WO1994016086A1 - Bacterie d'acide lactique recombinee contenant un promoteur insere, et son procede de construction - Google Patents

Bacterie d'acide lactique recombinee contenant un promoteur insere, et son procede de construction Download PDF

Info

Publication number
WO1994016086A1
WO1994016086A1 PCT/DK1994/000004 DK9400004W WO9416086A1 WO 1994016086 A1 WO1994016086 A1 WO 1994016086A1 DK 9400004 W DK9400004 W DK 9400004W WO 9416086 A1 WO9416086 A1 WO 9416086A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
promoter
lactic acid
bacterium
dna
Prior art date
Application number
PCT/DK1994/000004
Other languages
English (en)
Inventor
Hans Israelsen
Egon Bech Hansen
Eric Johansen
Søren Michael MADSEN
Dan Nilsson
Astrid Vrang
Original Assignee
Bioteknologisk Institut
Chr. Hansen A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26065017&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1994016086(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from DK921579A external-priority patent/DK157992D0/da
Priority claimed from DK98893A external-priority patent/DK98893D0/da
Priority to DK94904150.3T priority Critical patent/DK0677110T4/da
Priority to DE69434196T priority patent/DE69434196T3/de
Priority to CA002152898A priority patent/CA2152898C/fr
Application filed by Bioteknologisk Institut, Chr. Hansen A/S filed Critical Bioteknologisk Institut
Priority to AT94904150T priority patent/ATE285476T1/de
Priority to JP51560094A priority patent/JP3553065B2/ja
Priority to AU58325/94A priority patent/AU675821B2/en
Priority to EP94904150A priority patent/EP0677110B2/fr
Priority to US08/179,557 priority patent/US5837509A/en
Publication of WO1994016086A1 publication Critical patent/WO1994016086A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1051—Gene trapping, e.g. exon-, intron-, IRES-, signal sequence-trap cloning, trap vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/90—Vectors containing a transposable element

