WO1992007942A1 - Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques - Google Patents
Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques Download PDFInfo
- Publication number
- WO1992007942A1 WO1992007942A1 PCT/FR1991/000855 FR9100855W WO9207942A1 WO 1992007942 A1 WO1992007942 A1 WO 1992007942A1 FR 9100855 W FR9100855 W FR 9100855W WO 9207942 A1 WO9207942 A1 WO 9207942A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- leu
- sequences
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1267—Gram-positive bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
Definitions
- the invention relates to polypeptides associated with the expression of resistance to antibiotics of the glycopeptide family, in particular in Gram-positive bacteria, in particular of the Gram-positive cocci family.
- the invention also relates to a nucleotide sequence coding for these polypeptides. It also relates to the use of these polypeptides and of their nucleotide sequence as means of in vitro detection of resistance to glycopeptides.
- the invention particularly targets enterococci, streptococci and staphylococci which are of particular interest for the implementation of the invention.
- Glycopeptides including vancomycin and teicoplanin, are antibiotics that inhibit the synthesis of the bacterial wall. These antibiotics are widely used for the treatment of severe infections caused by Gram-positive cocci (enterococci, streptococci and staphylococci), in particular in cases of allergy and resistance to penicillins. Despite long clinical use of vancomycin, this antibiotic remained active on almost all strains until 1986, when the first resistant strains were isolated. Since then, resistance to glycopeptides has been detected by many microbiologists in Europe and the United States, especially in strains isolated from immunocompromised patients, making it necessary to systematic evaluation of the sensitivity of germs in hospitals.
- glycopeptides depends on the formation of a complex between the antibiotic and the precursors of peptidoglycan, more than on the direct interaction with enzymes of the metabolism of the cell wall. In particular, it has been found that the glycopeptides bind to the terminal residues D-alanyl-D-alanine (D-ala-D-ala) of the precursors of peptidoglycan.
- strain resistant to a high level is meant a strain of bacteria, in particular a Gram-positive cocci strain for which the minimum inhibitory concentrations (MIC) of vancomycin and of teicoplanin are respectively greater than 32 and 8 ⁇ g / ml.
- the MICs of vancomycin for resistant strains at a low level are between 16 and 32 ⁇ g / ml. These strains are apparently sensitive to teicoplanin.
- VANA a particular protein having a certain homology with D-alanine-D-alanine ligases. VanA is nevertheless functionally distinct from ligases.
- van " will denote a gene sequence and "Van " an amino acid sequence.
- the invention relates to polypeptides or proteins involved in the expression of resistance to antibiotics of the glycopeptide family and in particular to vancomycin and / or teicoplanin, as well as the nucleotide sequences coding for such complexes.
- the invention also relates to nucleotide probes which can be used for the detection of resistance to glycopeptides, in particular by the reaction chain polymerization (PCR), or by tests involving antibodies.
- PCR reaction chain polymerization
- the invention relates to a polypeptide composition, characterized in that it comprises at least one protein or part of protein chosen from the amino acid sequences identified in the sequence list by SED ID NO 1 (VanH), SEQ ID NO 2 (VanA), SEQ ID NO 3 (VanX) or SEQ ID NO 19 (VanC), or any protein or part of protein recognized by the antibodies directed against VanH, VanA, VanX or VanC, or any protein or part of encoded protein by a sequence hybridizing with one of the nucleotide sequences identified in the sequence list by SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 or SEQ ID NO 21 or with one of the following V1 or V2 sequences in stringent or little stringent conditions:
- V2 AAT ACX ATX CCX GGX TTT AC
- a first particular composition according to the invention involved in the expression of resistance to glycopeptides is characterized in that it comprises at least 3 proteins or any part of one or more of these proteins necessary to confer on Gram bacteria -positive, resistance to antibiotics of the glycopeptide family, in particular to vancomycin and / or teicoplanin, or to promote this resistance, in particular in strains of the Gram-positive cocci family, these proteins or parts of protein being a) recognized by antibodies directed against one of the sequences identified in the sequence list by SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO
- ORF3 ORF1 containing the gene vanH, vanA (or ORF2); they characterize the resistance proteins as obtained from the Enterococcus faecium BM4147 strain described by Leclerq et al (N Engl J Med 319: 157-161).
