 504-8) It has been shown that thromboxane A receptors interact with both Gaqn (Kinsella BT, O 'Mahony DJ, Fitzgerald GA (1997) J. Pharmacol. Exp. Ther. 281: 957-64, Ushikubi F., Nakamura K., Narumiya S. (1994) Functional reconstitution of platelet thromboxane A2 receptors with Gq and Gi2 in phospholipid vesicles [Functional reconstitution of platelet thromboxane A2 receptors with Gq and Gi2 in vesicles phospholipids]. Mol. Pharmacol. 46: 808-16, Baldassare J.J., Tarver A.P., Henderson P.A., Mackin W.M., Sahagan B., Fischer G.J. (1993) Biochem. J. 291: 235-40, Knezevic I., Borg C, Le Breton G.C. (1993) J. Biol. Chem. 268: 26011-7), G3? 3 (Offermanns S., Laugwitz KL, Spicher K., Schultz G. (1994) Proc. Nati. Acad. Sci. USA 91: 504- 8, Djellas Y., Manganello JM, Antonakis K., Le Breton GC (1999), J. Biol. Chem. 274: 14325-30) as with Ga isoforms. (Ushikubi F., Nakamura K., Narumiya S. (1994) Functional reconstitution of platelet thromboxane A2 receptors with Gq and Gi2 in phospholipid vesicles [Functional reconstitution of platelet thromboxane A2 receptors with Gq and Gi2 in phospholipid vesicles] Mol. Pharmacol 46: 808-16). More recently it has been shown that in platelets, the concomitant activation of the pathways linked to Gai and the pathways linked to Gaq are critical for platelet aggregation by ADP (Jin J., Kunapuli SP (1998) Proc. Nati. Acad. Sci. USA 95: 8070-4, Jantzen HM, Gousset L., Bhaskar V., Vincent D., Tai A., Reynolds EE, Conley PB (1999) Thromb. Haemost 81: 111-7). It is therefore not surprising that Gaq has been involved in an integral regulator of hemostasis in mice, since mice knocked out in Gaq present profound tendencies to bleeding, and die perinatally due to hemorrhages (Offermanns S, Toombs CF, Hu YH, Simon MI (1997) Nature 389: 183-6). The citations of all references herein should not be construed as the admission that such reference is available as "Prior Art" of the present invention. COMPENDIUM OF THE INVENTION The present invention relates to nucleic acids that encode a novel protein signaling protein (RGS) regulator, RGS18. Thus, a first object of the present invention is a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NO: 11, 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a sequence of complementary polynucleotides, og) nucleotides 418-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a nucleic acid according to the present invention. Preferably, a nucleic acid according to the present invention will have 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, or 1500 consecutive nucleotides of a nucleic acid according to the present invention. The invention also relates to a nucleic acid having at least a nucleotide identity of 80% with a nucleic acid according to the present invention. The invention also relates to a nucleic acid having a nucleotide identity of at least 85%, preferably 90%, more preferably 95%, and even more preferably 98% with a nucleic acid according to the invention. The invention also relates to a hybridization of nucleic acid, under very stringent conditions, with a polynucleotide sequence of a nucleic acid of the invention. The present invention also relates to nucleic acids encoding a polypeptide comprising the novel RGS18 domain. Thus, a second object of the present invention relates to a nucleic acid comprising a polynucleotide sequence of a) either of SEQ ID NOs: 18 or 19 or of a complementary polynucleotide sequence, b) nucleotides 163-870 of SEQ ID NO: 19 c either of a complementary polynucleotide sequence or c) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to nucleic acids, particularly cDNA molecules, which encode the entire length human RGS18 protein. The present invention also relates to a cDNA molecule encoding the novel whole length RGS18 protein. Thus, the invention relates to a nucleic acid comprising a polynucleotide sequence of a) either of SEQ ID NOs: 18 or 19 or of a complementary polynucleotide sequence, or c) nucleotides 163-870 of SEQ ID NO. : 19, or of a complementary polynucleotide sequence. In accordance with the present invention, a nucleic acid comprises a polynucleotide sequence of SEQ ID NOs: 18 or 19 that encodes a full length 235 amino acid RGS18 domain polypeptide, comprising the amino acid sequence of SEQ ID NO: 20 The present invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, a nucleic acid according to the present invention encodes a polypeptide comprising one amino acid sequence of SEQ ID NO: 20. The present invention also relates to polypeptides comprising the novel RGS18 domain according to the present invention. In a preferred embodiment, a polypeptide according to the present invention comprises an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the polypeptide according to the present invention comprises an amino acid sequence of SEQ ID NO: 20. The invention also relates to a polypeptide comprising an amino acid sequence having an amino acid identity of at least 80% with a polypeptide comprising an amino acid sequence of a) either SEQ ID NOs : 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86 -166 of SEQ ID NO: 20. In a specific embodiment, the invention relates to a polypeptide having at least an amino acid identity of 85%, preferably 90%, more preferably 95%, and preferably still greater than 98% with a co-polypeptide nformity with the present invention. The present invention also provides nucleotide probes and primers that hybridize to a nucleic acid sequence of a nucleic acid according to the present invention. invention. The nucleotide probes or primers according to the present invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a nucleotide polynucleotide sequence a) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence. b) 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or d) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Preferably, nucleotide probes or primers according to the present invention will have a length of 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive of a nucleic acid according to the present invention. The present invention also relates to a method for amplifying a nucleic acid according to the present invention contained in a sample, wherein said method comprises the steps of: a) placing the sample in which the presence of the target nucleic acid is suspected in contact with a pair of nucleotide primers whose hybridization position is respectively located on the 5 'side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the reaction of amplification; and b) detecting the amplified nucleic acids. The present invention also relates to a method for detecting the presence of a nucleic acid according to the invention in a sample, wherein said method comprises the steps of: 1) placing one or more nucleotide probes in accordance with the present invention in contact with the sample to be tested; 2) detect the complex that may have formed between the probe (s) and the nucleic acid present in the sample. Another object of the present invention is a kit or kit for amplifying all or part of a nucleic acid according to the present invention, wherein the kit or kit comprises: 1) a pair of nucleotide primers according to the present invention , whose hybridization position is located respectively on the 5 'side and on the 3' side of the target nucleic acid whose amplification is sought; and optionally, 2) reagents necessary for an amplification reaction.
The invention also relates to a set or kit for detecting the presence of a nucleic acid according to the invention in a sample, said set or kit comprising: a) one or more nucleotide probes according to the present invention; Y b) if appropriate, reagents necessary for a hybridization reaction. The invention also relates to a recombinant vector comprising a nucleic acid according to the present invention. The present invention also relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 polypeptide. In a preferred embodiment, the defective recombinant virus comprises a cDNA molecule that encodes a RGS18 polypeptide. In another preferred embodiment of the invention, the defective recombinant virus comprises a cDNA molecule that encodes a RGS18 polypeptide. Preferably, the encoded RGS18 polypeptide comprises amino acids 86-166 of SEQ ID NO: 20. Most preferably, the encoded RGS18 polypeptide comprises amino acids 86-202 of SEQ ID NO: 20. With even greater preference, the polypeptide of encoded RGS18 comprises an amino acid sequence of SEQ ID NO: 20. In another preferred embodiment, the invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein under the control of a promoter selected from terminal repeat Long-term Rous sarcoma virus (RSV-LTR) or the early Cytomegalovirus (CMV) promoter. The present invention also relates to a composition which comprises a nucleic acid, which encodes a polypeptide according to the present invention, wherein the nucleic acid is under the control of appropriate regulatory elements. The invention also relates to the use of a nucleic acid, polypeptide, or recombinant vector according to the present invention for the manufacture of a drug contemplated for the treatment and / or prevention of a disorder or condition associated with a dysfunction of the platelet activation. The invention also relates to the use of a nucleic acid, polypeptide, or recombinant vector according to the invention for the preparation of a pharmaceutical composition contemplated for the treatment and / or prevention of conditions or disorders associated with a dysfunction of platelet activation . Thus, the present invention also relates to a pharmaceutical composition comprising a nucleic acid, polypeptide or recombinant vector according to the present invention, in combination with one or more physiologically compatible vehicles and / or excipients. The present invention also relates to the use of genetically modified cells ex vivo with a nucleic acid or recombinant vector according to the invention, or to the use of cells that produce a recombinant vector, in where the cells are implanted in the body, to allow prolonged and effective expression in vi vo of a biologically active RGS18 polypeptide. Thus, the invention also relates to the use of a recombinant host cell according to the present invention comprising a nucleic acid encoding a RGS18 polypeptide according to the present invention for the manufacture of a drug contemplated for prevention and / or more particularly, for the treatment of subjects suffering from a condition or disorder associated with dysfunction of platelet activation. The present invention also relates to the use of a recombinant host cell according to the present invention, for the preparation of a pharmaceutical composition for the treatment and / or prevention of pathologies related to a condition or disease associated with a dysfunction of platelet activity . The invention relates to the use of a defective recombinant virus according to the present invention for the preparation of a pharmaceutical composition contemplated for the treatment and / or for the prevention of a condition or disease associated with a dysfunction of platelet activation. Thus, the present invention also relates to a pharmaceutical composition comprising a defective recombinant virus according to the present invention. invention, in combination with one or more physiologically compatible vehicles and / or excipients. The present invention also relates to the use of genetically modified cells ex vivo with a defective recombinant virus according to the present invention, or of cells reproducing such viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active RSG18 protein. A specific embodiment of the present invention is an isolated mammalian cell infected with one or several defective recombinant viruses according to the present invention. Another object of the present invention relates to an implant comprising isolated mammalian cells infected by one or more defective recombinant viruses according to the present invention or cells that produce recombinant viruses, and an extracellular matrix. More particularly, in the implants of the invention, the extracellular matrix comprises a gel-forming compound and optionally a support that allows the anchoring of the cells. The invention also relates to an isolated recombinant host cell comprising a nucleic acid of the invention. In accordance with another aspect, the invention relates to also to an isolated recombinant host cell comprising a recombinant vector according to the present invention. Accordingly, the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid of the invention. The invention also relates to a method for the production of a polypeptide according to the present invention wherein said method comprises the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) cultivating in a suitable culture medium, a previously transformed host cell or transfecting a host cell with a recombinant vector from step a); c) recovering the conditioned culture medium or lysing the host cell, for example, by sonication or by osmotic shock. d) separating and purifying said polypeptide from said culture medium or alternatively from the cell lysates obtained in step c); and e) if appropriate, characterize the recombinant polypeptide produced. The present invention also relates to antibodies directed against a polypeptide according to the present invention.
Thus, another object of the present invention is a method for detecting the presence of a polypeptide according to the present invention in a sample, wherein said method comprises the steps of: a) putting the sample to be tested in contact with a directed antibody against a polypeptide according to the present invention; and b) detecting the antigen / antibody complex formed. The invention also relates to a kit or kit for diagnosing or detecting the presence of a polypeptide according to the present invention in a sample, said kit or kit comprising: a) an antibody directed against a polypeptide according to the present invention , and b) a reagent that allows the detection of the antigen / antibody complex formed. The present invention also relates to a new therapeutic approach for the treatment of pathologies related to a condition or disorder associated with a dysfunction of platelet activation, comprising the transfer and in vivo expression of a nucleic acid, recombinant vector, or virus defective recombinant according to the invention. Specifically, the present invention offers a novel therapeutic approach for the treatment and / or prevention of a condition or disorder associated with a dysfunction of platelet activation. According to another aspect, the object of the present invention is also a therapeutic method to prevent or cure diseases caused by an abnormal activation of platelets., said method comprises a step in which a therapeutically effective amount of a RGS18 polypeptide is administered to a patient according to the present invention in said patient, said polypeptide is combined, if appropriate, with one or more vehicles and / or physiologically compatible excipients. The invention also relates to methods for detecting RGS18 protein activators or inhibitors and polypeptides comprising RGS18 domain. The invention also provides methods for screening small molecules and compounds that act on the RGS18 protein to identify RGS18 polypeptide agonists and antagonists that can improve, reduce, or inhibit platelet activation from a therapeutic perspective. These methods are useful for identifying small molecules and compounds for therapeutic use in the treatment of diseases caused by a deficiency of platelet activation. Accordingly, the invention also relates to the use of a polypeptide according to the invention or a cell expressing a polypeptide according to the invention. for screening active ingredients for the prevention or treatment of a condition or disorder associated with a dysfunction of platelet activation. The invention also relates to a method for screening a compound or small molecule that functions as an agonist or antagonist of a RGS18 polypeptide. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Cloning and sequence information of a full-length cDNA for a novel RGS, RGS18. Panel A is a schematic representation of the full-length cloning of novel platelet RGS. A cDNA scheme for RGS18 is shown at the bottom, and the framed region represents the open predicted reading frame and the individual lines the 5 'and 3' untranslated regions. The relative locations of the initial RT-PCR product, the Incyte EST cDNA (clone 435706H1) and the 5 'RACE amplification product are shown above. Panel B represents nucleotide and deduced amino acid sequence of RGS18. The 5 'and 3' untranslated regions are provided in lowercase, the amino acid sequence predicted in abbreviations of a single uppercase letter. The initial RT-PCR product from the platelet RNA is shown in bold. The 5 'and 3' ends of the Incyte EST cDNA are presented through the "" rhombs. The oligonucleotide sequence of the primer in the region not translated 3 ' Extreme used for 5 'RACE is underlined. The putative CAAX motif is indicated by double underlining (©) and the cAMP / cGMP-dependent protein kinase consensus site is indicated by triple underlining (=). Figure 2. Alignment of RGS18 with other members of the RGS family. The predicted amino acid sequence of RGS28 was aligned with six other RGS protein sequences using the PILEUP program of GCG. The homology between RGS18 and these other RGS protein sequences are shown by shading. The amino acids conserved between RGS18 and at least two other RGSs are presented in shaded form. The solid line above the sequence indicates the domain of Preserved RGS that was amplified by polymerase chain reaction. The asterisk (*) refers to the location of the two amino acids that are conserved in members of Family B.
The down arrow () represent amino acids in RGS4 that are predicted to be in contact with GG subunits. The framed regions indicate the sequences of peptides synthesized for the production of antisera directed against peptides. Figure 3. Tissue distribution of RGS 18 by Northern Blot.
Panel A, a Northern Blot of 10 mg total RNA from human platelets, human leukocytes, DAMI, HEL, and MEG-01 cells probed with a 3 'untranslated region probe RGS18 in accordance with that described in Experimental Procedures. This blot was exposed to a Kodak BioMax MR film for 6 hours at a temperature of -70 ° C. Panel B, Hybridization of a Human Multiple Tissue Northern with the same RGS18 probe. This blot was exposed to a Kodak BioMax film for 6 days at a temperature of -70 ° C. The migration of the molecular weight standards in each gel is shown in the left part. After removal of the probe, each blot was hybridized with a β-actin probe for normalization, as shown below the corresponding blot. Figure 4. Western blot of lysates of cell lines of bundles, leukocytes and mega cariocytes. Panel A, Specificity of antisera anti-RGS18. Nitrocellulose strips containing 50 mg of platelet lysate treated with 15% SDS-PAGE were incubated with a 1: 500 dilution of 3NRGS-12 anti serum or a 1: 1000 dilution of 5NRGS-13. An immuno reactive band that migrates at ~ 30 kDa is detected by both anti sera (first lane for each blot). Identical strips were also probed with anti serum that had been preincubated with the corresponding immunizing peptide or with an unrelated peptide (in these studies 5CRGS-peptide was used for anti serum # 12 and 3NRGS-peptide for anti serum # 13). The migration of the molecular weight standard to 30 kDa is shown in the part left, the migration of RGS18 in the part on the right. Panel B. Detection of the expression of RGS18 in platelets, leukocytes and lines of megakaryocytic cells. Lysates (50 mg) of human platelets, leukocytes and DAMI, HEL and MEG-01 cells were subjected to 15% SDS-PAGE, transferred to nitrocellulose and labeled with antibodies against RGS18 and RGS10 (Santa Cruz BioTechnology, Santa Cruz, CA) . The above blot shows the reactivity of each lysate with the anti anti-RGS18 serum (5NRGS- # 13) and the blot of the lower part with the anti-RGS19 anti serum. As shown above, RGS18 co-migrates with a molecular marker of 30 kDa. RGS10, a much smaller protein, migrates near the 21 kDa molecular weight marker. Figure 5. Determination of the specific Ga subunit for RGS18. Platelet lysates were treated with GDP op GDP + A1F ~ as indicated and incubated with GST-RGS18 coupled to Sepharose 4B in accordance with that described in Experimental Procedures. The bound proteins were subjected to treatment with 12% SDS-PAGE and transferred to nitrocellulose and detected with anti sera against Gaii / ai2, Gaoi3r Gaqn, Gaz, Ga? 2, or Gas. The lane marked "Lisado" is 35 mg or 7.7% of the entry lysate in each of the reactions carried out concomitantly to show the reactivity of each anti serum with platelet lysate. DETAILED DESCRIPTION OF THE INVENTION GENERAL DEFINITIONS The present invention contemplates the isolation of a gene encoding a RGS18 polypeptide of the invention, including a full-length or naturally occurring form of RGS18, with any antigenic fragment thereof from any animal, particularly mammal or bird , and more particularly from a human source. In accordance with the present invention, conventional molecular biology, microbiology and recombinant DNA techniques can be employed within the art. Such techniques are each explained in the literature. See, for example, references; Sambrook, J. Fritsch, E.F., and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual] 2ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Glover (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis [DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis], MRL Press, LTD., Oxford, United Kingdom; Gait (ed.), 1984. Nucleic Acid Hybridization [Hybridization of Nucleic Acids]; Hames BD and Higgins SJ, 1985. Nucleic acid hybridization: a practical approach [Nucleic Acid Hybridization: A Practical Approach], Hames and Higgins Ed., IRL Press, Oxford; Hames and Higgins (eds.), 1984. Animal Cell Culture [Culture of Animal Cells]; Freshney (ed.), 1986. Immobilized Cells And Encimes [Immobilized Cells and Enzymes], IRL Press; Perbal, 1984. A Practical Guide to Molecular Cloning [A Practical Guide for Molecular Cloning]; Ausubel et al., 1989. Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. Therefore, within the framework of this document, the following terms have the definitions presented below. As used herein, the term "gene" refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA nucleic acids and genomic DNA. The term "isolated" for the purposes of the present invention refers to a biological material to nucleic acid or protein) that has been removed from its original environment (the environment in which it is naturally present). For example, a polynucleotide present in the natural state in a plant or an animal is not isolated. The same polynucleotide separated from adjacent nucleic acids where it is naturally inserted into the genome of the plant or animal is considered as "isolated". Said polynucleotide may be included in a vector and / or said polynucleotide may be included in the composition and remains, however, in the isolated state due to the fact that the vector or composition does not constitute its environment natural . The term "purified" does not require that the material be present in a form that shows absolute purity, exclusive of the presence of other compounds. It is a relative definition. A nucleotide is in the "purified" state after purification of the initial material or natural material by at least an order of magnitude, preferably 2 or 3 or preferably 4 or 5 orders of magnitude. For the purposes of the present invention, the expression "nucleotide sequence" can be used to designate either a polynucleotide or a nucleic acid. The expression "nucleotide sequence" encompasses the genetic material itself and therefore is not limited to information in relation to its sequence. The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide sequence" encompass RNA sequences, ADM} N, gDNA or cDNA or alternatively hybrid RNA / DNA sequences of more than one nucleotide, either in the form of a single chain or in the form of a double chain. Duplex. A "nucleic acid" is a polymeric compound comprising covalently linked subunits known as nucleotides. A nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both can be single stranded or double stranded.
The DNA includes cDNA, genomic DNA, synthetic DNA and semi-synthetic DNA. The nucleotide sequence that encodes a protein is known as the sense sequence or coding sequence. The term "nucleotide" refers to both the natural nucleotides (A, T, G, C) as well as the modified nucleotides comprising at least one modification such as for example (1) an analogue of a purine, (2) an analogue of a pyrimidine, or (3) an analogous sugar, examples of such modified nucleotides are described, for example, in application No. WO 95/04064. For the purposes of the present invention, a first nucleotide is considered as "complementary" to a second nucleotide when each base in the first nucleotide is paired with the complementary base of the second polynucleotide whose orientation is inverted. The complementary bases are A and T (or A and U), or C and G. The term "heterologous" DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell. As used herein, the term "homologs" in all its grammatical forms and orthographic variations refers to the relationship between proteins that possess a "common evolutionary origin", including superfamily proteins (for example, the superfamy of immunoglobulins) as homologous proteins from different species (for example, myosin light chain, etc.) (Reeck et al., 1987, Cell 50: 667). Such proteins (and their coding genes) have sequence homology in accordance with what is reflected by their high degree of sequence similarity. Accordingly, the term "sequence similarity" in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., 1987, Cell. 50: 667). However, in common usage and in the present application, the term "homologous", when modified by an adverb such as "highly", may refer to sequence similarity and not to a common evolutionary origin. In a specific embodiment, two DNA sequences are "substantially homologous" or "substantially similar when at least about 50% of the nucleotides (preferably at least about 75% of the nucleotides, and more preferably at least approximately 90 or 95% of the nucleotides) correspond in the defined segment of the DNA sequences, substantially homologous sequences can be identified by comparing the sequences using a standard programmatic available in sequence data banks, or having a Southern hybridization experiment for example under stringent conditions, in accordance with that defined for that particular system. An appropriate definition of the hybridization conditions is within the scope of the art. See, for example, Glover (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis [DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis], MRL Press, LTD., Oxford, United Kingdom; Hames BD and Higgins SJ, 1985. Nucleic acid hybridization: a practical approach [Nucleic Acid Hybridization: A Practical Approach], Hames and Higgins Ed., IRL Press, Oxford; Maniatis et al., 1982. Molecular cloning: A Laboratory Manual [Molecular Cloning: A Laboratory Manual], Cold Spring Harbor Press, Cold Spring, NY. Similarly, in a particular embodiment, two amino acid sequences are "substantially homologous" or "substantially similar" when more than 30% of the amino acids are identical, or more than about 60% are similar (functionally identical). Preferably, similar or homologous sequences are identified by alignment, using, for example, the GCG stacking program (Genetics Computer Group, Program Manual for the GCG Package [Program Manual for the GCG Package], version 7, Madison, Wisconsin). The expression "percent identity" between two nucleotide or amino acid sequences for the purposes of the present invention, can be determined by comparing two optimally aligned sequences, through a comparison window. The portion of the nucleotide or polypeptide sequence in the window for comparison may therefore comprise additions or deletions (for example "gaps") in relation to the reference sequence (which does not comprise these additions or deletions) in order to obtain a optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which an identical nucleic base or an identical amino acid residue is observed for the two compared sequences (nucleic or peptide), and then by dividing the number of positions in which there is identity between the two base or amino acid residues between the total number of positions in the window for comparison purposes, and then multiplying the result by 100 in order to obtain the percent identity of sequences. The optimal alignment of sequences for comparison can be achieved by using a computer with the auxiliary algorithms known and contained in the package of the company WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN. By way of illustration, it may be possible to produce the sequence percent identity with the help of the BLAST program (versions BLAST 1.4.9 of March 1996, BLAST 2.0.4 of February 1998 and BLAST 2.0.6 of September 1998 ), using exclusively the default parameters (Altschul et al, 1990. J. Mol. Biol., 215: 403-410, Altschul et al., 1997. Nucleic Acids Res., 25: 3389-3402). Blast searches for similar / homologous sequences to a reference "request" sequence, with the help of the algorithm of Altschul and collaborators. The request sequence and the databases used can be of the peptide or nucleic types, any composition being possible. The expression "corresponding to" is used herein to refer to similar or homologous sequences, that the exact position is identical or different from the molecule with which similarity or homology follows. An alignment of nucleic acid or amino acid sequences may include spaces. Thus, the term "corresponding to" refers to sequence similarity, and not to the number of amino acid residues or nucleotide bases. A gene encodes a RGS18 polypeptide of the present invention, whether genomic DNA or cDNA, can be isolated from any source, especially from a human or genomic cDNA library. Methods for working genes are well known in the art, as described above (see, for example, Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual ] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). Accordingly, any animal cell can potentially serve as the source of nucleic acid for the molecular cloning of an RGS18 gene. The DNA can be obtained by standard procedures known in the art from cloned DNA (eg, a "library" of DNA), and is preferably obtained from a cDNA library prepared from tissues with high level of DNA. protein expression, by chemical synthesis, by cDNA cloning or by cloning genomic DNA or fragments thereof, purified from the desired cell (see, for example, Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual] 2ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, Glover (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis [DNA Cloning: A Practical Approach, Volumes I and II Synthesis of Oligonucleotides], MRL Press, LTD., Oxford, United Kingdom). Clones derived from genomic DNA may contain intron and regulatory DNA regions in addition to the coding regions; clones derived from cDNA will not contain intron sequences. Whatever the source, the gene must be molecularly cloned into an appropriate vector for gene propagation. In the molecular cloning of the gene from genomic DNA, fragments of DNA are generated, some of which encode the desired gene. DNA can be dissociated at specific sites using several restriction enzymes. Alternatively, DNase can be used in the presence of manganese to fragment the DNA or the DNA can be physically cut, for example, by sonication. The linear DNA fragments can then be separated according to size by standard techniques, including, but not limited to, polyacrylamide and agarose gel electrophoresis and column chromatography. Once the DNA fragments are generated, the identification of the specific DNA fragment containing the desired RGS18 gene can be achieved in several ways. For example, if an amount or portion of a RSG18 gene or its specific RNA, or a fragment thereof, is available and can be purified and labeled, the generated DNA fragments can be screened by hybridization of nucleic acid in the probe marked (Benton and Davis, 1997, Science 196: 180, Grunstein and Hogness, 1975, Proc. Nati, Acad. Scie. U.S.A. 72: 3961). For example, a set of oligonucleotides corresponding to the partial amino acid sequence information obtained for the RGS18 protein can be separated and used as probes for DNA encoding RGS18, as was carried out in a specific example, infra, or as primers for cDNA or mRNA (for example, in combination with a poly-T primer for RT-PCR). Preferably, a fragment is selected which is highly unique for a RGS18 nucleic acid or polypeptide of the invention. These DNA fragments with substantial homology to the probe will hybridize. In accordance with the above, the greater the degree of homology, the narrower hybridization conditions can be used. In a specific embodiment, stringent hybridization conditions are employed to identify a homologous RGS18 gene. Further selection may be made based on the properties of the gene, for example, whether the gene encodes a protein product having the isoelectric, electrophoretic, amino acid composition, or the partial amino acid sequence of a RGS18 protein in accordance with disclosed here. Thus, the presence of the gene can be detected by assays based on the physical, chemical or immunological properties of its expressed product. By example, cDNA clones or DNA clones that select by hybridization the appropriate mRNAs, can be selected which produce a protein which, for example, has a similar or identical electrophoretic migration, similar or identical isoelectric focus or behavior in gel electrophoresis. a non-equilibrium pGH, proteolytic digestion maps, or antigenic properties as known for RGS18. A RGS18 gene of the present invention can also be identified by selection of mRNA, ie, by nucleic acid hybridization followed by in vitro translation. In this procedure, nucleotide fragments are used to isolate complementary mRNAs by hybridization. Such DNA fragments may represent RGS18 DNA, encoded, available, or may be synthetic oligonucleotides designed from the partial amino acid sequence information. Functional assays or immunoprecipitation analysis (eg, tyrosine phosphatase activity) of the in vitro translation products of the products of the isolated mRNAs identifies the mRNA and, therefore, the complementary DNA fragments containing the desired sequences. In addition, specific mRNAs can be selected by adsorption of polysomes isolated from cells on immobilized antibodies specifically directed against a RGS18 polypeptide of the invention.
A radiolabeled RGS18 cDNA can be synthesized using the selected mRNA (from adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA can then be used as a probe to identify fragments of RGS18 homologous DNA among other genomic DNA fragments. The term "variant" in relation to a nucleic acid according to the present invention refers to a nucleic acid that differs only in one or several bases relative to the reference polynucleotide. A variant nucleic acid can be of natural origin, such as a naturally occurring allelic variant, or it can be a non-natural variant obtained, for example, by mutagenic techniques. In general, the differences between the reference nucleic acid (in general, wild type) and the variant nucleic acid are small in such a way that the nucleotide sequence of the reference nucleic acid and the variant nucleic acid are very similar, and in many identical regions. Modifications of nucleotides present in a variant nucleic acid can be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid. However, changes in nucleotides in a variant nucleic acid can also result in substitutions, additions or deletions in the polypeptide encoded by the variant nucleic acid with respect to the polypeptides encoded by the reference nucleic acid. In addition, nucleotide modifications in the coding regions can produce conservative or non-conservative substitutions in the amino acid sequence of the polypeptide. Preferably. Variant nucleic acids according to the present invention encode polypeptides that retain substantially the same function of biological activity as the reference nucleic acid polypeptide or alternatively the ability to be recognized by antibodies directed against the polypeptides encoded by the initial reference nucleic acid . Some variant nucleic acids thus encode mutated forms of the polypeptides whose systematic study will make it possible to deduce the structure-activity relationships of the proteins in question. The knowledge of these variants in relation to the disease studied is essential since it makes possible the understanding of the molecular cause of the pathology. The term "fragment" refers to a sequence of nucleotides of reduced length relative to the reference nucleic acid and comprising, in the common portion, a nucleotide sequence identical to the reference nucleic acid. Said "fragment" of nucleic acid of In accordance with the present invention, it may be included, if appropriate, in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides having a length within a range of at least 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the invention. A "nucleic acid molecule" refers to the polymeric form of ribonucleoside phosphate ester (adenosine, guanosine, uridine or cytidine, "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "), or any phosphoester analogue thereof, such as for example phosphothioates and thioesters, either in the form of a single chain or in the form of a double-stranded helix. DNA-DNA propellers, double-stranded DNA-RNA and RNA-RNA are possible. The term "nucleic acid molecule" and in particular DNA molecule or RNA molecule, refers only to the primary and secondary structure of the molecule and is not limited to any particular tertiary form. Thus, this term includes the double-stranded DNA found, inter alia, in linear or circular DNA molecules (eg, restriction fragments), plasmids and chromosomes. Commenting on the structure of double-stranded DNA molecules In particular, sequences can be described herein in accordance with the normal convention of providing only the sequence in the 5 'to 3' direction along the non-transcribed DNA strand (ie, the strand having a sequence homologous to the mRNA) . A "recombinant AD" molecule is a molecule of AD? that has been subjected to molecular biological manipulation. A nucleic acid molecule is "hybridizable" in another nucleic acid molecule, such as AD? C, AD? genomic or AR ?, when a single-stranded form of the nucleic acid molecule can be fused onto the other nucleic acid molecule under appropriate conditions of solution temperature and ionic strength (see Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The conditions of temperature and ionic strength determine the "strict character" of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a Tm of 55 °, for example, 5x SSC, 0.1% SDS, 0.25% milk, and without formamide can be used; or 30% formamide, 5x SSC, 0.5% SDS. Hybridization conditions of moderately strict character correspond to a higher Tra, for example, 40% formamide, with 5x or 6x SSC. Highly stringent hybridization conditions correspond to the highest Tm, for example, 50% formamide, 5x or 6x SSC. Hybridization requires that the two nucleic acids contain complementary sequences, even though according to the strict character of the hybridization, mismatches between the bases are possible. The level of strictness appropriate for the hybridization of nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the higher the value of Tm for nucleic acid hybrids having these sequences. The relative stability (corresponding to a higher Tm) of nucleic acid hybridizations decreases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids of more than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 9.50-0.51). For hybridization with shorter nucleic acids, ie, oligonucleotides, the position of the mismatches becomes more important and the length of the oligonucleotide determines its specificity (see Sambrook et al., Supra, 11.7-11.8).
Preferably, a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
In a specific embodiment, the expression "standard hybridization conditions" refers to a Tm of 55 ° C, and the conditions presented above are used. In a preferred embodiment, the Tm is 60 ° C; in a more preferred embodiment, the Tm is 65 ° C.
The term "highly stringent hybridization conditions" for the purposes of the present invention are considered as the following conditions: 1 - . 1 - Membrane competence and PREHIBRITY: - Mix: 40 μl of salmon sperm DNA (10 mg / ml) + 40 μl of human placental DNA (10 mg / ml) - Denature for 5 minutes at a temperature of 96 ° C, then submerge the mixture on ice.
- Remove the 2X SSC and empty 4 ml of a formamide mixture into the hybridization tube containing the membranes.
Add the mixture of the two denatured DNAs. Incubation at 42 ° C for 5 to 6 hours, with rotation. 2 - . 2 - Marked probe competence: - Add the labeled and modified probe from 10 to 50 μl of Cot I DNA according to the number of repetitions.
- Denature for 7 to 10 minutes at a temperature of 95 ° C. - Incubate at a temperature of 65 ° C for 2 to 5 hours. 3 - HYBRIDIZATION: - Remove the prehybridization mixture. - Mix 40 μl of salmon sperm plus 40 μl of human placental DNA; denature for 5 minutes at a temperature of 96 ° C, and then immerse in ice. - Add to the hybridization tube 4 ml of a mixture of formamide, the mixture of the two DNAs and the denatured labeled probe / DNA of Cot I. - Incubate for 15 to 20 hours at a temperature of 42 ° C with rotation. 4 - Washing and Exposure: - Wash at room temperature in 2X SSC, to rinse.
- Twice 5 minutes at room temperature 2X SSC and 0.1% SDS at a temperature of 65 ° C. - Twice 15 minutes at a temperature of 65 ° C IX SSC and 0.1% SDS at a temperature of 65 ° C. - Wrap the membranes in a clear plastic wrap and expose. The hybridization conditions described above are adapted to the hybridization, under highly stringent conditions, of a nucleic acid molecule of variable length from 20 nucleotides to several hundred nucleotides. It is obvious that the hybridization conditions described above can be adjusted depending on the length of the nucleic acid whose hybridization is sought or depending on the type of marking selected, according to techniques known to a person skilled in the art. Suitable hybridization conditions can for example be adjusted according to the teachings contained in the references in references 43 or 47. As used herein, the term "oligonucleotide" refers to a nucleic acid, generally at least 15 nucleotides, that can hybridize with a nucleic acid according to the present invention. Oligonucleotides can be labeled, for example, with 32 P-nucleotides or nucleotides in which a label, such as biotin, has been covalently conjugated. In one modality A labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid encoding a RGS18 polypeptide of the invention. In another embodiment, oligonucleotides (one or both may be labeled) can be used as polymerase chain reaction primers, either for full-length cloning or a fragment of a RGS18 nucleic acid, or to detect the presence of acids nucleic acids that encode RGS18. In a further embodiment, an oligonucleotide of the present invention can form a triple helix with a molecule of DNA of RGS18. In general, oligonucleotides are prepared synthetically, preferably in a nucleic acid synthesizer. Therefore, Oligonucleotides can be prepared with analogues to phosphoesters that occur not naturally, such as, for example, thioester bonds, etc. The term "homologous recombination" refers to the insertion of a foreign DNA sequence of a vector into a chromosome. Preferably, the vector is targeted to a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology with the chromosome sequences to allow a complementary link and the incorporation of the vector into the chromosome. Longer regions of homology and higher degrees of sequence similarity may increase the efficiency of homologous recombination. A "coding sequence" of DNA is a double-stranded DNA sequence transcribed and translated into a polypeptide in a cell in vi tro or in vivo and then placed under the control of appropriate regulatory sequences. The limits of the coding sequence are determined by a start codon at the 5 'terminal (amino) and a stop codon at the 3' end (carboxyl). A coding sequence may include, but is not limited to, prokaryotic sequences, cDNA from mRNA. eukaryotic, genomic DNA sequences from eukaryotic (eg mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is contemplated for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3 'relative to the coding sequence. Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators and the like, which provide for the expression of a coding sequence in a cell. In eukaryotic cells, the polyadenylation signals are control sequences. The term "regulatory region" refers to a nucleic acid sequence that regulates the expression of a nucleic acid. A regulatory region may include sequences that are naturally responsible for the expression of a particular nucleic acid (a homologous region) or may include sequences from a different origin (responsible for the expression of different proteins or even synthetic proteins. be sequences of eukaryotic or viral genes or derived sequences that stimulate or repress the transcription of a gene in a specific or non-specific form and in an inducible or non-inducible form. replication, RNA splice sites, enhancers, transcription termination sequences, signal sequences that direct polypeptide in the secretory pathways of the target cell and promoters. A regulatory region from a "heterologous source" is a regulatory region not naturally associated with the expressed nucleic acid. Among the heterologous regulatory regions are regulatory regions of a different species, regulatory regions of a different gene, hybrid regulatory sequences, and regulatory sequences that do not occur in nature but are designed by a person with ordinary knowledge in the subject . A "cassette" refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The DNA segment encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. A "promoter sequence" is a regulatory region of DNA capable of binding the RNA polymerase in a cell and initiating the transcription of a coding sequence downstream (3 'direction). For purposes of defining the present invention, the promoter sequence is linked at its 3 'terminus by the transcription initiation site and extends upstream (5 'direction) to include the minimum number of bases or elements that are necessary to initiate transcription at detectable levels above the background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of an RNA polymerase). A coding sequence is "under the control" of transcription and translation control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then spliced trans-RNA and translated into the protein encoded by the coding sequence. A "signal sequence" is included at the beginning of the coding sequence in the protein to be expressed on the surface of a cell. This sequence encodes a signal peptide, in N-terminal relative to the mature polypeptide, which directs the cell for the translocation of the peptide. The term "translocation signal sequence" is used herein to refer to this type of signal sequence. Translocation signal sequences may be associated with several native proteins for eukaryotes and prokaryotes, and are frequently functional in both types of organisms.