Definitions

  • This invention pertains to the field of genetically improved food grade lactic acid bacteria.
  • methods for isolating useful lactic acid bacterial promoters and construction of recombinant lactic acid bacteria in which such promoters are utilized to obtain improved lactic acid bacteria which are useful in the manu- facturing of foods, animal feed and probiotically active compositions are provided.
  • lactic acid bacterial cultures have been used in food production due to their ability to convert sugars by fermentation into preserving organic acids, predominantly lactic acid, and various metabolites associated with the development in fermented food products of desirable taste and flavour.
  • lactic acid bacteria produce hydrolytic enzymes including peptidases, proteases and lipolytic enzymes, the production of which may e.g. contribute to a desired flavour development in cheeses.
  • lactic acid bacterial starter cultures each being adapted to particular types of food products.
  • Such cultures are presently being selected from naturally occurring strains of lactic acid bacteria on the basis of characteristics such as their ability to ferment sugars present in the food product to be fermented, specific growth temperature requirements, pro ⁇ duction of desired flavouring compounds, the specific combi ⁇ nation of which characteristics renders a specifically selected wild-type culture useful for the production of a particular food product but normally less useful for the production of others.
  • lactic acid bacteria are generally recognized as safe (GRAS) food ingredients, even if they are present in a fermented food product as live bacteria at a very high number, such as 10 8 to 10 9 per g.
  • GRAS safe
  • Another approach to the improvement of lactic acid bacteria would be to have useful genes inserted into the chromosome of the bacteria or to enhance the expression of chromosomal genes coding for desired gene products.
  • an introduced gene which becomes integrated in the chromosome is generally stably inherited by daughter cells.
  • DD 228 564 dis- closes a method of preparing an expression vector capable of replication in E. coli and/or B . ⁇ ubtilis, comprising insert ⁇ ing into a unique restriction site a promoterless basic E . coli and/or B .
  • subtilis plasmid comprising a structural gene, a promoter-carrying DNA fragment isolated from a Streptococ ⁇ cus species by restriction with a restriction enzyme cor- responding to the unique restriction site of the basic plasmid, and isolating the thus recombinant vector from E . coli and/or B . subtilis transformed with the vector and expressing the structural gene.
  • Youngman et al. (1987) disclosed a method for the isolation of promoters in Bacillus spp. using the transposon Tn917. However, this method is based on the ability of Bacillus spp. to grow at temperatures above 37°C and it has furthermore been found that this transposition procedure in Bacillus spp. results in the transposon being integrated into a dominating hot spot whereby a single dominant integrant will occur.
  • sequences comprising a lactic acid bacterial promoter and/or promoter-signal peptide sequences may be used to replace weaker native promoters and/or promoter-signal peptide sequences in plasmids to obtain a more efficient expression and secretion of an E . coli gene product, viz. ⁇ -lactamase in the lactic acid bacterium Lactococcu ⁇ lactis .
  • These authors identified the Lactococcu ⁇ promoter sequences by means of a promoter probe vector capable of replication in E. coli and/or B .
  • the present invention relates to a method of isolating a lactic acid bacterial DNA fragment comprising a promoter, the method comprising the steps of:
  • a DNA molecule replicating in a lactic acid bacterium comprising (a) a transposable element comprising a promoterless structural gene as a promoter probe gene, (b) a detectable selective marker gene, and (c) an origin of replication which is func ⁇ tional in a lactic acid bacterium,
  • the invention provides methods of con ⁇ structing a recombinant lactic acid bacterium comprising the steps of: (i) isolating in accordance with the above method a DNA fragment comprising a regulatable lactic acid bacterial promoter,
  • step (iii) inserting the isolated fragment comprising the promoter into the lactic acid bacterium resulting from step (ii) upstream of the gene coding for a desired gene product, the inserted promoter thereby becoming operably - linked to said gene.
  • the invention relates to a method of constructing a recombinant lactic acid bacterium compris ⁇ ing the steps of:
  • a DNA molecule replicating in a lactic acid bacterium comprising (a) a transposable element comprising a promoterless structural gene as a promoter probe gene, (b) a detectable selective marker gene, and (c) an origin of replication which is func ⁇ tional in a lactic acid bacterium, (ii) introducing under conditions allowing transposition of the transposable element to occur, the DNA molecule of step (i) into a population of a lactic acid bacterium,
  • step (iv) identifying the site in a replicon of the lactic acid bacterial cell of step (iii) into which the trans ⁇ posable element is integratable
  • the expression of the inserted gene hereby being altered as compared to the expression of the gene when operably linked to its native promoter.
  • the present invention relates to a recombinant lactic acid bacterium comprising a gene coding for a desired gene product and operably linked thereto a regulatable lactic acid bacterial promoter not natively associated with the gene, the presence of said promoter resulting in the expression of the gene being altered as compared to the expression of the gene when operably linked to its native promoter and to an isolated DNA fragment com ⁇ prising a lactic acid bacterial promoter which is functional in a lactic acid bacterium and operably linked thereto, a gene coding for a desired gene product, said promoter being one which is not naturally associated with the gene.
  • the invention also relates to the use of a recombinant lactic acid bacterium as defined herein in the manufacturing of food products, in the preservation of animal feed and in the manufacturing of a probiotically active composition.
  • the present invention provides a recombinant plasmid comprising a DNA sequence comprising a regulatable lactic acid bacterial promoter, a gene coding for a desired gene product, a lactic acid bacterial replicon which is functional in a lactic acid bacterium, an insertion site allowing the DNA sequence to be inserted so that the gene coding for the desired gene product is operably linked to the promoter, whereby the gene can be transcribed when the plasmid is present in a lactic acid bacterium.
  • the present invention relates to a recombinant plasmid comprising a vector comprising a promo ⁇ terless gene coding for a desired gene product, a theta- replicating lactic acid bacterial replicon which is function ⁇ al in a lactic acid bacterium and an insertion site allowing a DNA sequence to be inserted, and inserted into said inser- tion site a DNA sequence comprising a regulatable lactic acid bacterial promoter, the insertion resulting in that the gene coding for the desired gene product is operably linked to the promoter, whereby the gene is transcribed.
  • a plasmid may comprise as the vector, the plasmid pAK80.
  • a primary object of the present invention is to provide the means of constructing improved lactic acid bacteria which are food grade in the sense that they contain only DNA derived from a lactic acid bacterial species or DNA from a non-lactic acid bacterial species the presence of which may be generally recognized as safe.
  • lactic acid bacterium designates gram-positive, microaerophilic or anaerobic bacteria which ferment sugars with the production of acids including lactic acid as the predominantly produced acid, acetic acid and propionic acid.
  • the industrially most useful lactic acid bacteria are found among Lactococcus spp., Streptococcus spp., Lactobacillus spp., Leuconostoc spp., Pediococcus spp., BreviJbacterimn spp., Propionibacterium spp. and Bifidobacterium spp.
  • the invention provides in one aspect a method of isolating a lactic acid bacterial DNA fragment comprising a promoter.
  • a DNA molecule capable of replica ⁇ ting in a lactic acid bacterium, said molecule comprising a transposable element, a promoterless structural gene as a promoter probe gene, a detectable selective marker gene, and an origin of replication which is functional in a lactic acid bacterium.
  • host cell promoters may be identified by the detection of expression in the host cell of the promoterless structural gene of the integrated DNA fragment, since the structural gene lacking a promoter region cannot be expressed unless the insertion of the transposable element occurs at a site of a replicon where a promoter region present on the disrupted replicon molecule becomes operably linked to the gene.
  • transposable element is used to designate double stranded DNA molecules which possess the capacity to insert themselves into other DNA molecules.
  • transposition The process by which a transposable element inserts itself is termed “transposition” and this process requires a protein known as a “transposase” (cf. reference 3 for detailed expla ⁇ nations) .
  • transposase a protein known as a "transposase” (cf. reference 3 for detailed expla ⁇ nations) .
  • the transposition process results in the insertion of the transposable element into a particular site in a second DNA molecule. This insertion has several significant consequences. First, the original DNA sequence of the second (recipient) DNA molecule is physically and functionally disrupted.
  • transposition results in the incor ⁇ poration of new DNA into a second DNA molecule, it provides the means of introducing homologous or heterologous DNA into a particular DNA sequence.
  • transposable element so that its insertion into a DNA sequence can provide information regarding the expression and organization of the DNA sequence which flank the site of insertion. For example, it is possible to insert a gene which encodes a non-expressed or non-excreted gene product near the end of a transposable element and accordingly, such a transposable element provides a probe for promoters and secretion signal peptide.
  • Transposable elements which may be used in accordance with the invention are diverse in both size and functional organ- ization.
  • simple transposable elements termed “inser ⁇ tion sequences”
  • insertion sequences possess special ⁇ ized termini which contain complementary sequences which are inverted repeats of one another. The presence of such inverted repeat sequences appears to be essential for trans ⁇ position.
  • Transposase enzymes are thought to mediate transpo ⁇ sition by binding to DNA sequences at both ends of the transposable element.
  • transposable elements include transposons.
  • the term "transposons” denotes transposable elements which are larger than insertion sequences and which in addition to the trans ⁇ posase system encode several gene products such as proteins which confer cellular resistance to antibiotics or other selectable determinants.
  • transposons which are functional in gram-positive species have been isolated and studied, mainly in Bacillus spp, Listeria spp and Coryne - bacterium spp, but also to less extent in lactic acid bacteria.
  • Examples of transposons which may be used in lactic acid bacteria include T ⁇ .916 isolated from Streptococcus and functional i.a.
  • a useful transpo ⁇ sable element is one that mediate operon fusion and trans ⁇ criptional fusion.
  • fusion-generating deri ⁇ vatives of a transposon which has lactic acid bacterial DNA molecules as their target including derivatives of the above gram-positive transposons may be used in the present method.
  • fusion-generating transposon derivatives may comprise a promoterless structural gene, the expression of which is readily detectable.
  • a promoterless structural gene may e.g.
  • a gene coding for a gene product conferring antibiotic resistance a gene coding for a gene product complementing an auxotrophic deficiency or a gene coding for an enzyme having a readily detectable end product such as a product resulting in a colour reaction in an appropriate solid or liquid medium.
  • the insertion of a promoterless lacZ gene into a plasmid comprising the transposon, in an orientation suitable for obtaining transposition-mediated fusions results in a plasmid vector that turns bacteria containing it, blue when grown on plates containing 5-bromo-4-chloro-3-indolyl-/3-D- galactopyranoside (X-gal) as a result of the expression of ⁇ - galactosidase.
  • Transpositional insertions into the chromosome or into a plasmid, generated with such vectors produce white colonies, unless the insertions occur downstream of a func ⁇ tional promoter and in the right orientation to effect a transcriptional fusion.
  • a suitable fusion-generating transposon derivative may comprise the promoterless gene cat- 86 gene, the gene product of which mediate chloramphenicol resistance.
  • transposable elements vary greatly in target specificity, and their sites of insertion often exhibit little or no similarity to element sequences. Some elements may have from a few to hundreds of target sites in any gene, although no element has been found to insert completely randomly. Other elements are highly site specific, inserting into just a single chromosomal site. Yet other elements seem to insert quasi-randomly in some species, but prefer either particular regions of DNAs or certain regions of DNA molecules.
  • transposable element which is randomly or at least quasi- randomly integrated is preferred, the term "quasi-randomly” being defined herein as a degree of integration randomness in terms of the proportion of the total number of insertion. events which is observed in a target DNA fragment of a known size relative to the proportion of insertions expected in this DNA fragment which is at the most 5, preferably at the most 4, more preferably at the most 3 and in particular at the most 2.5.
  • transposable elements which have a preference for chromosomal DNA may be preferred.
  • a DNA molecule capable of replicating in a lactic acid bacterium and comprising a fusi ⁇ on-generating derivative of the Tn327 transposon may be selected for the present method.
  • Such derivatives include plasmids of the pTV series which include pTV32, pLTVl, pLTV3, pTV51, pTV52 and pTV53. Of these, pTV32 and pLTVl may be particularly useful.
  • the DNA molecule as provided in step (i) of the present method comprises a detectable selective marker gene allowing the selection of cells in which the DNA fragment has been introduced.
  • convenient marker genes include ones coding for gene products conferring resistance to antibiotics, e.g. resistance to macrolide antibiotics such as erythromycin and lincomycin; tetracycline, ⁇ -lactam anti ⁇ biotics and chloramphenicol.
  • the marker gene may code for the complementation of auxotrophy in the host cell into which the DNA fragment is introduced or it may be a gene coding for an enzyme capable of generating a read- ily detectable end product such as e.g. the above-mentioned lacZ gene.
  • the DNA molecule as defined above is introduced into a population of cells of a lactic acid bacterium.
  • Such an introduction may be carried out in accordance with known techniques of introducing DNA into a host cells including transformation of protoplasted cells, transformation by electroporation or, if the DNA fragment is a conjugative element, by conjugation.
  • the se ⁇ lected method should preferably result in a frequency of DNA introduction which is at least 10 4 recombinant cells per ⁇ g of DNA such as at least 5 x 10 4 per ⁇ g of DNA, e.g. at least 10 5 per ⁇ g of DNA.
  • step (ii) may include a substep allowing the introduced replicon to repli ⁇ cate, followed by a procedure to study to what extent repli ⁇ cation has occurred in the transformant or exconjugant.
  • a suitable extent of replication is considered to be a copy number which is in the range of 5 to 20 per cell.
  • step (ii) comprises subjecting the transformant or exconjugant cells to conditions which allow transposition to occur.
  • Transposition in non-lactic acid bacteria may be induced by one or more shifts in the environ- mental conditions of the cells.
  • the procedure for pTV-based TnS17 mutagenesis in B. subtilis includes a step involving an antibiotic switch combined with a temperature upshift. Both Tn917 erm gene expression and transposition are induced in B .
  • subtilis by erythromycin (reference 57) .
  • the replication activity of pE194Ts-rep is blocked at temperatures above 37°C (reference 56) . Consequently, curing for pTV plasmids, induction of and selection for transpositions are done by growing B. subtilis at temperatures exceeding 42°C in the presence of erythromy- cin.
  • step (ii) of the present method includes a substep where transpo- sition of free transposable element-containing DNA molecules in transformed lactic acid bacteria is induced with a con ⁇ comitant curing of such free molecules by growing the trans- formants at a temperature in the range of 20 to 35°C such as 30°C in the presence of an antibiotic to which the transpo- sable element confers resistance.
  • integrant cells are cloned and subjected to a selection procedure to detect integrant cells wherein the promoterless gene of the transposable element is expressible. This selection procedure will depend on the type of the promoterless gene. When e.g.
  • the selection may be carried out by plating the cloned integrants onto a medium containing a substance degradable by jS-galactosidase with the develop ⁇ ment of a colour or, if an antibiotic resistance gene is used, the integrants may be selected on a medium supplemented with the corresponding antibiotic.
  • step (iv) of the present method a selected integrant expressing the promoterless structural gene is cloned and a lactic acid bacterial replicon region including a promoter being operably linked to the originally promoterless gene and possibly sequences regulating the function of the promoter is isolated from the cloned cells by the use of appropriate restriction enzymes.
  • the resulting primary promoter-contain ⁇ ing DNA sequences may have varying sizes depending on the location of restriction sites for the selected enzyme(s).
  • a primary promoter-containing fragment may e.g. have a size which is in the range of 40 to 600 kb
  • a subsequence comprising the promoter and possibly other sequences required for its regulation may more appropriately have a size which is in the range of 50 to 10,000 base pairs.
  • the population of cells of a lactic acid bacterium into which the DNA fragment comprising the transposable element is introduced in the above-defined step (ii) are preferably selected from Lac- tococcus spp., Streptococcus spp., Lactobacillus spp., Leuco - nostoc spp., Pediococcus spp., Brevibacterium spp., Propioni - bacterium spp. and Bifidobacterium spp.
  • the lactic acid bacterium is selected from Lactoccus lactis subspecies lactis such as the Lactoccus lactis ssp.
  • the function of the bacteria is regulatable so that specific phenotypic traits of the lactic acid bacterial starter cultures may be turned on or switched off or the rate of expression of that trait is enhanced or reduced during specified periods of the manufacturing process including a maturation process.
  • the present method may, in one advantageous embodiment be a method wherein the promoter comprised in the DNA fragment being isolated and selected is a regulatable promoter.
  • a regulatable promoter may be regulatable by a factor selected from the pH and/or the content of arginine in the environment, the growth temperature, a temperature shift eliciting the expression of heat chock genes, the composition of the growth medium including the ionic strength/NaCl con ⁇ tent, and the growth phase/growth rate of the lactic acid bacterium into which the promoter-comprising DNA molecule is introduced.
  • a promoter regulation mode is the phenomenon of stringent control by which is understood that the RNA synthesis of a cell is suspended in case the cell is starved for an essential nutrient such as an amino acid.
  • a suitable regulatable promoter in accordance with the present invention may be one which is under strin ⁇ gent control.