- VanC Another protein, VanC, related to D-Ala- D-Ala ligases but of different specificity has been characterized in Enterococcus gallinarum BM4173; the vanC gene has domains having sufficient homology with the vanA gene, so that probes corresponding to specific regions of vanA allow its detection.
- E. gallinarum is an isolate constitutively resistant to low levels of vancomycin (Dutka-Malen et al, Antimicrob. Agents Chemother 34 (1990b) 1875-1879).
- polypeptides means any chain of amino acids which may contain proteins, or of a size smaller than that of a protein.
- the stringency conditions referred to above are determined according to the usual methods with regard to the hybridization of sequences. nucleotides.
- sequences hybridizing with the sequence of the vanA gene SEQ ID NO 8
- the following conditions may be applied: for a hybridization under conditions of high stringency:
- the hybridization temperature is 60oC overnight and the temperature of the washes
- glycopeptides The expression of resistance to glycopeptides can result in the persistence of an infection due to germs usually sensitive to glycopeptides.
- a polypeptide or a protein is necessary for the expression of resistance to glycopeptides, since its absence makes the strain which contains this polypeptide or this protein, more sensitive to glycopeptides and that this polypeptide or protein is not present in sensitive strains.
- the polypeptides entering into the composition defined above corresponds to the association of proteins identified in the list of sequences by SEQ ID NO 1 (VanH), SEQ ID NO 2 (VanA ), SEQ ID NO 3 (VanX).
- the inventors have therefore found that the expression of resistance to glycopeptides in Gram-positive bacteria requires the expression of at least three proteins or of polypeptides derived from these proteins.
- the polypeptides of the composition are further characterized in that the amino acid sequences necessary for the expression of resistance to antibiotics of the glycopeptide family are under the control of regulatory elements, in particular proteins corresponding to the sequences designated by SEQ ID NO 4 or SEQ ID NO 5 in the list of sequences, and which correspond respectively to a regulatory R sequence and to a sensor S sequence.
- VanS and VanR constitute a two-component regulatory system, VanR being a transcription activator and VanS stimulating transcription dependent on VanR. VanS is capable of modulating the level of VanR phosphorylation in response to vancomycin present in the external medium and thus intervenes in the control of the transcription of genes resistant to vancomycin.
- regulatory sequences are in particular capable of increasing the level of resistance, insofar as they promote the expression of the resistance proteins included in the polypeptides of the invention.
- the polypeptides of the above composition are coded by the sequence SEQ ID NO 6 identified in the list of sequences, which represents the coding sequence of the proteins described above.
- Another sequence according to the invention is designated by SEQ ID NO 11 which contains the sequence SEQ ID NO 6 as well as a sequence upstream from SEQ ID NO 6 coding for a transposase (coded by the strand (-) of the sequence, and a sequence downstream of SEQ ID NO 6 corresponding to vanY and vanZ genes and at each end, repeated reverse sequences of 38 bp.
- SEQ ID NO 11 constitutes a transposon whose genes intervene at different levels in the establishment of resistance to glycopeptides.
- the invention also relates to the purified proteins belonging to the composition and to the polypeptides described above.
- the invention relates to the purified protein VanA, characterized in that it corresponds to the amino acid sequence SEQ ID NO 2 in the list of sequences or a VanC protein, encoded by a gene capable of hybridizing with the gene vanA.
- the VanA protein contains 343 amino acids and has a calculated molecular mass of 37,400 Da.
- the VanC protein contains 343 amino acids and has a calculated molecular mass of 37504 Da.
- proteins of interest in the context of the invention correspond to the sequences identified by SEQ ID NO 1 (VanH), SEQ ID NO 3 (VanX), SEQ ID NO 4 (VanR), SEQ ID NO 5 (VanS) in the list of sequences.
- SEQ ID NO 1 contains the VanH protein encoded by the vanH gene, this protein contains 322 amino acids and begins with a methionine.