A "polypeptide" is a polymeric compound that comprises covalently bound amino acid residues. The amino acids have the following general structure: H I R-C-COOH I NH2 Amino acids are classified into seven groups based on R side chain: (1) aliphatic side chains, (2) side chains containing a hydroxyl group (OH), (3) side chains containing sulfur atoms, (4) side chains containing an acid group or an amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an amino acid in which the side chain is fused to the amino group. A "protein" is a polypeptide that performs a structural or functional function in a living cell. The polypeptides or proteins of the present invention can be glycosylated or non-glycosylated. The term "homology" refers to a sequence similarity that reflects a common evolutionary origin.
Polypeptides or proteins have homology or similarity, if a substantial number of their amino acids either (1) are identical or (2) have a chemically similar R side chain. Nucleic acids are homologous if a number substantial of their nucleotides are identical. The terms "isolated polypeptide" or "isolated protein" refers to a polypeptide or a protein substantially free of the compounds normally associated with them in their natural state (eg, other proteins or polypeptides, nucleic acids, carbohydrates, lipids). The term "isolated" does not mean that artificial or synthetic mixtures are excluded with other compounds, nor the presence of impurities that do not interfere with the biological activity, and that may present, for example, due to a complete purification, the addition of stabilizers, or agents for forming compounds in a pharmaceutically acceptable preparation. The term "fragment" of a polypeptide according to the present invention will be understood as meaning a polypeptide whose amino acid sequence is shorter than the amino acid sequence of the reference polypeptide and which comprises, in the whole portion with these reference polypeptides, an identical amino acid sequence. Such fragments may be included, if appropriate, in a larger polypeptide of which they are a part. Such fragments of a polypeptide according to the present invention can have a length of 10, 15, 20, 30 to 40, 50, 100, 200 or 300 amino acids. The term "variants" of a polypeptide according to the present invention will be understood as referring to primarily to a polypeptide whose amino acid sequence contains one or more substitutions, additions or deletions of at least one amino acid residue, relative to the amino acid sequence of the reference polypeptide, it being understood that the amino acid substitutions may be either conservative or not conservative. A "variant" of a polypeptide or protein is any analog, fragment, derivative or mutant that is derived from a polypeptide or a protein and that retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature, these variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene encoding the protein, or they may include differential splicing or post-translational modification. Variants also include a related protein that has substantially the same biological activity, but that is obtained from a different species. The person skilled in the art can produce variants having one or more substitutions, deletions, additions or replacements of amino acids. These variants may include, inter alia: a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, b) variants in which one or more amino acids of ai add polypeptide or protein, c) variants in which one or more of the amino acids include a substituent group, and d) variants in which the polypeptide or protein is fused with another polypeptide, such as for example serum albumin. The techniques for obtaining these variants, including genetic techniques (their pressure, deletion, mutations, etc.) chemical and enzymatic are known by people who have ordinary knowledge in the art. If such allelic variations, analogs, fragments, derivatives, mutants, and modifications, including alternative forms of mRNA splicing and alternative forms of post-translational modification result in polypeptide derivatives that retain any of their biological properties of the polypeptide, they are contemplated as being within the scope of the invention. A "vector" is a replicon, such as, for example, plasmid, virus, phage or cosmid, to which another DNA segment can be added in order to carry out the replication of the attached segment. A "replicon" is any genetic element (eg, plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, capable of replicating under its own control. The present invention also relates to the cloning of vectors containing genes encoding analogues and derivatives of a RGS18 polypeptide of the invention, having the same functional activity or a functional activity homologous to the RGS18 polypeptide, and homologues thereof of other species. The production and use of derivatives and analogues in relation to RGS18 are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of displaying one or more functional activities associated with a wild type, whole length, RGS18 polypeptide of the present invention. Derivatives of RGS18 can be made by altering the coding nucleic acid sequences by substitutions, additions or removals that offer functionally equivalent molecules. Preferably, derivatives having enhanced or enhanced functional activity compared to native RGS 18 are made. Due to the degeneracy of the nucleotide coding sequences, other DNA sequences that encode substantially the same amino acid sequence as a RGS18 gene can be employed in the practice of the present invention. These sequences include, but are not limited to, allelic genes, homologous genes from other species, and nucleotide sequences that comprise all or a portion of RGS18 genes that are altered by the substitution of different codons that encode the same residue. amino acid within the sequence, thus producing a silent change. In the same manner, the RGS18 derivatives of the present invention include, but are not limited to, the derivatives that contain as a primary amino acid sequence, all or a portion of the amino acid sequence of a RGS18 protein that includes altered sequences in where functionally equivalent amino acid residues are substituted by residues within the sequence resulting in a conservative substitution of amino acids. For example, one or more amino acid residues within the sequence may be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence can be selected from other members of the class to which the amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Amino acids that contain aromatic ring structures are phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged amino acids (acids) include aspartic acid and glutamic acid. It is not thought that these alterations can affect the apparent molecular weight in accordance with that determined by polyacrylamide gel electrophoresis, nor the isoelectric point. Particularly preferred substitutions are: - Lys by Arg and vice versa in such a way that a positive charge can be maintained; Glu by Asp and vice versa in such a way that a negative charge can be maintained; - Being by Thr in such a way that a free -OH can be maintained; and - Gln by Asn in such a way that free C0NH2 can be maintained. Amino acid substitutions can also be introduced to substitute amino acids with a particularly preferable property. For example, a Cys can introduce a potential site for disulfide bridges with another Cys. A his can be introduced as a site in particular "catalytic" (ie, His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro can be introduced due to its particularly flat structure, which induces b-turns in the structure of the protein.
Genes encoding RGS18 derivatives and analogs of the present invention can be introduced by various methods known in the art. The manipulations that result in its production can occur at the gene level or at the protein level. For example, the cloned RGS18 gene sequence can be modified by any of numerous strategies known in the art (Sambrook, J. Fritsch, E. F., and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Cloning molecular: a laboratory manual] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The sequence can be dissociated at appropriate sites with restriction endonuclease (s), followed by additional enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of RGS18, care must be taken to ensure that the modified gene remains within the same translation reading frame as the RGS18 gene, without interruption by end-of-translation signals, in the gene region where the desired activity is encoded. In addition, the nucleic acids encoding RGS18 can be mutated in vitro or in vitro to create and / or destroy translation, initiation and / or termination sequences, or to create variations in the coding regions and / or to form new endonuclease sites of Restrict or destroy pre-existing sites, to facilitate an additional in vitro modification. Preferably, such mutations increase the functional activity of the mutated RGS18 gene product. Any mutagenesis technique known in the art can to be employed including, but not limited to, these examples, in vitro site-directed mutagenesis (Hutchinson, C. et al., 1978, J. Biol. Chem. 253: 6551, Zoller and Smith, 1984, DNA-3: 479-488, Oliphant et al., 1986, Gene 44: 177, Hutchinson et al., 1986, Proc. Nati Acad.
Sci. U.S.A. 83: 710, Huygen et al., 1996. Nature Medicine, 2 (8): 893-898), the use of ® linkers (Pharmacia), etc. Polymerase chain reaction techniques are preferred for site-directed mutagenesis (see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principies and Applications for DNA Amplification ["Use of Polymerase Chain Reaction for Manipulate the DNA "in Reaction Technology in Chain of Polymerase: Principles and Applications for DNA Amplification], H. Erlich, ed., Stockton Press, Chapter 6, pages 61-70). The identified and isolated gene can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art can be employed. Possible vectors include, but are not limited to, these plasmids or modified viruses, but the vector system must be compatible with the host cell employed. Examples of vectors include, but are not limited to, Escherichia coli, bacteriophages such as landa derivatives, or plasmids, such as pBR322 derivatives or pUC plasmid derivatives, by example, vectors pGEX, pmal-c, pFLAG, etc. Cloning vector insertion can be achieved, for example, by ligating the DNA fragment into a cloning vector having complementary cohesive terminals. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, any desired site can be produced by ligation of nucleotide (linker) sequences at the DNA terminals; these ligated linkers may comprise chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. Recombinant molecules can be introduced into host cells through transformation, transfection, infection, electroporation, etc., in such a way that many copies of the gene sequence are generated. Preferably, the cloned gene is contained in a shuttle vector plasmid that provides expansion in a cloning cell, for example, Escherichia coli, and easy purification for subsequent insertion into an appropriate expression cell line, if desired. For example, a shuttle vector, which is a vector that can be replicated in more than one type of organism, can be prepared for replication in both Escherichia coli and Saccharomyces cerevisiae by Sequence binding of an Escherichia cosí plasmid to sequences from a 2m yeast plasmid. In an alternative method, the desired gene can be identified and isolated after insertion into a suitable cloning vector with a "gene gun" approach. The enrichment of the desired gene, for example, by fractionation of sizes, can be carried out before its insertion into the cloning vector. The nucleotide sequence is encoded for a RGS18 polypeptide or an antigenic fragment, derivative or analogue thereof, or a functionally active derivative, includes a chimeric protein that can be inserted into an appropriate expression vector. That is, a vector that contains the elements necessary for the transcription and translation of the inserted protein coding sequence. Such elements are referred to herein as "promoter". Thus, the nucleic acid encoding a RGS18 polypeptide of the present invention is operatively associated with a promoter in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under the control of such regulatory sequences. An expression vector also preferably includes an origin of replication. The necessary transcription and translation signals can be provided in a recombinant expression vector, or they can be delivered by a native gene encoding RGS18 and / or its flank regions. Potential host-vector systems include, but are not limited to, a system of cells infected with viruses, (eg, vaccinia virus, adenovirus, etc.); insect cell systems infected with virus, (eg, baculovirus); microorganisms such as yeast vectors containing yeast; or bacteria transformed with bacteriophages, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strength and specificities. Depending on the host-vector system used, any of numerous elements of transcription and suitable translation may be employed. A recombinant RGS18 protein of the invention, or functional fragment, derivative. Chimeric construct, or analogue thereof, can be expressed chromosomally after integration of the coding sequence by recombination. Regarding this aspect, any of several amplification systems can be used to achieve high levels of stable gene expression (Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning: a laboratory manual] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The cell in which the recombinant vector comprising the nucleic acid encoding a RGS18 polypeptide of In accordance with the present invention, an appropriate cell culture medium is cultured under conditions that provide for the expression of the RGS18 polypeptide by the cell. Any of the methods previously described for the insertion of DNA fragments into a cloning vector can be used to construct expression vectors containing a gene consisting of appropriate transcription / translation control signals and protein coding sequences. These methods may include recombinant DNA in vi tro and synthetic techniques and in vivo recombination (genetic recombination). The expression of a RGS18 polypeptide can be controlled by any promoter / enhancer element known in the art, but these regulatory elements must be functional in the host cell selected for expression. Promoters that can be used to control the expression of the RGS18 gene include, but are not limited to, the early promoter region of SV40 (Benoist and Chambon, 1981, Nature 290: 304-310), the promoter contained in the repeat of 3 'long terminal of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22: 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Nati. Acad. Sci. USA 78: 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42); prokaryotic expression vectors such as the b-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Nati, Acad. Sci. USA 75: 3727-3731), or the tac promoter (DeBoer, et al. 1983, Proc. Nati, Acad. Sci. USA 80: 21-25); see also "Useful proteins from recombinant bacteria" [Protein useful from recombinant bacteria] in Scientific American, 1980, 242: 74-94; promoter elements of yeast or other fungi such as the Gal4 promoter, the ADC (alcohol dehydrogenase) promoter, the PGK (phosphoglycerol kinase) promoter, the alkaline phosphatase promoter; and the transcriptional control regions of animals, which show a specific tissue and have been used in transgenic animals: elastase I gene control region that is active in pancreatic acinar cells (Swift et al., 1984, Cell 38: 639- 646, Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50: 399-409, MacDonald, 1987, Hepatology 7: 425-515); region of insulin gene control that is active in pancreatic beta cells (Hanahan, 1985, Nature 315: 115-122), immunoglobulin gene control region that is active in lymphoid cells (Grosschedl et al., 1984, Cell 38: 647-658, Adames et al., 1985, Nature 318: 533-538, Alexander et al., 1987, Mol. Cell. Biol. 7: 1436-1444), region of control of mouse mammary tumor virus that is active in testicular, breast, lymphoid and astocyte cells (Leder et al., 1986, Cell 45: 485-495), albumin gene control region that is active in liver (Pinkert et al, 1987, Genes and Devel.1: 268-276), alpha-fetoprotein gene control region that is active in the liver (Krumlauf et al., 1985, Mol Cell. Biol. 5: 1639-1648, Hammer et al., 1987, Science 235: 53-58), control region of alpha 1-antitrypsin gene that is active in the liver (Kelsey et al., 1987, Genes and Devel. 1: 161-171), control region of beta-globin gene that is active in myeloid cells (Mogran et al., 1985, Nature 315: 338-340, Kollias et al., 1986, Cell 46: 89-94), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48: 703-712), light chain gene control region of myosin 2 which is active in skeletal muscle (Sani, 1985, Nature 314: 283-286), and gonadotropin-releasing hormone control region that is active in the hypothalamus (Mason et al., 1986, Science 234: 1372- 1378). Expression vectors comprising a nucleic acid encoding a RGS18 polypeptide of the present invention can be identified through four general approaches: (a) amplification by chain reaction of polymerase (PCR) of the plasmid DNA derived from either specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, (d) analysis with appropriate restriction endonuclease and (e) ) expression of inserted sequences. In the first approach, the nucleic acids can be amplified by polymerase chain reaction to provide detection of the amplified product. In the second approach, the presence of a foreign gene inserted into an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene. In the third approach, the recombinant vector-host system can be identified and selected based on the presence or absence of certain "selectable marker" gene functions (eg, beta-galactosidase activity, thymidine kinase activity, antibiotic resistance). , phenotype of transformation, formation of occlusion bodies in baculovirus, etc.), caused by the insertion of foreign genes in the vector. In another example, if the nucleic acid encoding a RGS18 polypeptide is inserted into the "selectable marker" gene sequence of the vector, recombinants comprising the nucleic acid insert of RGS18 can be identified by the absence of the function of "selection marker" gene. In the fourth approach, recombinant expression vectors are identified by digestion with appropriate restriction enzymes. In the fifth approach, recombinant expression vectors can be identified by the assay to determine the activity, biochemical or immunological characteristics of the gene product expressed by recombinants, provided, that the expressed protein assumes a functionally active conformation. A wide range of host-vector expression combinations can be employed in the expression of the nucleic acids of the invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include SV40 derivatives and known bacterial plasmids, for example, Escherichia coli El plasmids, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67: 31-40), pMB9 and their derivatives, plasmids such as RP4; Phage DNAs, for example, the numerous derivatives of phage 1, for example, NM989, and other phage DNAs, for example M13, and phage DNA of a single filamentous chain; yeast plasmids such as plasmid 2m and derivatives thereof; useful vectors in eukaryotic cells, for example, vectors useful in insect or mammalian cells; vectors derived from combinations of plasmid and phage DNA, such as plasmids that have been modified to employ phage DNA or other control sequences of expression; and similar. For example, in a baculovirus expression system, both non-fusion transfer vectors such as, but not limited to, pVL941 (BamHl cloning site, Summers), pVL1393 (BamHl, Smal, Xbal, EcoRl, Notl cloning site). , XmalII, Bg / IÍ, and PstI; Invitrogen), pVL1392 (cloning sites, Bg / II j Pstl, Notl, XmalII, -5coRl, Xbal, Smal, and BamHl, Summers and Invitrogen), and pBlueBacIII (sites II of cloning BamHl, BglII, Pstl, Ncol, and Hi-ndlII, with possible blue / white recombinant sieving; Invitrogen), and fusion transfer vectors such as, but not limited to, pAc700 (cloning site BamHl and Kpnl; wherein the BamHl recognition site begins with the start codon; Summers), pAc701 and pAc 702 (same as pAc700, with different reading frames), pAc36 ?! (BamHl cloning site with 36 base pairs downstream of a polyhedrin start codon, Invitrogen (195)), and pBlueBacHis A, B, C (three different reading frames with cloning site BamHl, Bg / II, PstI , Ncol, and H? NdlII, a? Terminal peptide for ProBond purification, and blue / white recombinant sieves from I plates; Invitrogen (220) can be used.Examples and expression contemplated for use in the present invention include vectors! inducible promoters such as dihydrofolate reductase (DHFR), eg, any expression vector with a DHFR expression vector or co-amplification vector DHFR / methotrexate, for example pED (cloning site PstI, Sali, Sbal, Smal and IcoRI) with the vector expressing both the cloned gene and DHFR (Kaufman, 1991. Current Protocols in Molecular Biology [Current Protocols] in Molecular Biology], 16.12). Alternatively, a glutamine synthetase / methionine sulfoximine co-amplification vector, eg, pEE14 (HindIII, Xbal, Smal, Sbal, EcóRI, and Bc / I cloning site, and wherein the vector expresses glutamine tape and the cloned gene Celltech). In another embodiment, a vector that directs episomal expression under the control of Epstein Barr virus (EBV) can be employed, for example pREP4 (BamHl cloning site, Sfil, Xhol, Notl, Nhel, HindIII, Nhel, Pvul I, and Kpnl, constitutive RSV-LTR promoter, selectable hygromycin marker, Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindIII, Nhel, PvuII and .Kpnl cloning site, immediate early gene of constitutive hCMV, selectable marker of hygromycin; Invitrogen), pMEP4 (Kpnl cloning site, Pvul, Nhel, HindIII, Notl, Xhol, Sfil, BamH1, inducible metallothionein aIA gene promoter, selectable hygromycin marker: InvRrogen), pREP8 (BamHl cloning site, Xhol , Notl, iindIII, Nhel, and Kpnl, RSV-LTR promoter, histidinol selectable marker, Invitrogen), pREP9 (cloning site (Kpnl, Honey, BindlII, Notl, Xhol, Sfil, and BamHl, RSV-LTR promoter, marker selectable G418, Invitrogen) "and pEBVHis (RSV-LTR promoter, selectable hygromycin marker, N-terminal peptide purified through ProBond resin and dissociated by enterokinase; Invitrogen). Selectable mammalian expression vectors for use in the present invention include pRc / CMV (BindlII cloning site, BstXI, Notl, Sbal, and Apal, selection G418; Invitrogen), pRc / RSV (Hindl II cloning site, Spel, BstXI, Notl, Xbal, selection G418; Invitrogen), and others. Mammalian expression vectors of Vaccinia virus (Kaufman, 1991. Current Protocols in Molecular Biology [Current Protocols in Molecular Biology], 16.12) for use in accordance with the present invention include, without limitation, pSCll (Smal cloning site, selection TK- and b-gal), pMJ601 (SalI, Smal, AflI, NarI, BspMII, BamHI, Apal, Honey, SacII, Kpnl, and Jí? NdIII cloning sites; TK- and b-gal selection), and pTKgptFIS ( clRI site clRI, PstI, SalI, Accl, HindII, Sbal, BamRI, and Hpa, selection TK or XPRT). Yeast expression systems can also be used in accordance with the present invention to express a RGS18 polypeptide. For example, the non-fusion pYE2 vector (cloning site Xbal, Sphl, Shol, Notl, GstXI, EcoRI, BstXI, BamHl, Sacl, Kpnl, and HindIII, Invitrogen) or the fusion pYESHisA, B, C (site of Cloning Xbal, Sphl, Shol, Notl, BstI, £ coRI, BamHl, Sacl, Kpnl, and H? ndlII, N-terminal peptide purified with ProBond resin and dissociated with enterokinase; Invitrogen), to mention only two, may be employed in accordance with the present invention. Once a particular recombinant DNA molecule is identified and isolated, various methods known in the art can be employed to propagate it. Once a suitable host system and suitable growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. As explained above, the expression vectors that can be used include, without being limited to these examples, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus, insect virus such as baculovirus; yeast vectors, bacteriophage vectors (for example lambda), and plasmid and cosmid DNA vectors, to mention just a few. In addition, a host cell strain can be selected which modulates the expression of the grafted sequences or modifies and processes the gene product in the specific manner desired. Different host cells have characteristic and specific mechanisms for the processing and modification of translation and post-translation (eg, glycosylation, dissociation [eg, signal sequence]) of proteins. Appropriate cell lines or Appropriate host systems may be selected in order to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce a non-glycosylated core protein product. However, the RGS18 protein expressed in bacteria may not be properly folded. Expression in yeast can produce a glycosylated product. Expression in eukaryotic cells may increase the likelihood of "native" glycosylation and the fold of a heterologous protein. In addition, expression in mammalian cells may provide a tool to reconstitute, or constitute the activity of RGS18. In addition, different vector / host expression systems can affect processing reactions, for example proteolytic dissociations, to a different extent. Vectors are introduced into the desired host cells by methods known in the art, for example, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (fusion of lysosomes), use of a gun gene, or a DNA vector transporter (see, for example, Wu et al., 1992, J. Biol. Chem. 267: 963-967, Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624 , Hartmut et al., Canadian Patent Application No. 2,012,311 [Canadian Patent Application No. 2,012,311], filed March 15, 1990). A cell has been "transfected" by exogenous or heterologous DNA when said DNA has been introduced into the cell. A cell has been "transformed" by exogenous or heterologous DNA when the transfected DNA makes a genotypic change. Preferably, the transforming DNA must be integrated (covalently linked) into chromosomal DNA that constitutes the genome of the cell. A recombinant marker protein expressed as an integral membrane protein can be isolated and purified by standard methods. In general, the integral membrane protein can be obtained by lysing the membrane with detergents, for example, but without limitation to these examples, sodium dodecyl sulfate (SDS), Triton X-100, polyoxyethylene ester, Ipage / nonidet P-40 (NP-40) (octylphenoxy) -polyethoxyethanol, digoxin, sodium deoxycholate, and the like, including mixtures thereof. The solubilization can be increased by sonication of the suspension. Soluble forms of the protein can be obtained by harvesting the culture fluid or solubilizing inclusion bodies, for example, by treatment with detergent, and if desired, sonication or other mechanical objects, in accordance with what is described above. Solubilized or soluble protein can be isolated using various techniques, for example, polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, two-dimensional gel electrophoresis, chromatography, eg, ion exchange chromatography, affinity, immunoaffinity, and size column), centrifugation, differential solubility, immunoprecipitation , or any other standard technique for protein purification. Alternatively, a nucleic acid or vector according to the present invention can be introduced in vivo by lipofection. In the last decade, an increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro has been observed. Synthetic cationic lipids designed to limit the difficulties and hazards encountered with liposome-mediated transfection can be used to prepare liposomes for the in vivo transfection of a gene encoding a marker (Felgner et al., 1987. PNAS 84: 7413, Mackey, et al. 1988. Proc. Nati, Acad. Sci. USA 85: 8027-8031, Ulmer et al., 1993. Science 259: 1745-1748). The use of cationic lipids can promote the encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Felgner and Ringold, 1989. Science 337: 387-388). Particularly useful lipid compounds and compositions for transfer nucleic acids are described in the International Patent Publications W095 / 18863 and W096 / 17823, and in U.S. Patent Number 5,459,127.
The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. The molecular approach of liposomes to specific cells represents an area of benefit. It is clear that targeting transfection to particular types of cells would be particularly preferred in a tissue with cellular heterogeneity, for example, pancreas, liver, kidney, and brain. Lipids can be chemically coupled to other molecules for the purpose of focusing [89] Focused peptides, for example, hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be chemically coupled to liposomes. Other molecules are also useful for facilitating the transfection of a nucleic acid in vivo, for example cationic oligopeptide (e.g., International Patent Publication W095 / 21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO96 / 25508), or a cationic polymer (for example, International Patent Publication W095 / 21931). It is also possible to introduce the vector in vivo as a naked DNA plasmid (see US Patent No. 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, for example, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gun gene, or use of a DNA vector transporter (see, Wu et al., 1992, J. Biol. Chem. 267: 963-967, Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624 , Hartmut et al., Canadian Patent Application No. 2,012,311 [Canadian Patent Application No. 2,012,311], filed March 15, 1990, Williams et al., 1991. Proc.
Nat. Acad. Sci. U.S.A. 88: 2726-2730). Approaches for the administration of receptor-mediated DNA can also be used (Curiel et al., 1992. Hura Gene 3: 147-154, Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432). "A" pharmaceutically acceptable carrier or excipient "includes pharmaceutically acceptable diluents and fillers for method and administration, which are sterile, and can be formulated in aqueous or oleaginous suspensions, using suitable dispersing agents or wetting agents and suspending agents The particular pharmaceutically acceptable carrier and the ratio between active compound and vehicle are determined by the solubility and by the chemical properties of the composition. The particular mode of administration and standard pharmaceutical practice. Any nucleic acid, polypeptide, vector, or host cell of the invention will preferably be introduced in vivo in a pharmaceutically acceptable carrier or excipient. The term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and typically do not produce any allergic or similar detrimental reaction, for example gastric problems, dizziness and the like, when administered to a human being. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the federal government or a state government or listed in the North American Pharmacopoeia or in other pharmacopoeias generally recognized for use in animals, and particularly in the human being. The term "excipient" refers to a diluent, adjuvant, excipient or vehicle with which the compound is administered. Said pharmaceutical vehicles can be sterile liquids, for example water and oils, including petroleum, animal, vegetable or synthetic, for example, peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water with or aqueous solution, saline solutions, and aqueous solutions of dextrose or glycerol are preferably used as excipients, particularly for injectable solutions. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Of course, the invention contemplates the administration of a vector that will express a therapeutically effective amount of a RGS18 polypeptide for gene therapy applications. The term "therapeutically effective amount" is used herein to refer to an amount sufficient to reduce by at least about 15%, preferably at least 50%, more preferably at least 90%, and preferably even higher to avoid a clinically significant deficit of the activity, function and response of the host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the host. NUCLEIC ACIDS CODING RGS P0LIPEPTIDES18 In an effort to better understand the modulation of signaling sent by GPCRs in platelets, the applicants sought to identify regulators of G protein signaling proteins (RGSs) that are present in human platelets and several megakaryocytic cell lines . Using degenerate oligonucleotides based on conserved regions of the highly homologous RGS domain, RT-PCR was performed using human platelet RNA, as well as several RNAs. megakaryocytic cell lines. In addition to confirming the presence of several known RGS transcripts, a novel RGS domain containing transcript was found in platelet RNA. A Northern blot analysis of multiple human tissues indicates that this novel transcript is expressed more abundantly in platelets compared to other tissues examined. This RGS transcript is abundantly expressed in platelets, with significantly lower expression in other tissues, primarily the tissues of the hematopoietic system. This transcript is modestly expressed in three lines of megakaryocytic cells and tissues of hematopoietic origin such as leukocytes, bone marrow or spleen with low level of expression detected in other tissues as well. A full-length cloning of this novel RGS, which has been called RGS18, demonstrates that this transcript encodes a protein of 235 amino acids. RGS18 is more closely related to RGS5 (identity of 46%) and has an identity of approximately 30-40% with other RGS proteins. Antisera directed by peptide against RGS18 detect the expression of a protein of approximately 30 kDa in lysates of platelets, leukocytes and megakaryocytic cell lines. In vi tro, RGS18 binds to Ga? 2, Gai3 and G ^ endogenous but not to Ga2, Ga = or Gai2 of platelet lysates treated with GDP + A1F-T. Since platelet aggregation requires the activation of a receptor coupled to Gaq and / or one or more Ga forms ?, RGS18 may be responsible in part for the regulation of important pathways of platelet activation. The present invention relates to nucleic acids encoding a novel G protein signaling protein (RGS) regulator, RGS18. Thus, a first subject of the present invention is a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, or either g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a polynucleotide sequence of a) nucleotides 1-169 of SEQ ID NO: 11, or of a polynucleotide sequence complementary, b) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, c) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or d) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Preferably, a nucleic acid according to the present invention comprises at least 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200 or 500 consecutive nucleotides of a sequence of polynucleotides of a) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, b) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) nucleotides 163 -658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence or d) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid having a nucleotide identity of at least 80% with a nucleic acid comprising a polynucleotide sequence of a) any of SEQ ID NOs: 11, 18, or 19 or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary,, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid having a nucleotide identity of at least 85%, preferably 90%, more preferably 95%, and even more preferably 98% with a nucleic acid comprising a polynucleotide sequence a) any of SEQ ID NOs: 11, 18, or 19, either of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of. SEQ ID NO: 19, either of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid that hybridizes, under very stringent conditions, to a polynucleotide sequence of a) any of SEQ ID NOs: 11, 18, 19, or of a complementary polynucleotide sequence, b) nucleotides 1 -169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO. : 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence, g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The present invention also relates to nucleic acids encoding a polypeptide comprising the novel RGS18 domain. Thus, a second object of the present invention relates to a nucleic acid comprising a sequence of polynucleotides of a) any of SEQ ID NOs: 18 or 19, or of a sequence of polynucleotides complementary to b) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, or c) nucleotides 418-768 of SEQ ID NO: 19, or complementary polynucleotide sequence. The invention also relates to nucleic acids, particularly cDNA molecules, which encode the full-length human RGS18 protein. The present invention also relates to a cDNA molecule that encodes the novel full-length RGS18 protein. Thus, the invention relates to a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NO: 18 or 19, or of a complementary polynucleotide sequence, or b) nucleotides 163-870 of SEQ ID NO. : 19, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid comprising a polynucleotide sequence according to any of SEQ ID NOs: 18 or 19, or a complementary polynucleotide sequence, or b) nucleotides 163-870 of SEQ. ID NO: 19, or of a complementary polynucleotide sequence. In accordance with the present invention, a nucleic acid comprising a polynucleotide sequence of any of SEQ ID NOs: 18 or 19 encodes a 235 amino acid full length RGS18 domain polypeptide comprising the amino acid sequence of SEQ ID NO: 20. The present invention also relates to a nucleic acid encoding a polypeptide comprising the novel RGS18 domain. In a preferred embodiment, the nucleic acid encodes a polypeptide comprising a sequence of amino acids of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the nucleic acid encodes a polypeptide comprising an amino acid sequence of SEQ ID NO: 20. POLYPEPTIDES OF RGS18 The present invention also relates to polypeptides which they comprise the novel domain of RGS18 in accordance with the present invention. Accordingly, the present invention relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In addition, the present invention also relates to a polypeptide comprising the of novel RGS18. In a preferred embodiment, a polypeptide according to the present invention comprises an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred embodiment, the polypeptide according to the present invention comprises an amino acid sequence of SEQ ID NO: 20. The invention also relates to a polypeptide comprising an amino acid sequence according to that presented in SEQ ID NO: 20. The invention also relates to a polypeptide comprising an amino acid sequence comprising the amino acids 86-202 of SEQ ID NO: 20. The invention also relates to a polypeptide comprising an amino acid sequence having at least 80% amino acid identity with a polypeptide comprising an amino acid sequence of a) and SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20. The invention also relates to a polypeptide having an amino acid identity of at least 85%, preferably 90%, more preferably 95%, and even greater preference 98% with a polypeptide comprising an amino acid sequence of a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20. Preferably, a polypeptide according to the present invention. The invention will have a length of 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide according to the present invention, in particular a polypeptide comprising an amino acid sequence of a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, or c) amino acids 86-166 of SEQ ID NO: 20. Alternatively, a polypeptide according to present invention will comprise a fragment having a length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a polypeptide according to the present invention, more particularly of a polypeptide comprising an amino acid sequence of a) amino acids 1-166 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, or c) amino acids 86-166 of SEQ ID NO: 20. PROBE AND PROBE NUCLEOTIDES Probes and primers of nucleotides that hybridize with a nucleic acid (genomic DNA, messenger RNA, cDNA) according to the present invention also form part of the invention. The definition of a nucleotide probe or primer according to the present invention therefore encompasses oligonucleotides that hybridize, under very stringent hybridization conditions defined above, to a polynucleotide sequence of a nucleic acid according to the present invention or a sequence of complementary nucleotides. In accordance with the present invention, nucleic acid fragments derived from a polynucleotide according to the present invention are useful for detecting the presence of at least one copy of a nucleotide sequence of a RGS18 nucleic acid or a fragment thereof. or a variant thereof (which contains a mutation or a polymorphism) in a sample. In accordance with the present invention, nucleic acid fragments derived from a nucleic acid comprising a polynucleotide sequence of any of SEQ ID NO: 11, 18 and 19, or of a complementary polynucleotide sequence are useful for the detection of the presence of at least one copy of a nucleotide sequence of the RGS18 gene or of a fragment of a variant thereof (containing a mutation or a polymorphism) in a sample. Thus, nucleotide probes and primers that hybridize to a nucleic acid sequence of a nucleic acid encoding a RGS18 domain (genomic DNA, messenger RNA, cDNA) are also part of the invention. Oligonucleotide probes or primers according to the present invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a sequence of complementary polynucleotides, b) 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or d) 418 -658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Preferably, nucleotide probes or primers according to the present invention will have a length of 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the present invention, in particular of a nucleic acid comprising a nucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a complementary nucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, or d) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Alternatively, a nucleotide probe or primer according to the present invention will comprise and / or comprise a fragment having a length of 10, 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the present invention, more particularly of a nucleic acid comprising a polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or d) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence.
Preferred probes and primers according to the present invention comprise all or part of a polynucleotide sequence comprising a) any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32 , 33, 34, 35, or 36, either of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The nucleotide primers according to the present invention can be used to amplify any of the nucleic acids according to the present invention, and more particularly a nucleic acid comprising a polynucleotide sequence of a) any of SEQ ID NO: 11, 18, or 19, either of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or either of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Alternatively, the nucleotide primers according to the present invention can be used to amplify a nucleic acid fragment or variant of a nucleic acid comprising a polynucleotide sequence of a) any of SEQ ID NOs: 11, 18 or 19, or either of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418 -768 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The definition of a nucleotide probe or primer according to the present invention therefore encompasses oligonucleotides that hybridize, under the conditions of Very strict hybridization defined above, with u? nucleic acid according to the present invention or a complementary nucleotide sequence. According to a preferred embodiment, a nucleotide primer according to the present invention comprises a nucleotide sequence of any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34 , 35 or 36, or of a complementary nucleic acid sequence. A nucleotide primer or probe according to the present invention can be prepared by any suitable method well known to those skilled in the art, including by cloning and restriction enzyme action or by direct chemical synthesis in accordance with such techniques as the phosphodiester method by Narang et al. (Narang SA, Hsiung HM, Brousseau R, 1979. Methods Enzymol, 68: 90-98) or by Brown et al. (Brown EL, Belagaje R, Ryan MJ, Khorana HG, 1979 Methods Enzymol. 68: 109-151), the diethylphosphoramidite method by Beaucage et al. (Beaucage et al., 1981. Tetrahedron Lett, 22: 1859-1862) or in the art on a solid support described in the Union Patent. European No. 0,707,592. Each of the nucleic acids according to the present invention, including the probes and oligonucleotide primers described above, can be labeled, if wishes, through the incorporation of a marker that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical devices. For example, such labels may consist of radioactive isotopes (32P, 33P, 3H, 35S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin), or ligands such as biotin. The labeling of the probes is preferably carried out by incorporation of labeled molecules in the polynucleotides by extension of primers, or alternatively by addition to the 5 'or 3' ends. Examples of non-radioactive labeling of nucleic acid fragments are described in particular in French Patent No. 78 109 75 or in the articles by Urdea et al. (Urdea MS, 1988. Nucleic Acid Research, 11: 4937-4957) or Sánchez -Pischer and collaborators (Sánchez-Pescador R., 1988. J. Clin Microbiol., 26 (10): 1934-1938). Preferably, the probes and nucleotide primers according to the present invention can have structural characteristics of the type that allows an amplification of the signal, for example the probes described by Urdea et al. (Urdea MS et al., 1991. Nucleic Acids Symp Ser ., 24: 197-200) or alternatively in European Patent No. EP-0,225,807 (CHIRON). The oligonucleotide probes according to the present invention invention can be used in particular in Southern hybridization with the genomic DNA or alternatively in hybridization with the corresponding messenger RNA when the expression of the corresponding transcript is searched in a sample. The probes and primers according to the present invention can also be used for the detection of amplification products by polymerase chain reaction or alternatively for the detection of mismatches. Nucleotide probes or primers according to the present invention can be immobilized on a solid support. Such solid supports are well known to persons skilled in the art and comprise well surfaces of microtiter plates, polystyrene beads, magnetic beads, nitrocellulose bands or microparticles such as latex particles. METHODS FOR DETECTING NUCLEIC ACIDS CODING RGS18 POLYPEPTIDES AND RGS POLYPEPTIDES The invention also relates to a device for detecting RGS18 nucleic acids, protein, and polypeptides comprising RGS18 domain. A preferred embodiment of the present invention relates to a method for amplifying a nucleic acid according to the present invention, and more particularly to an acid nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18, or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a sequence of complementary polynucleotides, c) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, or a fragment of nucleic acid or variant thereof contained in a sample, wherein said method comprises the steps of: a) placing the sample in which suspects the presence of white nucleic acid in contact with a pair of nucleotide primers whose hybridization position is respectively located at the 5 'end and at the 3' end of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the reaction and amplification; and b) detecting the amplified nucleic acids. The present invention also relates to a method for detecting the presence of a nucleic acid in a sample, wherein the nucleic acid comprises a polynucleotide sequence of a) any of SEQ ID NOs: 11. 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1- 169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, either g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence; or a fragment of nucleic acid or variant thereof, said method comprises the steps of: 1) contacting one or several nucleotide probes according to the present invention with the sample to be tested; 2) detect the complex that may have formed between the probe (s) and the nucleic acid present in the sample. In accordance with a specific embodiment of the detection method according to the invention, the probes and Oligonucleotide primers are immobilized on a support. In accordance with another aspect, the oligonucleotide probes and primers comprise a detected marker. The invention also relates to a kit or kit for detecting the presence of a nucleic acid according to the present invention in a sample, said kit or kit comprising: a) one or several nucleotide probes or one or more primers of nucleotides in accordance with that described above; b) if appropriate, the reagents necessary for the hybridization reaction. In accordance with a first aspect, the kit or detection kit is characterized in that the probe or the probes or the primer or the primers are immobilized on a support.