  • An other example of a useful mode of regulating a promoter is to select a promoter that regulates a gene coding for an enzyme involved in the de novo synthesis of purine nucleoti- des from their precursors.
  • a promoter which is regulated by being re ⁇ pressed in the presence of purine compounds, in front of a gene whose expression is to be regulated, this gene will only be expressed when the bacterium is growing in a medium not containing purine compound precursors.
  • An example of such a regulated promoter is the lactococcal purD promoter as descr ⁇ ibed hereinbelow.
  • the isolated promoter may be screened for temperature/growth phase regulation by plating cells into which the promoter being operably linked to a gene coding for a gene product the expression of which is readily detectable, has been intro ⁇ quizzed by transposition, onto a suitable medium and incubating the plates at varying temperatures such as different tempe ⁇ ratures within the range of 10 to 30°C and observing for temperature dependent gene expression.
  • temperatures such as different tempe ⁇ ratures within the range of 10 to 30°C and observing for temperature dependent gene expression.
  • the growth rate of the integrants cells will depend on the growth temperature it cannot be determined whether an observed apparently temperature-dependent expression is a result of a direct temperature regulation or the dependence is due to growth phase regulation.
  • a possible pH and/or arginine dependent regulation of gene expression may be screened for by plating the above integrant cells onto media having different compositions which will result in varying pH values after growth of the integrant cell cultures.
  • the cells may be grown on GM17 medium where the final pH will be about 5 and on a modified GM17 medium having 1/5 of the normal glucose content and supplemented with 0.5% arginine.
  • the pH in such a medium after growth of a culture of Lactococcus lactis integrant cells as defined above will be about 9.
  • a pH and/or arginine dependent regulation is demonstrated.
  • one object of the present invention is to provide the means of constructing improved recombinant lactic acid bacteria by inserting promoter-containing sequences which result in enhanced expression of lactic acid bacterial gene(s) coding for desired gene products, it is part of the invention to screen promoter sequences for strength. This screening is carried out in accordance with methods which are known per se .
  • the present invention relates in a further aspect to a method of constructing a recombinant lactic acid bacterium containing a lactic acid bacterial gene coding for a desired gene product, the method comprising as a first step the isolation in accordance with the method as defined above, of a DNA sequence comprising a lactic acid bacterial promoter including where appropriate, additional regulatory sequences.
  • the method comprises in a second step the insertion of the thus isolated DNA sequence into a lactic acid bacterium upstream of the lactic acid bacterial gene coding for the desired gene product so that the inserted promoter and possibly the above-defined regulatory sequences thereby becomes operably linked to the gene coding for a desired gene product.
  • the gene coding for a desired gene product may in accordance with the present invention be a homologous gene or it may be an inserted heterologous gene including a gene which is derived from a lactic acid bacterium.
  • the gene When the gene is an inserted gene it may be inserted on the same DNA sequence as that comprising the promoter sequence or it may be inserted on a separate DNA sequence.
  • the insertion of the above isolated promoter-containing sequence may be on the chromosome of the lactic acid bacterium and in an other useful embodiment, the sequence may be inserted extrachromosomally e.g. on a plasmid harboured by the bacterium.
  • the promoter-containing sequence integrated into the chromosome, since the sequence and the gene to which it is operably linked is hereby more stably contained as compared to a location on an extrachromo ⁇ somal element.
  • the insertion of the promoter-containing sequence is done according to gene technology methods which are known per se such as by insertion into a plasmid by conventional restriction and ligation procedures or integra ⁇ tion into the chromosome by the use of transposons or bacteriophages or by conventional recombmational techniques.
  • the isolated promoter-con ⁇ taining sequence comprises a further sequence whereby the isolated promoter becomes regulated by a stochastic event.
  • a regulation may e.g. be useful in lactic acid cultures for which it is advantageous to have a gradually decreasing activity of the gene under control of the inserted promoter- containing sequence.
  • Such further sequences may e.g. be sequences which result in a recombinational excision of the promoter or of genes coding for substances which are posi ⁇ tively needed for the promoter function.
  • a stochastic regulation of the promoter function may also be in the form of recombinational excision of a regulatory se- quence inhibiting the function of the promoter whereby a gradually increasing promoter activity is obtained at the recombinant cell population level.
  • the present invention provides a further method of constructing a recombinant lactic acid bacterium which bacterium comprises a gene coding for a desired gene product, the expression of which is altered as compared to expression of the gene when it is operably linked to its native promoter.
  • a DNA molecule as defined above and comprising a transposable element with a promoter probe gene is utilized to identify a site/sites in a lactic acid bacterial replicon (chromosome or plasmid) in which the transposable element is integratable and where the promoterless probe gene becomes operably linked to a promoter sequence present in the replicon and subsequently, inserting in a non-integrant lactic acid bacterial cell at that or these sites or at a site/sites which are functionally equiva ⁇ lent thereto, a gene coding for a desired gene product, whereby this gene becomes operably linked to the identified promoter sequence.
  • transposable element will become inserted between two base pairs
  • a gene coding for a desired gene product may, besides being inserted between those two base pairs also be inserted at a neighbouring site which is located at a distance from that specific insertion (integration) site which will still allow the identified promoter sequence to control transcription of the inserted gene.
  • neighbouring sites are referred to as functionally equivalent sites. It is contem ⁇ plated that the distance from the specific transposon inte- gration site where such functionally equivalent sites may be found is within the range of 1 to 2000 base pairs.
  • the gene coding for a desired gene product which is inserted into the above-defined site may be a homologous or a heterologous gene including a gene derived from a lactic acid bacterium.
  • the present invention provides in a further aspect a recombi ⁇ nant lactic acid bacterium comprising a gene coding for a desired gene product and operably linked thereto a lactic acid bacterial promoter not natively associated with the gene, the presence of said promoter resulting in the expres ⁇ sion of the gene being altered as compared to the expression of the gene when operably linked to its native promoter.
  • altered expression is used to indicate that the regulation of the expression of the gene quantitatively or qualitatively different from the regulation of the gene when operably linked to its native promoter.
  • a quantitatively different expression may be recognizable as an increased level of expression of the gene products such as at least a 10% increased expression. It may e.g. be advantageous that the expression is increased by at least 25% such as at least 50%.
  • a useful recombinant bacterium may have an expression the level of which is at least 10% reduced, pre ⁇ ferably at least 25% or more preferably at least 50% reduced.
  • the expression of a gene coding for a desired gene product, the native promoter of which is a constitutive promoter may be altered by operably linking it to a regu ⁇ latable promoter or the expression of a gene having a native regulatable promoter may be altered by linking it to a con ⁇ stitutive promoter.
  • the expression of a gene having a native regulatable promoter may be qualitat ⁇ ively altered by linking it to a regulatable promoter having a different mode of regulation.
  • the present invention provides the recombinant lactic acid bacterium as one comprising an in- serted lactic acid promoter-comprising DNA sequence as de ⁇ fined above, the lactic acid bacterial promoter being operab ⁇ ly linked to a gene coding for a desired gene product.
  • the gene coding for a desired gene product may in accordance with the invention be a chromosomal gene or an extrachromosomally located gene.
  • the above gene coding for a desired gene product may be a native gene which in the pres ⁇ ent context is defined as a homologous gene which is in its natural position on a chromosome or on a plasmid naturally occurring in a particular lactic acid bacterium or it may be a homologous gene which is isolated from its natural position and reinserted into the same lactic acid bacterial strain, but in an other position.
  • the gene coding for a desired gene product is a heterologous gene isolated from a non-lactic acid bacterial species or from an other lactic acid bacterial species.
  • the inserted promoter is a regulatable promoter
  • the mode of regulation may be selected from the factors as defined hereinbefore, including regulation by a stochastic event.
  • a plasmid is one which further comprises a gene coding for a desired gene product as defined herein, a lactic acid bacterial replicon which is functional in a lactic acid bacterium, an insertion site allowing the DNA sequence to be inserted so that the gene coding for the desired gene product is operably linked to the promoter, whereby the gene can be transcribed when the plasmid is present in a lactic acid bacterium.
  • the promoter inserted into the plasmid may preferably be a promoter which is regulatable as it is described herein.
  • a suitable lactic acid bacterium is one harbouring the plasmid pAK80 which is described in the fol ⁇ lowing or a derivative hereof including pAK80:SB, pAK80:143, pAK80:162, pAK80:163, pAK80:170, pAK80:224 and pAK80:242.
  • the lactic acid bacterium to be recombined in accordance with the present invention may carry the gene coding for a desired gene product on a plasmid having a conditional replication behaviour so that the plasmid copy number under certain conditions is substantially increased, e.g. to several hundreds or thousands. Plasmids having such a replication behaviour is also designated run ⁇ away plasmids.
  • a recombinant lactic acid bacterium as defined herein may be one which is selected from Lactococcus spp. including Lacto ⁇ coccus lactis ssp. lactis, Lactococcus lactis ssp. diacety- lactis and Lactococcus lactis ssp. cremoris, Streptococcus spp. including Streptococcus salivarius ssp. thermophilus, Lactobacillus spp. including Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus delbruckii ssp.
  • the recombinant lactic acid bacte ⁇ rium is one in which the inserted promoter-containing sequence as defined herein is derived from Lactococcus spp. such as from Lactoccus lactis subspecies lactis. , Strepto ⁇ coccus spp., Lactobacillus spp., Leuconostoc spp., Pedio- coccus spp., Brevibacterium spp., Propionibacterium spp. and Bifidobacterium spp.
  • Lactococcus spp. such as from Lactoccus lactis subspecies lactis. , Strepto ⁇ coccus spp., Lactobacillus spp., Leuconostoc spp., Pedio- coccus spp., Brevibacterium spp., Propionibacterium spp. and Bifidobacterium spp.
  • the inserted promoter may be isolated from Lactoccus lactis sub ⁇ species lactis strains MG1614, MG1363 or CHCC285 (Chr. Han- sens Laboratorium A/S) .
  • interesting promoters are tRNA and rRNA promoters including the PI and PII promoters and the purD promoter from Lactoccus lactis subspecies lactis as described in the following.
  • Particularly interesting promo ⁇ ters are strong promoters such as tRNA or rRNA promoters which comprise the conserved sequence (motif) AGTT.
  • the present recombinant lactic acid bacterium is preferably one in which the gene coding for a desired gene product is selected from a gene coding for a lipase, a gene coding for a nuclease, a gene coding for a peptidase such as an aminopep- tidase, a gene coding for a protease, a gene coding for a gene product involved in carbohydrate metabolism, a gene coding for a gene product involved in citrate metabolism, a gene coding for a gene product involved in bacteriophage resistance, a gene coding for a lytic enzyme such as lysozyme or a phage lytic enzyme and a gene coding for a bacteriocin including nisin.
  • the gene coding for a desired gene product may be one the gene product of which confer resistance to a bacteriocin such as nisin, or pediocin.
  • genes coding for a desired gene product may be genes derived from a lactic acid bacterium or they may suit ⁇ ably be genes derived from a non-lactic acid bacterial micro- bial species or from a eucaryotic cell including plant cells and human or animal cells.
  • a useful gene derived from a eucaryotic cell may be mentioned plasminogen.
  • the gene is selected from the lacL gene of a Leuconostoc spp., the lacM gene of a Leuconostoc spp. and a Lactococcus lactis ssp. lactis gene coding for a peptidase such as a lysine aminopeptidase.
  • the recombinant lactic acid bacterium as defined herein may suitably be one in which a gene coding for a desired gene product is inserted at a site in a replicon where it is under the control of a promoter present in the replicon, which site is identifiable by the insertion of a promoterless structural gene by means of a transposable element comprising the promoterless struc ⁇ tural gene whereby the originally promoterless gene becomes expressible by being operably linked to the promoter present in said replicon, the insertion of the gene at said site having resulted in said gene becoming operably linked to the promoter being present in the replicon.
  • the site at which the gene coding for a desired gene product may be inserted is not limited to the specific site between two base pairs as identified by the insertion of the transposable element, but may be any site within a distance from this specific site which may still allow the lactic acid bacterial promoter to which the promo ⁇ terless gene of the transposable element may become operably linked, to control the expression of the inserted gene.
  • Insertion sites which are in such a distance from the speci ⁇ fically identified site may in the present context be refer ⁇ red to as functionally equivalent insertion sites.
  • a recombinant lactic acid bacterium into which has been inserted a promoter-comprising sequence as defined above as well as a gene coding for a desired gene product also as defined above.
  • the present invention provides in a still further aspect an isolated DNA fragment comprising (i) a regulatable lactic acid bacterial promoter which is func ⁇ tional in a lactic acid bacterium and operably linked thereto (ii) a gene coding for a desired gene product, said promoter being one which is not naturally associated with the gene and which confers to the gene coding for a desired gene product an altered expression as defined hereinbefore.
  • DNA fragment is isolated in accordance with the method as described herein.
  • the DNA frag ⁇ ment is one which further comprises at least one transcrip- tion terminator.
  • the present DNA fragment is preferably a fragment having a size which is in the range of 100 to 10000 base pairs such as a size which is in the range of 200 to 5000 base pairs.
  • the DNA fragment may also be one which further comprises sequences coding for gene products involved in the regulation of the promoter.
  • the DNA fragment is one in which the gene coding for a desired gene product is selected from a gene coding for a lipase, a gene coding for a peptidase, a gene coding for a protease, a gene coding for a gene product involved in carbohydrate metabolism, a gene coding for a gene product involved in citrate metabolism, a gene coding for a gene product involved in bacteriophage resistance, a gene coding for a lytic enzyme and a gene coding for a bacterio ⁇ cin.
  • the gene may also be one which codes for a gene product conferring resistance to an antibiotic or a bacteriocin such as e.g. nisin or pediocin.
  • the DNA fragment as defined above may comprise a gene coding for a desired gene product which is a homologous or a heterologous gene including a gene derived from a lactic acid bacterium. Accordingly, the gene may in certain preferred embodiments be one which is selected from the lacL gene of a Leuconostoc spp. , the lacM gene of a Leuconostoc spp. and a Lactococcus lactis ssp. lactis gene coding for a lysine aminopeptidase.
  • the lactic acid bacterial promoter comprised in the DNA fragment may be isolated from any lactic acid bacterial species as mentioned herein and may be a constitutive or regulatable promoter as also defined above.
  • the promoter is selected from the regulatable promoter contained in the Lactococcus lactis ssp. lactis MG1363 integrant clone P139-170 deposited under the accession number DSM 7360 and the promoter contained in the Lactococcus lactis ssp. lactis MG1614 integrant clone 63b deposited under the accession number DSM 7361.
  • the recombinant bacterium may in accordance with the inven ⁇ tion be one in which the inserted DNA sequence comprising a regulatable lactic acid bacterial promoter is inserted into a vector comprising a promoterless gene coding for a desired gene product, a theta-replicating lactic acid bacterial replicon which is functional in the bacterium, an insertion site allowing the DNA sequence to be inserted so that the gene coding for the desired gene product is operably linked to the promoter, whereby the gene is transcribed.
  • such a bacterium may as the vector into which the inserted DNA sequence is inserted comprise the plasmid pAK80.
  • the recombinant lactic acid bacterium as provided herein may be useful in starter cultures for the manufacturing of food products including dairy products, meat products and vege ⁇ table products and in the preservation of animal feed.
  • the present recombinant bacteria are par ⁇ ticularly interesting as inoculants in field crops which are to be ensiled.
  • the bacteria When the bacteria are to be used for these purposes they may conveniently be provided in the form of dried or frozen bacterial concentrates e.g. containing 10 10 to 10 12 colony forming units (CFUs) per g of concentrate.
  • probiotically active indicates that the bacteria selected for this purpose have characteris ⁇ tics which enables them to colonize in the gastrointestinal tract and hereby exert a positive regulatory effect on the microbial flora in this habitat. Such effect may be recogniz ⁇ able as an improved food or feed conversion in human or animals to which the bacteria are administered, or as an increased resistance against invading pathogenic microorga ⁇ nisms.
  • the present recombinant lactic acid bacteria may be useful in the preparation of recombinant vaccine strains in which one or more genes coding for antigenic determinants are inserted.
  • the recombinant plasmid according to the present invention is preferably one in which the lactic acid bacterial promoter is a promoter which is regulatable in a manner such as it has been defined hereinbefore.
  • useful plasmids may be selected from the plasmid pAK80 or a derivative hereof including pAK80:SB, pAK80:143, pAK80:162, pAK80:163, pAK80:170, pAK80:224 and pAK80:242.
  • Figure 1 is a map of pTV32 in which the following abbrevia ⁇ tions indicate restriction enzyme sites: Sail, EcoRI, PstI, Xbal, Knpl and Smal, Tn917 indicates the transposon part, er indicates the gene coding for erythromycin resistance, bla the gene coding for 0-lactamase, ColEI rep the origin of replication of the ColEI plasmid, cat indicate the gene coding for chloramphenicol acetyltransferase mediating resis ⁇ tance to chloramphenicol, lacZ the promoterless ⁇ -galactosi- dase gene or E. coli , tet indicates the gene coding for tetracycline resistance and pE194 Ts rep indicates the tem- perature sensitive origin of replication derived from plasmid pE194,