- This protein is an enzyme involved in the synthesis of peptidoglycan and has a molecular mass of 35,754 kDa.
- VanH has certain similarities with dehydrogenases which catalyze the NAD + dependent oxidation of 2-hydroxy acids carboxylic to form the corresponding 2-ketocarboxylic acids.
- the VanH protein could implement NADP + rather than NAD + .
- the VanH protein also contains several residues of reactive sites which probably participate directly in the binding of the substrate and in catalysis.
- VanH would be involved in the synthesis of a substrate for the VanA ligase.
- This substrate for VanA would be a D- ⁇ -hydroxy-carboxylic acid, which would be condensed by VanA with D-alanine in place of a amino acid D, which would affect the binding of the precursor of peptidoglycan, with vancomycin, by loss of a hydrogen bond because one of the hydrogen bonds formed between vancomycin and N-acetyl-D-Ala-D-Ala is produced with the NH group of the D-alanine-terminal residue.
- Al is the abbreviation of "alanine”.
- VanA ligase D-alanine: D-alanine of specificity altered for its substrate
- VanA ligase D-alanine of specificity altered for its substrate
- the invention also relates to any combination of these different proteins in a resistance complex, as well as hybrid proteins comprising one or more of the above proteins, or part of these proteins, in association with a determined amino acid sequence.
- nucleotide sequences encoding one of the amino acid sequences described above.
- a particular sequence is the nucleotide sequence of approximately 7.3 kb, corresponding to the HindIII-EcoRI restriction fragment, as obtained from the plasmid pIP816 described in the publication by Leclercq et al - 1988, cited above.
- This 7.3 kb sequence includes the nucleotide sequence coding for the 3 resistance proteins and the 2 regulatory proteins mentioned above. This coding sequence is included in an internal BglII-Xbal fragment. It also includes part of the coding sequences of transposase and resolvase.
- the invention also relates to any nucleotide fragment comprising the aforementioned restriction fragment as well as any part of the HindIII-EcoRI fragment, in particular the 3.4 kb fragment approximately EcoRI-Xbal coding for the 3 resistance proteins or the fragment of 1, 7 kb approximately EcoRV-SacII coding for VanA or else the 3.3 kb fragment approximately HindIII-EcoRI coding for the 2 regulatory proteins VanR and VanS.
- nucleotide sequence of the invention corresponds to a nucleotide fragment comprising, in order, the following restriction sites, as obtained from the abovementioned pIP816:
- nucleotide sequence is characterized in that it corresponds to the sequence chosen from the sequences identified by SEQ ID NO 7, SEQ ID NO 6, SEQ ID NO 11 or SEQ ID NO 22, or in that it includes this first sequence or any part of this sequence, or even all chain or part of chain of complementary DNA or any chain of RNA corresponding to one of these DNA, susceptible,
- sequence SEQ ID NO 7 codes for the 3 resistance proteins VanH, VanA and VanX.
- sequence SEQ ID NO 22 and the sequence SEQ ID NO 11 comprise a transposon represented in FIG. 7a; this transposon contains the genes necessary for the expression of resistance to glycopeptides, as well as the genes associated with this resistance involved for example in the regulation of the expression of the genes necessary for obtaining the resistance phenotype or involved in the quantity of resistance polypeptide obtained.
- a particular sequence corresponding to the definition above is one of the following sequences: V1: GGX GAA GAT GGX TCX TTX CAA GGX
- V2 AAT ACX ATX CCX GGX TTT AC
- V1 and V2 allow the constitution of probes if necessary in association with other nucleotides, depending on the degree of specificity sought for detecting vanA and vanC and can also be used as primers in polymerization chain reactions.
- nucleotide sequences are the sequences SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 21, SEQ ID N012 (transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY ), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or a variant of one of these sequences as soon as it codes for a protein with immunological properties and / or functional similar to those of the proteins encoded by the sequences SEQ ID NO 8 SEQ (vanA), ID NO 9 (vanH), SEQ ID NO 10 (vanX), or SEQ ID NO 21 (vanC), SEQ ID NO12 ( transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or in that it allows the detection of strains resistant to antibiotics of the glycopeptide family.