According to a second aspect, the kit or detection kit is characterized in that the oligonucleotide probes comprise a detectable label. In accordance with a specific embodiment of the detection kit described above, said kit comprises several probes and / or oligonucleotide primers according to the invention which can be used to detect a target nucleic acid of interest or alternatively to detect mutations in the coding regions or in the regions not encoders of the nucleic acids according to the present invention. Another object of the present invention is a kit or kit for amplifying all or a part of a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18 or 19, or of a polynucleotide sequence complementary, b) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163 -870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO. : 19, either of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, wherein said kit or kit comprises: 1) a pair of primers of nucleotides according to the invention, whose hybridization position is located respectively on the 5 'side and on the 3' side of the target nucleic acid whose amplification is sought; and optionally, 2) reagents necessary for an amplification reaction.
Said kit or amplification kit preferably comprises at least one pair of nucleotide primers according to that described above. The invention also relates to a kit or kit for detecting the presence of a nucleic acid according to the present invention in a sample, said kit or kit comprising: a) one or more nucleotide probes according to the present invention; b) if appropriate, reagents necessary for a hybridization reaction. According to a first aspect, the kit or detection kit is characterized in that the nucleotide probe or the nucleotide probes and the nucleotide primer or the nucleotide primers are immobilized on a support.
According to a second aspect, the kit or detection kit is characterized by the nucleotide probe or the nucleotide probes and the nucleotide primer or the nucleotide primers comprise a detectable label. In accordance with a specific embodiment of the detection kit described above, said kit comprises several probes and / or oligonucleotide primers according to the invention which can be used to detect target nucleic acids of interest. In accordance with a preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a sequence of complementary polynucleotides, c) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Alternatively, the target nucleic acid is a fragment of nucleic acid or variant of a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs .: 11, 18, 19, or of a complementary polynucleotide sequence, b ) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. According to a preferred embodiment, two primers according to the present invention comprise all or a portion of SEQ ID NOs: 9 and 10, making it possible to amplify the nucleotide region 163-870 of SEQ ID NO: 19, or an acid nucleic that has a complementary polynucleotide sequence. According to a preferred embodiment, two primers according to the present invention comprise all or a portion of SEQ ID NO: 14 and 15, making it possible to amplify the region of nucleotides 510-839 of SEQ ID NO: 19, or a nucleic acid having a complementary polynucleotide sequence. According to a preferred embodiment, two primers according to the present invention comprise all or a portion of SEQ ID NOs: 14 and 16, making it possible to amplify the nucleotide region 510-885 of SEQ ID NO: 19 or a nucleic acid having a complementary polynucleotide sequence. According to a preferred embodiment, two primers according to the present invention comprise all or part of SEQ ID NOs: 14 and 17, making it possible to amplify the nucleotide region 510-923 of SEQ ID NO: 19, or a nucleic acid having a complementary polynucleotide sequence. According to another preferred embodiment, a primer according to the present invention comprises, in general, all or a portion of any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36 or a complementary sequence. Thus, the probes according to the present invention, immobilized on a support, can be ordered in matrices, for example, "DNA chips". Such ordered arrays have been described in particular in U.S. Patent No. 5,143,854, in published PCT applications WO 90/15070 and WO 92/10092. Support matrices where oligonucleotide probes have been immobilized with high density are described, for example, in U.S. Patent No. 5,412,087 and in published PCT application WO 95/11995. The nucleotide primers according to the present invention can be used to amplify any of the nucleic acids according to the present invention, or a complementary polynucleotide sequence. Alternatively, the nucleotide primers according to the present invention can be used to amplify a nucleic acid fragment or variants of a nucleic acid according to the invention, or a complementary polynucleotide sequence. Another object of the present invention relates to a method for amplifying a nucleic acid according to the invention, or a complementary polynucleotide sequence, contained in a sample, said method comprising steps d: a) contacting the sample where the presence of the soft nucleic acid is suspected with a pair of nucleotide primers whose hybridization position is respectively located on the 5 'side and on the 3' side of the target nucleic acid region whose amplification is sought, in the presence of the reactants necessary for the amplification reaction; and b) detecting the amplified nucleic acids. To carry out the amplification method as defined above, any of the nucleotide primers described above is preferably used. The object of the present invention is, in addition to a kit or kit for amplifying all or a part of a nucleic acid according to the present invention, or a complementary polynucleotide sequence, said kit or kit comprising: a) a pair of nucleotide primers according to the present invention, whose hybridization position is locates respectively on the 5 'side and on the 3' side of the target nucleic acid whose amplification is sought; and optionally, b) reagents necessary for the amplification reaction. Said kit or amplification kit preferably comprises at least one pair of nucleotide primers according to that described above. The invention also relates to a kit or kit for detecting the presence of a nucleic acid according to the invention in a sample, said kit or kit comprising: a) one or more nucleotide probes according to the invention; b) if appropriate, reagents necessary for a hybridization reaction. According to a first aspect, the kit or detection kit is characterized in that the nucleotide probe (s) and the nucleotide primer (s) are immobilized by a support. According to a second aspect, the kit or detection kit is characterized in that the probe (s) and the nucleotide primer (s) comprise a detectable label. In accordance with a specific embodiment of the detection kit described above, said kit comprises several probes and / or oligonucleotide primers according to the invention that can be used to detect nucleic acids. target of interest or alternatively to detect mutations in the coding regions or in the non-coding regions of the nucleic acids according to the invention. In accordance with the preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of a) any of SEQ ID NOs: 11, 18, 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ. ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, or either g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. Alternatively, the target nucleic acid is a fragment of nucleic acid or a variant of a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, b ) nucleotides 1-169 of SEQ ID NO: 11, or of a polynucleotide sequence complementary, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418- 768 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. According to a preferred embodiment, a primer according to the present invention comprises, in general terms, all or part of any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or a complementary sequence. RECOMBINANT VECTORS The invention also relates to a recombinant vector comprising a nucleic acid according to the present invention. The term "vector" for the purposes of the present invention will be understood as referring to a circular DNA or RNA molecule or line that is either single stranded or double stranded. Preferably said recombinant vector comprises a nucleic acid selected from the group consisting of a) a nucleic acid comprising a polynucleotide sequence of 1) of any of SEQ ID NOs: 11, 18 or 19 or of a complementary polynucleotide sequence, 2) nucleotides 1-169 of SEQ ID NO: 11, or of a sequence of complementary polynucleotides, 3) nucleotides 1-658 of SEQ ID NO: 19, or of a sequence of complementary polynucleotides, 4) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, 5) nucleotides 163- of SEQ ID NO: 19, or of a complementary polynucleotide sequence, 6) nucleotides 418 -768 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, or 7) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, b) a nucleic acid comprising a polynucleotide sequence according to any one of SEQ ID NOs: 18 or 19, or of a complementary polynucleotide sequence, c) a nucleic acid having at least 8 consecutive nucleotides of a nucleic acid comprising a sequence of polynucleotides of 1) nucleotides 1-169 of SEQ ID NO: 11, or of a sequence of complementary polynucleotides, 2) nucleotides 1-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, 3) nucleotides 163 -658 of SEQ ID NO: 19 either of a complementary polynucleotide sequence, or 4) nucleotides 418-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, e) a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of 1) of any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, 2) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, 3) nucleotides 1-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, 4) nucleotides 163-870 of SEQ ID NO: 19 either of a complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, either 7) nucleotides 418-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, f) a nucleic acid having a nucleotide identity of 85%, 90%, 95% or 98% with a nucleic acid comprising a sequence ia of polynucleotides of 1) any of SEQ ID NOs: 11, 18 or 19, either of a complementary polynucleotide sequence, 2) nucleotides 1-169 of SEQ ID NO: 11 or of a complementary polynucleotide sequence, 3) nucleotides 1-685 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, 4) nucleotides 163-870 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ ID NO: 19 o either of a complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, or 7) nucleotides 418-658 of SEQ ID NO: 19 or of a polynucleotide sequence complementary, g) a nucleic acid that hybridizes, under highly stringent hybridization conditions, to a nucleic acid comprising a polynucleotide sequence of 1) of any SEQ ID NOs: 11, 18 or 19, or of a polynucleotide sequence complementary, 2) nucleotides 1-169 of SEQ ID NO: 11 either of a complementary polynucleotide sequence, 3) nucleotides 1-685 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, 4) nucleotides 163- 870 of SEQ ID NO: 19 either of a complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ ID NO: 19 or well of a sequence of complementary polynucleotides, either 7) nucleotides 418-658 of SEQ ID NO: 19 or of a complementary polynucleotide sequence, h) a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 20, and i) a nucleic acid encoding a polypeptide comprising 1) amino acids 1-58 of SEQ ID NO: 12, 2) amino acids 1-166 of SEQ ID NO: 20, 3) amino acids 86-202 of SEQ ID NO: 20, or 4) amino acids 86-166 of SEQ ID NO: 20. According to a first embodiment, a recombinant vector according to the present invention is used to amplify a nucleic acid inserted there, following transformation and transfection of a desired cellular host. According to a second embodiment, a recombinant vector according to the present invention corresponds to an expression vector comprising, in addition to a nucleic acid according to the present invention, a regulatory signal or a nucleotide sequence that directs or controls the transcription and / or translation of the nucleic acid and its encoded mRNA. According to a preferred embodiment, a recombinant vector according to the present invention comprises in particular the following components: (1) an element or signal for regulating the expression of a nucleic acid to be inserted, such as for example a promoter sequence and / or enhancer; (2) a nucleotide coding region comprising within the nucleic acid according to the present invention to be inserted into said vector, said coding region placed in phase with the regulatory element or signal described in (Bourne (1997) Curr. Opin. Biol., 9: 134-142); Y (3) an appropriate nucleic acid for initiating and terminating the transcription of the nucleotide coding region of the nucleic acid described in (Wess (1997) FASEB, J., 11: 346-354). In addition, the recombinant vectors according to the present invention can include one or more origins of replication in cellular hosts where their amplification or expression, markers, or selectable markers are sought. By way of example, the bacterial promoters can be the Lacl or LacZ promoters, the bacteriophage T3 or T7 RNA polymerase promoters, the PR or PL lambda phage promoters. Promoters for eukaryotic cells comprise the viral herpes simplex virus (HSV) thymidine kinase promoter or alternatively mouse metallothionein-L promoter. In general for the choice of a suitable promoter, those skilled in the art may refer preferably to the book by Sambrook et al. (Sambrook, J. Fritsch, EF, and T. Maniatis, 1989. Molecular cloning: a laboratory manual [Molecular cloning : a laboratory manual] 2ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) mentioned above or to the techniques described by Fuller et al. (Fuller SA et al., 1996.
Immunology, In: Current Protocols in Molecular Biology, Ausubel et al. (Eds.)). When the expression of the genomic sequence of the RGS18 gene is sought, vectors capable of containing large insertion sequences will preferably be used. In a particular embodiment, bacteriophage vectors such as the bacteriophage Pl vectors such as the vector pl58 or the vector pl58 / neo8 described by Sternberg (Sternberg NL, 1992. Trends Genet., 8: 1-16, Sternberg NL, 1994. Mamm. Genome, 5: 397-404) will be used preferentially. Preferred bacterial vectors according to the present invention are for example pBR322 vectors (ATCC37017) or alternatively vectors such as pAA223-3 (Pharmacia, Uppsala, Sweden), and pGEMl (Promega Biotech, Madison, Wl, UNITED STATES OF AMERICA). Other commercially available vectors may also be mentioned such as the vectors pQE70, pQE60, pQE9 (Qiagen), psiX174, pBluescript SA, pNH8A, pNH16A, PNH18A, pNH46A, pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene). They can also be vectors of the baculovirus type such as vector pVL1392 / 1393 (Pharmingen) used to transfect cells of the Sf9 line (ATCC No. CRL 1711) derived from Spodoptera frugiperda. The present invention also relates to a virus defective recombinant comprising a nucleic acid encoding a RGS18 polypeptide. In a preferred embodiment, the defective recombinant virus comprises a cDNA molecule encoding a RGS18 polypeptide. In another preferred embodiment of the invention, the defective recombinant virus comprises a gDNA molecule encoding a RGS18 polypeptide. Preferably, the encoded RGS18 polypeptide comprises amino acids 86-166 of SEQ ID NO: 20. More preferably, the encoded RGS18 polypeptide comprises amino acids 86-202 of SEQ ID NO: 20. With even greater preference, the polypeptide of encoded RGS18 comprises an amino acid sequence of SEQ ID NO: 20. In another preferred embodiment, the invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein under the control of a promoter selected from repeat of long terminal Rous sarcoma virus (RSV-LTR) or the cytomegalovirus early promoter (CMV). They can also be adenoviral vectors such as human adenovirus type 2 or 5. A recombinase vector according to the present invention can be a retroviral vector or an adeno-associated vector (AAV). Such adeno-associated rectors are described, for example, in the references; Flotte et al., 1992. Am. J. Respir. Cell Mol. Biol., 7: 349- 356; Samulski et al., 1989. J. Virol., 63: 3822-3828; McLaughlin BA et al., 1996. Am. J. Hum. Genet., 59: 561-569. To allow the expression of a polynucleotide according to the present invention, the latter must be introduced into a host cell. The introduction of a polynucleotide according to the present invention into a host cell can be carried out in vi tro, in accordance with techniques well known to those skilled in the art to transform or transfect cells, either in primer culture or in the form of cell lines. It is also possible to effect the introduction of a polynucleotide according to the present invention in vivo or ex vivo to prevent or treat diseases related to a deficiency in the reverse transport of cholesterol. To introduce a polynucleotide or vector of the present invention into a host cell, one skilled in the art can preferably refer to several techniques such as calcium phosphate precipitation technique (Graham et al., 1973. Virology, 52: 456-457 , Chen et al., 1987. Mol. Cell. Biol., 7: 2745-2752), DEAE Dextran (Gopal, 1985. Mol Cell. Biol., 5: 1188-1190), electroporation (Tur-Kaspa et al. 1986. Mol Cell, Biol., 6: 716-718, Potter et al., 1984. Proc. Nat.
Acad Sci U.S.A. 81 (22): 7161-5), direct microinjection (Harland et al., 1985. J. Cell. Biol., 101: 1094-1095) liposomes loaded with DNA (Nicolau C. et al., 1987. Methods Enzymol., 149 : 157-76, Fraley et al., 1979. Proc. Nati, Acad. Sci. USA 76: 3348-3352). Once the polynucleotide has been introduced into the host cell, it can be stably integrated into the genome of the cell. Integration can be achieved at a precise genome site, by homologous recombination, or it can be integrated randomly. In some embodiments, the polynucleotide can be stably maintained in the host cell in the form of an episome fragment, the episome comprising sequences that allow retention and replication of the latter, either independently or in a synchronized manner with the cell cycle. According to a specific embodiment, a method for introducing a polynucleotide according to the present invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a A pharmaceutically compatible vector and a "naked" polynucleotide according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the selected tissue, for example, a smooth muscle tissue, the polynucleotide "naked" being absorbed by the cells of that tissue. Compositions for in vi tro and in vivo use comprising "naked" polynucleotides are described, for example, in PCT Application No. WO 95/11307 (Institut Pasteur, Inserm, University of Ottawa) as well as articles by Tacson et al. ( Tacson et al., 1996. Nature Medicine, 2 (8): 888-892) and Huygen et al. (Huygen et al., 1996. Nature Medicine, 2 (8): 893-898). In accordance with a specific embodiment of the invention, the composition for the in vivo production of the RGS18 protein is provided. This composition comprises a polynucleotide encoding the RGS18 polypeptide under the control of appropriate regulatory sequences, in solution in a physiologically acceptable carrier or excipient. Accordingly, the invention also relates to a pharmaceutical composition contemplated for the prevention and / or treatment of a patient or subject affected by a disorder or a condition that is related to a dysfunction of platelet activation, comprising a nucleic acid that encodes the RGS18 protein, in combination with one or more physiologically compatible excipients. Preferably, said composition will comprise a nucleic acid comprising a polynucleotide sequence of a) of any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, either of a sequence of complementary polynucleotides, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, either g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal . The object of the present invention is furthermore a pharmaceutical composition contemplated for the prevention and / or treatment of a patient or a subject affected by a condition or disorder associated with a dysfunction of platelet activation, comprising a recombinant vector in accordance with the invention, in combination with one or more physiologically compatible excipients. The amount of vector that is injected into the selected host organism varies according to the site of the injection. As a guide, between about 0.1 and about 100 μg of polynucleotide encoding a RGS18 polypeptide can be injected into the body of an animal, preference in a patient who may develop a disorder or condition that is related to a dysfunction of platelet activation or a patient who has already developed the condition or disorder. The invention also relates to the use of a nucleic acid according to the invention, which encodes the RGS18 protein, for the manufacture of a drug contemplated for the prevention of a condition or a disorder associated with an arrangement of platelet activation in several forms or more particularly for the treatment of subjects affected by a condition or disorder associated with the dysfunction of platelet activation. The invention also relates to the use of a recombinant vector according to the present invention, comprising a nucleic acid encoding the RGS18 protein, for the manufacture of a drug contemplated for prevention or more particularly for the treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation. The object of the present invention is therefore also a recombinant vector comprising a nucleic acid according to the present invention that encodes a RGS18 protein or a polypeptide involved in platelet activation. The invention also relates to the use of a vector Such a recombinant for the preparation of a pharmaceutical preparation contemplated for the treatment and (or for the prevention of a disorder or a condition that is related to a dysfunction of platelet activation.) The present invention also relates to the use of cells genetically modified ex vivo with said recombinant vector according to the present invention, or of cells that produce a recombinant vector, wherein the cells are implanted in the body, to allow a prolonged and effective in vivo expression of a biologically active RGS18 polypeptide The invention also relates to the use of a nucleic acid according to the present invention which encodes a RGS18 protein for the manufacture of a drug contemplated for the prevention or treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation The invention also relates to in the use of a recombinant vector according to the present invention comprising a nucleic acid encoding a polypeptide of RGS18 according to the present invention for the manufacture of a drug contemplated for the prevention or, more particularly, for the treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation.
The invention also relates to the use of a recombinant host cell according to the present invention, which comprises a nucleic acid encoding a RGS18 polypeptide according to the present invention for the manufacture of a drug contemplated for prevention or more particularly for the treatment of subjects affected by a disorder or a condition that is related to a dysfunction of platelet activation. The present invention also relates to the use of a recombinant vector according to the present invention, preferably a defective recombinant virus, for the preparation of a pharmaceutical composition for the treatment and / or prevention of pathologies related to an activation dysfunction platelet The invention relates to the use of a recombinant vector or a defective recombinant virus of this type for the preparation of a pharmaceutical composition contemplated for the treatment and / or prevention of a condition or a disorder associated with a dysfunction of platelet activation. Thus, the present invention also relates to a pharmaceutical composition comprising one or more recombinant vectors or defective recombinant viruses according to the present invention. The present invention also relates to a new therapeutic approach for the prevention and / or treatment of pathologies related to a dysfunction of platelet activation. It offers a beneficial solution to the disadvantages of the internal technique, demonstrating the possibility of treating pathologies related to a dysfunction of platelet activation by means of gene therapy, through the transfer and in vivo expression of a nucleic acid encoding a polypeptide of RGS18 involved in platelet activation. The invention therefore offers a simple means that allows a specific and effective treatment of related pathologies such as, for example, arterial thrombosis, myocardial infarction, coronary artery disease, stroke, cerebrovascular disease, unstable angina, deep vein thrombosis, thrombus. -systemic embolism, as well as its use in invasive cardiac procedures for anticoagulant purposes. Gene therapy consists in the correction of a deficiency or an abnormality (mutation, aberrant and similar expression) and in the production of the expression of a protein of therapeutic interest by introducing a genetic information into the affected cell or organ. This genetic information can be introduced either ex vivo in a cell extracted from the organ, the modified cell is then introduced into the body, or directly in vivo into the appropriate tissue. In this second case, there are several techniques among which several transfection techniques that involve DNA and DEAE-dextran complexes (Pagano et al., 1967. J. Virol., 891), DNA and nuclear proteins (Kaneda et al., 1989. Science 243: 375), DNA and lipids (Hartmut et al. Canadian Patent Application No. 2,012,311 [Canadian Patent Application No. 2,012,311], filed March 15, 1990), the use of liposomes (Fraley et al., 1980. J. Biol. Chem., 255: 10431), and the like . More recently, the use of viruses such as vectors to transfer genes seems to be a promising alternative to these techniques of physical transfection. Regarding this aspect, several viruses have been tested to determine their ability to infect certain cell populations. In particular, the retroviruses (RSV, HMS, MMS, and the like), the HSV virus, the adeno-associated viruses and the adenoviruses. The present invention thus also relates to a novel therapeutic approach for the treatment of a condition or disorder associated with a dysfunction of platelet activation, comprising the transfer and in vivo expression of genes encoding RGS18. Specifically, the present invention offers a novel therapeutic approach for the treatment and / or prevention of a disorder or condition that is associated with a dysfunction of platelet activation, such as arterial thrombosis, myocardial infarction, artery disease. coronary artery disease, stroke, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism, as well as its use in invasive cardiac procedures for anticoagulant purposes. In a particularly preferred manner, the applicant has now found that it is possible to construct recombinant vectors comprising a nucleic acid encoding a RGS18 polypeptide involved in platelet activation, to administer these recombinant vectors in vivo and that this administration allows stable and effective expression of a biologically active RGS18 polypeptide in vivo, without histopathological effect. The present invention also results from the demonstration that adenoviruses constitute particularly efficient vectors for the transfer and expression of RGS18 nucleic acids of the invention. In particular, the present invention shows that the use of recombinant adenoviruses as vectors makes it possible to obtain sufficiently high levels of expression of this gene to produce the desired therapeutic effect. Other viral vectors such as retroviruses or adeno-associates (AAV) allow stable expression of the gene are also claimed. The present invention therefore offers a new approach for the treatment and prevention of a condition or disorder associated with an activation dysfunction. platelet The object of the present invention is therefore also a defective recombinant virus comprising a nucleic acid according to the present invention that encodes a RGS18 protein or a polypeptide involved in platelet activation. The invention also relates to the use of such a defective recombinant virus for the preparation of a pharmaceutical composition contemplated for the treatment and / or for the prevention of a condition or disorder associated with a dysfunction of platelet activation, such as Examples include arterial thrombosis, myocardial infarction, coronary artery disease, stroke, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism, as well as its use in cardiac and mass procedures for anticoagulant purposes. The present invention also relates to the use of genetically modified cells ex vivo with said defective recombinant virus according to the invention, or of cells that produce a defective recombinant virus, wherein the cells are implanted in the body, to allow an expression Prolonged and effective in vivo treatment of a biologically active RGS18 polypeptide. The present invention shows that it is possible to incorporate a nucleic acid sequence encoding RGS18 in a viral vector, and that these vectors make it possible to effectively express a mature, biologically active form. More particularly, the invention shows that the in vivo expression of RGS18 can be obtained by direct administration of an adeno-virus either by implanting a producer cell or a genetically modified cell by an adeno-virus or by a retrovirus incorporating said nucleic acid. The present invention is particularly advantageous because it makes it possible to induce a controlled expression without detrimental effect of RGS18 in organs that are not normally involved in the expression of this protein. In particular, a significant release of RGS18 protein is obtained by implanting cells that produce vectors of the invention, or infected ex vivo with vectors of the invention. The nucleic sequence used in the context of the present invention can be a cDNA, a genomic DNA (gDNA), an RNA (in the case of retroviruses) or a hybrid construct consisting, for example, of a cDNA wherein one or more introns (GDNA) could be inserted. It can also involve synthetic or semi-synthetic sequences. In a particularly advantageous manner, a cDNA or a gDNA is used. In particular, the use of a gDNA allows better expression in human cells To allow their incorporation into a viral vector according to the invention, these sequences are preferably modified, for example, by site-directed mutagenesis, in particular for the insertion of appropriate restriction sites. In the context of the present invention, the use of a nucleic acid encoding a human RGS18 protein is preferred. In addition, it is also possible to use a construct encoding a derivative of these RGS18 proteins. A derivative of these RGS18 proteins comprises, for example, any sequence obtained by mutation, deletion and / or addition relative to the native sequence, and coding of a product that retains a biological activity. These modifications can be made by techniques known to a person skilled in the art (see general molecular biological techniques below). The biological activity of the derivatives obtained in this way can be easily determined, in accordance with that indicated in particular in the examples. Derivatives for the purposes of the present invention can also be obtained by hybridization from nucleic acid libraries, using the native sequence or a fragment thereof as a probe. These derivatives are, in particular, molecules that have a higher affinity for their binding sites, molecules that present a greater resistance to proteases, molecules that have a greater therapeutic efficacy or less collateral effects, or optionally new biological properties. The derivatives also include the modified DNA sequences that allow improved expression in vivo. Thus, the present invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 polypeptide. In the first embodiment, the present invention relates to a defective recombinant virus comprising a cDNA encoding a RGS18 polypeptide. In another preferred embodiment of the invention, a defective recombinant virus comprises a genomic DNA (gDNA) encoding a RGS18 polypeptide. Preferably, the encoded RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, B) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20. More preferably, the encoded RGS18 polypeptide comprises an amino acid sequence of SEQ ID NO: 20. The vectors of the invention can be prepared from various types of viruses. Preferably, vectors derived from adeno-virus, adeno-associated virus (AAV), herpes-virus (HSV) or retroviruses are employed. It is preferable to use an adeno-virus, for direct administration, or for the ex vivo modification of cells contemplated to be implanted, or a retro-virus for the implantation of cells productas The viruses according to the present invention are defective, that is, they are not capable of replicating autonomously in the target cell. In general, the genome of the defective viruses used in the context of the present invention do not have at least the sequences for the replication of said virus in an infected cell. These regions can be deleted (totally or partially) or they can be made non-functional, or substituted with other sequences and in particular with the nucleic acid sequence encoding the RGS18 polypeptide. Preferably, the defective virus retains, however, the sequence of its genome that are necessary for the encapsulation of the viral particles. In more particularly the adeno-virus, several serotypes, whose structure and properties vary in some way, have been characterized. Among these serotypes, human adeno-viruses of type 2 or 5 (Ad 2 ° Ad 5) or adeno-virus of animal origin (see Application WO 94/26914) are preferably used in the context of the present invention. Among the adenoviruses of animal origin that can be used in the context of the present invention, we can mention adenoviruses of canine, bovine, murine origin (for example: Mavl, Beard et al., 1990. Virology, 75:81), sheep, pig, bird or ape (for example: SAV). From Preferably, the adeno-virus of animal origin is a canine adenovirus, more preferably a CAVÍ adeno-virus [Manhattan or A26 / 61 (ATCC VR-800) for example]. Preferably, adeno-viruses of human or canine origin or mixed are used in the context of the present invention. Preferably, the defective adenoviruses of the present invention comprise the ITRs, a sequence that allows the encapsulation and coding sequence of the RGS18 polypeptide. Preferably, in the genome of the adenoviruses of the invention, the El region is at least rendered non-functional. Even more preferably, in the genome of the adenoviruses of the invention, the El gene and at least one of the genes E2, E4 and L1-L5 are not functional. The considered viral gene can be rendered non-functional by any technique known to a person skilled in the art, and in particular by its total pressure, by substitution, by partial deletion, or by the addition of one or more bases in the (the) gene (s) considered. Such modifications can be obtained in vi tro (in the isolated DNA) or in you, for example, through genetic manipulation techniques, or through treatment through mutagenic agents. Other regions can also be modified, and in particular the E3 regions (WO95 / 02697), E2 (W094 / 28938), E4 (W094 / 28152, W094 / 12649, WO95 / 02697) and L5 (WO / 02697). In accordance with a preferred embodiment, the adeno-virus according to the invention comprises a deletion in the regions El and E4 and the coding sequence of RGS18 is inserted at the level of the inactivated region. In accordance with another preferred embodiment, it comprises a deletion in the El region at the level where the E4 region and the coding sequence of RGS18 (French Patent Application FR94 13355) are inserted. Defective recombinant adenoviruses according to the present invention can be prepared by any technique known to those skilled in the art (EP 185 573 and 120, 121). In particular, they can be prepared by homologous recombination between an adeno-virus and a plasmid carrying, inter alia, the nucleic acid encoding the RGS18 protein. A homologous recombination occurs after the co-transfection of said adeno-virus and plasmid into the appropriate cell line. The cell line used must preferably (i) be able to transform through said elements, and (ii) contain the sequences capable of complementing the defective adeno-virus genome part, preferably in an integrated manner in order to avoid the risks of recombination. By way of example of a line, the line 293 of human embryonic kidney can be mentioned (Graham et al., 1977. J. Gen. Virol., 36:59), which contains in particular the genome of the left part of the genome of an adenovirus Ad5 (12%) or lines capable of complementing the functions of El and E4 in accordance with what is described in particular in Requests No. WO 94/26914 and WO95 / 02697. Then, the adeno-viruses that have multiplied are recovered and purified in accordance with conventional molecular biology techniques, in accordance with what is illustrated in the examples. As for the adeno-associated virus (AAV), they are DNA viruses of a relatively small size, which are integrated into the genome of the cells that they infect, in a stable and site-specific manner. They can infect a broad spectrum of cells, without inducing any effect on cell growth, morphology or differentiation. In addition, they do not seem to be involved in pathologies in humans. The genome of AAVs has been cloned, sequenced and characterized. It comprises approximately 4700 bases, and contains at each end an inverted repeat region (ITR) of approximately 145 bases, which serves as the origin of replication for the virus. The rest of the genome is divided into 2 essential regions that carry the functions of encapsulation: the left part of the genome, which contains the rep gene, involved in viral replication and the expression of viral genes; the right part of the genome, which contains the cap gene that encodes viral capsid proteins.
The use of vectors derived from AAVs for the transfer of genes in vitro and in vivo have been described in the literature (see in particular WO 91/18088, WO 93/09239, US 4,797,368, US 5,139,941, EP 488 528). These applications describe several constructs derived from AAVs, where the rep and / or cap genes are deleted and replaced by a gene of interest, and their use to transfer in vi tro (in cells in culture) or in vivo (directly in an organism). ) said gene of interest. However, none of these documents describe or suggest the use of a recombinant AAV for the transfer or expression of an RGS18 protein in vivo or ex vivo, nor the advantages of such transfer. Defective recombinant AAVs according to the present invention can be prepared by co-transfection, in a cell line infected with a human helper virus (for example an adeno-virus), from a plasmid containing the protein coding sequence of RGS18 flanked by two regions of inverted repeats of AAV (ITR), and of a plasmid carrying the AAV encapsulation genes (rep and cap genes). The recombinant AAVs produced are then encoded by conventional techniques. As regards herpes-viruses and retroviruses, the construction of recombinant vectors has been widely described in the literature: see in particular: WO 94/21807, O 92/05263, EP 453242, EP 178220, and Breakfield and collaborators, 1991. New Biologist, 3: 203; Bernstein et al., 1985. Genet. Eng. 7: 235; McCormick, 1985. BioTechnology, 3: 689, and the like. In particular, retroviruses are integration viruses that infect cells that are dividing. The genome of retroviruses essentially comprises two long terminal repeats (LTRs), one encapsulation sequence and three coding regions (gag, pol and env). In recombinant vectors derived from retroviruses, the gag, pol and env genes are generally deleted, in whole or in part, and replaced by a heterologous nucleic acid sequence of interest. These vectors can be produced from various types of retroviruses, in particular MoMuLV ("murine moloney leukemia virus", which is also known as MoMLV), MSV ("murine moloney sarcoma virus"), HaSV ( "Harvey sarcoma virus"); SNV ("spleen necrosis virus"), RSV ("rous sarcoma virus") or Friend virus. To construct recombinant retroviruses containing a sequence encoding the RGS18 region according to the present invention, a plasmid containing in particular the LTRs, the encapsulation sequence and said coding sequence is generally constructed, and then used to transfect a cell of encapsulation, which can provide deficient retroviral functions in trans in the plasmid. In general, the encapsulation lines can therefore express the gag, pol and env genes. Said encapsulation lines have been described in the prior art and in particular the line PA317 (US 4,861,719), the PsiCRIP line (WO 90/02806) and the GP + envAm-12 line (WO 89/07150). In addition, the recombinant retroviruses may contain modifications at the level of the LTRs in order to suppress transcription activity, as well as extended encapsulation sequences, which contain a portion of the gag gene (Bender et al., 1987. J. Virol., 61 : 1639). The recombinant retroviruses produced are then purified by conventional techniques. In order to carry out the present invention, it is preferable to use a defective recombinant adenovirus. Particularly beneficial properties of adenoviruses are preferred for in vivo expression of a protein having a cholesterol transport activity. The adenoviral vectors according to the present invention are particularly preferred for a direct in vivo administration of a purified suspension, or for the ex vivo transformation of cells, in particular autologous cells, taking into account their implantation. In addition, the adenoviral vectors according to the present invention also have considerable advantages, particularly its very high infection efficiency, which makes it possible to carry out infections using small volumes of viral suspension. In accordance with another particularly preferred embodiment of the invention, a line that produces retroviral vectors containing the coding sequence of the RGS18 protein is used for in vivo implantation. The lines that can be used for this purpose are in particular the cells PA317 (US 4,861,719), PsiCrip (WO 90/02806) and GP + envAm-12 (US 5,278,056) modified in such a way that the production of a retrovirus is allowed. contains a nucleic sequence encoding a RGS18 protein according to the present invention. Preferably, in the vectors of the invention, the nucleic acid encoding the RGS18 protein is placed under the control of signals that allow its expression in the infected cells. They may be expression signals that are homologous or heterologous, ie signals different from the signals naturally responsible for the expression of the RGS18 protein. They can also be in particular sequences responsible for the expression of other proteins, or else synthetic sequences. In particular, they can be sequences of eukaryotic or viral genes or derived sequences, which stimulate or repress the transcription of a gene in a specific form or in another form and in an inducible or well in another way. By way of example, they can be promoter sequences derived from the genome of the cell to be infected, or from the genome of a virus, and in particular the promoters of ElA or of major late promoter genes (MLP) of adenovirus, the cytomegalovirus promoter (CMV), the RSV-LTR and the like. Among the eukaryotic promoters, one can also mention the ubiquitous promoters (PRET, vimentin, α-actin, tubilin and the like), the promoters of the intermediate filaments (desmin, neurofilaments, keratin, GFAP and the like), the promoters of therapeutic genes ( of MDR, CFTR or type of factor VIII, and the like), tissue-specific promoters (pyruvate kinase, villin, fatty acid-binding intestinal protein promoter, smooth muscle cell a-actin promoter, liver-specific promoters, Apo, AI, Apo II, human albumin and the like) or promoters that they correspond to a stimulus (steroid hormone receptor, retinoic acid receptor and the like). In addition, these expression sequences can be modified by the addition of enhancer or regulatory sequences and the like. In addition, when the inserted gene does not contain expression sequences, it can be inserted into the genome of the defective virus current below said sequence. In a specific embodiment, the invention relates to a defective recombinant virus comprising a nucleic acid encoding a RGS18 protein operably linked or placed under the control of a promoter selected from RSV-LTR or the CMV early promoter. As indicated above, the present invention also relates to any use of a virus in accordance with that described above for the preparation of a pharmaceutical composition for the treatment and / or prevention of a condition or disorder associated with an activation dysfunction. platelet The present invention also relates to a pharmaceutical composition comprising one or more defective recombinant viruses in accordance with that described above. These pharmaceutical compositions can be formulated for administration via topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, or transdermal route and the like. Preferably, the pharmaceutical compositions of the present invention comprise a pharmaceutically acceptable carrier or a physiologically compatible excipient for an injectable formulation, in particular for an intravenous injection, for example in the portal vein of a patient. They may relate in particular to sterile isotonic solutions or dry compositions, in particular lyophilized, which when added according to the case, sterilized water or a physiological saline solution allow the preparation of solutions injectables. A direct injection into the portal vein of a patient is preferred since it makes it possible to focus the infection at the level of the liver and consequently concentrate the therapeutic effect at the level of this organ. The doses of defective recombinant virus used for the injection can be adjusted according to several parameters, and in particular depending on the viral vector, the mode of administration used, the relevant pathology or the desired duration of treatment. In general, the recombinant adenoviruses according to the present invention are formulated and administered in dosage form between 10 4 and 10 14 pfu / ml, preferably between 10 6 and 10 10 pfu / ml. The term "pfu" (plaque forming unit) corresponds to the infectious capacity of a viral solution, and is determined by infection of an appropriate cell culture and the number of plaques resulting is measured, generally after 48 hours. of the lysis of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature. As for the retroviruses, the compositions according to the present invention can directly contain the producer cells, taking into account their implantation. Regarding this aspect, another object of the present invention relates to an isolated mammalian cell infected with one or several defective recombinant viruses of according to the present invention. More particularly, the invention relates to any population of human cells infected with said viruses. They can be in particular cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, endothelial and smooth muscle cells, gual cells and the like). The cells according to the present invention can be derived from primary cultures. They can be collected by any technique known to those skilled in the art and then cultivated under conditions that allow their proliferation. More particularly as regards fibroblasts, these can be easily obtained from biopsies, for example, in accordance with the technique described by Ham (1980). These cells can be used directly for infection with a virus, or stored, for example, by freezing, for the establishment of autologous libraries, for subsequent use. The cells according to the present invention can be secondary cultures, obtained for example from pre-established libraries (see, for example, EP 228458, EP 289034, EP 400047, EP 456640). The cells in culture are then infected with a recombinant virus according to the present invention, in order to provide them with the ability to produce a RGS18 protein biologically active, the infection is carried out in vi tro in accordance with techniques known to persons skilled in the art. In particular, according to the type of cells used and the desired number of virus copies per cell, those skilled in the art can adjust the multiplicity of infection and optionally the number of infectious cycles produced. It is clearly understood that these steps should be carried out under appropriate conditions of sterility when the cell is contemplated for its administration in vivo. The doses of recombinant virus that are used for the infection of the cells can be adjusted by those skilled in the art in accordance with the desired purpose. The conditions described above for in vivo administration can be applied to the infection in vi tro. For infection with a retrovirus, it is also possible to co-culture a cell to be infected with a cell that produces the recombinant retrovirus according to the invention. This makes it possible to eliminate purification of the retrovirus. Another object of the present invention relates to an implant comprising isolated mammalian cells infected with one or more defective recombinant viruses according to the present invention or cells that produce recombinant viruses, and an extracellular matrix. Preferably, the implants according to the present invention comprise 105 to 10iü cells. More preferably, they comprise 106 to 108 cells. More particularly, in the implants according to the present invention, the extracellular matrix comprises a gel-forming compound and optionally a support that allows the anchoring of the cells in the support. For the preparation of the implants according to the present invention, various types of gel-forming agents can be employed. The gel forming agents are used for the inclusion of the cells in a matrix having the constitution of a gel, and to promote the anchoring of the cells on the support, if appropriate. Various cell adhesion agents can therefore be used as gel forming agents, for example, collagen, gelatin, glycosaminoglycans, fibronectin, lectins and the like. Preferably, collagen is used in the context of the present invention. It could be collagen of human, bovine or murine origin. More preferably, type I collagen is used. In accordance with the above, the compositions according to the present invention preferably comprise a support that allows the anchoring of the cells. The term "anchor" refers to any form of biological and / or chemical and / or physical interaction that causes adhesion and / or fixation of the cells on the support.