  • Figure 2 is a map of pLTVl (abbreviations, cf. the legend to Figure l) ,
  • Figure 3 illustrates Southern hybridization analysis of 12 independent L. lactis ssp. lactis TV32 integrants. DNA from integrants, indicated on top of each lane, was digested with EcoRI, electrophoresed through an agarose gel, transferred to a nylon membrane and hybridized with A: 32 P labelled pLTVl. B: 32 P labelled pE194 replicon-specific probe. Size markers are given in kilobase pairs,
  • Figure 4 shows pulsed-field gel electrophoresis (PFGE) of Smal-digested DNA from L. lactis ssp. lactis TV32 integrants. Integrant numbers are indicated on top of the lanes.
  • A lambda ladder (Promega, Madison, USA) starting from the bottom with 48.5 kb, 97.0 kb, 145.5 kb etc.
  • B delta 39 lambda ladder (Promega) starting from the bottom with 39.0 kb, 78.0 kb, 117 kb etc.
  • M is Smal-digested DNA from L. lactis ssp. lactis MG1614,
  • Figure 5 illustrates pulsed-field gel electrophoresis (PFGE) of 19 clones (E1-E19) picked from a culture of Lactococcus lactis ssp. lactis MG1614 comprising a dominant TV32 in- tegrant. Lanes indicated by A, B and M are as indicated above for Figure 5. The digestion of clone E5 resulted in fragments which could not be visualized as discrete bands,
  • Figure 6 illustrates pulsed-field gel electrophoresis (PFGE) of 18 clones (K1-K2, K4-K14, K16-K20) picked randomly from a pooled culture of Lactococcus lactis ssp. lactis MG1614 TV32 integrants. Lanes indicated by A, B and M are as indicated above for Figure 5,
  • Figure 7 shows the streak pattern for investigation of regu ⁇ lated lacZ expression in promoter fusion clone collection no. 1.
  • Each clone was streaked onto a plate containing 1 ⁇ g/ml erythromycin and 320 ⁇ g/ml of X-gal in a straight line of about 0.5 cm,
  • Figure 8 illustrates the construction of pAK67.7 as described in Example 6.
  • P represents the -galactosidase promoter of Leuconostoc mesenteroides subsp. cremoris, and rbs the ribo- some binding site.
  • the sites of homology to the primers lac-1 and lac-2 are indicated by small arrows.
  • the ribosome binding site is also present in pA 67.7,
  • Figure 9 illustrates the growth and /3-galactosidase activity of the LTV1 integrant 170 grown at pH 5.5 and 7.0
  • Figure 10 illustrates the growth and /3-galactosidase activity of the LTV1 integrant SB grown at pH 5.5 and 7.0
  • Figures 11 illustrates a DNA fragment from Lactococcus lactis subsp. lactis strain CHCC285 containing seven tRNA genes and a 5S rRNA gene arranged in a single operon including two promoters and two putative transcription terminators,
  • Figure 12 shows the gene organization and nucleotide sequence of trnA.
  • the deduced amino acid sequence of ' ma is shown in one-letter code below, the stop codon indicated by an aste ⁇ risk.
  • Putative -35 and -10 promoter sequences (PI, PII) , a conserved motif in the -44 region and a conserved sequence that might be involved in stringent control (Chiaruttini & Milet, 1993; Ogasawara et al., 1983) are double underlined.
  • the coding regions of the tRNA genes and rrfU are underlined.
  • Putative transcription terminators are indicated by arrows above the sequence.
  • the location of restriction enzyme sites for Seal and Spel, used for the cloning and promoter cloning, is shown above the sequence,
  • Figure 13 shows a comparison of tRNA and rRNA promoter sequences from Lactococcus lactis and Lactococcus cremoris.
  • the conserved -44 region, -35 region, a doublet TG (cf. reference 19) , -10 and a conserved sequence suggested to be involved in control of expression during the stringent response of Bacillus subtilis (Ogasawara et al., 1983) are underlined.
  • A PI of trnA
  • B PII of trnA
  • C P21 from a Lactococcus cremoris tRNA leu gene (van der Vossen et al., 1987; this study)
  • D P2 from Lactococcus lactis (Koivula et al., 1991)
  • E promoter region in front of a Lactococcus lactis ochre suppressor gene (F. Dickely & E. Bech Hansen, personal communication)
  • F P10 from a Lactococcus lactis tRNA arg gene (Koivula et al. , 1991; this study);
  • G promoter of a Lactococcus lactis rRNA operon (Chiaruttini & Milet,
  • Figure 15 illustrates the OD 600 and the ⁇ -galactosidase activity versus time during fermenter growth of pSMA344/MG- 1363 in liquid medium under controlled conditions
  • Figure 16 is a restriction map of a 9.7 kb lactococcal EcoRI- Clal fragment from pl70 and of deletion derivatives
  • Figure 17 is a restriction map of a 4.0 kb lactococcal Ndel - Clal fragment of pl70 and of deletion derivatives, and
  • Figure 18 illustrates the Campbell-like integration of a n ⁇ n- replicating plasmid into the lactic acid bacterial chromosome
  • P represents a promoter
  • Erm represent an erythromycin resistance gene
  • reporter gene is the ⁇ -galactosidase gene from Leuconostoc mesenteroides
  • E. coli replicon is the pACYC replicon from pVA891 and where black areas illus ⁇ trate the region of DNA homology between the plasmid and the chromosome and arrows indicate the direction of transcription- from the promoter P.
  • pTV plasmids containing derivatives of the transposon Tn_917 from the lactic acid bacterial species Streptococcus faecalis have been constructed for use in Bacillus subtilis and other gram-positive bacteria (refe ⁇ rences 10, 55 and 57) .
  • Two derivatives of the pTV plasmid series, pTV32 (reference 57) and pLTVl (reference 55) were selected for this and the following experiments.
  • pTV32 (15.6 kb) and pLTVl (20.6 kb) contain (i) a temperature sensitive replicon (pE194Ts- rep) from the plasmid E194, (ii) on the replicon part of the plasmid, a cat gene (pTV32) which confers chloramphenicol resistance (Cm r ) or tetracycline resistance (Tc r ) gene (pLTVl) , (iii) Tn917 harbouring an erm gene which confers erythromycin resistance (Em r ) , and (iv) a promoterless E.
  • coli lacZ gene with a ribosomal binding site from Bacillus subtilis inserted in non-essential Tn_917 DNA at the erm-proximal end ( Figures 1 and 2) .
  • pTV32 and pLTVl were isolated from E. coli PY1173 and Bacillus subtilis PY258, respectively. These strains were obtained from P. Youngman, University of Pennsylvania.
  • Lactococcus lactis ssp. lactis MG1614 which is a prophage- free, plasmid-free, streptomycin- and rifampicin resistant derivative of strain NCDO 712 was transformed with pTV32 or pLTVl using the electroporation method described by Holo and Ness (reference 20) and primary transformants were selected by plating onto M17 medium (Sigma Chemical Co.) containing 0.5% glucose (GM17 medium) supplemented with 0.5 M sucrose, 2mM CaCl 2 (SGM17,Ca medium) and the appropriate selective antibiotic (erythromycin or chloramphenicol) and incubated at 30°C.
  • the antibiotics were purchased from Sigma and were used at the following concentrations: erythromycin, 1.0 ⁇ g ml "1 ; chloramphenicol, 5.0 ⁇ g ml "1 .
  • the transformation efficiencies were 10 4 to 5 x 10 4 transformants per ⁇ g of DNA when selecting for Cm r or Em r .
  • Selected primary transformant colonies were transferred to GM17 liquid medium supplemented with 5.0 ⁇ g ml "1 of chlor ⁇ amphenicol and the transformant cells were grown up till a number of generations being in the range of 10 to 50.
  • Plasmid DNA was subsequently extracted from these transformants by performing an alkaline lysis of the cells substantially in accordance with the method described by Birnboim et al. (reference 6) with modifications as indicated in the follow ⁇ ing. Cells were grown exponentially to an A 600 of 0.3, and 5 ml cultures were harvested by centrifugation at 4,000 x g.
  • lactis MG1614 as well as the restriction enzyme sites EcoRI, Sail and Hind III were retained as compared to with the original plasmids.
  • the level of recovery in the above plasmid preparation procedure was 100%, the average copy number of both the plasmids in the trans ⁇ formed Lactococcus lactis ssp.
  • lactis MG1614 was estimated to be 6 to 12 copies per cell by performing a comparison on agarose gels with a standard of phage lambda DNA of known concentration digested with Hindlll. Accordingly, it could be concluded from this experiment that lactic acid bacteria may be transformed with pTV32 and pLTVl at a high efficiency and that these plasmids are capable of replicating in a lactic acid bacterium.
  • Lactococcus lactis ssp. lactis MC1614 ceases to grow in M17 broth (Sigma Chemical Co.) containing 0.5 glucose at tempera ⁇ tures exceeding 37°C. Since pTV32 or pLTVl could be extracted from L. lactis ssp. lactis MG1614 transformed with these plasmids and grown at 37°C under selection for Cm r , the temperature curing procedure developed for B. subtilis could not be used in the Lactococcus strain.
  • Example 2 Primary transformed cells prepared as described in Example 1 were plated on SGM17,Ca agar containing erythromycin and incubated at 30°C for about 40 hours. 12 single colonies were subcultured twice in M17 broth medium selecting for Em r . In order to obtain single colonies each culture was streaked on GM17 agar containing erythromycin and a single colony from each culture was restreaked once. All incubations were done at 30°C.
  • the pellets were frozen at -20°C and subsequently dissolved in 3 ml STET buffer ( 8 w/v% sucrose, 5 v/v% Triton X-100, 50 mM EDTA [pH 8.0], 50 mM Tris hydrochloride [pH 8.0].
  • 750 ⁇ l lysozyme (10 mg/ l) was added and the solution incubated at 37°C for 1 hour.
  • 750 ⁇ l of 10% SDS was added and incubation continued at 37°C for 1/2 hour followed by incubation at 65°C for 1/2 hour.
  • Two ml of TE buffer was added and the aqueous solution extracted three times with 5 ml phenol:chloroform (1:1) .
  • pTV32 is 15.6 kb and has a unique EcoRI site which is located in the replicon part of the plasmid.
  • the Tn_917 part of pTV32 is 8 kb. From 8 out of the 12 TV32 integrants a single signal was detected with pLTVl as the probe ( Figure 3A) whereas no signal was seen with the pTV-replicon specific probe ( Figure 3B) . These 8 integrants were Em r and Cm s as would be expected if TV32 had transposed to the chromosome and pTV32 was lost. From the remaining four integrants (num ⁇ ber 27, 33, 36 and 39) two signals were detected with pLTVl as the probe ( Figure 3A) .
  • TnS27 In order for TnS27 to be used as an efficient mutagenesis tool in L . lactis ssp. lactis, insertions of the transposon should be random.
  • An analysis of transposition randomness was carried out by determination of the physical location of TV32 on chromosomal Smal fragments of 61 independent MG1614 TV32 integrants which were prepared according to the method as described in Example 2.
  • the preparation and Smal in si tu restriction enzyme digestion of genomic DNA was done as described by Tanskanen et al. (reference 52) .
  • 10 expressed -galactosidase As shown by plating on GM agar supplemented with 160 ⁇ g/ml of X-gal.
  • the Smal restriction fragments were separated by pulsed-field gel electrophoresis (PFGE) using a model CHEF-DR II apparatus (Bio Rad Laboratories, Richmond, California) .
  • the gels were 1.5% agarose gels in 0.5 x TBE (1 x TBE in 89 mM boric acid,
  • the MG1614 chromosome digested with Smal generated the fol ⁇ lowing ten fragments larger than 45 kb (Fig. 4, lane 3) : 600, 310, 280, 200, 175, 175, 140, 120, 105 and 65 kb.
  • TV32 con ⁇ tains a unique Smal site. The insertion of TV32 into any of the ten large Smal fragments was therefore detectable on pulsed-field gel electrophoresis (PFGE) gels unless the insertion was located close to the fragment end.
  • PFGE pulsed-field gel electrophoresis
  • a x indicates a fragment that could not be detected on
  • PFGE gels b Clones whose designations end with b are blue on plates containing 5-bromo-4-chloro-3-indolyl-/3-D-galactopyrano- side. c Double integrant. d ND, not determined. Based on the physical location of TV32 on the Smal fragments, the 61 integrants could be divided into 38 groups.
  • Fig. 4 shows PFGE of integrants representing each of the groups listed in Table 1.
  • members of the same integrant group do not necessarily carry the TV32 at the same position on the fragment. Insertions located symme- trically on a fragment are indistinguishable on PFGE gels and the limit of resolution varies from two to ten kb depending on the fragment length.
  • Table 2 gives the number of integrants obtained in each fragment, together with the expected number of integrants assuming that the probability of integration into a fragment is dependent only on the length of the fragment.
  • a chi-square test was used to test this assumption. The chi-square test showed (P ⁇ 0.005) that the insertions obtained were not absolutely randomly distributed on the chromosome. The major contribution to this unevenness came from a 2.5-fold overrep- resentation of insertions into the 600 kb fragment and an absence of insertions into 280 kb fragment. The 37 insertions into the 600 kb fragment were located at least 21 different positions with no more than 3 insertions at the same posi ⁇ tion.
  • the probability of insertion was assumed to equal frag ⁇ ment size relative to chromosome size.
  • the total number of insertions expected was 62.1.
  • Lactococcus lactis ssp. lactis MG1614 clone desig ⁇ nated 63b was deposited on 21 December 1992 with the DSM-Deutsche Sammlung von Mikroorganismen und Cellkul- turen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany under the accession number DSM 7361.
  • a single colony of a pTV32-containing Lactococcus lactis ssp. lactis strain MG1614 was inoculated into GM17 medium and grown for 8 to 10 generations with selection for Cm r . One per cent of these cells were grown for 8 to 10 generations in GM17 medium with selection for Em r . The temperature was kept at 30°C. The resulting cells were plated onto GM17 agar plates with selection for Em r . 19 colonies were randomly picked and preparation and digestion of genomic DNA in situ in agarose blocks were done as described in Example 3.
  • Figure 5 and table 3 show that 12 out of 18 (digestion one clone resulted in fragments which could be visualized as discrete bands) clones had the transposon inserted at the same loca ⁇ tion on the chromosome indicating that the culture was domi ⁇ nated by a single integrant.
  • Strain MG1614 was transformed with pTV32 as described in Example 1. The transformed cells were plated onto SGM17 agar plates containing 1 ⁇ g/ml of erythromycin. Following incuba ⁇ tion at 30°C for 48 hours, 20 plates each with about 100 colonies were replica-plated onto plates of GM17 agar with selection for Em r . The replicated plates were incubated at 30°C for 30 hours. The replication step was repeated and the colonies were washed off and pooled. From the pooled culture, 18 integrants were randomly selected and analyzed by PFGE as defined above.
  • a) indicates a fragment that could not be detected on PFGE gels
  • Sterile glycerol was added to the pooled culture at a concen ⁇ tration of up till 25% and this mixture stored -80°C.
  • a pooled culture containing a collection of quasi-random LTVl insertions in Lactococcus lactis ssp. lactis MG1363 was prepared essentially as described above. However, before the washing off and pooling of the colonies the following was carried out:
  • 320 ⁇ g/ml of X-gal was added to the plates used for the second replication. 242 colonies with varying blue inten- sities were seen on the second replication plate. In contrast less than 5% of these colonies were blue on GM17 agar plates containing 40 ⁇ g/ml of X-gal incubated for more than 48 hours. (40 ⁇ g/ml of X-gal is the standard concentration for identification of lacZ expression in E. coli) .
  • Each of the 242 blue colonies appearing on the plate containing 320 ⁇ g/ml of X-gal were restreaked to obtain single colonies on GM17 containing 1 ⁇ g/ml of erythromycin and 320 ⁇ g/ml of X-gal followed by restreaking once on the same medium.
  • a single colony from each of these subcultures was inoculated into liquid GM17 medium supplemented with 1 ⁇ g/ml of erythromycin and incubated overnight at 30°C and sterile glycerol added at a concentration of 25% to each of these subcultures for storage at -80°C.
  • These 242 clones are referred to in the following as promoter fusion collection no. 1 (PFC-1) .
  • Lactococcus lactis ssp. lactis MG1363 PFC-1 clones with the designation P139-170 was deposited with the DSM- Deutsche Sammlung von Mikroorganismen und Cellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany on 21 December, 1992 under the accession number DSM 7360.
  • Each clone of PFC-1 was streaked onto a set of M17 plates containing 0.1% of glucose, 0.5% of arginine, 1 ⁇ g/ml of erythromycin and 320 ⁇ g/ml of X-gal and onto a set of GM17 plates containing 1 ⁇ g/ml of erythromycin and 320 ⁇ g/ml of X- gal using the same streak pattern as described above. Both sets of plates were incubated at 30°C for about 30 hours. Three main types of lacZ expression were observed on the incubated plates:
  • the pH of sterile GM17 is about 6.8.
  • the pH in GM17 medium inoculated with Lactococcus lactis ssp. lactis and incubated overnight is about 5.0.
  • the pH in M17 supplemented with 0.1% glucose and 0.5% arginine inoculated with Lactococcus lactis ssp. lactis and grown overnight exceeds 9.0. Accordingly, the regulated lacZ expression observed is a function of arginine concentra ⁇ tion and/or pH in the medium.
  • Each clone of the PFC-1 collection was streaked onto a set of GM17 plates supplemented with 1 ⁇ g/ml of erythromycin, 320 ⁇ g/ml of X-gal and 2% of NaCl and on a set of plates with the same medium but without NaCl using the same streaking pattern as defined above. Both set of plates were incubated at 30°C for about 30 hours. Two main types of lacZ expression were observed:
  • an insertion point or a range on the Lactoc ⁇ occus chromosome is defined where an inserted gen will be regulatably expressed in Lactococcus.
  • the clone designated P139-170 of PFC-1 is of type 3T, type 1A and type 2S which indicates that the lacZ gene resides at a position where expression of an inserted gene is suppressed partly or totally at 30°C and on M17 plates supplemented with arginine.
  • the gene expression at this position is high at 15°C on GM17 plates.
  • the gene expression level on GM17 plates is unaffected by the tested concentration of NaCl.
  • P139-170 was shown to be of the type 1A. The following pre- experiment was carried out to study the pH dependence of lacZ expression in this clone. :
  • Total DNA was extracted from a clone according to the method as defined in Example 2. About 1 ⁇ g DNA was digested with 50 units EcoRI and incubated for two hours at 37°C. Phenol and chloroform extraction and ligation in 200 ⁇ l of ligation buffer containing 50 units of ligase was carried out as described by Maniatis (reference 34) . The DNA was precipi ⁇ tated by adding three volumes of ice cold ethanol and 1/10 volume sodium acetate, followed by centrifugation at 10.000 x g for 30 minutes. The DNA was resuspended in 20 ⁇ l of TE (ImM EDTA, 10 mM Tris hydrochloride [pH 8.0]).
  • a useful tool for analysing the conditions that turn on a gene and measuring the level of expression is a promoter probe.
  • pGKV210 a promoter-probe vector based on chloramphenicol acetyl transferase and driven by the pWVOl replicon has been constructed (van der Vossen et al., 1985) .
  • this vector only provides slightly enhanced chloramphenicol-resistance when promoters are cloned into it (van der Vossen et al., 1987) .
  • mRNA containing the cat-86 gene is activated by chloramphenicol (Alexieva et al., 1988) so that the level of enzyme measured is dependent on two factors, the promoter strength and acti- vation efficiency.
  • the pWVOl replicon replicates by rolling-circle replication, and is therefore susceptible to size-dependent segregational instability (Kiewiet et al. 1993) .
  • a promoter-probe vector for Lactococcus and assumingly other lactic acid bacteria was constructed based on the -galacto- sidase genes of Leuconostoc mesenteroides subsp. cremoris, the Lactococcus lactis subsp. lactis biovar diacetylactis citrate plasmid replicon and an erythromycin-resistance marker.
  • This vector is named pAK80. Cloning of the promoter for the tRNA cluster adjacent to the t a gene of CHCC285 showed that this vector functions. The resulting construc ⁇ tion, pAK90, produces extremely high levels of 3-galactosi- dase in MG1363.