- Variants include all fragments of the sequences having the following properties.
- the nucleotide sequence designated by SEQ ID NO 8 corresponds to a DNA fragment of 1029 bp located between the ATG codon at position 377 and the TGA codon at position 1406 on the plasmid pAT214 (FIG. 6).
- the invention also relates to a nucleotide sequence corresponding to the sequence SEQ ID NO 6 corresponding to the coding sequence of the 5 proteins (2 regulatory proteins and 3 resistance proteins), and also comprising the flanking sequences associated with these coding sequences, or including this sequence.
- flanking sequences are the sequences represented on the following pages and delimited as follows:
- sequence upstream of the sequence coding for R between bases 1 and 1476 of the sequence of FIG. 5,
- sequence between the sequence coding for the sensor protein S and ORF1 between the bases 3347 and 3500 of the sequence of FIG. 5,
- sequence downstream of the coding sequence 0RF3 between bases 6168 and 7227 of the sequence of FIG. 5.
- sequence designated by SEQ ID NO 6 is further characterized by the fragment comprising the restriction sites in the following order:
- the inventors have identified upstream and downstream genes vanR, vanS, vanH, vanA and vanX necessary or associated with the expression of resistance to glycopeptides at a given level, from genes coding for a transposase and a resolvase (upstream from the aforementioned group) and genes vanY and vanZ, downstream from this group.
- the transposase and resolvase genes would be involved in transposition functions and the vanY gene coding for a D, D-carboxy peptidase would be involved in the metabolism of peptidoglycan, and could contribute to resistance to glycopeptides in E. faecium BM4147 even if vanR, vanS, vanH, vanA and vanX carried by a plasmid with a high number of copies, alone confer a high level of resistance.
- the coding sequence of the transposase is located on the (-) strand of the sequence ID NO 22 which codes for vanR, vanS, vanH, vanA, vanX, vanY, vanZ and the resolvase.
- the invention relates not only to the DNA sequences identified in the sequence list but also to the complementary DNA sequences and the corresponding RNA sequences.
- the invention also relates to the equivalent sequences of the preceding ones, either in terms of expression of proteins, of polypeptides or of their fragments described above, or in terms of the ability to detect, for example by chain polymerization techniques, strains of Gram-positive bacteria, showing resistance to antibiotics of the glycopeptide family such as vancomycin or teicoplanin.
- Also forming part of the invention are recombinant sequences characterized in that they comprise one of the above nucleotide sequences.
- the invention also relates to a recombinant vector characterized in that it comprises one of the above nucleotide sequences, at a site which is not essential for its replication, under the control of regulatory elements capable of intervening in the expression, of resistance to antibiotics of the glycopeptide family, in particular vancomycin or teicoplanin, in a determined host.
- Recombinant vectors which are particularly advantageous for implementing the invention are the following vectors: pAT214 containing the 1761 bp EcoRV-SacII fragment containing a nucleotide sequence coding for the VanA protein; in these vectors, the sequences of the invention are advantageously placed under the control of promoters such as the lac promoter.
- the invention also relates to a recombinant cell host comprising a nucleotide sequence as described above or a vector described above, under conditions allowing the expression of resistance to antibiotics of the glycopeptide family, in particular resistance to vancomycin or / and teicoplanin, this host being for example chosen from bacteria, in particular Gram-positive cocci.
- yeasts for certain applications, it is also possible to use yeasts, fungi, insect or mammalian cells.
- the invention also relates to a nucleotide probe characterized in that it is capable of hybridizing with a sequence described above, this probe being optionally labeled. These probes may or may not be specific for glycopeptide resistance proteins.
- Markers which can be used for the purposes of the invention are the radioactive markers known as well than other markers such as enzyme markers or chemoluminescent markers.
- Gram-positive In this case, low stringency conditions can be used.
- Nucleotide probes according to the invention can be characterized in that they are specific in Gram-positive bacteria sequences coding for a protein for resistance to glycopeptides, in particular vancomycin and / or teicoplanin, these probes being able to besides being universal among these sequences.