In addition, the cells can either cover the support used or penetrate the support, or both. It is preferable to use, within the framework of the present invention, a solid, non-toxic and / or biocompatible support. In particular, it is possible to use polytetrafluoroethylene (PTFE) fibers or a support of biological origin. The present invention therefore offers a very effective means for the treatment and prevention of a disorder or a condition that is associated with a dysfunction of platelet activation. In addition, this treatment can be applied to both humans and animals such as sheep, cattle, domestic animals (dogs, cats and the like), horses, fish and the like. RECOMBINANT GUEST CELLS The present invention also relates to the use of genetically modified cells ex vivo with a virus according to the present invention, or of cells that produce such viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active RGS18 protein. The present invention shows that it is possible to incorporate a nucleic acid encoding a RGS18 polypeptide according to the present invention into a viral vector, and that these vectors make it possible to effectively express a mature, biologically active polypeptide. More particularly, the invention shows that the in vivo expression of RGS18 can be obtained by direct administration of an adenovirus either by implantation of a producer cell or of a genetically engineered cell. modified by an adenovirus or by a retrovirus incorporating said nucleic acid. Regarding this aspect, another object of the present invention relates to an isolated mammalian cell infected with one or several defective recombinant viruses according to the present invention. More particularly, the invention relates to a population of human cells infected with these viruses. They can be, in particular, cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle cells and endothelial cells, gual cells and the like. Another object of the present invention relates to an implant comprising isolated mammalian cells infected with one or more defective recombinant viruses according to the present invention or cells that produce recombinant viruses, and an extracellular matrix. Preferably, the implants according to the present invention comprise 105 to 1010 cells. More preferably, they comprise 106 to 108 cells More particularly, in the implants of the invention, the extracellular matrix comprises a gel-forming compound and, optionally, a support that allows the anchoring of the cells. The invention also relates to an isolated recombinant host cell comprising a nucleic acid of the invention, and more particularly, a nucleic acid comprising a) any of SEQ ID NOs: 11, 18 or 19, or of a polynucleotide sequence complementary, b) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163 -870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO. : 19, either of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to an isolated recombinant host cell comprising a nucleic acid of the invention, and more particularly a nucleic acid comprising a nucleotide sequence according to the invention. presented in any of SEQ ID NOs: 18 or 19, or of a complementary polynucleotide sequence. The invention also relates to an isolated recombinant host cell comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NOs: 20. The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising a nucleic acid encoding a polypeptide comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ ID NO: 20, c) amino acids 86-202 of SEQ ID NO : 20 or d) amino acids 86-166 of SEQ ID NO: 20. According to another aspect, the invention also relates to an isolated recombinant host cell comprising a recombinant vector according to the present invention. Accordingly, the invention also relates to a recombinant host cell comprising a recombinant vector comprising any of the nucleic acids of the present invention. Specifically, the invention relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a) any of SEQ ID NOs: 11, 18 or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or either of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, or either g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The invention also relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence in accordance with that presented in any of SEQ ID NOs: 18 or 19, or of a polynucleotide sequence complementary The invention also relates to an isolated recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 20. The invention also relates to an isolated recombinant host cell which comprises a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20. Preferred host cells according to the present invention are for example the following: a) prokaryotic host cells: strains of Escherichia coli (strain DH5-a) of Bacill us subtilis, of SaJmonella typhimurium, or good strains of genera such Pseudomonas, Streptomyces and Staphylococcus; b) eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No. CCL70), COS cells (ATCC No. CRL 1650), Sf-9 cells (ATCC No. CRL 1711), CHO cells ( ATCC No. CCL-61) or 3T3 cells (ATCC No. CRL-6361). METHODS FOR PRODUCING RGS POLYPEPTIDES The invention also relates to a method for the production of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, or of a polypeptide or a variant thereof, in wherein the polypeptide or variant comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86- 166 of SEQ ID NO: 20, wherein said method comprises the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) culturing, in an appropriate culture medium, a previously transformed host cell, or transfecting a host cell with the recombinant vector of step a); c) recovering the conditioned culture medium or lysing the host cell, for example, by sonication or by osmotic shock; d) separating and purifying said polypeptide from said culture medium, or alternatively from the cell lysates obtained in step c); and e) where appropriate, characterizing the recombinant polypeptide produced. A specific embodiment of the present invention relates to a method for the production of a polypeptide comprising an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20. A polypeptide known as a "homologue" relative to a polypeptide that has an amino acid sequence comprising a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86- 202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20, also form part of the invention. Said homologous polypeptide comprises an amino acid sequence having one or more substitutions of an amino acid with an amino acid equivalent in relation to a) either one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12 , c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20 or amino acids 86-166 of SEQ ID NO: 20, respectively. The RGS18 polypeptides according to the present invention, in particular, comprise: 1) a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, 2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, 3) a fragment of polypeptide or a variant of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or either d) 86-166 of SEQ ID NO: 20, or 4) a polypeptide known as a "homolog" with a polypeptide comprising a) either one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86- 202 of SEQ ID NO: 20, or e) amino acids 86- 166 of SEQ ID NO: 20. The polypeptides according to the present invention can be characterized by binding to a column of immunoaffinity chromatography wherein the antibodies directed against this polypeptide or against a fragment or a variant thereof have previously been immobilized. According to another aspect, a recombinant polypeptide according to the present invention can be purified by passage in an appropriate series of chromatography columns., according to methods known to persons skilled in the art and described for example in F. Ausubel et al. (Ausubel et al., 1989. Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience. , NY). A polypeptide according to the present invention can also be prepared by conventional chemical synthesis techniques either in homogeneous solution or in solid phase. By way of illustration, a polypeptide according to the present invention can be prepared through the technique either in homogeneous solution described by Houben Weyl (Houben Weyl, 1974. In: Meuthode der Organischen Chemie [In: Organic Chemistry Method], E. Wunsch Ed., 15-1: 15: 11) or the solid-phase synthesis technique described by Merrifield (Merrifield RB, 1965a.Nature, 207 (996): 522-523, Merrifield RB, 1965b. 150 (693): 178-185). An "amino acid equivalent" according to the present invention will be understood as meaning, for example, a replacement of a residue in an L form by a residue in the D form or the replacement of a glutamic acid (E) with a pyro-glutamic acid in accordance with techniques well known to persons skilled in the art. By way of illustration, the synthesis of peptide containing at least one residue in the D form is described by Koch (Koch Y., 1977. Biochem. Biophys. Res. Commun., 74: 488-491). According to another aspect, two amino acids belonging to the same class, that is, two polar, non-polar, basic or uncharged acid amino acids are also considered equivalent amino acids. Polypeptides comprising at least one non-peptide bond, for example a retro-inverso bond (NCO), a carba bond (CHCH2) or a ketomeethylene bond (CO-CH2) also forms part of the invention. Preferably, the polypeptides according to the present invention comprising one or more additions, deletions, substitutions of at least one amino acid will retain their ability to be recognized by antibodies directed against unmodified polypeptides. ANTIBODIES The RGS18 polypeptides according to the present invention can be used for the preparation of an antibody, in particular for the detection of the production of a normal or altered form of a RGS18 polypeptide in a patient. Thus, the present invention also relates to antibodies directed against a RGS18 polypeptide. In a specific embodiment, an antibody according to the present invention is directed against 1) a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 7, 8 or 20, 2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20 or d) 86-166 of SEQ ID NO: 20, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the polypeptide or variant fragment comprises amino acids a) 1- 58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, or 4) a polypeptide known as a "homologue" of a polypeptide comprising a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20. The present invention relates to an antibody directed against a polypeptide of RGS18, in accordance with the produced in the trioma technique or in the hybridoma technique described by Kozbor et al. (Kozbor et al., 1983. Hybridoma, 2 (1): 7-16). An anticorrup directed against a polypeptide known as I "homolog" of a polypeptide according to the present invention also forms part of the invention. Said antibody is directed against a homologous polypeptide comprising an amino acid sequence having one or more substitutions of an amino acid for an equivalent amino acid, relative to a polypeptide according to the invention, wherein the polypeptide according to the present invention comprises a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20 or e) amino acids 86-166 of SEQ ID NO: 20. The term "antibody" for the purposes of the present invention will be understood as referring in particular to polyclonal or monoclonal antibodies or fragments (e.g., F (ab) fragments). '2 and Fab) or any polypeptide comprising an initial antibody domain that recognizes the target polypeptide or polypeptide fragment according to the invention. Monoclonal antibodies can be prepared from hybridomas in accordance with the technique described by Kohier and Milstein (Kohier G. and Milstein C, 1975. Nature, 256: 495- 497). In accordance with the invention, a polypeptide produced recombinantly or by chemical synthesis, and fragments or other derivatives or analogs thereof, including proteins I of fusion can be used as an immunogen to create antibodies that recognize a polypeptide according to the present invention. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain antibodies, Fab fragments, and Fab expression library. The anti-RGS18 antibodies of the present invention can be cross-reactive, for example, they can recognize a RGS18 polypeptide of different species. Polyclonal antibodies have a greater chance of cross-reactivity. Alternatively, an antibody of the present invention may be specific for a unique form of RGS18. Preferably, said antibody is specific for human RGS18. Various methods known in the art may be employed] for the production of polyclonal antibodies to a RGS18 polypeptide or derivative or analogue thereof. For antibody production, several host animals can be immunized by injection with a RGS18 polypeptide, or a derivative (eg, fragment or fusion protein) thereof, including, but not limited to, rabbits, mice, rats, sheep, goats, etc. In one modality, the RGS18 polypeptide or fragment thereof can be conjugated to an immunogenic carrier, for example, bbvin serum albumin (BSA) or limpet hemocyanin (KLH). Various adjuvants can be used to increase the immune response according to the host species, including but not limited to these examples, Freund's adjuvant (completed and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants, eg, BCG. { bacille Calmette Guerin) and Corynebacterium parvum. For the preparation of monoclonal antibodies directed towards the RGS18 polypeptide or fragment, analogue, or derivative thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture can be employed. These include, but are not limited to, these examples, the hybridoma technique originally developed by Kohier and Milstein (Kohier G. and Milstein C, 1975. Nature, 256: 495-497), as well as the trioma technique, the hybridoma technique. of human B cells (Kozbor et al., 1983. Immunology Today, 4:72); Cote et al. (Cote et al., 1983. Proc. Nati. Acad. Scí. U.S.A. 80: 2026-2030), and the EBV hybridoma technique to produce human monoclonal antibodies (Colé et al. collaborators, 1985. In: Monoclonal Antibodies and Cancer Therapy [In: Monoclonal Antibodies and Cancer Therapy], Alan R. Liss, Inc. pp. 77-96). In a further embodiment of the present invention, monoclonal antibodies can be produced in animals without germs [International Patent Publication No. WO 89/12690, published on December 28, 1989]. In fact, in accordance with the present invention, the techniques developed for the production of "chimeric antibodies" (Morrison et al, EP 173494; Neuberger et al., 1984. Nature, 312: 604-608; Takeda et al., 1985. Nature 314: 452-454) by splicing genes from a mouse antibody molecule specific for a RGS18 polypeptide together with genes from a human antibody molecule of appropriate biological activity can be employed; such antibodies are within the scope of the present invention. Such human or humanized chimeric antibodies are preferred for use in the therapy of diseases or disorders of humans (described infra), since human or humanized antibodies have a much lower tendency than xenogeneic antibodies to induce an immune response, in particular an allergic response, themselves. In accordance with the present invention, techniques described for the production of single chain antibodies [Patents US Nos. 5,476,786 and 5,132,405 to Houston, US Patent No. 4,946,778] may be adapted to produce single chain antibodies specific for RGS18 polypeptides. A further embodiment of the present invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., 1989. Science 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for a RGS18 polypeptide, or its derivatives, or analogues. Antibody fragments that contain the idiotype of the antibody molecule can be generated by known techniques. For example, such fragments include, but are not limited to: the fragment of F (ab ') 2 which can be produced by digestion with pepsin of the antibody molecule; Fab 'fragments that can be generated by reducing the disulfide bridges of the F (ab') 2 fragment, and Fab fragments that can be generated by treating the antibody molecule with papain and with a reducing agent. In the production of antibodies the screening for the desired antibody can be achieved by known techniques, for example radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitin, immunodiffusion assays, in situ immunoassays (using colloidal gold labels, enzyme or radioisotopes, for example), Western blots, precipitation reactions, agglutination assays (for example, gel agglutination assay, hemagglutination), complement fixation assays, immunofluorescence assays, protein A assays, as well as immunoelectrophoresis assays, etc. In one embodiment, an antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting the binding of the secondary antibody or reagent with the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art to detect a link in an immunoassay and such means are within the scope of the present invention. For example, to select antibodies that recognize a specific epitope of a RGS18 polypeptide, hybridomas generated for a product that binds to a RGS18 polypeptide fragment containing said epitope can be tested. For the selection of an antibody specific for a RGS18 polypeptide from a particular species of animal, it can be selected based on a positive linkage with a RGS18 polypeptide expressed by cells of this animal species or isolated from cells of said animal. species of animal. The aforementioned antibodies can be used in methods known in the art with regard to the localization and activity of a RGS18 polypeptide, for example, for Western Blot polypeptide analysis RGS18 itself, measurement of its levels in appropriate physiological samples, etc. , using any detection technique mentioned above or known. In a specific embodiment, antibodies that agonize or antagonize the activity of a RGS18 polypeptide can also be generated. Such antibodies can be tested using the assays described infra to identify ligands. The present invention relates to an antibody directed against a polypeptide comprising an amino acid sequence of 1) of any of SEQ ID NOs: 7, 8, 12 or 20; 2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86- 166 of SEQ ID NO: 20, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the polypeptide or variant fragment comprises amino acids a) 1 -58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20 or 5) a polypeptide known as a "homolog" of a polypeptide comprising an amino acid sequence of a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20 , or e) amino acids 86-166 of SEQ ID NO: 20, in accordance with that produced in the trioma technique or the hybridoma technique described by Kozbor et al. (Kozbor et al., 1983. Hybridoma, 2 (1): 7-16) is also part of the invention. The invention also relates to single chain Fv antibody fragments (ScFv) in accordance with that described in US Patent No. 4,946,778 or by Martineau et al. (1998). The antibodies according to the present invention also comprise fragments of antibodies obtained with the help of phage libraries (Martineau P. Jones P. Winter G, 1988. J. Mol Biol, 280 (1): 117-127) or humanized antibodies. (Reimann KA et al., 1997. AIDS Res Hum Retroviruses, 13 (11): 933-943, Leger OJ, et al., 1997. Hum Antibodies, 8 (1): 3-16). Antibody preparations according to the present invention are useful in screening tests immunological tests contemplated for the identification of the presence and / or quantity of antigens present in a sample. An antibody according to the present invention may further comprise a detectable label that is isotopic or non-isotopic, for example, fluorescent, or may be coupled to a molecule, biotin, in accordance with techniques well known to experts in the matter. Thus, another object of the present invention is a method for detecting the presence of a polypeptide according to the present invention in a sample, said method comprising the steps of: a) putting the sample to be tested in contact with an antibody directed against ) a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 7, 8, 12 or 20, 2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the polypeptide fragment or variant comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO : 20, or 4) a polypeptide known as a "homologue" of a polypeptide comprising an amino acid sequence of a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20, and b) detect the antigen / antibody complex formed. The invention also relates to a kit or kit for diagnosing or detecting the presence of a polypeptide according to the present invention in a sample, said kit comprising: a) an antibody directed against 1) a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 7, 8, 12 or 20, 2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, 3) a fragment of polypeptide or variant of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the polypeptide or variant fragment comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO : 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, or 4) a polypeptide known as a "homologue" of a polypeptide comprising a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20, and b) a reagent that allows detection of the antigen / antibody complex formed. PHARMACEUTICAL COMPOSITIONS AND THERAPEUTIC METHODS OF TREATMENT The invention also relates to a pharmaceutical composition comprising a nucleic acid according to the invention. The invention also provides pharmaceutical compositions comprising a nucleic acid encoding a RGS18 polypeptide according to the present invention and pharmaceutical compositions comprising a polypeptide of RGS18 according to the invention contemplated for the treatment of a condition or disorder associated with a dysfunction of Platelet activation The present invention also relates to a novel therapeutic approach for the treatment of a condition or disorder associated with a dysfunction of platelet activation, comprising the transfer and in vivo expression of nucleic acids encoding a RGS18 protein according to the invention. . Specifically, the present invention offers a novel therapeutic approach for the treatment and / or prevention of a condition or disorder associated with a dysfunction of platelet activation. Thus, the present invention offers a new approach for the treatment and prevention of a condition or disorder associated with a dysfunction of platelet activation. Specifically, the present invention offers methods for restoring or promoting improved platelet activation in a patient or subject. The object of the present invention is, furthermore, a pharmaceutical composition contemplated for the prevention or treatment of a condition or disorder associated with a dysfunction of platelet activation, characterized in that the composition comprises a therapeutically effective amount of the normal RGS18 polypeptide. , in particular, a polypeptide comprising an amino acid sequence of a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20. In a preferred embodiment, the RGS18 polypeptide comprises an amino acid sequence of SEQ ID NO: 20. The invention also relates to the use of the RGS18 polypeptide having an amino acid sequence of (a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86 -202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20 for the preparation of a contemplated drug for the prevention of a condition or disorder associated with a dysfunction of platelet activation. The invention relates to a pharmaceutical composition for the prevention or treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation, comprising an effective therapeutic amount of the polypeptide having an amino acid sequence of a) any of SEQ ID NOs: 12 0 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20 or amino acids 86-166 of SEQ ID NO: 20. In accordance with another aspect of the present invention, the object of the present invention is also a therapeutic method of prevention or cure for treating a condition or disorder associated with dysfunction of the platelet activation, wherein said method comprises a step in which a patient is administered a therapeutically effective amount of the RGS18 polypeptide in said patient, said polypeptide being, if appropriate, combined with one or more physiologically compatible vehicles and / or containers. Preferably, a pharmaceutical composition comprising a polypeptide according to the present invention will be administered to the patient. Thus, the invention also relates to pharmaceutical compositions contemplated for the prevention or treatment of a condition or disorder associated with a dysfunction of platelet activation, characterized in that they comprise a therapeutically effective amount of a polynucleotide capable of causing the production of an amount effective of a normal RGS18 polypeptide, in particular of a polypeptide having an amino acid sequence of a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-50 SEQ ID NO: 12, c) amino acids 1 -166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20. The object of the present invention is also pharmaceutical compositions contemplated for the prevention or treatment of a condition or disorder associated with a dysfunction of platelet activity, which is characterized because they comprise a therapeutically effective amount of a normal RGS18 polypeptide, in particular, of a polypeptide having an amino acid sequence of a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20. Such pharmaceutical compositions will be suitable preferably for the administration, for example, parenterally, of an amount of the RGS18 polypeptide within a range of 1 μg / kg / day to 10 mg / kg / day, preferably at le0.01 mg / kg / day day and more preferably between 0.01 and 1 mg / kg / day. The invention also provides pharmaceutical compositions comprising a nucleic acid encoding a RGS18 polypeptide according to the present invention and pharmaceutical compositions comprising a RGS18 polypeptide according to the present invention contemplated for treatment in the prevention of a condition or disorder associated with dysfunction of platelet activation such as for example arterial thrombosis, myocardial infarction, coronary artery disease, stroke, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism, as well as its use in invasive cardiac procedures for anticoagulants. The present invention also relates to a new therapeutic approach for the treatment of a condition or disorder associated with dysfunction of platelet activity comprising the transfer and in vivo expression of nucleic acids encoding a RGS18 protein according to the invention. Specifically, the present invention offers a novel therapeutic approach for the treatment and / or prevention of a condition or disorder associated with a dysfunction of platelet activation, such as for example arterial thrombosis, myocardial infarction, coronary artery disease, stroke, vascular brain disease, unstable angina, deep vein thrombosis, systemic thromboembolism as well as its use in invasive cardiac procedures for anticoagulant purposes. Thus, the present invention offers a new approach for the treatment and prevention of an associated condition or disease linked to abnormalities of platelet activation. Specifically, the present invention offers methods for increasing, reducing or inhibiting platelet activation in a patient or subject. Accordingly, the invention also relates to a pharmaceutical composition contemplated for the prevention or treatment of subjects affected by a disorder or condition that is related to an activity dysfunction. platelet, comprising a nucleic acid encoding the RGS18 protein, in combination with one or more physiologically compatible carriers and / or excipients. In accordance with a specific embodiment of the invention, a composition is provided for the in vivo production of the RGS18 protein. This composition comprises a nucleic acid encoding the RGS18 polypeptide under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and / or container. Accordingly, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20, wherein the nucleic acid is placed under the control of the appropriate regulatory elements. The present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86- 202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20, wherein the nucleic acid is placed under the control of appropriate regulatory elements. Preferably, said composition comprises a nucleic acid comprising a polynucleotide sequence of SEQ ID NOs: 18 or SEQ ID NO: 19, under the control of appropriate regulatory elements. As preferably, said composition comprises a nucleic acid comprising a nucleotide polynucleotide sequence 163-870 of SEQ ID NO: 19, wherein the nucleic acid is placed under the control of appropriate regulatory elements. According to another aspect, the object of the present invention is also a preventive or curative therapeutic method for treating a condition or disorder associated with a dysfunction of platelet activation, wherein said method comprises a step in which a patient is administered, a nucleic acid encoding a RGS18 polypeptide according to the invention in said patient, said nucleic acid, if appropriate, is combined with one or more physiologically compatible carriers or excipients. The invention also relates to a pharmaceutical composition contemplated for the prevention and / or treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation, comprising a recombinant vector according to the invention, in combination with one or several physiologically combated excipient vehicles. According to a specific embodiment, a method for introducing a nucleic acid according to the present invention, in a host cell, in particular in a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the present invention, placed under the control of appropriate regulatory sequences, is induced by local injection at the selected tissue level, such as a smooth muscle tissue, the "naked" nucleic acid is absorbed by the cells of that tissue. The invention also relates to the use of a nucleic acid according to the present invention, which encodes the RGS18 protein for the manufacture of a drug contemplated for the prevention or treatment of subjects affected by a condition or disorder associated with a dysfunction of the platelet function or more particularly for the treatment of subjects affected by a condition or disorder associated with a dysfunction of platelet activation. The invention also relates to the use of a recombinant vector according to the present invention, comprising a nucleic acid encoding the RGS18 protein for the preparation of a drug contemplated for the prevention or more particularly the treatment of subjects affected by a disorder or condition associated with a dysfunction of platelet activity-As indicated above, the present invention also relates to the use of a defective recombinant virus of according to the present invention for the preparation of a pharmaceutical composition for the treatment and / or prevention of a condition or disorder associated with a dysfunction of platelet activation. The invention relates to the use of said defective recombinant virus for the preparation of a pharmaceutical composition contemplated for the treatment and / or prevention of a condition or disorder associated with a dysfunction of platelet activation. Thus, the present invention also relates to a pharmaceutical composition comprising one or more defective recombinant viruses according to the invention. The present invention also relates to the use of genetically modified cells ex vivo with a virus according to the present invention, or to the production of such cells as viruses, implanted in the body, allowing prolonged and effective in vivo expression of a biologically active RGS18 protein. The present invention shows that it is possible to incorporate a nucleic acid encoding a RGS18 polypeptide into a viral vector, and that these vectors make it possible to effectively express a mature, biologically active form. More particularly, the invention shows that the in vivo expression of RGS18 can be obtained by direct administration of an adenovirus or by implantation of a producer or a cell genetically modified by an adenovirus or by a retrovirus incorporating said nucleic acid. Preferably, the pharmaceutical compositions of the present invention comprise a pharmaceutically acceptable carrier or a physiologically compatible excipient for an injected formulation, in particular for an intravenous injection, as for example in the portal vein of a patient. These can be related in particular to sterile isotonic solutions or dry compositions, in particular freeze-dried, which when added, depending on the case, sterilized water or physiological saline solution allow the preparation of injectable solutions. A direct injection into the patient's portal vein is preferred since it makes it possible to focus the infection at the level of the liver and therefore concentrate the therapeutic effect at the level of this organ. A "pharmaceutically acceptable excipient carrier" includes diluents and fillers that are pharmaceutically acceptable for a method of administration, are sterile, and can be aqueous or oleaginous suspensions formulated employing suitable dispersing or wetting agents and suitable suspending agents. The particular pharmaceutically acceptable carrier and the ratio between active compound and carrier are determined through the chemical properties and solubility of the composition, the mode particular administration, and standard pharmaceutical practice. Any nucleic acid, polypeptide, vector or host cell of the present invention will be introduced preferably in vivo in a pharmaceutically acceptable carrier or excipient. The term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and that typically do not produce an allergy or a similar negative reaction, such as for example gastric problems, dizziness and the like, when administered to a human being. Preferably, as used herein the term pharmaceutically acceptable means approved by a regulatory agency of the federal government or a state government or listed in the North American Pharmacopoeia or another Pharmacopoeia generally recognized for use in animals, and more particularly in humans . The term "excipient" refers to a diluent, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as, for example, peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water or saline solutions or aqueous solutions and aqueous dextrose and glycerol solutions are preferably used as excipients, especially for injectable solutions. Suitable pharmaceutical excipients are described in "Remington Pharmaceutical Sciences" by E.W. Martin. The pharmaceutical compositions according to the present invention can also be administered either orally, rectally, vaginally, parenterally, intravenously, subcutaneously or intradermally. The invention also relates to the use of the RGS18 polypeptide having an amino acid sequence of a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 66-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20 for the manufacture of a drug contemplated for prevention, or more particularly for the treatment of a patient or subject affected by a condition or disorder associated with activation of platelet activation. The invention ultimately relates to a pharmaceutical composition for the prevention or treatment of a patient or a subject affected by a condition or disorder associated with a platelet activation dysfunction comprising a therapeutically effective amount of a polypeptide having a sequence of amino acids of a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO: 20, combined with one or more vehicles and / or compatible excipients. According to another aspect, the object of the present invention is also a preventive or curative therapeutic method for treating a condition or a disorder associated with a dysfunction of platelet activation, wherein said method comprises a step in which it is administered to a patient. or subject a nucleic acid encoding a RGS18 polypeptide in said patient, said nucleic acid, if appropriate, is combined with one or more physiologically compatible vehicles and / or excipients. According to another aspect, the object of the present invention is also a preventive or curative therapeutic method for treating a disorder or condition that is associated with a dysfunction of platelet activation, wherein said method comprises a step in which a patient or a subject a therapeutically effective amount of a RGS18 peptide according to the invention in said patient or subject, said polypeptide, if appropriate, is combined with one or more physiologically compatible carriers and / or excipients. The invention relates to a pharmaceutical composition for the prevention or treatment of a patient or subject affected by a dysfunction of platelet activation, which comprises a therapeutically effective amount of a polypeptide having an amino acid sequence of any of SEQ ID NOs: 12 or 20, or a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20 or d) 86-166 of SEQ ID NO: 20, combined with one or more vehicles and / or physiologically compatible excipients. According to a specific embodiment, a group for introducing a nucleic acid according to the present invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, under the control of appropriate regulatory sequences, is induced by local injection at the level of the selected tissue such as, for example, a smooth muscle tissue, the "naked" nucleic acid "It is absorbed by the cells of this tissue. According to another aspect, the object of the present invention is also a preventive or curative therapeutic method for treating a disorder or a condition that is associated with a dysfunction of platelet activation, wherein said method comprises a step in which it is administered a patient a therapeutically effective amount of a RGS polypeptide according to the invention in said patient, said polypeptide if appropriate is combined with one or more vehicles and / or physiologically compatible excipients. Preferably, a pharmaceutical composition comprising a RGS18 polypeptide in accordance. with the present invention it is administered to the patient. Thus, the invention also relates to pharmaceutical compositions contemplated for the prevention or treatment of a disorder or condition that is associated with a dysfunction of platelet activation, which is characterized in that they comprise a therapeutically effective amount of a nucleic acid encoding a protein. RGS18 polypeptide, in particular a RGS18 polypeptide having an amino acid sequence of any SEQ ID NOs: 12 or 20. In a specific embodiment, the RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, b 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20 or d) 86-166 of SEQ ID NO: 20. The object of the present invention is, furthermore, pharmaceutical compositions contemplated for the prevention or treatment of a disorder or condition that is related to a dysfunction of platelet activity, which are characterized in that they comprise a therapeutically effective amount of a RGS18 polypeptide, in particular of a polypeptide comprising an amino acid sequence of any of SEQ ID NOs: 12 or 20. in a specific, the RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NOs: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86- 166 of SEQ ID NO: 20. In another embodiment the nucleic acids, polypeptides, recombinant vectors and compositions according to the invention can be delivered in a vesicle, in particular a liposome (see Langer, 1990. Science, 249: 1527-1533; Treat et al., 1989. In: Liposomes in the Therapy of Infectious Disease and Cancer [In: Liposomes in the Therapy of Infectious Diseases and Cancer], Lopez-Berestein and Fidler (eds.), Liss: New York, pages 353-365; Lopez-Berestein, 1989. In: Liposomes in the Therapy of Infectious Disease and Cancer [In: Liposomes in the Therapy of Infectious Diseases and Cancer], Lopez-Berestein and Fidler (eds.), Liss: New York, pages 317- 327). In another embodiment, the nucleic acids, polypeptides, recombinant vectors, recombinant cells and compositions according to the invention can be administered in a controlled release system. For example, the polypeptide can be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one mode, a pump can be used (Langer, 1990. Science, 249: 1527-1533, Sefton, 1987. CRC Crit Ref, Biomed Eng 14: 201, Buchwald et al. 1980. Surgery 88: 507; Saudek et al., 1989 N. Engl. J. Med. 321: 574). In another modality, polymeric materials can be employed (Langer and Wise (eds.), 1974. In: Medical Applications of Controlled Relay [In: Controlled Release Medical Applications], CRC Press: Boca Raton, Florida; Smolen and Ball (eds. .), 1984. Controlled Drug Bioavailability, Drug Product Design and Performance, Pharmaceutical Product Design and Performance, Wiley: New York, Ranger and Peppas, 1983. J. Macromol, Sci. Rev. Macromol, Chem. 23:61, Levy et al., 1985. Science 228: 190, During et al., 1989. Ann Neurol 25: 351, Howard et al., 1989. J. Neurosurg 71: 105). In another embodiment, a controlled release system can be placed in the vicinity of the target tissue or organ, i.e., the cardiovascular system, thus requiring only a fraction of the systemic dose (see Goodson, 1984. In: Controlled Drug Bioavailability, Drug Product Design and Performance [In: Controlled Pharmacological Bioavailability, Design and Performance of Pharmaceutical Products], Smolen and Ball (eds.), Wiley: New York, vol. 2, pages 115-138). Other controlled release systems that can be used are discussed in the review by Langer (Langer, 1990.
Science, 249: 1527-1533). In a further aspect, recombinant cells that have been Transformed with nucleic acid according to the present invention and expressing high levels of a RGS18 polypeptide according to the present invention can be transplanted into a subject in need of RGS18 polypeptide. Preferably, autologous cells transformed with a nucleic acid encoding RGS18 according to the present invention are transplanted to avoid rejection; alternatively, a technology is available to protect non-autologous cells that produce soluble factors within a polymeric matrix that prevents recognition and rejection by the immune system. Thus, the RGS18 polypeptide can be administered by intravenous, intra-arterial, intraperitoneal, intramuscular or subcutaneous administration. Alternatively, the appropriately formulated RGS18 polypeptide can be administered by nasal or oral administration. A constant supply of RGS18 can be ensured by providing a therapeutically effective dose (i.e., an effective dose to induce metabolic changes in a subject) at necessary intervals, eg, daily, every 12 hours, etc. These parameters will depend on the severity of the condition treated, or transactions such as diet modification, which are implemented, the weight, age and sex of the patient, and other criteria that can be easily determined according to standard good medical practice. part of the subject matter experts. A subject in which the administration of nucleic acids, polypeptides, recombinant vectors, recombinant host cells and compositions according to the present invention is carried out is preferably a human, but can be any animal. Thus, as can be readily observed by a person of ordinary skill in the art, the methods and pharmaceutical compositions of the present invention are particularly suitable for administration to any animal, particularly a mammal, and including, but not limited to, these. examples, domestic animals, such as felines or canines, farm animals, such as cattle, horses, goats, sheep and pigs, but without being limited to these examples, wild animals (either in the wild or in a zoological garden) animals of research such as mice, rats, rabbits, goats, sheep, pigs, dogs, cats, etc., species of birds such as chickens, turkeys, songbirds, etc., that is, for veterinary use. Preferably a pharmaceutical composition comprising a nucleic acid, a recombinant vector, a polypeptide, or a recombinant host cell according to that defined above, will be administered to a patient or subject. Methods for screening an agonist or antagonist compound for the RGS18 polypeptide.