  • the -galactosidase genes from Leuconostoc mesenteroides subsp. cremoris was cloned and found to be nearly identical to the jS-galactosidase gene from Leuconostoc lactis (David et al., 1992) . Both genes have been shown to be expressed in Escherichia coli and in Lactococcus lactis strain MG1363.
  • the promoter of the jS-galactosidase gene was deleted by polymera- se chain reaction (PCR) and replaced with a polylinker, allowing cloning of various DNA fragments and testing for promoter activity. This construction was cloned into a shuttle vector containing the L.
  • MG1363 which is a plasmid-free Lactococcus lactis strain (Gasson, 1983) .
  • Escherichia coli DH5o_ [ supE44 lacAU169 hsdR17 recAl en A2 gyrA96 thi -1 relAl 801acZ ⁇ M15] (Hanahan, 1983) was used for cloning.
  • the cloning vectors and relevant markers which were used were: pVA891 [erythromycin resistance; Em R ] (Macrina et al., 1983) , and pIC19H [ampicillin resistance; Amp R ] (Marsh et al., 1983).
  • pVA891 erythromycin resistance; Em R ] (Macrina et al., 1983)
  • pIC19H ampicillin resistance; Amp R ] (Marsh et al., 1983).
  • the various plasmids constructed during the construction of the promoter-probe vector are described in the following.
  • Lactococcus strains were grown at 30°C in GM17 medium. E. coli strains were grown in LB medium at 37°C. Antibiotics were used at the following concentrations: for E. coli ; erythromycin, 250 ⁇ g/ml; and ampicillin 50 ⁇ g/ml; for Lacto ⁇ coccus; erythromycin, 1 ⁇ g/ml.
  • Plasmid DNA for sequencing and electroporations was prepared with the Qiagen plasmid kit (Diagen, Dusseldorf, Germany) .
  • Plasmids were introduced into MG1363 by electroporation of glycine-grown competent cells essentially according to Holo and Nes, 1989.
  • Promoter activity was determined by carrying out -galactosi- dase assays on overnight cultures grown in G1.5M17 medium. 1 ml of culture was centrifuged at 10,000 x g for 10 min. The pellet was resuspended in 500 ⁇ l Z buffer (Miller, 1972) . 100 ⁇ l of cell suspension was mixed with 400 ⁇ l of Z buffer, 12.5 ⁇ l 0.1% SDS and 25 ⁇ l CHC1 3 on a Vortex mixer for 10 seconds. After Vortex mixing the suspension was treated as described in Example 7. The results are shown in Table 7.
  • the assay results are stated as Miller units.
  • One Miller unit (1000 x A 42 o)/(time x volume x A 600 ) (where time is in minutes and volume is in ml) .
  • Two PCR primers were obtained which allowed amplification of the entire replication region of the citrate plasmid. These had the following sequences:
  • Primer 1 5' TGAATTCAGAGGTTTGATGACTTTGACC 3' Primer 4 5' GGAATTCCTAACAAAAGACTATTAACGC 3'
  • Primer l corresponds to nucleotides 610-621 and Primer 4 is complementary to nucleotides 2340-2361 of the citrate plasmid replication region (Jahns et al., 1991). Both contain EcoRI sites at their 5' end to facilitate cloning.
  • the 1.7 kb amplification product was cloned as an EcoRI fragment into pIC19H to produce pKR41. This EcoRI fragment was then moved into the unique EcoRI site of pVA891 to produce the shuttle vector pAK66 which replicates in E. coli and L. lactis MG1363.
  • the construction of pKR41 has been described in a manuscript submitted for publication (Pedersen et al., 1993).
  • lac-1 ATAGATCTGCAGGATCCCGGGTAACTTTGAAAGGATATTCCTC lac-2 ATTGAGGGTATACGGTGGGCG
  • lac-1 The underlined part of lac-1 is identical to the beginning of the /3-galactosidase gene and contains the ribosome binding site. The remaining sequence contains a variety of restric- tion sites including Ssrlll.
  • the lac-2 primer anneals to the -galactosidase gene, 20 bp downstream of the unique Ncol site. PCR amplification with these primers will amplify from the ribosome binding site to just beyond the Ncol site and produce a 360 bp fragment containing several restriction sites at one end, an Ncol site at the other end and no promo ⁇ ter or other regulatory sequences from the 3-galactosidase gene.
  • This 360 bp fragment was purified, digested with Bglll and Ncol and cloned into Bglll/Ncol digested pSBl.
  • the resul ⁇ ting plasmid was named pAK67 and had the following polylinker preceding the ⁇ -galactosidase gene:
  • DNA sequence analysis revealed that this polylinker was present and that no alterations had been introduced in the i8-galactosidase gene by errors during PCR.
  • Stop-1 GGGTCTAGATTA
  • Stop-2 TAATCTAGACCC
  • oligonucleotides are complementary and will anneal to give a 12 bp piece of double stranded DNA containing an _XbaI restriction site. This small fragment was cloned into the Smal site of pAK67. These oligonucleotides were designed in such a way that the Smal site would be retained, a new _XbaI site would be present in plasmids with this tiny insert and stop codons would be introduced into the two open reading frames. The cloning was done by digesting pAK67 with Smal, phosphatase treating and ligating with a mixture of the two oligonucleotides that had been treated with kinase and allowed to anneal to each other. Transformants were purified and those in which the plasmid had gained an Xbal site were further analyzed. DNA sequence analysis revealed that one clone, pAK67.7 had the desired structure:
  • the final step in the production of the promoter-probe vector was the combining of the manipulated /3-galactosidase gene with a replicon and selectable marker for Lactococcus. This was accomplished by digesting pAK67.7 with Hindlll and Sail and ligating into pAK66, also digested with H ⁇ ndlll and Sail. Among the plasmids produced, was pAK80 which was the promoter-probe vector exactly as originally designed.
  • a DNA fragment from Lactococcus lactis subsp lactis adjacent to the t a gene of CHCC285 has been isolated and found to contain a cluster of tRNA genes preceded by a promoter region (Figs. 11 and 12) comprising two potential promoters (PI, nucleotides 107-134; PII, nucleotides 215-242) .
  • the PI and PII promoters contained on a 501 bp Hindlll-Scal fragment isolated from the clone pLN39 was cloned by inserting it into pAK80 digested with Hindlll and Smal, in front of the promo- terless Leuconostoc mesenteroides subsp cremoris -galactosi- dase gene. Following ligation, MG1363 was electroporated and the cells were plated on regeneration medium (Holo and Nes, 1989) containing erythromycin and X-gal. A total of seven blue colonies were obtained. Plasmid analysis revealed that all seven had identical plasmids and that each contained the desired insertion in pAK80.
  • MG- 1363/pAK90 produced 5000 Miller units of enzyme, while MG- 1363/pAK80 produced 1 Miller units.
  • the region preced- ing the tRNA genes contains a very strong promoter.
  • Fig. 13 Searching for sequences with similarity to the sequence of the above promoter region revealed a consensus sequence of promoters preceding rRNA operons and tRNA operons from Lactococcus species including a previously undescribed conserved sequence (motif) , AGTT. This sequence ends 5 bp upstream of the -35 region and is not conserved in tRNA and rRNA promoters of Escherichia coli or Bacillus subtilis .
  • promoters PI and PII both contain conserved sequen ⁇ ces assumingly involved in stringent control (Fig. 13) and accordingly, these promoters appear to be regulatable promo ⁇ ters.
  • a 1.0 kb Hindlll-EcoRI fragment from pLN39 was inserted into the plasmid pCI3340 digested with HindiII and EcoRI and the resulting plasmid pLN40 was introduced into Lactococcus lactis MG1363.
  • pLN40/MG1363 was deposited with the DSM-Deut- sche Sammlung von Mikroorganismen und Cellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany on 22 December 1993 under the accession numbers DSM 8858.
  • This Example describes the construction of a novel promoter- probe vector for Lactococcus and assumingly other lactic acid bacteria.
  • This vector has several advantages over previously described vectors. It is based on the Lactococcus lactis subsp. lactis biovar diacetylactis citrate plasmid replicon, a theta-replicating plasmid, and so is more stable.
  • the reporter gene chosen is not subject to post-transcriptional control so the enzyme levels can be measured without the presence of any inducers. This is in contrast to plasmids based on the cat- 86 gene where chloramphenicol actually activates the translation of the mRNA (Alexieva et al.,
  • Lactoccus lactis ssp. lactis MG1363 PFC-1 clones (LTV1 integrants) as defined in Example 4 are usually designated P139- followed by a number indication, e.g. P139-170. In the following, however, PFC-1 integrants are termed only by their number, e.g. 170. In this study was also included the LTV1 integrant in Lactoccus lactis ssp. lactis MG1614, mentioned in Example 5 under the designation H25A. However, in the following, this integrant has been designated as SB.
  • Integrant 170 was shown to be of type 1A whilst integrant SB apparently did not belong to this group. Both integrants are of type 2S which means that the expression of -galactosidase on GM17 plates is not affected by 2% NaCl.
  • OD 600 The fermentations were run for 45 hrs and the growth was followed by measuring OD 600 .
  • OD 600 At selected OD eoo values and time intervals /3-galactosidase activity was measured as follows: 10 ml aliquots from each fermenter were centrifuged at 10,000 x g at 4°C for 5 minutes. The pellet was resuspended in 1 ml Z buffer (Miller, 1972) and 0.4 ml of the bacterial suspen ⁇ sion and 0.1 ml Z buffer was mixed with 12.5 ⁇ l 0.1% SDS and 25 ⁇ l CHC1 3 by means of a Vortex mixer for 10 seconds.
  • the vortexed suspension was placed in a 30°C water bath for 5 minutes and 100 ⁇ l of a solution containing 4 mg/ml of o- nitrophenyl-jS-D-galactopyranoside (ONPG) in A-medium (Miller, 1972) was added.
  • the suspension was vortexed for 2 seconds and placed in a 30°C water bath.
  • Fig. 9 the OD 600 and -galactosidase activity versus time are shown for integrant 170 at pH 5.2 and pH 7.0.
  • Fig. 10 the corresponding data are shown for integrant SB. It is clearly demonstrated by the data in these two figures that the expression of -galactosidase of integrants 170 and SB are oppositely regulated by pH. Integrant 170 turns off the -galactosidase expression at pH 7.0. In both integrants, ⁇ -galactosidase expression is also influenced by the growth phase. This experiment does not exclude that the concentra ⁇ tion of arginine in the medium may also have a regulatory effect on the /3-galactosidase expression in the two integrants studied.
  • Chromosomal EcoRI fragments containing lactococcal DNA, lacZ, cat, bla and the ColEI replicon were prepared according to the method described in Example 5 from the Tn917-LTVl integrants listed in Table 5 below. The fragments were subsequently religated and introduced into E. coli DH5 ⁇ by transformation as described in Maniatis 1982.
  • Tn_17-LTV1 integrant fragment plasmids were termed p[integrant No], e.g. p86, pl43 and pSB. All TnS27-
  • LTV1 integrants from which the fragments were isolated are in Lactococcus lactis MG1363 except SB which is Tn_917-LTV1 in Lactococcus lactis MG1614.
  • pGKV210 is a promoter selection vector which contains an erm gene as a selection marker and a promoterless cat- 86 gene preceded by a polylinker (van der Vossen et al, 1987) .
  • the cat-86 gene is expressed if a DNA fragment carrying a promo ⁇ ter is inserted in the right orientation into the polylinker.
  • the level of chloramphenicol resistance conferred to the host- depends on the strength of the promoter.
  • the integrant fragment plasmids all have a Clal site located in the DNA originating from the lacZ part of Tn_917-LTVl.
  • a Clal site was first introduced into the polylinker of pGKV210 in the following manner: The synthetic DNA linker
  • pGKV210 (Clal) .
  • 50 ng of pGKV210 (Clal) digested with Clal and EcoRI was mixed and ligated with 200 ng of purified Clal-EcoRI fragment as defined above. This was done with Clal-EcoRI fragments from the following integrant fragment plasmids: pl43, pl62, pl63, pl70, pl72, p224, p237, p242 and pSB.
  • pl62 contains an additional Clal site located in the lacto ⁇ coccal DNA.
  • the fragment from the EcoRI site of this plasmid to the additional Clal site was inserted into pGKV210 (Clal) All of the DNA recombination work in this Example was carried out according to Maniatis, 1982.
  • the resulting pGKV210 derivative constructs were termed PGKV210: [integrant No], e.g. pGKV210:143, pGKV210:162 and pGKV210:SB.
  • the pGKV210 derivatives were introduced into E. coli MC1000 (F-, ara£>13S( ⁇ ara-leu)7679, gal ⁇ , galK( ⁇ lac)X74, rpsL (Strr) , thi) according to the method as described in Example 5.
  • the pGKV210 derivatives were extracted as described in Maniatis, 1982 from the transformed host strain.
  • pGKV210 [integrant No]/MG1363, e.g. pGKV210:143/MG1363.
  • the promoter activity of the above cloned fragments and of previously published pGKV210 derivatives in Lactococcus lactis IL1403 were determined by plating overnight culture of the pGKV/MG1363 derivatives onto GM17 plates supplemented with 5 mg/1 erythromycin and increasing concentrations of chloramphenicol.
  • the concentra ⁇ tions of chloramphenicol were 4, 6, 8, 12, 16, and 20 mg/1, respectively.
  • 50 ⁇ l of a 10 4 times diluted culture in a 0.9% NaCl aqueous suspension were plated on plates with 4-8 mg/1 of chloramphenicol.
  • pAK80 is a promoter selection vector which contains an erm gene as a selection marker and a promoterless ⁇ -galactosidase gene preceded by a polylinker.
  • the construction of pAK80 is described in Example 6.
  • pl70 contains a Sail site located in the lactococcal DNA.
  • the fragment from the Clal site to this Sail site was inserted into the cloning vector pBluescript II KS (Strategene) which was digested with Clal and Sail.
  • This construct was termed pBluescript:170.
  • Extracted plasmid DNA from this construction was digested with Xhol and Clal and ligated to pGEM-7Zf(+) digested with Xhol and Clal.
  • the pGEM-7Zf(+) constructions were termed pGEM: [integrant No], e.g. pGEM:143 and pGEM:170 and collectively designated pGEM derivatives.
  • the pGEM deri ⁇ vatives were introduced into E. coli strain DH5 ⁇ as described in Example 5.
  • the DH5 ⁇ transformants were termed pGEM/DH5 ⁇ _ derivatives.
  • Plasmid DNA from the pGEM/DH5 ⁇ derivatives were extracted, digested with Xhol and Ba HI and ligated to pAK80 digested with Xhol and BamHI.
  • the resulting constructions were termed pAK80: [integrant No], e.g. pAK80:143 and pAK80:170 and col ⁇ lectively designated pAK80 derivatives.
  • the pAK80 derivatives were introduced into E. coli MC1000 as described in Example 5.
  • the MC1000 transformants were designated pAK80/MC1000 deriva ⁇ tives.
  • the pAK80 derivatives were extracted from the pAK80/MC1000 derivatives.
  • pAK80 derivative For each extracted pAK80 derivative 1 ⁇ g DNA was introduced into Lactococcus lactis MG1363 as described in Example 5. The resulting transformants were termed pAK80: [integrant No]/MG1363, e.g. pAK80:143/MG1363 and pAK80:170/MG1363 and collectively designated pAK80/MG1363 derivatives.
  • the promoter activity of the cloned fragments were determined by carrying out /3-galactosidase assays on overnight cultures of the pAK80/MG1363 derivatives grown in G1.5M17 medium. 1 ml of culture was centrifuged at 10,000 x g for 10 min. The pellet was resuspended in 500 ⁇ l Z buffer (Miller, 1972) . 100 ⁇ l of cell suspension was mixed with 400 ⁇ l of Z buffer, 12.5 ⁇ l 0.1% SDS and 25 ⁇ l CHC1 3 on a Vortex mixer for 10 seconds. After Vortex mixing the suspension was treated as described in Example 7. The results are shown in Table 7.
  • the promoter selection vector pAK80 is capable of discriminating even weak promoters, since pAK80:163/MG1363, pAK80:170/MG1363, pAK80:224/MG1363 and pAK80:242/MG1363 appear to be without promoter activity when assayed for chloramphenicol resistance, but when assayed for /3-galactosi- dase activity it is evident that pAK80:170/MG1363 in contrast to the three other pAK80/MG1363 derivatives, has promoter activity.
  • pAK80/MG1363 derivatives pAK80:SB/MG1363, pAK80:143/MG1363, pAK80:162/MG1363, pAK80:163/MG1363, pAK80:170/MG1363, respectively were deposited with the DSM- Deutsche Sammlung von Mikroorganismen und Cellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany on 27 August 1993 under the accession numbers DSM 8495, DSM 8497, DSM 8498, DSM 8499 and DSM 8500, respectively.
  • pGEM-7Zf (+) constructions were digested with Sa HI and .Xhol and ligated to pAK80, also digested with Ba HI and Xhol.
  • the details of the cloning experiments were as described above.
  • pGEM:172 was digested with Xhol and BamHI.
  • the ligation mixture was introduced into E. coli DH5 ⁇ , and the resulting plasmid, pAK80:172, was introduced into Lactococcus lactis MG1363.
  • pAK80:172/MG1363 is blue on GM17 containing X-gal which demonstrates the presence of a promoter on the 4.5 kb Clal-EcoRI fragment of pl72.
  • the lactococcal DNA segment of pGEM:215 contains an internal BamHI site.
  • the distal Ba HI-XhoI fragment of pGEM:215 was ligated to pAK80 digested with BamHI and Xhol and the lacto ⁇ coccal Ba HI-BamHI fragment was ligated to pAK80 digested with BamHI.
  • Each ligation mixture was introduced into E. coli DH5 ⁇ .
  • the resulting plasmids were designated pAK80:215A and pAK80:215B, respectively.
  • the correct orientation of the BamHI fragment in pAK80:215B was verified by restriction map analysis.
  • Example 13 Measurements on overnight cultures of Lactococcus lactis MG1363 containing the plasmids pAK80:SB, pAK80:143, pAK80:162, pAK80:170 and pAK80:172, respectively, are described in Example 13 below. However, in Example 13 these plasmids are designated pSMA332, pSMA337, pSMA338, pSMA339 and pSMA345, respectively.
  • the media used for growth of lactic acid bacteria may contain purine compounds. Such media repress the synthesis of enzymes used in the formation of purine nucleotides. When the dairies inoculate the cultures in the purine-free milk, this repression is relieved.
  • This regulation pattern of the syn ⁇ thesis of enzymes used in the purine de novo pathway can be used commercially.
  • the purD gene encodes an enzyme of the purine de novo pathway.
  • the Lactococcus lactis strain MG1363 was grown in M17 medium (Oxoid) or in defined medium, DN-medium.
  • This medium is composed as follows (per litre) : 100 ml of a 10% salt buffer with the following composition: (NH 4 ) 2 S0 4 10 g, Na 2 HP0 4 ,2H 2 0 33.2 g, KH 2 P0 4 15 g, NaCl 5 g, NaAcetate,3H 2 0 10 g, ion exchanged water ad 500 ml; 900 ml of basis medium containing - 1.0 M MgCl 2 10 ml, 0.5 M CaCl 2 1.0 ml, 0.01 M FeCl 3 1.5 ml, ion exchanged water ad 4500 ml, 15 g of agar per litre; 25 ml of 20% carbon source; 25 ml of casamino acids, 20% (Difco) ; 10 ml of vitamin solution and 10
  • Glucose was used as carbon source in M17 medium and DN medium.
  • Antibiotics used for Lactococcus lactis Eryth ⁇ romycin, 1 mg/1.
  • Purine compounds as supplements were added, when necessary, per 1: Adenine and hypoxanthine, 15 mg; - guanosine, 30 mg) .
  • Lactococcus lactis plasmid DNA was isolated according to Johansen and Kibenich (1992) . Lactococcus lactis was trans ⁇ formed by electroporation as recommended by Holo and Nes (1989) . The use of the Lactococcus lactis promoter-probe plasmid pAK80 is described in Example 6.
  • a 846 bp DNA fragment (Fig. 14) contains the entire purD promoter region as well as an adjacent promoter initiating transcription in the opposite direction. This region was fused to the reporter gene (encoding ⁇ -galactosidase) in the promoter probe plasmid pAK80 giving pLN71 (purD promoter expression) and pLN72 (promoter expression opposite direc ⁇ tion) . Transforming pLN7l into Lactococcus lactis strain MG1363 gives us the possibility to measure the expression of the reporter gene initiated from the purD promoter. The results are shown in Table 8.
  • the plasmid pLN7l in Lactococcus lactis strain MG1363 was deposited on 22 December 1993 with the DSM-Deutsche Sammlung von Mikroorganismen und Cellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany under the accession number DSM 8859.
  • a Cells were grown exponentially at 30°C in DN-medium con ⁇ taining purines, harvested, washed, and resuspended in purine-free DN-medium, and incubated further 1.5 hour. The ⁇ - galactosidase activity expressed from the respective promoter was measured.
  • b Cells were grown exponentially in defined medium containing purines. The ⁇ -galactosidase activity expressed from the respective promoter was measured.
  • c A adenine
  • Hx hypoxanthine
  • GR guanosine
  • the plasmid pSMA344 consists of the 9.7 kb EcoRI-Clal frag ⁇ ment from pl70 (see Example 8) inserted into the promoter cloning vector pAK80.