- probes any oligonucleotide hybridizing with a nucleotide sequence coding for one of the proteins according to the invention, as described in the preceding pages, and not exhibiting a cross-hybridization or amplification reaction (PCR ) with sequences present in all sensitive strains.
- PCR cross-hybridization or amplification reaction
- the universal character of the oligonucleotides which can be used in PCR is determined by their capacity to specifically promote the amplification of a nucleotide sequence involved in resistance in any strain of Gram-positive bacteria, resistant to antibiotics of the glycopeptide family.
- nucleotide probes according to the invention can vary depending on the use sought.
- fragments of usual length will be used in this technique.
- probes you can take any part of the sequences of the invention, for example probe fragments of 200 nucleotides.
- a nucleotide probe is chosen for its specificity with respect to a nucleotide sequence coding for a protein necessary for the expression in Gram-positive bacteria of a high level of resistance antibiotics of the glycopeptide family, in particular vancomycin and teicoplanin.
- probes of interest may be chosen from the intragenic part of the vanA gene.
- probes advantageous for carrying out the invention are characterized by their universal character, according to the preceding definition, but not specific for resistance genes. They can also be used as PCR primers, and are for example:
- V2 AAT ACX ATX CCX GGX TTT AC
- V1 and V2 hybridize with vanA and vanC and are capable of leading to the detection in other microorganisms, of proteins associated with resistance to glycopeptides.
- probes of the invention have the specific character of a nucleotide sequence coding for a protein necessary for the expression in Gram-positive bacteria of a low level of resistance to antibiotics of the family of glycopeptides, particularly vancorycine in Gram-positive bacteria.
- oligonucleotide probes which would be derived from the sequence of the vanA gene coding for the VanA protein can be used to search for either high or low level resistance.
- a probe of the invention is characterized in that it hybridizes, with a chromosomal or non-chromosomal nucleotide sequence of a Gram-positive strain resistant to glycopeptides, in particular vancomycin and / or the teicoplanin, in particular in that it hybridizes with a chromosomal or non-chromosomal nucleotide sequence of a Gram-positive cocci strain, for example an enterococcal strain and preferably E. faecium 4147 or E. gallinarum.
- a hybridization test can be carried out by implementing conditions of high stringency.
- oligonucleotides of the invention can be obtained from the sequences of the invention, by cleavage with restriction enzymes, or by chemical synthesis according to conventional methods.
- the invention further relates to polyclonal or monoclonal antibodies, characterized in that they recognize the polypeptide or polypeptides described above or an amino acid sequence described above.
- monoclonal antibodies can be obtained by conventional methods of antibody production.
- monoclonal antibodies we will have recourse to the method of Kolher and Milstein according to which monoclonal antibodies are prepared by cell fusion between myeloma cells and spleen cells of mice previously immunized with a polypeptide or a composition according to the invention, according to the conventional method.
- the antibodies of the invention can advantageously be used for the detection of the presence of proteins characteristic of resistance to glycopeptides, in particular to vancomycin and to teicoplanin.
- antibodies are polyclonal or monoclonal antibodies directed against the protein VanA or VanC. Such antibodies advantageously make it possible to detect strains of bacteria, in particular Gram-positive cocci exhibiting high level resistance with respect to antibiotics of the glycopeptide family. If necessary, a step of prior lysis of the cells of the sample subjected to detection is carried out before the sample is brought into contact with the antibodies.
- tests for the detection in Gram-positive bacteria of a resistance to glycopeptides, in particular tests implementing the ELISA techniques.
- the means developed by the inventors also have the entirely advantageous advantage of being suitable for carrying out a rapid and reliable test or kit for detecting Gram-positive strains resistant to glycopeptides by the polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the carrying out of a test by the method of amplification of the genes of these proteins is made by the PCR technique or by the IPCR technique (IPCR: abbreviation of reverse chain polymerization reaction).
- the IPCR technique allows the amplification of the NH 2 and COOH terminal regions of the genes that it is desired to detect.