The invention also relates to methods for the activation of activators or inhibitors of the RGS18 protein and polypeptides comprising the RGS18 domain. The invention also provides methods for screening small molecules and compounds that act on the RGS18 protein to identify RGS18 polypeptide agonists and antagonists that can increase, reduce or inhibit platelet activation from a therapeutic perspective. These methods are useful for identifying small molecules and compounds for therapeutic use in the treatment of a disease or condition associated with a dysfunction of platelet activation. According to another aspect, the invention also relates to various methods for screening compounds or small molecules for therapeutic use that are useful in the treatment of a disorder or a condition that is associated with a dysfunction of platelet activation such as for example thrombosis. arterial, myocardial infarction, coronary artery disease, stroke, cerebrovascular disease, unstable angina, deep vein thrombosis, systemic thromboembolism, as well as its use in invasive cardiac procedures for anticoagulant purposes. Accordingly, the invention also relates to the use of a RGS18 polypeptide or a cell expressing a RGS18 polypeptide according to the invention, for sift active ingredients for the prevention or treatment of a disorder or condition that is associated with a dysfunction of platelet activation. The catalysts and immunogenic or oligopeptide fragments of a RGS18 polypeptide can serve to screen product libraries through a wide range of existing techniques. The polypeptide fragment used in this type of screening may be free in solution, bound in a solid support, on the surface of a cell or in the cell. The formation of the binding complexes between the polypeptide fragments of RGS18 and the tested agent can then be measured. Another product screening technique that can be employed in high-flux screening giving access to products that have affinity for the protein of interest is described in the application WO84 / 03564. in this method, applied to a RGS18 protein, several products are synthesized on a solid surface, these products react with the RGS18 protein or fragment thereof and the complex is washed. The products that bind to the RGS18 protein are then detected by methods known to persons skilled in the art. Non-neutralizing antibodies can also be used to capture a peptide and immobilize it on a support. Another possibility is to carry out a screening method of product using a neutralizing antibody competition for RGS18, a RGS18 protein and a product that potentially binds with the RGS18 protein. In this way, antibodies can be used to detect the presence of a peptide having a common antigenic unit with a RGS18 polypeptide or a protein. Accordingly, this invention relates to the use of any method for screening products, ie, compounds, small molecules and the like, of synthetic or cellular type, ie, of mammals, insects, bacteria or yeasts that constitutively express or where a nucleic acid coding for RGS18 of human being is incorporated. The present invention also relates to the use of such a system for screening molecules that modulate the activity of the RGS18 protein. thus, the invention relates to methods for screening and identifying a modulator, agonist or antagonist of a RGS18 polypeptide in a sample. The present invention relates to methods for identifying an agonist or antagonist modulator of a RGS18 polypeptide in a sample comprising: a) incubating a GTP-loaded G protein polypeptide labeled with a RGS18 polypeptide with the sample; b) measure the speed or magnitude of GTP hydrolysis; c) compare the speed or magnitude of the hydrolysis of GTP determined in step b) with a rate or magnitude of GTP hydrolysis according to that measured by a reconstituted mixture of G-protein polypeptide loaded with labeled GTP / RGS18 polypeptide that has not been previously incubated in the presence of the sample. In a specific embodiment, the GTP loaded GTP-tagged polypeptide of step a) is loaded with? -32P-GTP and the rate or magnitude of GTP hydrolysis of step b) is measured by the determination of free 32PX released. In another specific embodiment, the RGS18 polypeptide comprises an amino acid sequence that is selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20. In particular, the invention relates to a method for identifying a modulator, agonist or antagonist of a RGS18 polypeptide in a sample, wherein the method comprises: a) charging a purified G protein polypeptide with? -32P-GTP; b) of the G protein polypeptide loaded with? -32P-GTP from step a) with a purified RGS18 polypeptide and a candidate modulator, agonist or antagonist compound for the RGS18 polypeptide; c) measuring the rate or magnitude of GTP hydrolysis by determining the amount of free 32Pi released; d) comparing the rate or magnitude of GTP hydrolysis determined in step c) with a rate or magnitude of GTP hydrolysis measured in a reconstituted mixture of G protein polypeptide loaded with? 32P-GTP / purified RGS18 polypeptide which has not previously incubated in the presence of the candidate agonist or antagonist modulator compound for the RGS18 polypeptide. The reconstitution of the purified RGS18 polypeptide with purified G protein polypeptide within the methods of the present invention can be carried out in accordance with any technique, particularly in accordance with the technique described by Berman et al. (Berman, et al., 1996. Cell 86 : 445-452). In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID Nos: 12 or 20. In a second specific embodiment, the RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20. A RGS18 modulator compound identified by the methods of the present invention can reduce or increase the rate or magnitude of GTP hydrolysis by a RGS18 polypeptide according to the invention. The present invention relates to methods for identifying a RGS18 polypeptide modulator, agonist or antagonist in a sample, comprising: a) incubating a cell membrane fraction expressing a RGS18 polypeptide with labeled GTP and the sample; b) the measurement of the speed and magnitude of GTP hydrolysis; c) comparing the speed or magnitude of the GTP hydrolysis determined in step b), with a rate or magnitude of GTP hydrolysis measured with a cell membrane fraction expressing a RGS18 polypeptide that has not been previously incubated in the presence of the sample. In a specific embodiment, the cell membrane fraction is obtained from a cell which, either naturally or after transfection of the cell with a nucleic acid encoding RGS18, expresses a RGS18 polypeptide, and isolates the membrane from the cell.
In another specific embodiment, labeled GTP from step a) is labeled with? 32P and the rate or magnitude of the GTP hydrolysis of step b) is measured by determining the amount 32P? released. In another specific embodiment, the RGS18 polypeptide comprises an amino acid sequence selected within the range consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ. ID NO: 20, amino acids 86-202 of SEQ ID NO: 20 and amino acids 86-166 of SEQ ID NO: 20. The present invention also relates to a method for identifying a modulator, agonist, antagonist of a RGS18 polypeptide in a sample, wherein the method comprises: a) obtaining a cell, such as, for example, a cell line, which either naturally or after transfection of the cell with a nucleic acid encoding RGS18, expressing a RGS18 polypeptide and isolating the membrane of the cell; b) incubating the cell membrane of step a) with? 32 P-GTP and a candidate modulator agonist or antagonist compound for the RGS18 polypeptide; c) measuring the rate or magnitude of GTP hydrolysis by determining the amount of 32Pi released; Y d) comparing the rate or magnitude of GTP hydrolysis determined in step c) with the rate or magnitude of GTP hydrolysis measured with a cell membrane that has not been previously incubated in the presence of the candidate agonist or antagonist modulator compound for the polypeptide of RGS18. The cell membrane fractions within the methods of the present invention can be prepared according to any technique, particularly in accordance with the technique described by Denecke et al. (Denecke et al., 1999, J. Biol. Chem. 274: 26860- 26868). In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NOs: 12 or 20. In a second specific embodiment, the RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1- 166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20. A RGS18 modulator compound identified by the methods of the present invention can reduce ( inhibitor or increase) (activator) the rate or magnitude of GTP hydrolysis by a RGS18 polypeptide in accordance with the present invention. The present invention also relates to a method for identifying a modulator, agonist or antagonist of a RGS18 polypeptide wherein the method comprises determination of the effects of the agonist or antagonist modulator on the downstream effects of effector molecules of the RGS18 polypeptide. Accordingly, the present invention relates to methods for identifying an agonist or antagonist modulator of a RGS18 polypeptide in a sample, comprising: a) information of a cell expressing a RGS18 polypeptide with a labeled adenine and the sample; b) measure the amount of labeled cyclic AMP (cAMP) produced; c) comparing the amount of labeled cAMP measured in step b) with an amount of labeled cAMP measured with a cell expressing a RGS18 polypeptide that has not been previously incubated in the presence of the sample. In a specific embodiment, the cell expressing the RGS18 polypeptide is transfected with a nucleic acid encoding RGS18. In another specific embodiment, the labeled adenine of step a) is 3 H-adenine. In another specification, the RGS18 polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20.
In particular, the present invention relates to a method for identifying a modulator, agonist or antagonist of a RGS18 polypeptide, wherein the method comprises: a) obtaining a cell such as, for example, a cell line, which, either naturally or well after transfection of the cell with a nucleic acid encoding RGS18 expressing the RGS18 polypeptide, b) incubating a cell from step a) with 3 H-adenine and a candidate modulator compound for the RGS18 polypeptide; c) measuring the amount of radiolabeled cyclic AMP (cAMP) that is produced; and d) comparing the amount of radioactively labeled cAMP measured in step c) with an amount of radioactively labeled cAMP measured with a cell that has not been previously incubated in the presence of the candidate modulator, agonist or antagonist compound for the RGS18 polypeptide. The amount of radioactively labeled cAMP can be determined in accordance with any particular technique, in accordance with the technique described by Huang et al. (Huang et al., 1997. Proc.Nat.Acid.Sci.94: 6159-6163). In a first specific embodiment, the RGS18 polypeptide comprises any of SEQ ID NO: 12 or 20.
In a second specific embodiment the RGS18 polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20 or ) 86-166 of SEQ ID NO: 20. A RGS18 modulator compound identified by the methods of the present invention can reduce or increase the amount of cAMP produced by a RGS18 polypeptide according to the invention. The present invention also relates to methods for identifying a modulator, agonist or antagonist of a RGS18 polypeptide in a sample, comprising a) incubating a cell expressing a RGS18 polypeptide with a labeled inositol and the sample; b) measuring the amount of labeled inositol triphosphate produced; c) comparing the amount of labeled inositol triphosphate that was measured in step b) with an amount of labeled inositol triphosphate that was measured with the cell expressing a RGS18 polypeptide that has not been previously incubated in the presence of the sample.
In a specific embodiment, the cell expressing the RGS18 polypeptide is transfected with a nucleic acid encoding RGS18. In another specific embodiment, the labeled inositol of step a) is 3 H-inositol.
In another specific embodiment, the RGS18 polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of 5 SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20. In particular, the present invention also relates to a method for identifying a modulator, agonist or antagonist of a RGS18 polypeptide in a sample, wherein the method comprises a) obtaining a cell such as for example a cell line which, either naturally or after transfection ^ ft of the cell with a nucleic acid encoding RGS18, expressing a RGS18 polypeptide, 15 b) incubating the cell from step a) with 3 H-inositol and a candidate modulator compound for the RGS18 polypeptide; c) measuring the amount of radiolabeled inositol triphosphate that is produced; and 20 d) comparing the amount of radiolabeled inositol triphosphate that was measured in step c) with the amount of radiolabeled inositol triphosphate that was measured with a cell that has not been previously incubated in the presence of the modulator compound, agonist or antagonist candidate for RGS18 polypeptide. The amount of radiolabeled inositol triphosphate can be determined in accordance with any technique, particularly with the technique described by Huang et al. (Huang et al., 1997. Proc Nati Acad Sci 94: 6159-6163). In a first specific embodiment, the polypeptide of RGS18 with any of SEQ ID NO: 12 or 20. In a second specific embodiment, the polypeptide of RGS18 comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1- 166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86- 166 of SEQ ID NO: 20. A RGS18 modulator compound identified by the methods of the present invention can reduce or increasing the amount of inositol triphosphate that is produced by a RGS18 polypeptide in accordance with the present invention. According to a first aspect of the screening methods mentioned above, the cells used are cells that naturally express a polypeptide of RGS18. They can be human platelets in primary culture, purified from a population of human blood mononuclear cells. They can also be human megakaryocytic cell lines, such as HEL cells, Meg-01 cells and Dami cells.
According to a second aspect, the cells used in the sieving methods described above can be cells that do not naturally express, or alternatively express at a low level, a polypeptide of RGS18, said cells being transfected with a recombinant vector in accordance with the present invention capable of directing the expression of a nucleic acid encoding a RGS18 polypeptide. In accordance with a third aspect of the methods of In the above-mentioned screening, the RGS18 polypeptide can be a recombinant RGS18 polypeptide. The present invention will be better understood by reference to the following (I) non-limiting examples that are offered as exemplary of the invention. 15 Examples In an effort to better understand the modulation of platelet-mediated GPCR signaling, the applicants sought to identify regulators of G protein signaling proteins (RGSs) that are present in human platelets. 20 and several megakaryocytic cell lines. Using degenerate oligonucleotides based on the conserved regions in the highly homologous RGS domain, an RT-PCR was performed using RNA, from human platelets, as well as RNA from several megakaryocytic cell lines. 25 In addition, to confirm the presence of several transcripts known from RGS, a transcript containing the novel RGS domain was found in platelet RNA. A Northern blot analysis of multiple human tissues indicates that this novel transcript is expressed more abundantly in platelets compared to other tissues examined. This RGS transcript is abundantly expressed in platelets, with significantly less expression in other tissues, primarily the tissues of the hematopoietic system. This transcript is expressed modestly in three lines of megakaryocyte cells and tissues of hematopoietic origin such as leukocytes, bone marrow and spleen with low level of expression detected in other tissues as well. A complete cloning of this novel RGS that has been called RGS18 demonstrates that this transcript encodes a protein of 235 amino acids. RGS18 is more closely related to RGS5 (identity of 46%) and has an identity of approximately 30-40% with other RGS proteins. Antisera directed against RGS18 detect the expression of a protein of approximately 30kDa in lysates of cell lines of megakaryocytes, leukocytes and platelets. In vi tro, RGS18 binds to Gai2, G "i3, and endogenous Gaq, Gaz, Gas or Gaí2 of platelet lysates treated with GDP + A1F4." Since platelet aggregation requires the activation of a Gaq coupled receptor and / or one or several forms of Gai, RGS18 may be partly responsible for the regulation of roads important for platelet activation. Reagents contained in Sigma (St. Louis, MO) Unless otherwise indicated, reagents for the expression and purification of GST fusion protein including pGEX-5X-1 and glutathione-Sepharose 4B were obtained from Amersham / Pharmacia (Piscataway , NJ). Oligonucleotides and peptides were produced by Core Biotechnologies Department at Rhone-Poulenc Rorer. Double-stranded cDNA from human leukocytes and human bone marrow was obtained from Clontech (Palo Alto CA). Marathon cDNA of human peripheral blood and bone marrow leukocytes and the RACE polymerase chain reaction kit for 5 'were from Clontech (Palo Alto, CA) all reagents for cell culture were obtained from Gibco / BRL (Rockville, MD). Reagents for Western Blot including goat anti-rabbit IgG coupled to HRP were purchased from BioRad (Hercules, CA). SuperSignal Pico Reagent was acquired at Pierce (Rockford, IL). A cocktail of complete EDTA-free protease inhibitors was from Roche Biochemicals (Indianapolis, IN). The cell lines were obtained from ATCC (Manassas, VA). Example 1: Amplification by RT-PCR and cloning of nucleic acids encoding an RGS domain Preparation of platelets, leukocytes and cell lines: HEL cells and Meg-01 cells were maintained in RPMI supplemented with 10% fetal bovine serum, 0.3 mg / ml (L-glutamine and 10 U / ml of penicillin G / 100 mg / ml of streptomycin sulfate.) Dami cells were cultured in Dulbecco's medium modified by Iscove supplemented with serum of horse 10% thermally inactivated, 0.3 mg / ml L-glutamine and 100 U / ml penicillin G / 100 mg / ml streptomycin sulfate Human platelets were obtained from Interstate Blood Bank (Memphis, TN) in concentrated form and were used the day after collection (day 2). If necessary for functional studies, fresh platelets were extracted from donors who offered their consent using 0.38% citrate as an anticoagulant. In both cases, the platelets were rotated at 120 X g for 15 minutes to form pellets of red blood cells and recover platelet-rich plasma (PRP). Prostaglandin Ei (0.5 mg / ml) was added to the PRP to prevent activation, and the platelets were formed into pellets at 800 X g for 15 minutes, the platelet pellets were washed once in Tyrodes buffer (137 mm NaCl, 2.7 mM KCl, 1 mM MgCl2 6H20, 5.5 mM glucose, 11.9 mM NaHC03, 0.36 mM NaH2P04H20, 10 mM HEPES pH, 7.35) plus 0.35% human serum albumin (HSA; this was reduced to 1% HSA in the case of protein lysates to reduce the excess protein of albumin) plus 0.25 mg / ml of prostaglandin Ei. The platelets were formed into pellets at 800 X g and resuspended in the appropriate buffer (Trizol for RNA, Lysis buffer for protein lysates). White blood cells were obtained fresh from donors who offered their consent and isolated during the preparation of platelets. In summary, after the removal of PRP from platelet isolation, the coating that is the white cell plate that forms an interface between the platelet-rich plasma and the red blood cells formed in pellets was removed and taken to 15 ml with plasma. platelet poor and diluted 1: 1 with PBS. Fifteen more of this was carefully placed in layers on 15 ml of Hypaque. This was rotated at 400 X g for 30 minutes at room temperature. A band containing the human leukocytes was isolated diluted 1: 1 in PBS and rotated at 400 X g for 10 minutes to isolate the cells. The cell pellet was then resuspended in the appropriate lysis buffer (Trizol or protein lysis buffer). Cloning strategy by RT-PCR. Four degenerate oligonucleotides were synthesized which had previously been used to isolate RGS transcript and are designed in regions of high homology flanking the RGS domain of several members of the RGS superfamily (Koelle MR and Horvitz HR (1996) Cell 84: 115 -25). These four oligonucleotides given in IUB codes are RGS1: GRIGARAAYHTIGARTTYTGG (SEQ ID NO: ID # 1), RGS2: GRIGARAAYHTIMGITTYTGG (SEQ ID NO: ID NO.2), RGS3: GRTAIGARTYITTYTYCAT (SEQ ID NO: ID NO.3), and RGS4: GRTARCTRTYITTYTYCAT ( SEQ ID NO: ID NO.49) Total RNA was prepared from human platelets HEL cells, Dami cells and MEG-01 cells, using Trizol Reagent (Gibco / BRL, Rockville, MD) according to the manufacturer's instructions. Human platelets obtained from platelet concentrate from day 2 (Interstate Blood Bank, Memphis, T?) Were prepared according to the aforementioned, formed into pellets and used in 5 ml of Trizol reagent. Platelet counts varied in the cell pellet but typically the values were between 0.9-5xl010 platelets and AR yield? total was between 25 and 100 mg. AD? C single chain was prepared by reverse transcription of the AR? total using Superscript II (Gibco / BRL, Rockville, MD), 2-5 mg of AR? total and 160 mg random hexamer (Roche Biochemicals, Indianapolis, I?) following the manufacturer's instructions. A polymerase chain reaction was carried out using 1/8 of the AD? C reaction, typically 5 μl in a 50 μl reaction volume containing 300 ng of each of the oligonucleotides RGS1, RGS2, RGS3, and RGS4, 400 mM d? TPs, 1 X polymerase chain reaction buffer with 1.5 mM MgCl2 and 1 μl Taq Polymerase (Gibco / BRL). In some studies, 1 μl of Human peripheral blood leukocyte cDNA from human bone marrow was used for amplification. The amplification was performed in a PCRSprint thermocycler (Hybaid, Franklin, MA) with the following cycle conditions: 94 ° C for 2 minutes in one cycle, 94 ° C for 30 seconds, 42 ° C for 1 minute, 72 ° C for 2 minutes for 35 cycles followed by an extension at a temperature of 72 ° C for 7 minutes. In order to increase the yield of colonies, a second round of amplification was carried out using 1-5 μl of the initial polymerase chain reaction product. Reaction products (approximately 230 base pairs) were separated by agarose gel electrophoresis and purified using the Qiaquick gel extraction kit (Qiagen, Chatsworth, CA). The resulting purified polymerase chain reactions were sub-cloned into pCR2.1 using the TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into INVaF cells. Individual colonies were replicated in fresh dishes and numbered by reference and cultured for DNA purification. Automated purification of plasmids and sequencing were carried out in all colonies (50 colonies when two rounds of amplification were carried out, 25 each) using universal primers complementary to the sequence of cloning vectors (forward primer M13, SEQ ID NO: 37 and reverse primer M13 SEQ ID NO: 38). An analysis The sequence was carried out using an automated sequencing system (ABI). The identity of each polymerase chain reaction product was determined by comparing sequence data with the known RGS data using Seqman and Megalign programs from the programmatic Lasergene and BESTFIT, GAT and PILEUP of the GCG program. Results of RT-PCR of RGSs from human platelets and megakaryocytic cell lines. A strategy of Reverse Transcription Polymerase Chain Reaction (RT-PCR) was used to identify members of RGS families expressed in human platelets and several megakaryocytic cell lines. Degenerate primers were designed and synthesized based on highly homologous regions in several of the previously identified RGS proteins (Koelle M.R. and Horvitz H.R. (1996) Cell 84: 115-25). These primers were used to amplify the total RNA of human platelets (Plt), and three megakaryocytic cell lines, DAMI, HEL and MEG-01 cells. Amplification of the RNA from all four tissues resulted in a band of approximately 240 base pairs that was purified and sub-cloned into pCR2.1 and transformed into competent Escherichia coli. Fifty colonies of each polymerase chain reaction were selected, cultured and plasmid was isolated from each of them and sequenced. The analysis of the sequence data The results obtained are compared with known RGS proteins and the results are presented in Table 1. The amplification product that predominates mainly in the three megakaryocytic cell lines is RGS16, an RGS identified first in the mouse retina (Chen C, Zheng B., Han J., Lin SC (1997) J. Biol. Chem. 272: 8679-85) but also present in lymphocytes and many other tissues (Buckbinder L, Velasco-Miguel S., Chen Y., Xu N. , Talbott R., Gelbert L., Gao J., Seizinger BR, Gutkind JS, Kley N. (1997) Proc. Nati, Acad. Sci. USA 94: 7868-72, Snow BE, Antonio L., Suggs S. , Siderovski DP (1998) Gene 206: 247-53). In contrast to the cell lines, however, the most predominant polymerase chain reaction product (SEQ ID NO: 11) from the platelet RNA encodes a novel partial RGS domain (SEQ ID NO: 212 encoded by nucleotides 1-241 of SEQ ID NO: 11), which is not present in the public domain databases. A single colony of the 50 colonies examined in DAMI cells also encoded this novel RGS domain. This novel partial RGS domain comprises amino acids 1 to 81 of SEQ ID NO: 12 and is shown in Figure 1, slightly smaller due to position of degenerate oligonucleotide probes. This novel RGS domain displays a homology of 30 to 46% with the known RGSs, with the highest degree of homology with RGS5. In addition platelets contain transcript for RGS10, and MEG-01 cells contain RGS4. It is therefore not surprising that all tested tissues contain RGS2 expressed ubiquitously. Table 1. Identification of RGS isoforms by degenerated RT-PCR of total RNA from human platelets and three megakaryocytic cell lines. Plt DAMI HEL MEG RNA RNA RNA RNA RGS2 3 1 1 3 RGS10 1 RGS16 4 33 37 20 RGS4 3 RGS18 new 17 1 Vector /? 12/2 4/4 7/2 14/0 ND 11 7 3 10 The degenerate oligonucleotide primers designed against conserved regions of the RGS domain were used to amplify RNA from human platelets, DAMI, HEL and MEG-01 cells. compliance with what is described above. The amplification products were ligated in the extreme plane with pCR2.1 and transformed into competent Escherichia coli. Fifty colonies were selected and the plasmid DNA was isolated and subjected to sequence analysis. The resulting sequence data from each colony were compared to the coding regions of RGSs known and tabulated. In some cases, the plasmid was bound again with it which resulted in the absence of insert, these are indicated as "vector". Plasmids that contain inserts but apparently do not have homology with a known gene are marked with "?" and they are probably artifacts of the polymerase chain reaction. Sequencing reactions that resulted in low quality data (numerous unknown nucleotides) are indicated as "ND" which means not determined. EXAMPLE 2: Cloning of full length of RGS18 cRNA.l polymerase chain reaction product was purchased with the Incyte proprietary database of LIFESEQ from ESTs. Only one correspondence was found. This EST came from a human thyroid library and the 5 'end of EST was virtually identical to the last 72 base pairs of our clone. This EST clone was purchased from Incyte, cultured and analyzed to determine if these two transcripts were actually related. A complete sequence analysis using forward M13 primers and M13 reverse primers (SEQ ID NOs: 37 and 38, respectively) confirmed the presence of the 72 base pair splice and gave us the sequence information for the carboxy terminal portion of the protein and a 3 'untranslated region of 1274 base pairs. The full-length sequence information was obtained using 5 'RACE. Mhon cDNA from human bone marrow and peripheral blood leukocytes (Clontech, Palo Alto, CA) was used for the 5 'RACE strategy. 5 'Race was carried out with the antisense primer [5'-cgctagggccttagactccttgcttcttcc-3', SEQ ID NO: 5] from the 3 'untranslated region, using Mhon Ready cDNAs coupled to Advantage cDN polymerase (Clontech , Palo Alto, CA) following the manufacturer's instructions for 5 'RACE. The reaction products from the RACE procedure were sub-cloned into pCR2.1 and transformed into Escherichia coli competent for INVaF "and 20 colonies were analyzed by restriction analysis and sequencing using sequencing primers nRGSll-nRGS19 (SEQ ID NOs: 30 -36, respectively) and M13 Direct Primers and M13 Reversals (SEQ ID NOs: 37 and 38, respectively) Table 2 describes the sequencing primers nRGSll-nRGS19 used to determine the nucleic acid sequence of the 5 'RACE clones and the location of these primers within SEQ ID NO: 19, a cDNA encoding the full-length RGS18 polypeptide Table 2. Sequencing primers specific for RGS18, 5 'RACE SEQUENCE SEQUENCE (5' "3 ') SEQ ID LOCATION IN NO: SEQ ID NO: nRGSll CTACTATGTATATGTATGGAATAG_30_77-100 nRGS12 GAATTTTGGATAGCCTGTGAAG 31 502-523 3322 805-828 nRGS13 CGATCACGCTCATTTACCTGCAAT nRGS14 CTGAAATATGTCATGTGAAATTAT 3333 964-987 34 918-938 nRGS18 nRGS17 CATAAACATGCGATATGTTAG TGGGGCATCAGTCTGTATAAA 35 586-606 36 228-248 Resul nRGS19 CCTGAACCATGTATTAACTTG sults of the complete Cloning RG 'S Novel Platelet. In order to identify the full length sequence of this partial clone, electronic searches of EST databases were made. No identical results were found in EST databases in the public domain. The novel polymerase chain reaction product was also compared to the proprietary Incyte LIFESEQ database of ESTs. Only one result was found, an EST (SEQ ID NO: 6) from a human thyroid library.
Nucleotides 1-59 of SEQ ID NO: 6 display a complete identity with nucleotides 170-228 of SEQ ID NO: 11, and nucleotides 60-72 of SEQ ID NO: 6 display a partial identity with nucleotides 229-241 of SEQ ID NO: 11. Since the library was primed with Oligo (dT), it is likely that this EST contains the carboxy terminal region of the 3 'untranslated domain of the novel RGS18 transcript. This clone was acquired in Incyte and analyzed by restriction analysis and sequencing. The Incyte clone contains a cDNA insert of 1486 base pairs (SEQ ID NO: 6) having an identity with the novel polymerase chain reaction product (nucleotides 170-228 of SEQ ID NO: 11) at the 5 'end (nucleotides 1-59 of SEQ ID NO: 6) and a segment of poly (A) + residues at the 3 'end (nucleotides 1471-1486 of SEQ ID.
NO 6) . When translated, this EST comprises a partial open reading frame (nucleotides 3-209 of SEQ ID NO: 6) that encodes a 69 amino acid polypeptide (SEQ ID NO: 13). The partial open reading frame of this EST is contiguous with the open reading frame of the novel polymerase chain reaction product (SEQ ID NO: 11), wherein amino acids 1-23 of SEQ ID NO: 13 are identical to amino acids 59-81 of SEQ ID NO: 12, except for amino acid 20 of SEQ ID NO: 13 (amino acid 78 of SEQ ID NO: 12). Based on homology with other known RGS domain-containing proteins that extend beyond the splicing of 72 base pairs of EST and nucleic acid polymerase chain reaction products supports the fact that EST represents the 3 'end of the product Polymerase chain reaction reaction of novel RGS18. To further confirm that these two cDNAs in fact come from the same transcript, an RT-PCR analysis of platelet RNA was performed with a sense primer (5'-ATAGCCTGTGAAGATTTCAAG-3 '; SEQ ID NO: 14) designed against sequence information by of 5 'from our platelet polymerase chain reaction product and three antisense primers (5'-TGGCAACATCTGATTGTACAT-3 ', SEQ ID NO: 15; 5' -AAGTTTGTCATAAAAATGAGC-3 ', SEQ ID NO: 16; and 5'-TTAACATAAACATGCGATATG-3 ', SEQ ID NO: 17) selected at three different sites within the Incyte EST beyond the splice region with the initial polymerase chain reaction clone. The polymerase chain reaction products of the expected size were obtained from each of these reactions confirming that the novel polymerase chain reaction clone and the Incyte EST cDNA are in fact part of a contiguous transcript in the platelet RNA (data not shown). Using the sequence information from the 3 'untranslated region of the Incyte clone (SEQ ID NO: 6), 5' RACE was performed to isolate the entire coding region from the novel RGS18. Since platelets do not contain abundant levels of high quality RNA, human bone marrow cDNA and peripheral blood leukocytes were used specifically designed for 5 'RACE. Preliminary Northern blot data demonstrated that the novel RGS18 transcript is present at low levels in both tissues. A primer (SEQ ID NO: 5) was designed within the far 3 'untranslated region, the location of this primer is shown through the sequence information underlined in Figure 1, panel B. 5' RACE was performed using the kit A.dvantage polymerase chain reaction in accordance with the manufacturer's instructions with this 3 'untranslated region primer (SEQ ID NO: 5) and bone marrow and peripheral blood leukocyte cDNA. The 5 'RACE polymerase chain reaction products were sub-cloned in pCR2.1 and analyzed by restriction mapping. The longer inserts (approximately 2 kB) were selected for sequence analysis. A sequence analysis according to the above described determined that these 5 'RACE polymerase chain reaction products contained 1840 nucleotides (SEQ ID NO: 18). The 5 'RACE polymerase chain reaction products contained the entire predicted open reading frame (nucleotides 163-870 of SEQ ID NO: 18) encoding the novel full-length RGS18 polypeptide (SEQ ID NO: 20) and a short segment of the 5 'untranslated region (nucleotides 1-162 of SEQ ID NO: 18). Sequence data were compiled from the 5 'RACE clone (SEQ ID NO: 18), the Incyte EST cDNA (SEQ ID NO: 6) and the initial polymerase chain reaction clone (SEQ ID NO: 11) and assembled, and a scheme of the relative positions of each of these cloning clones are shown in Figure 1, panel A. Figure 1, panel B shows the nucleotide sequence of this compiled nucleic acid (SEQ ID NO: 19) and the predicted amino acid sequence of the novel whole-length RGS18 polypeptide encoding (SEQ ID NO: twenty) . Nucleotides 163-870 of SEQ ID NO: 19 represent the entire length open reading frame encoding the full-length RGS18 polypeptide (SEQ ID NO: 20). The RGS18 cDNA (SEQ ID NO: 19) is 2144 base pairs in length and encodes a 235 amino acid protein (SEQ ID NO: 20). The theoretical plot of this protein is 7.73 with a molecular weight of 27, 582.22 daltons. Screening for the presence of protein sequence motifs, using the Prosite database, confirms that this protein contains an RGS domain (residues 86 to 202 of SEQ ID NO: 20), as well as putative consensus sites for phosphorylation by several protein kinases. Residues 213 to 216 of SEQ ID NO: 20 form a consensus site for CGMP and Camp-dependent protein kinase phosphorylation (shown underlined in Figure 1, panel B). Four potential sites for protein kinase C phosphorylation and five potential sites for casein kinase II (ck) phosphorylation are present. { SEQ ID NO: 20) residues 28-30, 33-35, 63-65 and 92-94 for pkc and SEQ ID NO: 20 residues 28-31, 33-36, 76-79, 92-95 and 220-223 for ck II). The amino acids 221-224 SEQ ID NO: 20 at the carboxy terminus of the protein encode a putative CAAX motif that can act as a modification site by fatty acylation and serves to regulate the activity of RGS18. EXAMPLE 3: Tissue Distribution of Nucleic Acids of RGS18 and Polypeptides Total RNA Isolation and Northern Blot Analysis: The preparation of total RNA from human platelets, white blood cells, HEL cells, Dami cells and Meg-01 cells was carried out in accordance with what was described above. A Northern Blot of multiple human tissue was purchased from Clontech (Palo Alto, CA). From Northern blot of human platelets, human leukocytes and megakaryocytic cell lines, 10 mg of total RNA were treated in 1.5% agarose gel / 5.8% formaldehyde in 1 X MOPS buffer (20 mM 3-N morpholinopropanesulfonic acid , pH 7.0, 5 mM sodium acetate, 1 mM EDTA). The RNA was transferred in 20 X SSC (0.3 mM NaCl, 0.3 mM sodium citrate) to a nylon membrane using the Turboblotter System (Schleicher and Schull, Keene, NH) and UV-cross-linked to the membrane using a Stratalinker ( Stratagene, La Jolla, CA). A Northern blot of multiple tissues with one mg of poly (A +) RN? of each of 12 different tissues was purchased at Clontech (Palo Alto, CA). These blots were pre-hybridized in 10 ml of ExpressHyb solution (Clontech, Palo Alto, CA) at a temperature of 68 ° C for 1 hour. For each blot, approximately 25 ng of the 1486 base pair EST Incyte clone (SEQ ID NO: 6) encoding the 3 'end of the coding region and the 3' untranslated region was radiolabelled with 32P- [dCTP ] and the High Prime Kit (Roche Biochemicals, Indianapolis, IN) and purified on a S-200 micro-rotation column (Amersham / Pharmacia, Piscataway, NJ). Two batches of labeled probes were mixed and added to 20 ml ExpressHyb. Each blot was hybridized with 10 ml of this probe mixture for 2 hours at a temperature of 68 ° C. This process ensured that the blots were each hybridized with probes from the same specific activities and this would facilitate the comparison of the results. The blots were washed for 40 minutes in 2 X SSC / 0.05% SDS at room temperature followed by a wash with high stringency conditions in 0.1X SSC / 0.1% SDS at 50 ° C for 40 minutes and exposed to a Kodak film. BioMax MR at a temperature of -70 ° C. After removal of the probe with 0.5% SDS at a temperature of 100 ° C, the blots were normalized using a labeled β-actin probe (Clontech, Palo Alto, CA); catalog # SOI30) and was carried out in accordance with the above. Production of Polyclonal Antisera, Western Blot Analysis, and Cellular Lysate Preparation: Two peptides were selected to make polyclonal antisera, KLIHGSGEETSKEAKIR (SEQ ID NO: 7) from the amino terminal portion of RGS18 and QRPTNLRRRSRSFTCNEFQ (SEQ ID NO: 8) ), from the carboxy terminal region. These peptides were synthesized locally, by Core Biotechnologies Department and conjugated with Lapa hemocyanin (KLH) for injection in rabbits. Customary polyclonal antisera were produced from the peptides conjugated by Rockiand Immunochemicals (Gilbertsville, PA) according to standard procedures. The specificity of the antisera was characterized using platelet lysates and recombinant RGS18 produced by in vitro coupled transcription / translation (TNT reticulolysed system, Promega, Madison, Wl). Typically, the anti serum was used in Western blot analysis in dilutions 1: 500 (3NRGS-12) or 1: 1,000 (5NRGS-13) in 5% fat-free dehydrated milk in TBST (20 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.05% Tween-20). To ensure that the immuno reactivity observed was specific for RGS18, peptide inhibition studies were carried out. For peptide inhibition studies, anti serum was incubated in 100 mM Tris, pH 7.5 plus IX cocktail of EDTA-free Complete ™ mini protease inhibitor (Roche Biochemicals, catalog # 183-6170) in the absence or presence of 100 mg / ml of the immunizing peptide or an unrelated peptide for 2 hours or overnight at a temperature of 4 ° C. This was then diluted to the working concentration (1: 500 or 1: 100) in blocking buffer (dehydrated milk without 5% fat in TBST) and incubated with the nitrocellulose strips for 1 hour at room temperature (RT) and revealed in accordance with what is described above. Whole cell lysates for Western blot analyzes were made from platelets, leukocytes and the three megakaryocytic cell lines by lysate cells in 50 mM HEPES, pH 8.0, 6 mM MgCl2, 300-mM NaCl, 1 mM DTT, Triton X -100 to 1%, and IX cocktail of EDTA-free Complete ™ mino protease inhibitor (Roche Biochemicals, catalog # 183-6170). The cells were used on ice, rotated for 10 minutes at 13,000 X g at a temperature of 4 ° C to form pellets of insoluble material, and the overhangs were transferred to fresh tubes. Protein determinations were carried out using a Bradford assay using BSA to generate the standard curve. Fifty micrograms of each lysate were placed in 15% reducing SDS-PAGE, transferred to 0.2 mM nitrocellulose and absorbed in accordance with the aforementioned. For detection of RGS10 in cell lysates, an SDS-PAGE was carried out in accordance with that indicated above and the resulting nitrocellulose strips were blocked in 2% BSA-TBST and incubated with 1: 500 dilutions of anti-RGS10 antibody ( Santa Cruz BioTechnology, Santa Cruz, CA) in blocking buffer at room temperature for 2 hours or overnight at a temperature of 4 ° C. The bound antibody was detected with mouse anticabra IgG coupled to horseradish peroxidase (HRP, Pierce, Rockford, IL) and Supersignal West Pico ECL reagent (Pierce, Rockford, IL).