  • Integrant 170 expression of the inserted ⁇ -galactosidase gene has been demonstrated to be regulated by pH and growth phase (Example 7) .
  • the following experiment was performed to investigate if the cloned DNA fragment contains the sequences that are necessary for pH regulated expression of downstream genes.
  • Lactococcus lactis MG1363 harbouring the plasmid pSMA344 was cultivated in two fermenters each containing 1 litre of medium.
  • the fermenters were set to operate at pH 7.0 and 5.2, respectively, by automatic addition of 5 M sodium hydroxide and 5 M hydrochloric acid. Any other parameter (medium compo ⁇ sition, inoculum size, stirring rate, temperature etc.) was as described in Example 7.
  • the fermentations were run for 45 hours and the growth was followed by measuring OD 600 in cul ⁇ ture samples.
  • the experiments described below were performed to analyze the regulation of 3-galactosidase gene expression in 25 selected integrants grown overnight in liquid culture.
  • the regulation parameters analyzed included pH and/or arginine concen ⁇ tration, sodium chloride concentration, and growth tempera ⁇ ture.
  • the media used for liquid cultures are listed in the table below.
  • the basic medium for all experiments was 1.5 x M17 broth (Oxoid, Unipath Ltd. , UK) containing 1 mg/1 erythromycin.
  • a 5-10 ml preculture of each integrant in liquid G1.5M17 was inocu ⁇ lated with a single colony from GM17 agar (see Example 15 below) and grown to stationary phase by incubation for 12-18 hours at 30°C. From the precultures 10 ⁇ l of each strain was inoculated into 10 ml of each medium,and the cultures were incubated at 30°C for 20 hours or at 15°C for 165 hours. A sample for measurement of OD 600 was taken from each culture immediately before harvest. The cells were harvested by centrifugation (10 minutes at 10,000 x g, 4°C) and washed once in 1 ml ice-cold 0.15 M NaCl.
  • Table 10 shows jS-galactosidase activities measured in cul ⁇ tures of 17 different integrant strains in media with and without arginine. Most of the integrants showing pH and/or arginine regulated ⁇ -galactosidase expression had been iden- tified by plate assays. In Integrants 237, 241 and SB such control of expression had not been clearly observed by in ⁇ spection of plates. A possible reason is that above a certain activity level it is difficult to distinguish between diffe ⁇ rent activities by the plate assay.
  • Table 10 Expression of ⁇ -galactosidase controlled by arginine and/or medium pH as activity in cells from liquid cultures of selected PFC-1 integrants, grown for 20 hours at 30°C from a 1:1000 inoculum
  • a blank space indicates that this particular combination of strain and medium has not been tested.
  • Integrants 170 and 192 exhibited the regulation of ⁇ -galacto- sidase gene expression also found in the plate, both giving higher activity at low temperature.
  • the effect of temperature on ⁇ -galactosidase gene expression was opposite to that expected from the results of plate assays, and for Integrant 172, 187, 188, and 201 the effect was weaker than anticipated. It must be taken into account that the cells from the liquid cultures were harvested in stationary phase, whereas the 0-galactosidase activity detected in the plate assay is accumulated from both the growth phase and the stationary phase.
  • Plate assays of PFC-1 integrants had revealed either decreas- ing ⁇ -galactosidase gene expression or no change in response to addition of NaCl to the growth medium.
  • the results of activity measurement in cultures grown in liquid medium containing 1% or 2% NaCl are shown in Table 12.
  • Sev ⁇ eral integrants that had not shown any influence of NaCl on ⁇ -galactosidase activity in plate assays were included in these experiment, and results from three of these, namely 224, 229 and SB, are also presented in the Table.
  • the chromosomal sequence of about 200 bp to 1500 bp upstream of TnS17 insertion was determined in six selected TnS17-LTVl Lactococcus lactis promoter fusion integrants. In one of the selected integrants, the sequence downstream of the transpo ⁇ son insertion was also determined. The sequencing was done to present examples of sites and regions on the chromosome of Lactococcus lactis showing regulated expression of inserted promoterless gene(s) .
  • the first sequence reaction was performed using the primer ppl (5' GTTAAATGTACAAAATAACAGCG'3) (DNA Technology, Arhus, Denmark) .
  • ppl is homologous to a sequence in the lacZ proxi ⁇ mal end of TnS17-LTVl. If the first bp upstream of TnS17-LTVl is designated No. 1, the complementary sequence to ppl is located at bp No. -58 to No. -80.
  • the obtained sequence, designated ppl-sequence consisted of about 20 bp of the lacZ proximal end of TnS17-LTVl followed by 200 to 300 bp of adjacent, upstream Lactococcus lactis DNA sequence.
  • pi is homologous to a 20 to 24 bp sequence located about 60 bp from the 3' end of the ppl-sequence.
  • the second sequence reaction was performed using the primer pi.
  • the obtained sequence, designated pi-sequence was an overlap of about 20 bp of the 3' end of the ppl-sequence and extended 200 to 300 bp further upstream on the Lactococcus lactis DNA.
  • p2 and plr were synthesized (DNA Technology) .
  • p2 is homologous to a 20 to 24 " bp sequence located about 60 bp from the 3' end of the pl-se- quence and plr is homologous to the complementary Lactococcus lactis DNA sequence located about 250 bp upstream of trans ⁇ poson insertion.
  • the third and fourth sequence reaction was performed using the primers p2 and plr, respectively.
  • the obtained sequence, designated p2-sequence was an overlap of about 20 bp of the 3' end of the pi-se ⁇ quence and 200 to 300 bp further upstream on the Lactococcus lactis DNA.
  • the obtained sequence, designated plr-sequence was complementary to the ppl-se ⁇ quence.
  • sequence reactions were performed using the primers p3, p4, etc., each primer homologous to a sequence located about 300 bp upstream of the previously used primer. Also, sequence reactions were performed using the primers p2r, p3r, etc., each of which are homologous to a sequence located about 300 bp upstream of the previously used primer.
  • BA21 (5'CTCACTGGTCACCTTTATCC 3') were used for the PCR ampli ⁇ fication.
  • a GeneAmp DNA Amplification Reagent Kit from Perkin Elmer Cetus, 761 Main Ave., Norwalk, CT 06859 was used.
  • the concentration of reaction buffer, dNTPs and Taq polymerase was as described in the protocol from the manufacturer.
  • the final concentration of the primers in the reaction mixture was 10 ng/ ⁇ l.
  • the following temperature profile was used: Denaturation at 94°C, 1 min.; annealing at 53°C, 1 min.; extension at 72°C, 2 min. The total number of PCR cycles were 40.
  • the 1400 bp fragment from the PCR reaction was ligated to the pT7Blue(R) vector (Novagen, Madison, Wisconsin, USA) under standard ligation conditions as described by Maniatis et al. 1982.
  • the ligation mixture was introduced into E. coli DH5 ⁇
  • the resulting plasmid was designated pSBCl.
  • a putative transcription terminator is indicated with lower case letters and the -35 and -10 consensus sequences of the promoter, PSB is underlined.
  • AAACCAACTC AGAATAGCCA CCAATGTTTG AAATATTTTA CTCCCATAAT
  • ATGTGTTAAC ATTTATTACT ATCTAAATAG CCAGAAAATT CTACAATAGA 200 GTTATAAATT AATGGAGACT CTATATGAGA AAAAATAAAA CCAAGTTTAT
  • the 9.7 kb Clal-EcoRI fragment of pl70 was cleaved into subfragments and a restriction map was created (see Figure 16) . Appropriate subfragments were subsequently cloned into the promoter probe vector pAK80. However, it was necessary first to create compatible restriction sites on the subfrag ⁇ ments and pAK80.
  • Cloning of the large 9.7 kb Clal-EcoRI fragment from pl70 into pGEM-7Zf(+) was done by digesting pl70 with Clal and EcoRI followed by ligation of the 9.7 kb fragment to pGEM-7Zf (+) digested with Clal and EcoRI.
  • the ligation mix- ture was introduced into E. coli DH5 ⁇ and the resulting plasmid was termed pSMA212.
  • pSMA212 was digested with Xhol and BamHI and ligated to pAK80 also digested with Xhol and BamHI.
  • the ligation mixture was introduced into E. coli DH5 ⁇ .
  • the resulting plasmid, pSMA344, was subsequently introduced into Lactococcus lactis MG1363.
  • Plasmid pSMA342 was constructed in the following manner: pSMA212 was digested with Clal and Ndel , the sticky ends were filled in by use of Klenow polymerase as described by Mania ⁇ tis et al. 1982. The large 8.7 kb fragment [3kb from pGEM-7Zf(+) and 5.7 kb from the Lactococcus chromosome] was purified, religated, and introduced into E. coli DH5 ⁇ _. The resulting plasmid, pSMA213, was digested with Xhol and BamHI and the purified 5.7 kb fragment was ligated to pAK80 also digested with Xhol and BamHI. The ligation mixture was intro ⁇ quizd into E.coli DH5 ⁇ and the resulting plasmid, pSMA342, was subsequently introduced into Lactococcus lactis MG1363.
  • the plasmid pSMA343 was constructed in the following manner: pSMA212 was digested with Clal and Sail, the sticky ends were filled in by Klenow polymerase. The 6.2 kb fragment [3kb from pGEM-7Zf (+) and 3.2 kb from the Lactococcus chromosome] was purified, religated and introduced into E. coli DH5 ⁇ . The resulting plasmid, pSMA214, was digested with Xhol and BamHI and the 3.2 kb lactococcal fragment was ligated to pAK80 digested with Xhol and BamHI. The resulting plasmid, pSMA343, was introduced into E. coli DH5 ⁇ and subsequently into Lacto- coccus lactis MG1363.
  • the plasmid pAK80:170 (DSM 8500) as described in Example 8 is in the following designated pSMA339.
  • Plasmid pSMA340 was constructed in the following manner:
  • pSMA201 The cloning of the 6.5 kb Clal - Sail lactococcal fragment from pl70 into the cloning vector pBluescript II KS is described in Example 8.
  • This construct being termed pBluescript:170 in Example 8 is designated pSMA201 in the following.
  • pSMA201 was digested with _NdeI and Sail and treated with Klenow polymera ⁇ se to fill in the sticky ends.
  • the large 7 kb fragment [3 kb from pGEM-7Zf(+) and 4 kb from the lactococcus chromosome] was purified, religated and introduced into E. coli DH5 ⁇ .
  • the resulting plasmid was termed pSMA202.
  • pSMA202 was digested with Xhol and BamHI, and the 4 kb lacto ⁇ coccal fragment was purified and ligated to pAK ⁇ O, also digested with Xhol and BamHI.
  • the ligation mixture was intro ⁇ quizd into E. coli DH5 ⁇ and the resulting plasmid, pSMA340, was subsequently introduced into Lactococcus lactis MG1363.
  • pSMA341 was constructed in the following manner: pSMA202 was digested with 27del and EcoRI and treated with Klenow polymerase to fill in the sticky ends. The large 5.5 kb fragment [3 kb from pGEM-7Zf(+) and 2.5 kb from the lacto ⁇ coccus chromosome] was purified, religated and introduced into E. coli DH5 ⁇ . The resulting plasmid, pSMA208 was digested with Xhol and BamHI and the 2.5 kb lactococcal fragment was ligated to pAK ⁇ O, also digested with Xhol and BamHI. The resulting plasmid, pSMA341, was introduced into E. coli DH5 ⁇ _ and subsequently into Lactococcus lactis MG1363. (iii) Assessment in Lactococcus lactis of promoter activity on the subfragments of the 9.7 kb fragment from p!70
  • a plate assay for determination of promoter activity of the cloned lactococcal fragments was performed by plating over- night cultures of Lactococcus lactis containing the plasmids pSMA339, pSMA340, pSMA341, pSMA342, pSMA343 and pSMA344, respectively, on GM17 supplemented with l ⁇ g/ml Em and 160 ⁇ g/ml X-gal. Surprisingly, all cultures appeared blue on these plates, showing the existence of at least one func- tional promoter on all plasmids. From these results it is evident that at least three promoters are located within the lactococcal 9.7 kb fragment from pl70.
  • This promoter is in the following referred to as P170.
  • the promoter carried on pSMA342 does not show a regulated expression.
  • the promoter harboured on pSMA343 is regulated by pH or arginine. This regulation was not detected in the plate assay. This might be due to differences in the growth on plates and in liquid medium.
  • the regulation observed on the promoter harboured on pSMA343 is not as tight as the regulation of P170.
  • pSMA202 contains three Hindlll sites, of which two are located within the lactococcal DNA and one in the polylinker region. Insertion into pAK80 of the 1.3 kb Hindlll fragment, extending from the Hindlll site in the polylinker to the H ⁇ ndlll site in the Lactococcus DNA resulted in the plasmid, pSMA357. The insert in pSMA357 contained no promoter activity when introduced into Lactococcus lactis MG1363.
  • ⁇ -galactosidase was expressed from pSMA358.
  • the 1.5 kb Hindi fragment covers most of the 1.3 kb Hindlll fragment and has a 400 bp overlap with the adjacent 2.3 kb Hindlll fragment.
  • the promoter P170 was mapped to a 400 bp Hindi-Hindlll fragment located about 1.3 kb upstream of Tn_917-LTV1 insertion in Integrant 170. (iv) Mapping of the promoter PSB.
  • a consensus promoter was identified [see Example 12 (i)] within a 190 bp Hpal- Clal fragment.
  • pSB was digested with Hpal and Clal and the fragment was ligated to pNZ336 (Simons et al. 1990) digested with Hpal and Clal.
  • the resulting plasmid, pNZ336:SB was digested with Sail and BamHI.
  • the 190 bp fragment was ligated to pAK80, digested with Xhol and BamHI. The ligation mixture was introduced into E.
  • pSMA347 was subsequently introduced into Lactococcus lactis MG1363.
  • Strain MG1363/pSMA347 expresses ⁇ -galactosidase, which demonstrate the existence of a functional promoter on the 190 bp fragment.
  • ⁇ -galactosidase activities on overnight cultures grown under induced and non-induced conditions, respectively, are given.
  • the different growth conditions are temperature variations and variation of pH/concentration of arginine in the growth medium, respectively.
  • the strains analyzed include both pAK80 derivatives containing EcoRI- lal fragments from the rescue plasmids and, based on the above mapping analyses, pAK80 derivatives containing deletions of the EcoRI- lal fragments.
  • the growth of cultures as well as the jS-galactosi ⁇ dase assay were performed as described in Example 11. In this example 5Argl.5M17 is designated as 5ArgM17.
  • Table 14a ⁇ -Galactosidase activities in overnight cultures grown at induced and non-induced conditions. Expression controlled b r inine and or medium H 30°C
  • the temperature regulation of the promo ⁇ ter from pSB is reversed when located on pAK80.
  • the promoter from pl62 is still regulated when located on pAK80.
  • the total expression of ⁇ -galactosidase from the plasmid harboured promoter is not as high as expected from the high copy number of pAK80.
  • the pH regulation of P170 is described above.
  • the temperature regulation of P170 is conserved, although to a lesser extent, when located on pAK80.
  • the promoter from pl43 is regulated when located on pAK80.
  • a non-replicating vector can integrate into the chromosome, if the vector carries homologous DNA (Leenhouts et al. 1989).
  • the integration mechanism involved is a single cross-over event (Campbell-like integration) between the homologous DNA contained on the vector and on the chromosome.
  • Campbell-like integration is a duplicate set of the homologous DNA on the chromosome and in between the duplicate set of homologous DNA, the non-replicating vector is located.
  • a non-replicating vector, pSMA500 was constructed based on the E. coli plasmid pVA891 (Macrina et al. 1983) carrying an erythromycin resistance marker, and, as a reporter gene, the promoterless ⁇ -galactosidase genes derived from Leuconostoc mesenteroides subsp. cremoris.
  • the polylinker and the promoterless ⁇ -galactosidase genes from the plasmid pAK80 was cloned into the plasmid pVA891, which is unable to replicate in lactic acid bacteria.
  • pAK80 was digested with Hindlll and Sail .
  • the 4.1 kb fragment containing the polylinker and the ⁇ -galactosidase genes was purified and ligated to pVA891 also digested with Hindlll and Sail.
  • This ligation mixture was introduced into E. coli MC1000, selecting for erythromycin resistance (Em r ) (250 ⁇ g/ml).
  • the resulting plasmid was designated pSMA500.
  • Example 8 The regulation of the promoters from pl70 and pSB has been described in Example 8.
  • P170 was inserted into pSMA500 and this construct subsequently inte ⁇ grated into the chromosome of Lactococcus lactis MG1363.
  • Lactococcus DNA from pSB containing the regulatable promoter PSB, was inserted into pSMA500 and this construct subsequently integrated into the chromosome of Lactococcus lactis MG1614.
  • pSMA212 as described in Example 13 contains a 9.7 kb
  • Xhol -BamHI fragment This fragment is essentially the same as the 9.7 kb Lactococcus DNA segment of pl70, which harbours the regulated promoter P170.
  • the 9.7 kb fragment from pSMA212 was cloned into pSMA500 also digested with Xhol and BamHI.
  • the resulting plasmid, pSMA501 was introduced into E. coli MClOOO and transformants selected for Em r (250 ⁇ g/ml) .
  • Transformation of strain MG1363 and strain MG1614 with pSMA500 showed less than 5 CFU/ ⁇ g DNA, which clearly demonstrated that the integration of pSMA501 and pSMA502 was mediated by the chromosomal Lactococcus insert on these vectors.
  • Ten primary, randomly picked transformants from each parallel set of plates were streaked on GM17 plates containing 1 ⁇ g/ml Em and 160 ⁇ g/ml X-gal. All colonies appearing after this streaking were homogeneous and blue. Plasmid DNA extractions from transformants revealed no de ⁇ tectable extrachromosomally plasmid DNA in the bacterial cell.
  • strain MG1363 harbouring chromosomally integrated pSMA501 (strain MG1363: :pSMA501) and strain MG1614 harbouring chromosomally integrated pSMA502 (strain MG1614: :pSMA502) .
  • strain MG1614: :pSMA502 Eight randomly picked reisolates of strain MG1614: :pSMA502 were streaked on GM17 plates and on ArgM17 plates. Both types of plates contained 1 ⁇ g/ml Em and 160 ⁇ g/ml X-gal. All isolates of strain MG1614: :pSMA502, i.e.isolates no. 7, 8, 10, 13, 14, 17, 18, and 22 were blue on GM17 plates and slightly more blue on ArgM17 plates. This result indicated at least a certain level of pH dependent ⁇ -galactosidase expres ⁇ sion in the strain MG1614 : :pSMA502. However, in this plate assay it was not possible to compare the levels of ⁇ -galacto- sidase expression and hence the tightness of regulation in strain MG1614 : :pSMA502 and Integrant SB.
  • Examples 7 and 11 the media consisting of 1.5 x M17 supplemented with 0.5% glucose and 1.5 x M17 supplemented with 0.1% glucose and 0.1% arginine were referred to as G1.5M17 and Argl.5M17, respectively. In the following these media are designated GM17 and ArgM17, respectively.
  • ⁇ -galactosidase The activity of ⁇ -galactosidase were measured in cultures grown for 17-18 hrs at 30°C in GM17 medium (pH 5.6 after growth) and in ArgM17 medium (pH 6.7 after growth), respect- ively. Both GM17 medium and ArgM17 medium contained l ⁇ g/ml erythromycin. Three reisolates of strain MG1363 : :pSMA501 and two reisolates of strain MG1614 : :pSMA502 were each assayed for ⁇ -galactosidase activity. As a control of regulated ⁇ -galactosidase expression, the Integrants 170 and SB, res- pectively were included in the experiment. The results are shown in Tables 15a and 15b below:
  • MG1363 :pSMA501, Isolate No. 21 2.6 0.2 13 Table 15b .
  • ⁇ -qalactosidase activity of MG1614 : ; pSMA502
  • transposition vectors pTV32 and pLTVl
  • the vector pNZ18 conferring Cm resis ⁇ tance to the host, was also introduced into strain CNZR32 as control of transformation efficiency.
  • the transformed cells were plated on MRS agar (Oxoid) containing lOmM CaC12 and an antibiotic depending on the vector used for transformation.
  • MRS agar Oxoid
  • concentration used for selection of transfor ⁇ mants are given in Table 16 below. Also given in Table 16 are the results from the transformations. A blank space in the Table indicates that this experiment was not performed.
  • Leuconostoc lactis ⁇ -galactosidase is encoded by two overlapping genes. J. Bacteriol. 174:4475-4481.
  • the applicants request that a sample of the deposi ⁇ ted microorganisms only be made available to an expert nominated by the requester until the date on which the patent is granted or the date on which the application has been refused or withdrawn or is deemed to be withdrawn.