- Certain specific primers make it possible to amplify the genes of the resistant strains at low level. These primers are for example chosen from the sequence coding for the VanA resistance protein.
- sequences can be used as primers for the preparation of probes for the detection of an amplification by the PCR or IPCR method.
- V2 AAT ACX ATX CCX GGX TTT AC
- X represents one of the bases A, T, C or G or also corresponds in all cases to inosine.
- the invention naturally targets the probes complementary to the oligonucleotides previously described as well as possibly the RNA probes which correspond to them.
- a kit for the in vitro diagnosis of the presence of strains of Gram-positive bacteria, resistant to glycopeptides, in particular resistant to vancomycin and / or to teicoplanin, these strains belonging in particular to Gram-positive cocci, in particular in what are strains of enterococci, for example E. faecium or E. gallinarum, is characterized in that it comprises:
- nucleotide probe corresponding to the above definitions and, where appropriate,
- the invention also relates to a method of in vitro detection of the presence of Gram-positive strains, resistant to glycopeptides, in particular to vancomycin and / or to teicoplanin, these strains belonging in particular to the Gram-cocci family.
- positive in particular in the case of enterococcal strains, for example E. faecium or E.gallinarum, characterized in that it comprises:
- step c) repeating step a) so as to obtain a detectable quantity of the nucleotide sequences sought
- the detection of the elongation products of the desired sequence can be carried out by a probe identical to the primers used to carry out the PCR or IPCR technique, or also by a probe different from these primers, this probe being optionally labeled.
- A Restriction maps of the insertions of plasmids pAT213 and pAT214.
- the vector and DNA insert are distinguished by light and dark segments respectively.
- the open arrow represents the vanA gene.
- FIG. 8 nucleotide sequence of the transposon shown in Figure 7 and amino acid sequence of the corresponding proteins.
- the nucleotide sequence is presented for the (+) strand and for the (-) strand (corresponding to the complementary sequence of the (+) strand at positions 1 to 3189) on which the coding sequence of the transposase is located.
- nucleotide sequence of the 1347 bp Sacl-PstI fragment of the plasmid pAT216 containing the vanC gene The numbering starts at the first G base of the Sacl restriction site. The potential RES sequence upstream of the ATG translation initiation codon at position 215 is underlined. The STOP codon (TGA) is indicated by *. The coding region of vanC and the deduced amino acid sequence are indicated in bold. Overlapping sequential clones were generated by restriction cloning fragments of pAT216 in bacteriophage M13mp10 (Amersham, England). The universal primer (New England Biolabs Beverly MA) was used to sequence the insert of the recombinant phages.
- the sequencing was carried out by the enzymatic method of di-deoxy nucleotide (Sanger et al, 1977 PNAS 74: 5463-5467) using T7 DNA polymerase (Sequenase US B CORP, Cleveland, OH) and [ ⁇ - 35 S] dATP (Amersham, England). The reaction products were loaded onto 6% denaturing polyacrylamide gels.
- FIG. 10 alignment of the amino acid sequences of VanC, VanA, DdlA and DdlB.
- the identical amino acids (I) and the conservative substitutions (C) in the 4 sequences are indicated in the alignment.
- the amino acids have been grouped as follows: RK, LFPMVI, STQNC, AGW, H, ED and Y. Regions of strong homology corresponding to domains 1, 2, 3 and 4 are underlined. The sequences corresponding to peptides 1 and 2 are indicated by the arrows.
- oligonucleotides V1 and V2 (A): Amino acid sequence of peptides 1 and 2 of VanA and D-Ala-D-Ala ligases. The number of amino acids between the N-terminus and peptide 1, between peptides 1 and 2 and peptide 2 and the C-terminal end is indicated. The identical amino acids between at least 2 of the 3 sequences are shown in bold type.
- X represents any base of DNA.
- Peptide 2 in DdlB differs from the target peptide in 2 positions (*).
- C Nucleotide sequence of V1 and V2. Alternate nucleotides and deoxyinosine (I), which can correspond to any DNA base, have been used at positions where the nucleotide sequences encoding the target peptides vary. The arrows indicate the direction of DNA synthesis.