Results of Tissue Distribution of Nucleic Acids of RGS 18 and Polypeptides in Human Tissues. In order to determine the relative tissue distribution of RGS18, two Northern blots were hybridized with a 3 'untranslated region probe (SEQ ID NO: 6) from RGS18. The first blot contained 10 mg / lane of total RNA from human platelets, human leukocytes, DAMI cells, HEL cells and MEG-01 cells. The second blot was a commercially available Human Multiple Tissue Northern (Clontech, Palo Alto, CA) containing 1 ug of Ply (A) + -mRNA from 12 human tissues, a lane containing RNA from polymorphonuclear leukocytes. In order to ensure a fair comparison, the label probe was divided in half and used to study both blots simultaneously. The RGS18 probe hybridizes with a species greater than ~ 2.75 Kb and with a species smaller than ~ 4.2 Kb in platelet RNA and to a lesser extent in DAMI, HEL, and MEG-01 cells (Figure 3, panel A). Human leukocyte RNA also expresses both transcripts at levels equal to or slightly lower than that of MEG-01 cells. Since a complete comparison of platelets and leukocytes is difficult, when expression levels of transcripts in platelet RNA are evaluated, the level of contamination of platelet RNA by the more abundant leukocyte RNA should be taken into account. The fact that leukocytes have such a low level of expression of RGS18 Compared with platelet RNA it indicates that this is not an important issue for this transcript. Accordingly, platelets express significantly greater amounts of message for RGS18 compared to leukocytes, with intermediate levels expressed in megakaryocytic cell lines. Results of the Human Multiple Tissue Northern Blot are shown in Figure 3, panel B. Overall, the hybridization signal was much lower than what was observed with the Northern blot of platelets above and required much longer exposures. For example, when both blots were hybridized with the same probe and the same specific activity, platelet Northern blotting required only 6 hours of self-radiographic exposure versus the 6 days required for the Human Multiple Tissue Northern. In the Multiple Tissue blot, the most intense band was consistently in the leukocyte lane, followed by spleen, then heart and liver, and very low levels in skeletal muscle, colon, kidney, small intestine, placenta and lung. Hybridization of a multiple tissue Northern containing RNA from other human tissues demonstrated moderate levels of expression in RGS18 in human bone marrow also, levels comparable to the levels observed in the spleen (data not shown). These Northern blots were repeated at least twice in fresh blots for ensure that the results were consistent. Using these data for comparison of RGS18 expression levels, it seems that the level of expression of this message in platelets greatly exceeds the level of expression in leukocytes, which express RGS18 in excess of the other tissues examined. To support this conclusion, we used leukocyte and bone marrow cDNA in the degenerated RT-PCR strategy to obtain RGS transcripts, as was done in the case of platelets and none of the colonies sequenced contained RGS18. As can be predicted from previous studies, the most abundant products of leukocyte and bone marrow amplification in these studies were hRGS2 and hRGS16 (data not shown). Results of Western Blot Analysis of Expression of RGS18 in Human Platelets. Polyclonal anti-RGS18 antisera were generated against two peptides, one at the amino terminal (SEQ ID NO: 7) and the second at the carboxy terminal (SEQ ID NO: 8) of RGS18. The location and sequences of these peptides are shown in the regions in tables of Figure 2. These regions were selected due to their divergence from similar regions of the other known RGSs. The resulting sera were tested in Western blot with platelet lysates for reactivity and specificity. Previous studies show that these polyclonal antibodies also react with RGS18 recombinant synthesized by coupled transcription / translation (data not shown). Antibodies directed against carboxy terminal peptides and amino terminal peptides reacted with a ~ 30 kDa band in platelet lysates. Preincubation of each anti serum with its corresponding immunizing peptide but not with other peptides ablates the reactivity of the antibody with the 30 kDa protein, which indicates that each antibody is in fact specific for RGS18 (Figure 4, Panel A). Anti-sera 5NGRS-13 (directed against an amino-terminal peptide comprising SEQ ID NO: 7) has a higher titer than anti-serum 3NRGS-12 (directed against a carboxy-terminal peptide comprising SEQ ID NO: 8) and was used for additional evaluation of protein expression levels. A Western analysis was performed on lysates prepared from platelets, leukocytes and DAMI cells, HEL and MEG-01 to compare the relative levels of protein expression of RGS18. Figure 4, Panel B shows the results of a representative experiment using anti serum against the amino terminal peptide, 5NRGS-13. Consistent with Northern expression data, the RGS18 protein is significantly more abundant in platelets than in leukocytes, DAMI cells, HEL cells, or MEG-01 cells. Even when an immuno-reactive band in the MEG-01 lane is not visible in Figure 4, Panel B, major exposures duration effectively demonstrate the expression of RGS18 in these cells. Northern expression data suggest that the expression levels of RGS18 in MEG-01 cells may be similar to leukocytes, however, this was not observed in the Western blot analysis. This may be due to the presence of contaminating platelets in the leukocyte preparation, which could lead to an over estimation of the expression of RGS18 in leukocytes. In fact, Western blots using an antibody against a platelet-specific protein a2b (GPIIb, CD41) demonstrate reactivity with leukocyte lysates, indicating the presence of certain contaminating platelets in the leukocyte preparation (data not shown). Since the presence of hGRSIO was detected by RT-PCR and an hRGS10 antibody was available, the expression levels of hRGS10 were examined by Western blot analysis. A Western blot analysis of lysates of platelets, leukocytes and megakaryocytic cell lines was carried out in accordance with that described above, using this anti-hRGS10 antibody, indicated that hRGS10 is expressed in an almost equivalent manner in platelets, leukocytes and DAMI cells, with levels of lower expression in the other two megakaryocytic cell lines (Figure 4, Panel B). It has also been reported that hRGS10 is expressed in the brain (Gold S.J., Ni Y.G., Dohlman H.G., Nestler E.J. (1997) J. Neurosci. 17: 8024-37). Together, these data indicate that hRGSld and hRGS10 are both expressed in platelets, and that hRGSld but not hRGS10 is expressed preferentially in platelets as compared to leukocytes. Based on Northern analysis data, the expression of hRGSld in other human tissues is predicted to be equal to or less than that observed in leukocytes, suggesting that hRGSld probably has a limited tissue distribution, with preferential platelet expression. EXAMPLE 4: Expression and Purification of GST Fusion Proteins. In order to create a GST fusion protein in frame using the Bam Hl and Xho I sites of the pGEXZ-5X-1 plasmid, oligonucleotides were synthesized from the 5 'and 3' end coding regions with a Bam Hl site in box in the 5 'primer and an Xho I site after the stop codon in the 3' primer. These oligonucleotides, sense (5'-gttcggatccgagagaagatggaaacaacattgcttttc-3 '; SEQ ID NO: 9) and antisense (5'-gtgctcgagttaacataaacatgcgatatg-3'; SEQ ID NO: 10), were used in RT-PCR to amplify platelet RNA . The resulting polymerase chain reaction amplification product was fully sequenced for fidelity of the polymerase chain reaction, sub-cloned into pGEX-5X-1 and transformed into BL-21 (DE3) (Novagen, San Diego, CA). The expression and purification of the resulting fusion protein was carried out in accordance with that described in the manufacturer's instructions. Essentially, an overnight culture was diluted 1: 100 in Luria Broth containing 100 mg / ml of ampicillin (typically 500 ml to 1 liter) and cultured, shaking at 30 ° C until it reached an OD60o = 0.6. The culture was then induced with 0.5 mM IPTG for 2 hours at a temperature of 30 ° C. Cells were formed into pellets, washed once in cold PBS and resuspended in PBS containing 100 mg / ml lysozyme (ICN, Costa Mesa, CA), 50 mg / ml DNase (Gibco / BRL, Rockville, MD) and IX EDTA-free Complete ™ mini protease inhibitor cocktail (Roche Biochemicals, catalog # 183-6170). The suspended cells were sonicated on ice and Triton X-100 was added at a final concentration of 1%. The cell lysate was mixed for 30 minutes at a temperature of 4 ° C followed by centrifugation at 12,000 X g for 10 minutes at a temperature of 4 ° C. The swelling envelope was transferred to a fresh tube and 2 ml of 50% washed glutathione-Sepharose 4B was added and incubated at 4 ° C for 1 hour. The matrix was then washed in batches 5-8 times in PBS at ice temperature and resuspended in a 50% paste in 50 mM HEPES, pH7.4, 150 mM NaCl, 5 mM DTT, 10% glycerol and inhibitors of protease and aliquots were formed that were stored frozen at a temperature of -70 ° C. Before its use, the matrix was melted, washed 2-3 times in PBS or in buffer lysis and resuspended in a 50% paste. If necessary, an elution of GST-RGS18 was effected by loading the fusion protein bound to Sepharose 4 B in a column and eluting with 20 mM reduced glutathione in 100 mM Tris pH 8.0, 120 mM NaCl. EXAMPLE 5 Alpha Protein Subunit Linkage Assay G. Determination of the G protein alpha subunit binding specificity of RGS18 was carried out in accordance with that described in Beadling et al. (164), with minor modifications. Platelets washed from the Day 2 concentrate were used in 50 mM HEPES, pH 8.0, 300 mM NaCl, 1 mM DTT, 6 mM MgCi2, 1% Triton X-100, and IX mini protease inhibitor cocktail EDTA-free Complete ™ (Roche Biochemicals, catalog # 183-6170). Protein determination was performed using a Bradford assay (BioRad, Hercules, CA) using BSA as standard and lysates were adjusted to a mg / ml lysis buffer before use. The cell lysates (450 ml) were activated with 30 mM of GDP or 30 mM of GDP plus 30 mM of A1C13 and 100-mM of NaF for 30 minutes at a temperature of 30 ° C. After incubation, the lysates were subjected to rapid rotation in a micro centrifuge to form actin pellets that became insoluble upon the activation of the platelet lysates. Lysates were transferred to tubes fresh and incubated with 20 ml of a 50% paste of GST-RGSld coupled to beads of glutathione-Sepharose 4B (typically ~ 10 mg of RGSld protein) for 1 hour at a temperature of 4 ° C. The beads were washed twice in 1 ml of wash buffer (50 mM and HEPES, pH dO, 300 mM NaCl, 1 DTT, 6 mM MgClz, 0.025% Ci2E10, and IX mini protease inhibitor cocktail). EDTA-free Complete ™ (Roche Biochemicals, catalog # 163-6170). The bound protein was eluted in two rounds of boiling in Laemmli reducing buffer (50 mM Tris-HCL pH 6.8, 1% SDS, bromophenol blue 0.008%, glycerol 5%) and subjected to SDS-PAGE in 12% gels, transferred to 0.45 mM nitrocellulose and absorbed with anti serum against a / 2 (Calbiochem, San Diego, CA), Gaio (Calbiochem, San Diego, CA), Gaz (Santa Cruz BioTechnology, Santa Cruz, CA), Gc ^ n (Santa Cruz BioTechnology, Santa Cruz, CA), Ga? 2 (Santa Cruz BioTechnology, Santa Cruz, CA) or Gas (Calbiochem, San Diego, CA and Santa Cruz BioTechnology, Santa Cruz, CA). The bound antibody was detected using HRP of goat anti rabbit (BioRad, Hercules CA) and Supersignal West Pico ECL reagent (Pierce, Rockford, IL) Results of Linkage Analysis of RGS18 with Alpha Subunits of Endogenous Protein G in Human Platelets With the In order to determine the white alpha subunits of RGSld, link experiments were performed using GST- RGSld in accordance with that prepared in Example 4 and human platelet lysates. A similar method has been used to determine the binding specificity of? 1RGSI6 using Jurkat cell lysates (Beadling, c, Druey, KM, Richter, G., Kerh; JH, and Smith, KA (1999) J. Immunol. 162, 2677-2662). Previous work has shown that the RGS proteins studied to date bind with G protein alpha subunits only when the alpha subunit is in its transition state or "activated state" (Dohlman HG, Thorner J. (1997) RGS proteins and signaling by heterotrimeric G proteins [RGS proteins and heterotrimeric G protein signaling], J. Biol. Chem. 272: 3871-4). For these experiments, platelets were used in a buffer containing Triton X-100 and resuspended at 1 mg / ml. The lysate was then treated with GDP, which contains the alpha subunit in the "deactivated" state, bound to GDP or to GDP + A1F4 ~ which mimics the transition state of the Ga subunit. Recombinant GST-RGS18 bound to beads of Sepharose-4 was added to the treated lysates, incubated and washed several times. The bound protein was eluted in Laemmli buffer and subjected to SDS-PAGE followed by Western blot analysis. A panel of antibodies specific for G protein alpha subunit was used to determine the alpha subunits that bind to RGSld. Figure 5 shows the results a representative experiment. RGSld binds little if the alpha subunit is in the idle GDP joined state (middle lane of each panel). In contrast, in lysates that have been treated with GDP + A1F4. "RGSld binds a significant amount of alpha subunit detected by antibodies directed against Ga? / 2, Gao / i3 and Gaq / n.This inter action seems to be specific that RGSld does not bind to Gaz, Ga? 2 and Gas. Neither GST nor Sepharose 4B binds to any of these alpha subunits in lysates treated with GDP or lysates with GDP + AIF4"(data not shown). The binding selectivity of RGSld is consistent with that found in the case of other RGS proteins that selectively bind to members of the Gai family and / or Gaq family (Hepler JR (1999) Pharmacol. Sci. 20: 376-82 ). EXAMPLE 6: Comparison of Homology of RGS 18 with other RGS Proteins. The predicted amino acid sequence of RGSld (SEQ ID NO: 20) was compared to the sequence of several other of the most closely related RGS proteins. Figure 2 shows an alignment of RGSld protein from human (SEQ ID NO: 20) with (h) RGS4 of human (SEQ ID NO: 25), and hRGSlO of (SEQ ID NO: 26), which was generated using the Pileup program of GCG. The shaded areas represent the amino acids that are conserved between RGSld and at least two other RGSs. The region of the RGSld domain that was initially isolated by RT-PCR, ie, amino acids 1-777 and 79-81 of SEQ ID NO: 12, corresponding to amino acids 109-165 and 187-189 of SEQ ID NO: 20 are shown through a line above the amino acids in Figure 2. RGSld of human is almost completely homologous with RGS5 (47% identity), followed by rat RGS8 (SEQ ID NO: 27, 44%), hRGS2 (41%) hRGS4 and hRGS16 (40%), hRGSl (37%), hRGS10 and hRGS3 (SEQ ID NO: 2d, 36%) and hRGS13 (SEQ ID NO: 29, 34%). RGSld of being human has an identity between 20 and 30% with other known RGS proteins. A recent phylogenetic analysis of the RGS superfamily indicates the presence of at least six distinct subfamilies (Zheng B., De Vries L., Farquhar M.G. (1999) Trends, Biochem. Sci. 24: 411-4). RGSld is very closely related to members of Family B. RGS proteins in Family B contain characteristic short amino and terminal carboxyl terminal domains (except RGS3) and two conserved amino acids (locations shown through asterisks above the residues in Figure 2). The first is an asparagine residue (ASN) at position 128 in hRGS4 (SEQ ID NO: 21) found in families B, C and D and is conserved in hRGSld (amino acid 152 of SEQ ID NO: 20). Family B is the most divergent of the group and contains only a specific residue for a subfamily. A serine (Ser) is conserved among the known family members RGS [see Sternberg N.L., 1994. Mamm. Genome, 5: 397-404; in hRGS4 (SEQ ID NO: 21)] however, this residue is not conserved in hRGSld (glycine at amino acid 127 of SEQ ID NO: 20). All residues except one in hRGS4 that have been in contact with the Ga subunit (Tesmer JJ, Berman DM, Gilman AG, Sprang SR (1997) Cell 89: 251-61) are conserved between hRGSld and hRGS4 (shown by t in Figure 2). COMMENTS Classically, the G protein signal transduction cascade consists of the integral membrane receptor, the heterotrimeric GTP binding protein and the downstream effector. More recently, the complexity of these signaling pathways has become apparent through the identification of additional signaling molecules that regulate different aspects of these pathways. Several families of molecules have been identified that serve to attenuate receptor-mediated signaling at the receptor and / or G protein level (Bunemann M, Lee KB, Pals-Rylaarsdam R, Roseberry AG, Hosey MM (1999) Annu. Physiol. 61: 169-92). G protein signaling regulators (RGS) are a new family of proteins that were identified in genetic studies of yeast and worms (nematodes) as negative regulators of G protein signaling, and many mammalian homologs have been characterized since then (Hepler JR (1999) Pharmacol. Sci. 20: 376-82). The RGSs they seem to regulate the signaling through the interaction with one or several Ga subunits, stabilizing the transition state of the Ga subunits, thus accelerating GTP hydrolysis (Berman DM, Kozasa T., Gilman AG (1996) J. Biol. Chem. 271: 27209-12). In an effort to better understand GPCR-mediated signaling in human platelets, studies were to examine the isoforms of the RGS family that exist in platelets were made. Applicants here describe the identification of nucleic acids encoding a novel G protein signaling Regulator, RGSld, abundantly expressed in human platelets. Even when platelets are cells that do not have nuclei, they contain small amounts of residual cytoplasmic RNA probably carried from their precursor cell, the megakaryocyte. Several groups have taken advantage of the presence of this residual RNA to carry out a biological molecular identification of platelet proteins (Newman P.J., Gorski J., White G.C. 2d, Gidwitz S., Cretney C.J., Aster R.H. (1988) J. Clin.Invest.82: 739-43). A degenerate RT-PCR analysis is well suited to study the expression of platelet transcripts, due to the minimal RNA requirement of this technique. Using degenerate primers (SEQ ID NOs: 1-4) that were designed based on conserved amino acids from the amino terminal regions and carboxy terminal of the RGS domain, transcribed from RGS expressed in platelet RNA were identified. Surprisingly, most of the amplification products encoded a novel partial RGS domain (amino acids 1-81 of SEQ ID NO: 12 corresponding to amino acids 109-189 of SEQ ID NO: 20, with the exception of amino acid 78 of SEQ ID. NO: 12). The platelets also appear to contain transcripts from other previously known RGS proteins including hRGS2, hRGS16 and hRGS10. In addition, RNA from three megakaryocytic cell lines, DAMI, HEL, and MEGOl cells were analyzed using the same method and in contrast to that found in platelet RNA, the most abundant amplification product in each of these cells was hRGS16. A colony among 50 analyzed in DAMI cells contained a polymerase chain reaction product containing the novel partial RGS domain, indicating that these cells also express the novel RGS. These cells probably differ from platelets in their expression of RGSs due to the fact that they are not differentiated, and leukemic in nature. This is not unexpected since several studies have shown a modulation of RGS expression in several different cell types. The expression levels of hRGS1 and hRGS2 can be regulated by mitogens in lymphocytes (Newton J.S., Deed R.W., Mitchell E.L., Murphy J.J., Norton J.D. (1993 Biochim.
Biophys. Acta. 1216: 314-6, Wu H.K., Heng H.H., Shi X.M., Forsdyke D.R. , Tsui L.C., Mak T.W., Minden M.D., Siderovski D.P. (1995) Leukemia 9: 1291-8), and hRGS16 can be regulated by IJL-1 in lymphocytes (Beadling, c, Druey, KM, Richter, 5G, Kerh; JH, and Smith, KA (1999) J. Immunol., 162, 2677-26d2) and the tumor suppressor, p53 in a colon carcinoma cell line (Buckbinder L, Velasco-Michael S., Chen Y., Xu N., Talbott R., Gelbert L., Gao J., Seizinger BR, Gutkind JS, Kley N. (1997) Proc. Nati, Acad. Sci. USA 10 94: 7668-72). Even though these cell lines have many features of the megakaryocytic lineage (ie, the expression of GPIIb / IIIa and other genes specific for?) Platelets) (Tabilio A., Rosa J.P., Testa U., Kieffer N., Nurden A.T., Del Cañizo M.C., Breton-Gorius J, Vainchenker W. 15 (1984) EMBO J. 3: 453-9; Ogura M., Morishima Y., Ohno R., Kato Y, Hirabayashi N., Nagura H., Saito H. (1995) Blood 66: 1384-92; Greenberg S.M., Rosenthal D.S., Greeley T.A., Tantravahi R., Handin R.I. (1988) Blood 72: 1968-77) and have proven to be useful for the identification of specific genes for 20 platelets, they are not perfect models of platelet signal translation. More importantly, these cells do not appear to have intact signaling pathways that stimulate the binding of soluble fibrinogen on GPIIb / IIIa, indicating that their signal transduction pathways or complement of signaling proteins differ from platelets.
(Boudignon-Proudhon C, Patel P.M., Parise L.V. (1996) Blood 87: 968-76). The most abundant RGS isoform in peripheral blood leukocyte RNA and human bone marrow that was detected by degenerate RT-PCR was hRGS2 (data not illustrated) which further indicates the distinction between platelets and other hematopoietic cells. The fact that each tissue has a different transcript profile is a good indication that the primers were not biased for one isoform of RGS against others, and that the proportional expression that we observed with this method probably reflects relative RNA expression levels. Even though RGSld was not detected in human peripheral blood leukocyte RNA through this degenerate RT-PCR method, it may be that this transcript was in fact not amplified from platelet RNA but from contaminating leukocyte RNA. Since platelets contain such a limited amount of RNA, a small amount of leukocyte contamination could cause a disproportionate contamination of platelet RNA by leukocyte RNA. A Northern blot analysis of human leukocyte and platelet RNAs indicates that this is not the case, since the platelet RNA expresses significantly higher levels of RGSld than leukocytes. Megakaryocytic cell lines express intermediate levels of RGS18 between platelets and leukocytes. The examination of the expression of RGSld by Northern blot analysis in a wide range of human tissues indicates that RGSld appears to be expressed more abundantly in platelets, followed by leukocytes and then other tissues of the hematopoietic system, specifically spleen and bone marrow, as well as heart and liver. A very low level expression can be detected in other tissues as well, including skeletal muscle, colon, kidney, small intestine, placenta and lung, but it remains to be determined whether these levels translate into significant expression of the protein in these tissues. Two transcripts for RGSld, a greater species of 2.75 Kb and a smaller species of 4.2 Kb, are expressed in platelet RNA, as well as in all other tissues examined. The presence of two mRNA species in the Northern blot indicate that this transcript, like many others, undergoes alternative splicing and / or differential polyadenylation. Full-length cloning of RGSld was achieved by combining the sequence information from the initial polymerase chain reaction product (SEQ ID NO: 11) of the RGS domain, an Incyte EST cDNA splice (SEQ ID NO: 6) comprising the 3 'untranslated region and the 5' RACE cDNA. { SEQ ID NO: 18) to obtain the entire coding region and a portion of the 5 'untranslated region of RGS18 (SEQ ID NO: 19). The RGSld cDNA open reading frame (SEQ ID NO: 19) encodes a 235 amino acid protein (SEQ ID NO: 20) with a putative RGS domain (amino acids 86-202 of SEQ ID NO: 20). RGS18 has very short carboxy terminal and amino terminal domains flanking the internal RGS domain and does not appear to contain functional domains for scaffolds (ie, PH, Dbl, GGL or DEP). It has however a putative CAAX motif that can serve as an acylation site and allow membrane anchoring. RGSld also contains several consensus sites for phosphorylation by the protein kinase enzymes dependent on cAMP / cGMP, protein kinase C and casein kinase II. This indicates the regulation potential of RGSld by other signaling cascades. Recently, a phylogenetic analysis of this family has been carried out and has shown that the RGS superfamily can be divided into at least 6 subfamilies (from A to F) (Zheng B., De Vries L., Farquhar M.G. (1999) Trends. Biochem.
Sci. 24: 411-4). RGSld would most likely be a member of a subfamily B, since it is more closely related to these RGSs and as RGSld, members of subfamily B typically contain short terminal amino and terminal carboxy domains. RGSld contains a highly conserved asparagine residue at position 152 of SEQ ID NO: 20 (relative position 128 in hRGS4; SEQ ID NO: 21) which is conserved in three of the six families. Structural studies of RGS4 indicate that this residue is critical for the activity of GAP and the stabilization of the transition state Ga (Tesmer JJ, Berman DM, Gilman AG, Sprang SR (1997) Cell 69: 251-61, Srinivasa SP, Watson N., Overton MC, Blumer, KJ ( 1998) J. Biol. Chem. 273: 1529-1533). Unlike some of the other subfamilies, subfamily B is a diverse group and only one amino acid, a residue Ser (position 103 in hRGS4, SEQ ID NO: 21), is conserved among all members of family B, however , the corresponding residue in RGSld (position 127 of SEQ ID NO: 20) is a glycine, which draws attention to the fact itself RGSld is in fact a member of subfamily B. It is interesting to note, hRGSlO can not be placed in one of the subfamilies due to its divergence from the other known RGSs. Recently, the sequence of a novel RGS that has been called RGS17, isolated from a chicken dorsal root ganglion cDNA library was reported and is distinct from platelet hRGSld (31% amino acid identity), and in fact appears to be a member of a subfamily A (Jordan JD, Carey KD, Stork PJ, Iyengar R. (1999) J. Biol. Chem 274: 21507-21510). If RGSld belongs to the B family it is still an uncertain one, and additional functional and structural characterization is required. Seven of eight human RGSs of the B family appear to be clustered on the chromosome, perhaps due to gene duplication events (Zheng B., De Vries L., Farquhar M.G. (1999) Trends, Biochem.
Sci. 24: 411-4). It will be interesting to determine if RGSld is located on this chromosome. As additional members of the RGS superfamilies are identified, and as more information is gained regarding the functionality of each RGS, the defining characteristics of the various RGS subfamilies will become clearer. Since RNA expression levels do not always reflect protein expression levels, we thought it was important to look for the expression of RGS18 in Western blots using specific antisera. Two antisera directed against peptides were generated against peptides, one located at the amino terminal and one second at the carboxy terminal of RGSld. RGSld migrates in SDS-PAGE with an apparent molecular weight of 30 kDa and is abundantly expressed in platelets and significantly less abundant in leukocytes and in the three megakaryocytic cell lines. This reactivity can be neutralized by pre-incubation of the antisera with the immunizing peptide, demonstrating that the reactivity of this 30 kDa band is specific for RGSld. The presence of RGS18 in commercially prepared lysates (Clontech, Palo Alto, CA) was not detected from the brain, liver or human lung (data not shown). If RGS18 is expressed in all of these tissues, its level of expression is probably too low to be detected with the tools currently available. It is known that platelets express several Ga subunits. Previous work has shown that platelets contain members of the Gai / Gaii family, Gai2 Gaz, Ga? 2i3 / Gai6, Gas and Gaq, but not Ga ?? (Milligan G., Mullaney I., McCallum J.F. (1993) Biochim, Biophys., Acta., 1179: 208-212, Johnson G.J., Leis L.A., Dunlop P.C. (1996) Biochem. J. 318: 1023-31). Since a source of recombinant G protein alpha subunits was not available, the G protein alpha subunit selectivity of RGSld was analyzed using endogenous platelet G proteins. This strategy was used by Beadling and colleagues, using lysates of Jurkat cells and recombinant hRGS16, in order to determine the binding specificity of hRGS16 (Beadling, c, Druey, KM, Richter, G., Kerh, JH, and Smith , KA (1999) J. Immunol. 162, 2677-2662). A GST-labeled fusion protein from RGSld binds Ga subunits, detected by antibodies with Gaü2, Gai3 / o and Gaq ??, in platelet lysates that are activated by treatment with GDF + A1F ~. In the same experiments, RGSld could not interact with Gaz, Gaí2 or Gas. Even though the antisera have certain splicing specificity for the Ga subunits, the platelets contain immunologically undetectable levels of Gau (William AG, Woolkalis MJ, Poncz M., Manning DR, Gerwitz AM, Brass LF (1990) Blood 76: 721- 30), in such a way that most Ga subunits detected by the first antiserum is probably Ga2- Gao has not been reported in platelets, and therefore this antibody is more likely to detect interaction with Gai3. Gan is not expressed on platelets (Milligan G., Mullaney I., McCallum JF (1993) Biochim, Biophys. Acta., 1179: 206-212, Johnson GJ, Leis LA, Dunlop PC (1996) Biochem. J. 318: 1023-31), such that the Gaq / n antibody is detecting the presence of Gaq. Together, these data indicate that RGSld interacts with Gaq, Gai2 and / or Gai3 and probably regulates one or more pathways mediated by these Ga subunits in platelets. This specificity of Ga corresponds to what has been demonstrated for RGSs that typically interact with members of the Gai and / or Gaq family. No RGS has been identified that interacts with Gas. The RGS protein, pll5 RhoGEF, from the F subfamily appears to be the only identified member that interacts with the Ga? 2 / i3 subunits (Kozasa T., Jiang X., Hart MJ, Sternweis PM, Singer WD, Gilman. AG, Bollag G., Sternweis PC (1998) Science 280: 2109-11, Hart MJ, Jiang X., Kozasa T., Roscoe W., Singer WD, Gilman AG, Sternweis P. C, Bollag G. (199d) Science 280: 2112-4). Despite the fact that Gaz is abundantly expressed in platelets (Gagnon AW, Manning DR, Catani L., Gewirtz A., Poncz M., Brass LF (1991) Blood 78: 1247-53), RGSld does not seem to interact with this alpha subunit. It is interesting to note that hRGS10 is expressed in platelets both at the RNA level and at the protein level. hRGSlO has been reported as interacting with Gaz as well as G "i3 (Hunt T.W., Fields T.A., Casey P.J. Peralta (1996) Nature, 383: 175-7). It is likely that, due to their relatively clear preference for Ga, RGS10 and RGSld may serve to regulate different signaling pathways in platelets. The exact function of RGS18 in signal transduction in platelets is unclear. The binding specificity of Ga subunits in vitro indicates that RGS18 probably regulates mediated pathways through the activation of pathways linked to Ga? and Gaq tracks. In platelets, aggregation seems to be dependent on the concomitant activation of Ga-coupled receptors. and of Gaq-coupled receptors (Jin J., Kunapuli S.P. (1996) Proc. Nati, Acad. Sci. U.S.A. 95: 8070-4). Platelet agonists, thrombin, thromboxane A2 and ADP are all linked to signaling pathways through these Ga subunits. The blocking of Gaq signaling in mice causes a phenotype in which platelets do not respond to several agonists and as a result are susceptible to hemorrhage (Offermanns S, Toombs CF, Hu YH, Simon MI (1997) Nature 389: 183 -6). Due to the ubiquitous expression of Gaq, these mice also exhibit other deleterious phenotypes including ataxia, so Gaq is an unsatisfactory target for antiplatelet therapy. Because of his potential to regulate G-mediated pathways in platelets that are critical for platelet activation, and due to the fact that it is enriched in platelets compared to tissues, RGS18 or a still unknown protein that regulates RGSld, may be an appropriate target of therapies whose purpose is the regulation of platelet activity. Additional studies that address the regulation of individual GPCRs and their signal transduction pathways by RGSld, and other RGSs that are present in platelets, will provide us with a better understanding of the role that RGSs play in platelet activation events. The present invention is not limited in its scope to the specific embodiments described herein. In fact, various modifications of the present invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description and the appended figures. Such modifications are contemplated to fall within the scope of the appended claims. It will further be understood that all base sizes, amino acid sizes and all values of molecular weights or molecular masses, which are provided for the nucleic acids or polypeptides, are approximate, and are offered for descriptive purposes. Several publications are discussed here, whose disclosures are incorporated by reference in their entirety.
LIST OF SEQUENCES < 110 > MURRAY, David L. GAGNON, Alison W. < 120 > NUCLEIC ACIDS THAT CODIFY AN INNOVATIVE REGULATOR OF PROTEIN SIGNALIZATION, RGSld, AND ITS USES < 130 > A3656-US < 140 > < 141 > < 160 > 38 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 220 > < 221 > base_modified < 222 > (3) < 223 > n = Inosine < 220 > < 221 > base_modified < 222 > (12) < 223 > n = Inosine < 400 > 1 grngaraayh tngarttytg g 21 < 210 > 2 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 220 > < 221 > base_modif icada < 222 > (3) < 223 > n = Inosine < 220 > < 221 > base_modified < 222 > (12) < 223 > n = Inosine < 220 > < 221 > base_modified < 222 > (15) < 223 > n = Inosine < 400 > 2 grngaraayh tnmgnttytg g 21 < 210 > 3 < 211 > 19 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 220 > < 221 > base_modified < 222 > (5) < 223 > n = Inosine < 220 > < 221 > base_modified < 222 > (11) < 223 > n = Inosine < 400 > 3 grtangarty nttytycat 19 < 210 > 4 < 211 > 19 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 220 > < 221 > base_modified < 222 > (eleven) < 223 > n = Inosine < 400 > 4 grtarctrty nttytycat 19 < 210 > 5 < 211 > 30 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 5 cgctagggcc ttagactcct tgcttcttcc 30 < 210 > 6 < 211 > 1486 < 212 > DNA < 213 > Homo sapiens < 400 > 6 ctcaacctac cctccacagt tttgatgctg cacaaagcag agtgtatcag ctcatggaac 60 aagacagtta tacacgtttt ctgaaatctg acatctattt agacttgatg gaaggaagac 120 ctcagagacc aacaaatctt aggagacgat cacgctcatt tacctgcaat gaattccaag 180 atgtacaatc agatgttgcc atttggt at aaagaaaatt gattttgctc atttttatga 240 caaacttata catctgcttc taacatatcg catgtttatg ttaagatttg gtcccatcct 300 ttaaactgaa atatgtcatg tgaaattatt ttaaaaatgt aaaaacaaaa ctttctgcta 360 acaaaataca tacagtatct gccagtatat tctgtaaaac cttctatttg atgtcattcc 420 atttataatc agaaaaaaaa cttatttctt aatcaaaagg cagtacaaaa aaagtaataa 480 tgttttataa gattgtagag ttaagtaaaa gttaagcttt tgcaaagttg tcaaaagttc 540 ctagttggga aaacaaaagt ttttttacca aagcagcata tataaacata atatgtgtta 600 gatatccaaa ataatactca tgttcagata gcatttttca taatgaatgt tctctttttt 660 ttggtaatag tgtagaagtg atctggttct tacaatggga gatgaagaac atttattatt 720 gggttactac taaccctgtc ccaagaatag taatatcacc tctagttata agccagcaac 780 aggaactttt gtgaagacac attcatctct acagaacttc agattaaata taatctagat 840 taatgactga gaataag atc cacatttgaa ctcattccta agtgaacatg gacgtaccca 900 gttatacaaa tggtcacaga gtacttctgt aacatgacca gattttgcat atctccaggt 960 agggaactaa gtagactacc ttatcaccgg ctaagaaaac ttgctactaa actattaggc 1020 catcaatggg ctggaataaa aaccgagaag tttttcccag gacgtctcat gtttggccct 1080 ttagaattgg ggtagaaatc agaaatgaga tgaggggaag aagcaaggag tctaaggccc 1140 tagcgatttg ggcatctgcc acattggttc atattcagaa agtgttatct cattgattat 1200 attcttgtta agcaaatctc cttaagtaat tattattcaa ataagattat actcatacat 1260 ctgttttaaa ctatatgtca gagatattta atttttaatg tgtgttacat ggtctgtaaa 1320 tatttgtatt taaaaatgcc atgcattagg ctttggaaat ttaatgttag ttgaaatgta 1380 aaatgtgaaa actttagatc atttgtagta ataaatattt ttaacttcat tcatacaatt 1440 gacaataaaa aagtttatct aaaaaaaaaa aaaaaa gctctgactg 1486 < 210 > 7 < 211 > 17 < 212 > PRT < 213 > Homo sapiens < 400 > 7 lys Leu lie His Gly Ser Gly Glu Glu Thr Ser Lys Glu Ma Lys lie 1 5 10 15 Arg < 210 > 8 < 211 > 19 < 212 > PRT < 213 > Homo sapiens < 400 > 8 Gln Arg Pro Thr Asn Leu Arg Arg Arg Ser Arg Ser Phe Thr Cys Asn 1 5 10 15 Glu Phe Gln < 210 > 9 < 211 > 39 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 9 gttcggatcc gagagaagat ggaaacaaca ttgcttttc 39 < 210 > 10 < 211 > 30 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 10 gtgctcgagt taacataaac atgcgatatg 30 < 210 > 11 < 211 > 241 < 212 > DNA < 213 > Homo sapiens < 400 > 11 gaggaaaatc tggagttctg gatagcctgt gaagatttca agaaaagcaa gggacctcaa 60 caaattcacc ttaaagcaaa agcaatatat gagaaattta tacagactga tgccccaaaa 120 gaggttaacc ttgattttca cacaaaagaa gtcattacaa acagcatcac tcaacctacc 180 ctccacagtt ttgatgctgc acaaagcaga gtgtatcagc tcatggaaaa cgacagctat 240 c 241 < 210 > 12 < 211 > 81 < 212 > PRT < 213 > Homo sapiens < 400 > 12 Leu Glu Glu Asn Leu Glu Phe Trp He Wing Cys Glu Asp Phe Lys Lys 1 5 10 15 c Ser Lys Gly Pro Gln Gln He His Leu Lys Wing Lys Wing He Tyr Glu 5 20 25 30 Lys Phe He Gln Thr Asp Ala Pro Lys Glu Val Asn Leu Asp Phe His 35 40 45 Thr Lys Glu Val He Thr Asn Ser He Thr Gln Pro Thr Leu His Ser 50 55 60 Phe Asp Ala Ala Gln Ser Arg Val Tyr Gln Leu Met Glu Asn Asp Ser 65 70 75 80 or tyr < 210 > 13 < 211 > 69 < 212 > PRT < 213 > Homo sapiens < 400 > 13 Gln Pro Thr Leu His Ser Phe Asp Ala Ala Gln Ser Arg Val Tyr Gln 1 5 10 15 Leu Met Glu Gln Asp Ser Tyr Thr Arg Phe Leu Lys Ser Asp He Tyr 20 25 30 keu Asp Leu Met Glu Gly Arg Pro Gln Arg Pro Thr Asn Leu Arg Arg 35 40 45 Arg Ser Arg Be Phe Thr Cys Asn Glu Phß Gln Asp Val Gln Ser Asp 50 55 60 Val Ala He Trp Leu 65 < 210 > 14 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 14 atagcctgtg aagatttcaa g 21 < 210 > 15 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 15 tggcaacatc tgattgtaca t 21 < 210 > 16 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 16 aagtttgtca taaaaatgag c 21 < 210 > 17 < 211 > 21 < 212 > DNA 5 < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Polymerase Chain Reaction Primer < 400 > 17 10 ttaacataaa catgcgatat g 21 < 210 > 18 < 211 > 1840 © < 212 > DNA < 213 > Homo sapiens 15 < 400 > 18 gcagagacag aaagaaacgc agctcttgac tgcttttttg taaacattac tgtaagagtt 60 gtgataactt tttattctac tatgtatatg tatggaatag tattaataaa tgaactaggg 120. aaggatgtaa taaattagac atctcttcat tttagagaga agatggaaac aacattgctt 180 ttcttttctc aaataaatat aaagaaaaaa gtgtgaatca cttttttcaa gttaatacat 240 aagaagaaac ggttcaggaa aagcaaagaa gccaaaatca gagctaagga aaaaagaaat 300 ttcttgtgca agactaagtc gaaacctgag tttcatgaag acacccgctc cagtagatct 360 gggcacttgg ccaaagaaac aagagtctcc cctgaagagg cagtgaaatg gggtgaatca 420 trttgac-faac tgctttccca tagagatgga ctagaggctt ttaccagatt tcttaaaact 480 gaattcagtg aagaaaatat tgaattttgg atagcctgtg aagatttcaa gaaaagcaag 540 ggacctcaac aaattcacct taaagcaaaa gcaatatatg agaaatttat acagactgat 600 20 gccccaaaag aggttaacct cgattttcac acaaaagaag tcattacaaa cagcatcact 660 caacctaccc tccacagttt tgatgctgca caaagcagag tgtatcagct catggaacaa 720 gacagttata cacgttttct gaaatctgac atctatttag acttgatgga aggaagacct 780 caaatcttag cagagaccaa cgctcattta gagacgatca cctgcaatga attccaagat 840 gtacaatcag atgttgccat ttggttataa agaaáattga ttttgctcat ttttatgaca 900 tctgcttcta aacttataca acatatcgca tg ttatgtt aagatttggt cccatccttt 960 aaactgaaa t atgtcatgtg aaattatttt aaaaatgtaa aaacaaaact ttctgctaac 1020 aaaatacata cagtatctgc cagtatattc tgtaaaacct tctatttgat gtcattccat 1080 ttataatcag aaaaaaaact tatttcttaa tcaaaaggca gtacaaaaaa agtaataatg 1140 ttttataaga ttgtagagtt aagtaaaagt taagcttttg caaagttgtc aaaagttcaa 1200 acaaaagtct agttgggatt ttttaccaaa gcagcataat atgtgttata taaacataat 1260 25 aatactcaga tatccaaatg ttcagatagc jtttt: cata ^ "" J SSS? w SS ggtaatagtg tagaagtgat ctggttctta caat? ggaga tg 9 ccaqCaacag 1440 g? tactacta accctgtccc aagaatagta Jtatcacctc g * at ctagatta 1500 gaacttttgt gaagacacat tcatctctac * J "c tcag a cgtacccagt 1560 Tgactgaga ataagatcca «tttgaact« ttcctaag tg JJt c? Ccaggtag 1620 tatacaaagt acttctgttg gtcacagaaa «tgaccaga« tattaggcca 1680 ggaactaagt agactacctt atcaccggct «£" cgtctcatgt ttggcccttt 1740 SSSS,? 5SSß «; SSSSSS? 55SSSSS-g sagtc taaggcccta 1.00 gCgatt? Ggg ca? Ctgccac «ttggttcat attcagaaag < 210 > 19 < 211 > 2144 <; 212 > DNA < 213 > Homo sapiens < 400 > 19 gcagagacag aaagaaacgc agctcttgac tgcttttttg taaacattac tgtaagagtt 60 gtgataactt tttattctac tatgtatatg tatggaatag tattaataaa tgaactaggg 120 aaggatgtaa taaattagac atctcttcat tttagagaga agatggaaac aacattgctt 180 ttcttttctc aaataaatat gtgtgaatca aaagaaaaaa cttttttcaa gttaatacat 240 aagaagaaac ggttcaggaa gccaaaatca aagcaaagaa gagctaagga aaaaagaaat 300 agactaagtc ttcttgtgca gaaacctgag tttcatgaag acacccgctc cagtagatct 360 gggcacttgg ccaaagaaac aagagtctcc cctgaagagg cagtgaaatg gggtgaatca 420 tttgacaaac tgctttccca tagagatgga ctagaggctt ttaccagatt tcttaaaact 480 gaattcagtg aagaaaatat tgaattttgg atagcctgtg aagatttcaa gaaaagcaag 540 ggacctcaac aaattcacct taaagcaaaa gcaatatatg agaaatttat acagactgat 600 gccccaaaag aggttaacct cgattttcac acaaaagaag tcattacaaa cagcatcact 660 caacctaccc tccacagttt tgátgctgca caaagcagag tgtatcagct catggaacaa 720 gacagttata cacgttttct gaaatctgac atctatttag acttgatgga aggaagacct 780 caaatcttag cagagaccaa gagacgatca cgctcattta cctgcaatga attccaagat 840 gtacaatcag atgtt gccat ttggttataa agaaaattga ttttgctcat ttttatgaca 900 tctgcttcta aacttataca acatatcgca tgtttatgtt aagatttggt cccatccttt 960 aaactgaaat atgtcatgtg aaattatttt aaaaatgtaa aaacaaaact ttctgctaac 1020 aaaatacata cagtatctgc cagtatattc tgtaaaacct tctatttgat gtcattccat 1080 ttataatcag aaaaaaaact tatttcttaa tcaaaaggca gtacaaaaaa agtaataatg 1140 ttttataaga ttgtagagtt aagtaaaagt taagcttttg caaagttgtc aaaagttcaa 1200 acaaaagtct agttgggatt ttttaccaaa gcagcataat atgtgttata taaacataat 1260 aatactcaga tatccaaatg ttcagatagc atttttcata atgaatgttc tctttttttt 1320 ggtaatagtg tagaagtgat ctggttctta caatgggaga tgaagaacat ttattattgg 1380 gttactacta accctgtccc aagaatagta atatcacctc tagttataag ccagcaacag 1440 gaa gaacttttgt? acacat tcatctctac agaacttcag atctagatta attaaatata 1500 ataagatcca atgactgaga catttgaact cattcctaag tgaacatgga cgtacccagt 1560 tatacaaagt acttctgttg gtcacagaaa catgaccaga ttttgcatat ctccaggtag 1620 ggaactaagt agactacctt atcaccggct aagaaaactt gctactaaac tattaggcca 1680 tcaatgggct ggaataaaaa cc gagaagtt tttcccagga cgtctcatgt ttggcccttt 1740 agaattgggg tagaaatcag aaatgagatg aggggaagaa gcaaggagtc taaggcccta 1800 gcgatttggg catctgccac attggttcat attcagaaag tgttatctca ttgattatat 1860 tcttgttaag caaatctcct taagtaatta ttattcaaat aagattatac tcatacatct 1920 atatgtcact gttttaaaga gatatttaat ttttaatgtg tgttacatgg tctgtaaata 1980 tttgtattta aaaatggpat gcattaggct ttggaaattt aatgttagtt gaaatgtaaa 2040 atgtgaaaac tttagatcat ttgtagtaat aaatattttt aacttcattc atacaattaa 2100 caataaaagc gtttatctga tctgactgaa aaaaaaaaaa yyyy 2144 < 210 > 20 < 211 > 235 < 212 > PRT < 213 > Homo sapiens < 400 > 20 Met Glu Thr Thr Leu Leu Phe Phe Ser Gln He Asn Met Cys Glu Ser 1 5 10 15 Lys Glu Lys Thr Phe Phe Lys Leu He His Gly Ser Gly Lys Glu Glu 20 25 30 Thr Ser Lys Glu Ala Lys He Arg Ala Lys Glu Lys Arg Asn Arg Leu 35 40 45 Ser Leu Leu Val Gln Lys Pro Glu Phe His Glu Asp Thr Arg Ser Ser 50 55 60 Arg Ser Gly His Leu Ala Lys Glu Thr Arg Val Ser Pro Glu Gl? Ala 65 70 75 80 Val Lys Trp Gly Glu Ser Phe Asp Lys Leu Leu Ser His Arg Asp Gly 85 90 95 Leu Glu Wing Phe Thr Arg Phe Leu Lys Thr Glu Phe Ser Glu Glu Asn 100 105 110 He Glu Phe Trp He Wing Cys Glu Asp Phe Lys Lys Ser Lys Gly Pro 115 120 125 Gln Gln He His Leu Lys Ala Lys Ala He Tyr Glu Lys Phe He Gln 130 135 140 Thr Asp Ala Pro Lys Glu Val Asn Leu Asp Phe His Thr Lys Glu Val 145 150 155 160 He Thr Asn Ser He Thr Gln Pro Thr Leu His Ser Phe Asp Wing Wing 165 170 175 Gln Ser Arg Val Tyr Gln Leu Met Glu Gln Asp Ser Tyr Thr Arg Phe 180 185 190 Leu Lys Ser Asp He Tyr Leu Asp Leu Met Glu Gly Arg Pro Gln Arg 195 200 205 Pro Thr Asn Leu Arg Arg Arg Ser Arg Ser Phe Thr Cys Asn Glu Phe 210 215 220 Gln Asp Val Gln Ser Asp Val Wing He Trp Leu 225 230 235 < 210 > 21 < 211 > 205 < 212 > PRT < 213 > Homo sapiens < 400 > 21 Met Cys Lys Gly Leu Wing Gly Leu Pro Wing Being Cys Leu Arg Being Wing 1 5 10 15 Ly Asp, _Met Lys His Arg Leu Gly Phe Leu Leu Gln Lys Ser Asp Ser 20 25 30 Cys Glu His Asn Ser Ser His Asn Lys Lys Asp Lys Val Val He Cys 35 40 45 Gln Arg Val. Ser Gln Glu Glu Val Lys Lys Trp Wing Glu Ser Leu Glu 50 55. 60 Asn Leu He Ser His Glu Cys Gly Leu Ala Wing Phe Lys Wing Phe Leu 65 70 75 80 Lys Ser Glu Tyr Ser Glu Glu Asn He Asp Phe Trp He Ser Cys Glu 85 90 95 Glu Tvr Lvs Lys He Lys Ser Pro Ser Lys Leu Ser Pro Lys Wing Lys 100 105 110 Lys He Tyr Asn Glu Phe He Ser Val Gln Ala Thr Lys Glu Val Asn 115 120 125 Leu Asp Ser Cys Thr Arg Glu Glu Thr Ser Arg Asn Met Leu Glu Pro 130 135 140 Thr He Thr Cys Phe Asp Glu Wing Gln Lys Lys He Phe Asn Leu Met 145 150 155 160 Glu Lys Asp Ser Tyr Arg Arg Phe Leu Lys Ser Arg Phe Tyr Leu Asp 165 170 175 . Goes! M »Pr- S-r S-r Cy, Gly Ala --- Ly-« »W» «g« • W 180 185 Ser Ser Wing Asp Cys Wing Ser Leu Val Pro Gln Cys Wing 195 200 < 210 > 22 < 211 > 181 < 212 > PRT < 213 > Homo sapiens < 400 > 22 Met Cys Lys Gly Leu Ala Ala Leu Pro His Sex Cys Leu Glu Arg Ala 1 5 10 15 Lys Glu He Lys He Lys Leu Gly He Leu Leu Gln Lys Pro Asp Ser 20 25 30 Val Gly Asp Leu Val He Pro Tyr Asn Glu Lys Pro Glu Lys Pro Wing 35 40 45 Lys Thr Glp Lys Thr Ser Leu Asp Glu Wing Leo Gln Trp Arg Asp Ser 50 55 60 Leu Asp Lys Leu Leu Gln Asn Asn Tyr Gly Leu Wing Sex Phe Lys Ser 65 70 75 80 Phe Leu Lys Ser Glu Phe Ser Glu Glu Asn Leu Gla Phe Trp He Wing 85 90 95 Cys Glu Asp Tyr Lys Lys He Lys Ser Pro Wing Lys Met Wing Glu Lys 100 105 110 Wing Lys Gln He Tyr Glu Glu Phe He Gln Thr Glu Wing Pro Lys Glu 115 120 125 Val Asn He Asp His Phe Thr Lys Asp He Thr Met Lys Asn Leu Val 130 135 140 Glu Pro Ser Leu Ser Ser Phe Asp Met Wing Gln Lys Arg He His Wing 145 150 155 160 Leu Met Glu Lys Asp Ser Leu Pro Arg Phe Val Arg Sex Glu Phe Tyr 165 '170 175 Gln Glu Leu He Lys 180 < 210 > 23 < 211 > 204 < 212 > PRT < 213 > Homo sapiens < 400 > 2. 3 Met Cys Arg Thr Leu Wing Wing Phe Pro Thr Thr Cys Leu Glu Arg Wing 1 5 10 15 Lys Glu Phe Lys Thr Arg Leu Gly He Phe Leu His Lys Ser Glu Leu 20 25 30 Gly Cys Asp Thr Gly Ser Thr Gly Lys Phe Glu Trp Gly Ser Lys His 35 40 45 Ser Lys Glu Asn Arg Asn Phe Ser Glu Asp Val Leu Gly Trp Arg Glu 50 55 60 Ser Phe Asp Leu Leu Leu Ser Ser Lys Asn Gly Val Ala Wing Phe His 65 70 75 80 Wing Phe Leu Lys Thr Glu Phe Ser Glu Glu Asn Leu Glu Phe Trp Leu 85 90 95 Wing Cys Glu Glu Phe Lys Lys He Arg Ser Wing Thr Lys Leu Wing Ser 100 105 110 Arg Wing His Gln He Phe Glu Glu Phe He Cys Sex Glu Wing Pro Lys 115 120 125 Glu Val Asn He Asp His Glu Thr Arg Glu Leu Thr Arg Met Asn Leu 130 135 140 Gln Thr Wing Thr Wing Thr Cys Phe Asp Wing Wing Gln Gly Lys Thr Arg 145 150 155 160 Thr Leu Met Glu Lys Asp Ser Tyr Pro Arg Phe Leu Lys Ser Pro Wing 165 170 175 Tyr Arg Asp Leu Wing Wing Gln Wing Wing Wing Wing Wing Thr Leu Ser 180 185 190 Ser Cys Ser Leu Asp Glu Pro Ser His Thr Wing Thr 195 200 < 210 > 24 < 211 > 211 < 212 > PRT < 213 > Homo sapiens < 400 > 24 Met Gln Ser Wing Met Phe Leu Wing Val Gln His Asp Cys Arg Pro Met 1 5 10 15 Asp Lys Ser Wing Gly Ser Gly His Lys Ser Glu Glu Lys Arg Glu Lys 20 25 30 Met Lys Arg Thr Leu Leu Lys Asp Trp Lys Thr Arg Leu Ser Tyr Phe 35 40 45 Leu Gln Aßn Ser Ser Thr Pro Gly Lys Pro Lys Thr Gly Lys Lys Ser 50 55 60 Lys Gln Gln Wing Phe He Lys Pro Ser Pro Glu Glu Wing Gln Leu Trp 65 70 75 80 Ser Glu Ala Phe Asp Glu Leu Leu Ala Ser Lys Tyr Gly Leu Ala Ala 85 90 95 Phe Arg Wing Phe Leu Lys Ser Glu Phe Cys Glu Glu Asn He Glu Phe 100 105 110 Trp Leu Wing Cys Glu Asp Phe Lys Lys Thr Lys Ser Pro Gln Lys Leu 115 120 125 Ser Ser Lys Wing Arg Lys He Tyr Thr Asp Phe He Glu Lys Glu Wing 130 135 140 Pro Lys Glu He Asn He Asp Phe Gln Thr Lys Thr Leu He Wing Gln 145 150 155 160 Asn He Gln Glu Wing Thr Ser Gly Cys Phe Thr Thr Wing Gln Lys Arg 165 170 175 Val Tyr Ser Leu Met Glu Asn Asn Ser Tyr Pro Arg Phe Leu Glu Ser 180 185 190 Glu Phe Tyr Gln Asp Leu Cys Lys Pro Gln He Thr Thr Glu Pro 195 200 205 His Ala Thr 210 < 210 > 25 < 211 > 199 < 212 > PRT < 213 > Homo sapiens < 400 > 25 Met Pro Gly Met Phe Phe Ser Wing Asn Pro Lys Glu Leu Lys Gly Thr 1 5 10 15 Thr His Ser Leu Leu Asp Asp Lys Met Gln Lys Arg Arg Pro Lys Thr 20 25 30 Phe Gly Met Asp Met Lys Wing Tyr Leu Arg Ser Met He Pro His Leu 35 40 45 Glu Ser Gly Met Lys Ser Ser Lys Ser Lys Asp Val Leu Ser Ala Ala 50 55 60 Glu Val Met Gln Trp Ser Gln Ser Leu Glu Lys Leu Leu Ala Asn Gln 65 70 75 80 Thr Gly Gln Asn Val Phe Gly Ser Phe Leu Lys Ser Glu Phe Ser Glu 85 90 95 Glu Asn He Glu Phe Trp Leu Wing Cys Glu As-fTyr Lys Thr Glu 100 105 110 Ser Asp Leu Leu Pro Cys Lys Wing Glu Glu He Tyr Lys Wing Phe Val 115 120 125 His Ser Asp Wing Wing Lys Gln He Asn He Asp Phe Arg Thr Arg Glu 130 135 140 Be Thr Ala Lys Lys He Lys Wing Pro Thr Pro Thr Cys Phe Asp Glu 145 150 155 160 Wing Gln Lys Val He Tyr Thr Leu Met Glu Lys Asp Ser Tyr Pro Arg 165 170 175 Phe Leu Lys Ser His He Tyr Leu Asn Leu Leu Asn Asp Leu Gln Wing 180 185 190 Asn Ser Leu Lys Leu Val Pro 195 < 210 > 26 < 211 > 167 < 212 > PRT < 213 > Homo sapiens < 400 > 26 Met Glu His He His Asp Being Asp Gly Being Ser Being His Gln 1 5 10 15 Ser Leu Lys Ser Thr Wing Lys Trp Wing Wing Ser Leu Glu Asn Leu Leu 20 25 30 Glu Asp Pro Glu Gly Val Lys Arg Phe Arg Glu Phe Leu Lys Glu 35 40 45 Phe Ser Glu Glu Asn Val Leu Phe Trp Leu Wing Cys Glu Asp Phe Lys 50 55 60 Lys Met Gln Asp Lys Thr Gln Met Gln Glu Lys Ala Lys Glu He Tyr 65 70 75 80 Met Thr Phe Leu Ser Ser Lys Ala Ser Ser Gln Val Asn Val Glu Gly 85 90 95 Gln Ser Arg Leu Asn Glu Lys He Leu Glu Glu Pro His Pro Leu Met 100 105 110 Phe Gln Lys Leu Gln Asp Gln He Phe Asn Leu Met Lys Tyr Asp Ser 115 120 125 Tyr Ser Arg Phe Leu Lys Ser Asp Leu Phe Leu Lys His Lys Arg Thr 130 135 140 Glu Glu Glu Glu Glu Asp Leu Pro Asp Ala Gln Thr Ala Ala Lys Arg 145 150 155 160 Wing Being Arg He Tyr Asn Thr 165 < 210 > 27 < 211 > 180 < 212 > PRT < 213 > Rattus norvegicus < 400 > 27 Met Ala Ala Leu Leu Met Pro Arg Arg Asn Lys Gly Met Arg Thr Arg 1 5 10 15 Leu Gly Cys Leu Ser His Lys Ser Asp Ser Cys Ser Asp Phe Thr Wing 20 25 30 He Leu Pro Asp Lys Pro Asn Arg Ala Leu Lys Arg Leu Ser Thr Glu 35 40 45 Glu Wing Thr Arg Trp Wing Asp Ser Phe Asp Val Leu Leu Ser His Lys 50 55 60 Tyr Gly Val Wing Wing Phe Arg Wing Phe Leu Lys Thr Glu Phe Ser Glu 65 70 75 80 Glu Asn Leu Glu Phe Trp Leu Wing Cys Glu Glu Phe Lys Lys Thr Arg 85 90 95 Be Thr Ala Lys Leu Val Thr Lys Ala His Arg He Phe Glu Glu Phe 100 105 110 Val Asp Val Gln Ala Pro Arg Glu Val Asn He Asp Phe Gln Thr Arg 115 120 125 Glu Ala Thr Arg Lys Asn Met Gln Glu Pro Ser Leu Thr Cys Phe Asp 130 135 140 Gln Ala Gln Gly Lys Val His Ser Leu Met Glu Lys Asp Ser Tyr Pro 145 150 155 160 Arg Phe Leu Arg Ser Lys Met Tyr Leu Asp Leu Leu Ser Gln Ser Gln 165 170 175 Arg Arg Leu Ser 180- < 210 > 28 < 211 > 519 < 212 > PRT < 213 > Homo sapiens < 400 > 28 Met Phe Glu Thr Glu Wing Asp Glu Lys Arg Glu Met Wing Leu GÍU Glu 1 5 10 5 Glv Lvs Gly Pro Gly Wing Glu Asp Ser Pro Pro Ser Lys Glu Pro Sex 20 25 30 Pro Gly Gln Glu Leu Pro Pro Gly Gln Asp Leu Pro Pro Asn Lys Asp 35 40 45 Ser Pro Gly Gln Glu Pro Pro Wing Gln Glu Pro Leu Ser Ser 50 55 60 Lys Asp Be Wing Thr Ser Glu Gly Ser Pro Pro Gly Pro Asp Wing Pro 65 70 75 80 Pro Ser Lys Asp Val Pro Pro Cys Gln Glu Pro Pro Pro Wing Gln Asp 85 90 95 Leu Pro Pro Cys Gln Asp Leu Pro Wing Gly Gln Glu Pro Leu Pro His 100 105 110 Gln Asp Pro Leu Leu Thr Lys Asp Leu Pro Wing Gln Glu Ser Pro 115 120 125 Thr Arg Asp Leu Pro Pro Cys Gln Asp Leu Pro Pro Ser Gln Val Ser 130 135 140 Leu Pro Ala Lys Ala Leu Thr Glu Asp Thr Met Ser Ser Gly Asp Leu 145 150 '155 160 Leu Ala Ala Thr Gly Asp Pro Pro Ala Ala Pro Arg Pro Ala Phe Val 165 170 175 He Pro Glu Val Arg Leu Asp Ser Thr Tyr Ser Gln Lys Wing Gly Wing 180 185 190 Glu Gln Gly Cys Ser Gly Asp Glu Glu Asp Wing Glu Glu Wing Glu Gl? 195 200 205 Val Glu Glu Gly Glu Glu Gly Glu Glu Asp Glu Asp Glu Asp Thr Ser 210 215 220 Asp Asp Asn Tyr Gly Glu Arg Ser Glu Ala Lys Arg Ser Ser Met He 225 230 235 240 Glu Thr Gly Gln Gly Wing Glu Gly Gly Leu Ser Leu Arg Val Gln Asn 245 250 255 Be Leu Arg Arg Arg Thr His Ser Glu Gly Ser Leu Leu Gln Glu Pro 260 265 270 Arg Gly Pro Cys Phe Wing Being Asp Thr Thr Leu His Cys Ser Asp Gly 275 280 285 Glu Gly Wing Wing Being Thr Trp Gly Met Pro Pro Pro Be Thr Leu Lys 290 295 300 Lys Glu Leu Gly Arg Asn Gly Gly Ser Met His His Leu Ser Leu Phe 305 310 315 320 Phe Thr Gly His Arg Lys Met Ser Gly Wing Asp Thr Val Gly Asp Asp 325 330 335 Asp Glu Wing Being Arg Lys Arg Lys Being Lys Asn Leu Wing Lys Asp Met 340 345 350 Lys Asn Lys Leu Gly He Phe Arg Arg Arg Asn Glu Ser Pro Gly Wing 355 360 365 Pro Pro Wing Gly Lys Wing Asp Lys Met Met Lys Ser Phe Lys Pro Thr 370 375 380 Ser Glu Glu Ala Leu Lys Trp Gly Glu Ser Leu Glu Lys Leu Leu Val 385 390 395 400 His Lys Tyr Gly Leu Wing Val Phe Gln Wing Phe Leu Arg Thr Glu Phe 405 410 415 Ser Glu Glu Asn Leu Glu Phe Trp Leu Wing Cys Glu Asp Phe Lys Lys 420 425 430 Val Lys Ser Gln Ser Lys Met Wing Ser Lys Wing Lys Lys He Phe Wing 435 440 445 Glu Tyr He Wing He Gln Wing Cys Lys Glu Val Asn Leu Asp Ser Tyr 450 455 460 Thr Arg Glu His Thr Lys Asp Asn Leu Gln Ser Val Thr Arg Gly Cys 465 470 475 480 Phe Asp Leu Wing Gln Lys Arg He Phe Gly Leu Met Glu Lys Asp Ser 485 490 495 Tyr Pro Arg Phe Leu Arg Ser Asp Leu Tyr Leu Asp Leu He Asn Gln * 500 505 510 Lys Lys Met Ser Pro Pro Leu 515 < 210 > 29 < 211 > 159 < 212 > PRT < 213 > Homo sapiens < 400 > 29 Met Ser Arg Arg Asn Cys Trp He Cys Lys Met Cys Arg Asp Glu Ser 1 5 10 15 Lys Arg Pro Pro Be Asn Leu Thr Leu Glu Glu Val Leu Gln Trp Wing 20 25 30 Gln Ser Phe Glu Asn Leu Met Wing Thr Lys Tyr Gly Pro Val Val Tyr 35 40 45 Wing Wing Tyr Leu Lys Met Glu His Ser Asp Glu Asn He Gln Phe Trp 50 55 60 Met Wing Cys Glu Thr Tyr Lys Lys He Wing Ser Arg Trp Ser Arg He 65 70 75 80 Ser Arg Wing Lys Lys Leu Tyr Lys He Tyr He Gln Pro Gln Pro Pro 85 90 95 Arg Glu He Asn He Asp Being Ser Thr Arg Glu Thr He He Arg Asn 100 105 110 He Gln Glu Pro Thr Glu Thr Cys Phe Glu Glu Wing Gln Lys He Val 115 120 125 Tyr Met His Met Glu Arg Asp Ser Tyr Pro Arg Phe Leu Lys Ser Glu 130 135 140 Met Tyr Gln Lys Leu Leu Lys Thr Met Gln Ser Asn Asn Ser Phe 145 150 155 < 210 > 30 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 30 ctactatgta tatgtatgga atag 24 < 210 > 31 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 31 gaattttgga tagcctgtga ag 22 < 210 > 32 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 32 cgatcacgct catttacctg caat 24 < 210 > 33 < 211 > 24 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 33 ctgaaatatg tcatgtgaaa ttat 24 < 210 > 34 < 211 > twenty-one < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 34 cataaacatg cgatatgtta g 21 < 210 > 35 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 35 tggggcatca gtctgtataa to 21 < 210 > 36 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 36 cctgaaccat gtattaactt g 21 < 210 > 37 < 211 > 17 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 37 gttttcccag tcacgac 17 < 210 > 38 < 211 > 17 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Sequencing Primer < 400 > 38 caggaaacag ctatgac 17