Abstract

L'invention concerne un procédé d'isolation d'un fragment d'ADN de bactérie d'acide lactique comprenant un promoteur. Ledit procédé consiste à introduire une molécule d'ADN contenant un élément transposable comprenant un gène structurel exempt de promoteur utilisé en tant que sonde à gène promoteur dans une population de bactéries lactiques. L'invention porte également sur des procédés de construction d'une bactérie lactique recombinée comprenant un promoteur régulable au moyen du procédé sus-mentionné, une bactérie lactique recombinée comprenant un gène codant pour un produit génique voulu à laquelle est liée de manière opérationnelle un promoteur de bactérie lactique régulable non associé originellement au gène, ladite bactérie lactique recombinée et des plasmides recombinés étant utilisés avec un promoteur de bactérie lactique régulable.
PCT/DK1994/000004 1992-12-30 1994-01-03 Bacterie d'acide lactique recombinee contenant un promoteur insere, et son procede de construction WO1994016086A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP94904150A EP0677110B2 (fr) 1992-12-30 1994-01-03 Bacterie d'acide lactique recombinee contenant un promoteur insere
AU58325/94A AU675821B2 (en) 1992-12-30 1994-01-03 Recombinant lactic acid bacterium containing an inserted promoter and method of constructing same
JP51560094A JP3553065B2 (ja) 1992-12-30 1994-01-03 挿入プロモーター含有の組換え乳酸菌とその構築方法
DE69434196T DE69434196T3 (de) 1992-12-30 1994-01-03 Einen eingefügten Promotor enthaltendes rekombinantes Milchsäure Bakterium
CA002152898A CA2152898C (fr) 1992-12-30 1994-01-03 Bacterie lactique recombinante renfermant un promoteur incorpore; methode d'obtention
DK94904150.3T DK0677110T4 (da) 1992-12-30 1994-01-03 Rekombinant mælkesyrebakterie, der indeholder en inserteret promotor
AT94904150T ATE285476T1 (de) 1992-12-30 1994-01-03 Eingefügter promoter enthaltendes rekombinantes milchsäure bakterium
US08/179,557 US5837509A (en) 1992-12-30 1994-03-01 Recombinant lactic acid bacterium containing an inserted promoter and method of constructing same

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DK921579A DK157992D0 (da) 1992-12-30 1992-12-30 Bakteriestamme
DK1579/92 1992-12-30
US3668193A 1993-03-25 1993-03-25
DK0988/93 1993-09-01
DK98893A DK98893D0 (da) 1993-09-01 1993-09-01 Bakteriestamme

Publications (1)

Publication Number Publication Date
WO1994016086A1 true WO1994016086A1 (fr) 1994-07-21

Family

ID=26065017

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK1994/000004 WO1994016086A1 (fr) 1992-12-30 1994-01-03 Bacterie d'acide lactique recombinee contenant un promoteur insere, et son procede de construction