Claims (1)

CLAIMS An isolated nucleic acid comprising a polynucleotide sequence of a) any of SEQ ID NOs: 11, ld, or 19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or either of a complementary polynucleotide sequence, c) nucleotides l-65d of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-670 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, e) nucleotides 163-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f) nucleotides 41d-768 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. An isolated nucleic acid comprising at least eight consecutive nucleotides of a polynucleotide sequence of a) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, b) nucleotides 1-658 of SEQ ID NO : 19, either of a complementary polynucleotide sequence, c) nucleotides 163-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, or d) nucleotides 418-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. An isolated nucleic acid comprising at least one 80% nucleotide identity with a nucleic acid comprising a) any of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, either a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or either a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence, f) nucleotides 41d-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence, or either g) nucleotides 418-65d of SEQ ID NO: 19, or a complementary polynucleotide sequence. The isolated nucleic acid according to claim 3, wherein the nucleic acid comprises a nucleotide identity of 85%, 90%, 95%, or 98% with the nucleic acid comprising a) any of SEQ ID NOs: 11 , 18, or 19, or a complementary polynucleotide sequence, b) nucleotides 1-169 of 266 SEQ ID NO: 11, or a complementary polynucleotide sequence, c) nucleotides 1-656 of SEQ ID NO: 19, or a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence, e) nucleotides 163-656 of SEQ ID NO: 19, or a complementary polynucleotide sequence, f) nucleotides 416-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence, or ) nucleotides 418-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence. An isolated nucleic acid that hybridizes under highly stringent conditions to a nucleic acid comprising a) any of SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO : 11, either a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or a sequence of complementary polynucleotides, e) nucleotides 163-658 of SEQ ID NO: 19, either a complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or a complementary polynucleotide sequence, or g) nucleotides 418-656 of SEQ ID NO: 19, or a complementary polynucleotide sequence. An isolated nucleic acid comprising a polynucleotide sequence according to any one of SEQ ID NOs: 18 or 19, or of a complementary polynucleotide sequence. A specific nucleotide probe or primer for a RGSld nucleic acid, wherein the nucleotide probe or primer comprises at least 15 consecutive nucleotides of a nucleotide polynucleotide sequence a) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, b) nucleotides 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, od) 418-658 of SEQ ID NO: 19, or well of a complementary polynucleotide sequence. The polynucleotide probe or primer according to claim 7, wherein the nucleotide probe or primer comprises a marker compound. A nucleotide probe or primer specific for a RGSld nucleic acid, wherein the nucleotide probe or primer comprises a) any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33 , 34, 35, or 36, or of a complementary polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence , c) l-65d of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) 163-65d of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 416-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. The polynucleotide probe or primer according to claim 9, wherein the nucleotide probe or primer comprises a marker compound. A method for amplifying a nucleic acid region according to claim 1, wherein the method comprises: a) contacting the nucleic acid with two nucleotide primers, wherein the first nucleotide primer is hybridized at a 5 'position of the nucleic acid region, and the second nucleotide primer is hybridized at a 3 'position of the nucleic acid region, in the presence of reagents necessary for an amplification reaction; and b) detecting the amplified nucleic acid region. 12. The method according to claim 11, wherein the two nucleotide primers are selected from the group consisting of A) a nucleotide primer comprising at least 15 consecutive nucleotides of a nucleotide polynucleotide sequence a) 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, b) 1-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163-656 of SEQ ID NO: 19, or either of a complementary polynucleotide sequence, either d) 418-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and B) a nucleotide primer comprising a polynucleotide sequence of a) any of SEQ. ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, either of a complementary polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 418-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. 13. A kit to amplify the nucleic acid in accordance with claim 1, wherein the kit comprises: a) two nucleotide primers whose hybridization position is respectively located 5 'and 3' of the nucleic acid region; and optionally, b) reagents necessary for an amplification reaction. . The kit according to claim 13, wherein the two nucleotide primers are selected from the group consisting of A) a nucleotide primer comprising at least 15 consecutive nucleotides of a nucleotide polynucleotide sequence a) 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO: 19, or either of a complementary polynucleotide sequence, od) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and B) a nucleotide primer comprising a nucleotide sequence of a) any of SEQ ID NOs : 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a complementary polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-658 of SEQ ID NO: 19, either of a complementary polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence. . A method for detecting a nucleic acid according to claim 1, wherein the method comprises: A) contacting the nucleic acid with a selected nucleotide probe within the group consisting of: 1) a nucleotide probe comprising at least 15 consecutive nucleotides of a nucleotide polynucleotide sequence a ) 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163-658 of SEQ ID NO. : 19, or of a complementary polynucleotide sequence, either d) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and 2) a nucleotide probe comprising a polynucleotide sequence of ) any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a complementary polynucleotide sequence, b)
1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, c) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, either e) 418-656 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and B) detect a complex formed between the nucleic acid and the probe. 16. The detection method according to claim 15, wherein the probe is immobilized on a support. 17. A kit for detecting the acid according to claim 1, wherein the kit comprises A) a nucleotide probe selected from the group consisting of 1) a nucleotide probe comprising at least 15 consecutive nucleotides of a sequence of nucleotide polynucleotides a) 1-169 of SEQ ID NO: 11, either of a complementary polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163- 658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, either d) 418-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, and 2) a nucleotide primer comprising a polynucleotide sequence of a) any of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, either of a polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-658 of SEQ ID NO: 19, or of a polynucleotide sequence complementary, d) 163-65 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and optionally, B ) a reagent necessary for a hybridization reaction. 18. The kit according to claim 17, wherein the probe is immobilized on a support. 19. A recombinant vector comprising the nucleic acid according to claim 1. 20. The recombinant vector according to claim 19, wherein the recombinant vector is an adenovirus. 21. A recombinant vector comprising the nucleic acid according to claim 6. 22. The recombinant vector according to claim 21, wherein the recombinant vector is an adenovirus. 23. A recombinant host cell comprising the nucleic acid according to claim 1. 24. A recombinant host cell comprising the nucleic acid according to claim 6. 25. A recombinant host cell comprising the recombinant vector in accordance with Claim 19 26. A recombinant host cell comprising the recombinant vector according to claim 21. 7. An isolated nucleic acid encoding a polypeptide comprising an amino acid sequence of a) any of SEQ ID NO: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ 20. 8. A recombinant vector comprising the nucleic acid according to claim 27. 9. A recombinant host cell comprising the recombinant vector according to claim 28. A recombinant host cell comprising the nucleic acid according to claim 27 1. An isolated polypeptide comprising an amino acid sequence of a) any of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 66-166 of SEQ ID NO: 20. An antibody directed against the polypeptide isolated in accordance with Claim 31. The antibody according to claim 32, wherein the antibody comprises a detectable compound. An isolated polypeptide comprising an amino acid sequence according to that presented in SEQ ID NO: 20. An antibody directed against the isolated polypeptide according to claim 34. The antibody according to claim 35, wherein the antibody comprises a detectable compound. A method for detecting a polypeptide, wherein the method comprises a) contacting the polypeptide with an antibody according to claim 32; and b) detecting an antigen / antibody complex formed between the polypeptide and the antibody. A diagnostic kit for detecting a polypeptide, wherein the kit comprises a) the antibody according to claim 32; and b) a reagent that allows the detection of an antigen / antibody complex formed between the polypeptide and the antibody. 39. A pharmaceutical composition comprising the nucleic acid according to claim 1 and a physiologically compatible excipient. 40. A pharmaceutical composition comprising the nucleic acid according to claim 6 and a physiologically compatible excipient. 41. A pharmaceutical composition comprising the recombinant vector according to claim 19 and a physiologically compatible excipient. 42. A pharmaceutical composition comprising the recombinant vector according to claim 21 and a physiologically compatible excipient. 43. A pharmaceutical composition comprising the nucleic acid according to claim 27 and a physiologically compatible excipient. 44. A pharmaceutical composition comprising the recombinant vector according to claim 28 and a physiologically compatible excipient. 5. A pharmaceutical composition comprising the recombinant host cell in accordance with claim 29 and a physiologically compatible excipient. 46. A pharmaceutical composition comprising the recombinant host cell according to claim 30 and a physiologically compatible excipient. 47. A pharmaceutical composition comprising the polypeptide according to claim 31 and a physiologically compatible excipient. 48. A pharmaceutical composition comprising the polypeptide according to claim 34 and a physiologically compatible excipient. 49. The use of the nucleic acid according to claim 1 for the manufacture of a drug contemplated for the prevention or treatment of a dysfunction of platelet activation. 50. The use of the nucleic acid according to claim 6 for the manufacture of a drug for the prevention or treatment of a dysfunction of platelet activation. 51. The use of the recombinant vector according to claim 19 for the manufacture of a drug for the prevention of a dysfunction of platelet activation. 52. The use of the recombinant vector in accordance with claim 21 for the preparation of a drug contemplated for the prevention or treatment of a dysfunction of platelet activation. 53. The use of the nucleic acid according to claim 27 for the preparation of a drug for the prevention or treatment of a dysfunction of platelet activation. 54. The use of the recombinant vector according to claim 28 for the preparation of a drug for the prevention or treatment of a dysfunction of platelet activation. 55. The use of the recombinant host cell according to claim 29 for the preparation of a drug for the prevention or treatment of a dysfunction of platelet activation. 56. The use of the recombinant host cell according to claim 30 for the preparation of a drug for the prevention or treatment of a dysfunction of platelet activation. 57. The use of the polypeptide according to claim 31 for the preparation of a contemplated drug for the prevention or treatment of a dysfunction of platelet activation. 58. The use of the polypeptide according to claim 31 for screening an active ingredient for the prevention or treatment of a dysfunction of platelet activation. 59. The use of a recombinant host cell that expresses the polypeptide according to claim 31 for screening an active ingredient for the prevention or treatment of a platelet activation dysfunction. 60. An implant comprising the recombinant host cell according to claim 23. 61. An implant comprising the recombinant host cell according to claim 25. 62. An implant comprising the recombinant host cell according to claim 29. 63. A method for identifying a modulator, agonist, or antagonist of a RGS18 polypeptide in a sample, comprising: a) incubating a GTP-loaded protein polypeptide labeled with a RGSld polypeptide with the sample; b) measure the speed or magnitude of the hydrolysis of GTP; and c) comparing the rate or magnitude of the GTP hydrolysis determined in step b) with a rate or magnitude of GTP hydrolysis measured with a reconstituted mixture of G protein loaded with labeled GTP / RGSld polypeptide that has not been previously incubated in the presence of the sample. 64. The method according to claim 63, wherein the G-protein polypeptide loaded with GTP labeled in step a) is loaded with? -32Pi-GTP and the rate or magnitude of the GTP hydrolysis of step b is measured. by determining the amount of free 32Pi released. 65. The method according to claim 63, wherein the RGS18 polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12 , amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20. 6. A method for identifying a modulator, agonist or antagonist of a polypeptide of RGSld in a sample, comprising: a) incubating a cell membrane fraction expressing a RGSld polypeptide with a labeled GTP and the sample; b) measure the rate or magnitude of GTP hydrolysis; and c) compare the speed or magnitude of hydrolysis of GTP determined in step b) with a rate or magnitude of GTP hydrolysis measured with a cell membrane fraction expressing a RGSld polypeptide that has not been previously incubated in the presence of the sample. The method according to claim 66, wherein the cell membrane fraction is obtained from a cell either naturally or after transfection of the cell with a nucleic acid encoding RGSld, expressing a RGSld polypeptide, and isolating the membrane of the cell. The method according to claim 66, wherein labeled GTP from step a) is labeled with? -32P and the rate or magnitude of GTP hydrolysis of step b) is measured by determining the amount of free 32Pi released. The method according to claim 66, wherein the RGSld polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20. A method for identifying a modulator, agonist or antagonist of a RGSld polypeptide in a sample, 264 comprising: a) incubating a cell expressing a RGSld polypeptide with a labeled adenine and the sample; b) measure the amount of cyclic labeled AMP (cAMP) produced; and c) comparing the amount of labeled cAMP measured in step b) with an amount of labeled cAMP measured with a cell expressing a RGSld polypeptide that has not been previously incubated in the presence of the sample. 71. The method according to claim 70, wherein the cell expressing the RGSld polypeptide is transfected with a nucleic acid encoding a RGS18. 72. The method according to claim 70, wherein the labeled adenine of step a) is 3 H-adenine. 73. The method according to claim 70, wherein the RGS18 polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids l-5d of SEQ ID NO. : 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids d6-166 of SEQ ID NO: 20. 4. A method for identifying a modulator, agonist or antagonist of a RGSld polypeptide in a sample, 265 comprising: a) incubating a cell expressing a RGSld polypeptide with a labeled inositol and the sample; b) measuring the amount of labeled inositol triphosphate produced; and c) comparing the amount of labeled inositol triphosphate measured in step b) with an amount of labeled inositol triphosphate measured with a cell expressing a RGSld polypeptide that has not been previously incubated in the presence of the sample. 75. The method according to claim 74, wherein the cell expressing the RGSld polypeptide is transfected with a nucleic acid encoding RGS18. 76. The method according to claim 74, wherein the labeled inositol of step a) is 3 H-inositol. 77. The method according to claim 74, wherein the RGSld polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino acids 1-58 of SEQ ID NO. : 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO: 20, and amino acids 86-166 of SEQ ID NO: 20.
MXPA02010414A 2000-04-28 2001-04-26 Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof. MXPA02010414A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US20078600P 2000-04-28 2000-04-28
GB0018833A GB0018833D0 (en) 2000-08-02 2000-08-02 Nucleic acids and uses thereof
PCT/US2001/013540 WO2001083514A2 (en) 2000-04-28 2001-04-26 Nucleic acids encoding a regulator of a g protein signaling, rgs18, and uses thereof

Publications (1)

Publication Number Publication Date
MXPA02010414A true MXPA02010414A (en) 2003-04-25

Family

ID=26244772

Family Applications (1)

Application Number Title Priority Date Filing Date
MXPA02010414A MXPA02010414A (en) 2000-04-28 2001-04-26 Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof.

Country Status (11)

Country Link
EP (1) EP1292616A2 (en)
JP (1) JP2003531631A (en)
KR (1) KR20030064271A (en)
AU (1) AU2001261054A1 (en)
BR (1) BR0110417A (en)
CA (1) CA2408073A1 (en)
IL (1) IL152498A0 (en)
MX (1) MXPA02010414A (en)
NO (1) NO20025149L (en)
NZ (1) NZ522034A (en)
WO (1) WO2001083514A2 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0015708D0 (en) * 2000-06-27 2000-08-16 Smithkline Beecham Plc Novel compounds
US7846671B2 (en) 2002-01-28 2010-12-07 Bristol-Myers Squibb Company Methods of screening for agents that modulate the interaction of RGS and Gαq and urinary incontinence

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6274362B1 (en) * 1999-02-04 2001-08-14 Millennium Pharmaceuticals, Inc. RGS-containing molecules and uses thereof

Also Published As

Publication number Publication date
NO20025149L (en) 2002-12-16
CA2408073A1 (en) 2001-11-08
EP1292616A2 (en) 2003-03-19
AU2001261054A1 (en) 2001-11-12
NZ522034A (en) 2004-08-27
WO2001083514A3 (en) 2002-09-19
BR0110417A (en) 2003-06-03
JP2003531631A (en) 2003-10-28
KR20030064271A (en) 2003-07-31
WO2001083514A2 (en) 2001-11-08
IL152498A0 (en) 2003-05-29
NO20025149D0 (en) 2002-10-25

Similar Documents

Publication Publication Date Title
JP3294575B2 (en) Proteins that interact with the IGF-1 receptor, genes encoding them and uses thereof
MXPA02010414A (en) Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof.
US6586581B1 (en) Prolactin regulatory element binding protein and uses thereof
CZ398197A3 (en) Cytoplasmatic modulators of integrin regulation and signalling
US20040067903A1 (en) Nucleic acids encoding a novel regulator of g protein signaling, rgs18, and uses thereof
JP2003210183A (en) HUMAN IkappaB-beta
JP2004041174A (en) Pigrl-1, member of immunoglobulin gene superfamily
US20030087246A1 (en) Nucleic acids of the human ABCA12 gene, vectors containing such nucleic acids and uses thereof
JP2000512506A (en) New compound
JP2002529087A (en) Cell surface glycoprotein
US6566489B1 (en) Syndecan-4 binding protein (S4BP) and uses thereof
ZA200208536B (en) Nucleic acids encoding a novel regulator of G protein signalling, RGS18, and uses thereof.
CA2349814A1 (en) Cytokine signal regulators
JPH11206391A (en) Human lig-1 homologue (hlig-1)
JP2002238589A (en) NEW sMAD3 SPLICE VARIANT AS TARGET OF CHRONIC RENAL FAILURE, ATHEROSCLEROSIS AND FIBROSIS
JP2002524026A (en) MEKK1 (serine threonine kinase) interacting FHA (forkhead binding domain) protein 1 (MIF1)
US20030022299A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
JP2005505264A (en) New human proton-gated channel
JP2005500049A (en) Organic compounds
JP2004000193A (en) Pigr-2, member of immunoglobulin gene super-family
US7273724B1 (en) Polypeptide-human actin-binding protein 54 and a polynucleotide encoding the same
MXPA01000952A (en) C7f2-a novel potassium channel beta-subunit.
WO2003093427A2 (en) Molecules for disease detection and treatment
US20030148934A1 (en) Growth factor modulators
WO2003060089A2 (en) Metalloproteins