Country Status (11)

Country Link
EP (1) EP0677110B2 (fr)
JP (1) JP3553065B2 (fr)
AT (1) ATE285476T1 (fr)
AU (1) AU675821B2 (fr)
CA (1) CA2152898C (fr)
DE (1) DE69434196T3 (fr)
DK (1) DK0677110T4 (fr)
ES (1) ES2235159T5 (fr)
NZ (2) NZ259510A (fr)
PT (1) PT677110E (fr)
WO (1) WO1994016086A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010079A1 (fr) * 1996-09-06 1998-03-12 Bioteknologisk Institut Systeme d'expression regulable de bacteries lactiques
WO1999011284A1 (fr) * 1997-09-02 1999-03-11 Queen Mary & Westfield College Vaccin oral
FR2770536A1 (fr) * 1997-11-06 1999-05-07 Texel Nouveau plasmide non rcr apte a etre transfere dans des bact eries lactiques; utilisation comme outil de clonage et d'expression
WO1999054488A1 (fr) * 1998-04-21 1999-10-28 Chr. Hansen A/S Vecteur de clonage a usage alimentaire et son utilisation dans les bacteries lactiques
WO2001011060A2 (fr) * 1999-08-06 2001-02-15 Bioteknologisk Institut Procede d'isolement de signaux de secretion dans des bacteries d'acide lactique et nouveaux signaux de secretion isoles issus de lactococcus lactis
WO2002033109A2 (fr) * 2000-10-20 2002-04-25 Bioteknologisk Institut Ameliorations apportees a un procede de fermentation aux fins de la production de produits geniques heterologues dans des bacteries d'acide lactique
WO2002036752A2 (fr) 2000-11-06 2002-05-10 Chr. Hansen A/S Procede de production de chymosine d'origine non bovine et utilisation de cette derniere
AU757106B2 (en) * 1996-09-06 2003-02-06 Bioneer A/S Lactic acid bacterial regulatable expression system
US7358083B1 (en) 1998-04-21 2008-04-15 Chr. Hansen A/S Food-grade cloning vector and their use in lactic acid bacteria
EP2365083A1 (fr) 1997-05-30 2011-09-14 Chr. Hansen A/S Cultures de départ de bactéries de l'acide lactique et compositions
WO2013106510A2 (fr) 2012-01-12 2013-07-18 Auxilium Pharmaceuticals, Inc. Enzymes de clostridium histolyticum et procédés pour les utiliser

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014209912A1 (fr) 2013-06-27 2014-12-31 Starbucks Corporation D/B/A Starbucks Coffee Company Procédés de bioconservation pour des boissons et d'autres aliments
JPWO2018062225A1 (ja) * 2016-09-28 2019-07-11 株式会社アネロファーマ・サイエンス ビフィドバクテリウム属細菌の遺伝子発現用プロモーター
KR101915949B1 (ko) * 2018-01-09 2018-11-07 주식회사 쎌바이오텍 유전자 발현 카세트 및 그를 포함하는 발현벡터

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0228726A1 (fr) * 1985-11-29 1987-07-15 Stichting Nederlands Instituut Voor Zuivelonderzoek Méthode de préparation de protéines en utilisant des bactéries lactiques transformées
EP0307011A1 (fr) * 1987-06-12 1989-03-15 Nederlands Instituut Voor Zuivelonderzoek Fragments d'ADN contenant une région régulatrice, spécifique pour les bactéries lactiques, pour l'expression de gènes encodant des protéines normalement hétérologues
EP0380823A1 (fr) * 1988-12-07 1990-08-08 BCZ Friesland B.V. Bactéries lactiques manipulées génétiquement et leur utilisation pour la préparation de fromage et plasmides recombinants
WO1992004451A1 (fr) * 1990-08-30 1992-03-19 Genesit Oy Vecteurs sondes de promoteurs pouvant se repliquer en e.coli, b.subtilis, lactococci et lactobacillus, ainsi que leurs utilisations

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0228726A1 (fr) * 1985-11-29 1987-07-15 Stichting Nederlands Instituut Voor Zuivelonderzoek Méthode de préparation de protéines en utilisant des bactéries lactiques transformées
EP0307011A1 (fr) * 1987-06-12 1989-03-15 Nederlands Instituut Voor Zuivelonderzoek Fragments d'ADN contenant une région régulatrice, spécifique pour les bactéries lactiques, pour l'expression de gènes encodant des protéines normalement hétérologues
EP0380823A1 (fr) * 1988-12-07 1990-08-08 BCZ Friesland B.V. Bactéries lactiques manipulées génétiquement et leur utilisation pour la préparation de fromage et plasmides recombinants
WO1992004451A1 (fr) * 1990-08-30 1992-03-19 Genesit Oy Vecteurs sondes de promoteurs pouvant se repliquer en e.coli, b.subtilis, lactococci et lactobacillus, ainsi que leurs utilisations

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
GUUS SIMONS ET AL.: "Construction of a promoter-probe vector for lactic acid bacteria using the lacG gene of Lactococcus lactis", DEVELOPMENTS IN INDUSTRIAL MICROBIOLOGY, vol. 31, no. 5, 1990, pages 31 - 39 *
HANS ISRAELSEN ET AL.: "Insertion of transposon Tn917 into the Lactococcus lactis subsp. lactis chromosome", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 59, no. 1, January 1993 (1993-01-01), pages 21 - 26 *
JOS M.B.M. VAN DER VOSSEN ET AL.: "Isolation and characterization of Streptococcus cremoris Wg2-specific promoters", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 53, no. 10, October 1987 (1987-10-01), pages 2452 - 2457 *
M.E. SANDERS ET AL.: "A method for genetic transformation of nonprotoplasted Streptococcus lactis", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 53, no. 8, August 1987 (1987-08-01), pages 1730 - 1736 *
MERVI SIBAKOV ET AL.: "Secretion of TEM beta-lactamase with signal sequences isolated from the chromosome of Lactococcus lactis subsp. lactis", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 57, no. 2, February 1991 (1991-02-01), pages 341 - 348 *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6133023A (en) * 1996-09-06 2000-10-17 Bioteknologisk Institut Lactic acid bacterial regulatable expression system
AU757106B2 (en) * 1996-09-06 2003-02-06 Bioneer A/S Lactic acid bacterial regulatable expression system
WO1998010079A1 (fr) * 1996-09-06 1998-03-12 Bioteknologisk Institut Systeme d'expression regulable de bacteries lactiques
EP2365083A1 (fr) 1997-05-30 2011-09-14 Chr. Hansen A/S Cultures de départ de bactéries de l'acide lactique et compositions
WO1999011284A1 (fr) * 1997-09-02 1999-03-11 Queen Mary & Westfield College Vaccin oral
FR2770536A1 (fr) * 1997-11-06 1999-05-07 Texel Nouveau plasmide non rcr apte a etre transfere dans des bact eries lactiques; utilisation comme outil de clonage et d'expression
WO1999024591A1 (fr) * 1997-11-06 1999-05-20 Texel Plasmide de leuconostoc non rcr apte a etre transfere dans des bacteries lactiques; utilisation comme outil de clonage et d'expression
US6528285B1 (en) 1997-11-06 2003-03-04 Texel Non RCR leuconostoc plasmid capable of being transferred into lactic acid bacteria, use as cloning and expressing tool
US7358083B1 (en) 1998-04-21 2008-04-15 Chr. Hansen A/S Food-grade cloning vector and their use in lactic acid bacteria
WO1999054488A1 (fr) * 1998-04-21 1999-10-28 Chr. Hansen A/S Vecteur de clonage a usage alimentaire et son utilisation dans les bacteries lactiques
WO2001011060A3 (fr) * 1999-08-06 2001-08-23 Biotecknologisk Inst Procede d'isolement de signaux de secretion dans des bacteries d'acide lactique et nouveaux signaux de secretion isoles issus de lactococcus lactis
US7186815B2 (en) 1999-08-06 2007-03-06 Bioneer A/S Method of isolating secretion signals in lactic acid bacteria and novel secretion signals isolated from Lactococcus lactis
WO2001011060A2 (fr) * 1999-08-06 2001-02-15 Bioteknologisk Institut Procede d'isolement de signaux de secretion dans des bacteries d'acide lactique et nouveaux signaux de secretion isoles issus de lactococcus lactis
AU2002210401B2 (en) * 2000-10-20 2006-07-20 Bioneer A/S Fermentation method for production of heterologous gene products in lactic acid bacteria
US7358067B2 (en) 2000-10-20 2008-04-15 Bioneer A/S Fermentation method for production of heterologous gene products in lactic acid bacteria
WO2002033109A3 (fr) * 2000-10-20 2003-09-04 Bioteknologisk Inst Ameliorations apportees a un procede de fermentation aux fins de la production de produits geniques heterologues dans des bacteries d'acide lactique
WO2002033109A2 (fr) * 2000-10-20 2002-04-25 Bioteknologisk Institut Ameliorations apportees a un procede de fermentation aux fins de la production de produits geniques heterologues dans des bacteries d'acide lactique
EP2365069A1 (fr) 2000-11-06 2011-09-14 Chr. Hansen A/S Procédé de production de chymosine non bovine et utilisation associée
WO2002036752A2 (fr) 2000-11-06 2002-05-10 Chr. Hansen A/S Procede de production de chymosine d'origine non bovine et utilisation de cette derniere
US7270989B2 (en) 2000-11-06 2007-09-18 Chr. Hansen A/S Method of producing non-bovine chymosin and use hereof
WO2002036752A3 (fr) * 2000-11-06 2002-09-26 Hansens Lab Procede de production de chymosine d'origine non bovine et utilisation de cette derniere
US8545909B2 (en) 2000-11-06 2013-10-01 Eidgenossische Technische Hochschule Zurich Method of producing non-bovine chymosin and use hereof
US9307775B2 (en) 2000-11-06 2016-04-12 Chr. Hansen A/S Method for producing non-bovine chymosin and use hereof
WO2013106510A2 (fr) 2012-01-12 2013-07-18 Auxilium Pharmaceuticals, Inc. Enzymes de clostridium histolyticum et procédés pour les utiliser
EP3584317A1 (fr) 2012-01-12 2019-12-25 Endo Global Ventures Enzyme de clostridium histolyticum
EP4015627A1 (fr) 2012-01-12 2022-06-22 Endo Global Ventures Enzyme de clostridium histolyticum
EP4276180A2 (fr) 2012-01-12 2023-11-15 Endo Global Ventures Enzyme de clostridium histolyticum
US11879141B2 (en) 2012-01-12 2024-01-23 Endo Global Ventures Nucleic acid molecules encoding clostridium histolyticum collagenase II and methods of producing the same
US11975054B2 (en) 2012-01-12 2024-05-07 Endo Global Ventures Nucleic acid molecules encoding clostridium histolyticum collagenase I and methods of producing the same

Also Published As

Publication number Publication date
ES2235159T5 (es) 2010-05-11
JP3553065B2 (ja) 2004-08-11
DK0677110T4 (da) 2010-05-25
DK0677110T3 (da) 2005-01-24
AU5832594A (en) 1994-08-15
ES2235159T3 (es) 2005-07-01
DE69434196T3 (de) 2010-09-23
NZ259510A (en) 1997-06-24
PT677110E (pt) 2005-05-31
ATE285476T1 (de) 2005-01-15
EP0677110A1 (fr) 1995-10-18
AU675821B2 (en) 1997-02-20
NZ286635A (en) 1997-06-24
EP0677110B1 (fr) 2004-12-22
DE69434196D1 (de) 2005-01-27
DE69434196T2 (de) 2006-02-23
EP0677110B2 (fr) 2010-01-27
CA2152898A1 (fr) 1994-07-21
JPH08500739A (ja) 1996-01-30
CA2152898C (fr) 2003-04-29

Similar Documents

Publication Publication Date Title
Israelsen et al. Cloning and partial characterization of regulated promoters from Lactococcus lactis Tn917-lacZ integrants with the new promoter probe vector, pAK80
US5837509A (en) Recombinant lactic acid bacterium containing an inserted promoter and method of constructing same
Platteeuw et al. Use of the Escherichia coli beta-glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria
JP4469005B2 (ja) 選択された生物のための人工プロモーターライブラリー及び該ライブラリー由来のプロモーター
Platteeuw et al. Food-grade cloning and expression system for Lactococcus lactis
AU675821B2 (en) Recombinant lactic acid bacterium containing an inserted promoter and method of constructing same
Le Loir et al. Direct screening of recombinants in gram-positive bacteria using the secreted staphylococcal nuclease as a reporter
CA2160166C (fr) Mutants suppresseurs de bacteries d'acide lactique et leur utilisation comme marqueurs selectifs et comme moyens de confinement dans des bacteries d'acide lactique
Romero et al. Conjugative mobilization as an alternative vector delivery system for lactic streptococci
Haima et al. Development of a β-galactosidase α-complementation system for molecular cloning in Bacillus subtilis
Smith et al. Physical and functional characterization of the Bacillus subtilis spoIIM gene
US8354272B2 (en) Zinc-regulated prokaryotic expression cassettes
EP0925364B1 (fr) Systeme d'expression regulable de bacteries lactiques
Israelsen et al. Insertion of transposon Tn 917 derivatives into the Lactococcus lactis subsp. lactis chromosome
US6025190A (en) Temperature-sensitive plasmid
IE912791A1 (en) Integron of corynebacterium, method for transforming a¹corynebacterium with the said integron and the¹corynebacterium obtained
Bojovic et al. Improved vector for promoter screening in lactococci
Wells et al. Cloning and expression vectors for lactococci
WO1994006917A1 (fr) Production de proteines ou de polypeptides souhaites par mise en culture d'une bacterie d'acide lactique transformee
Sánchez et al. General and specialized vectors derived from pBM02, a new rolling circle replicating plasmid of Lactococcus lactis
Regeard et al. Genetic studies of a thermoregulated gene in the psychrotrophic bacterium Pseudomonas fluorescens
AU757106B2 (en) Lactic acid bacterial regulatable expression system
Renault Genetic engineering strategies
Vriesema et al. Wide-host-range shuttle vectors for the screening of regulated promoter activity in viridans group streptococci; isolation of a pH regulated promoter
Fitzgerald et al. Molecular Dissection of a Bifidobacterial

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR BY CA CN CZ CZ DE DE DK DK FI FI HU JP KP KR KZ LK LV MG MN MW NO NZ PL RO RU SD SK SK UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1994904150

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 259510

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2152898

Country of ref document: CA

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1994904150

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1994904150

Country of ref document: EP