- the oligonucleotides were synthesized by the methoxy-phospharamidite method with a Biosystem DNA 380B device (Applied Biosystem, Foster City, Ca). DNA was isolated from bacterial lysates by extraction with hexadecyl trimethyl ammonium bromide (Inst. Biotechnologies, Inc, New Haven, CO) (Le Bouguénec et al, 1990, J. Bacteriol.
- FIG. 12 inactivation by insertion of vanC.
- the vanC gene is represented by an open arrow and the internal fragment of 690 bp EcoRI-HinCII is hatched.
- the DNA of pAT114 is shown; in bold line the chromosomal DNA of PM4174; arrows indicate antibiotic resistance genes: aphA-3 is the gene coding for 3'-aminoglycoside phosphotransferase; erm is the gene encoding ER R methyl transferase.
- the plasmid pAT217 was constructed by ligation of the EcoRI-HinCII fragment of pAT216 with the suicide vector pAT114 (Trieu-Cuot et al, 1991, Gene 106: 21-27) digested with EcoRI and SmaI.
- Hybridization was carried out with probe C (Middle) or the aphA-3 probe specific for pAT114 (Lambert et al, 1985, Annales de l'Institut Pasteur / Microbiol. 136 (b): 135-150).
- FIG. 14 alignment of amino acid sequences deduced from VanS from E. faecium BM4147 and from PhoR and EnvZ from E.coli.
- the numbers on the left refer to the position of the first amino acid in the alignment.
- the numbers on the right refer to the position of the last amino acid in the line corresponding.
- Identical amino acids are boxed.
- the dotted lines indicate holes introduced to optimize the similarity.
- the lines indicate the positions of the conserved amino acid patterns in other HPKs.
- the histidine residues in bold in motif 1 are potential autophosphorylation sites.
- Enterococcus faecium BM4147 was cultured until an optical density (OD 600 ) of 0.7 was obtained in 500 ml of heart-brain broth (broth BHI medium).
- the induction was carried out with 10 ⁇ g / ml of vancomycin (Eli Lilly Indianapolis Ind).
- the subsequent steps were carried out at 4oC.
- the cells were recovered by centrifugation for 10 minutes at 6000 g, washed in TE buffer (0.01 M TRIS-HCl, 0.002 M EDTA, pH 7.0) and lysed with glass beads (100 ⁇ m in diameter) in a Braun device for 2 minutes.
- the cellular debris was separated by centrifugation for 10 minutes at 6000g.
- the membranes were collected by centrifugation for 1 hour at 65,000 g and resuspended in 0.5 ml of TE buffer.
- Plasmids were introduced by transformation into the E.coli AR1062 strain prepared in the form of a bacterial sac.
- the bacterial bags were recovered on sucrose gradients and the proteins were labeled with 50 ⁇ Ci of [ 35 S] L-methionine (Amersham, Great Britain) according to the method of Rambach and Hogness (1977, PNAS USA, 74; 5041-5045).
- E.coli JM83 and derived strains were cultured in BHI medium until an optical density (OD 600 ) of 0.7 was obtained, washed and suspended in TE buffer.
- the cell suspension was treated with ultrasound (phonolyzed) for 20 seconds with doses of 50 W in a cell fragmentation device in a Branson B7 ultrasound device and the intact cells were removed by centrifugation for 10 minutes at 6000 g.
- the supernatant was fractionated into membrane and cytoplasmic fractions by centrifugation for 1 hour at 100,000 g.
- SDS polyacrylamide gel electrophoresis SDS polyacrylamide gel electrophoresis (SDS-PAGE)
- the proteins of the bacterial fractions were separated by SDS-PAGE in gels with linear gradient of polyacrylamide (7.5% - 15%) (Laemmli 1970, Nature 227: 680-685). The electrophoresis was carried out for 1 hour at 200 V then 3 hours at 350 V. The gels were stained with Coomassie blue. The proteins of the extracts were separated in 10% polyacrylamide gels and visualized by autoradiography.
- the proteins of the membrane fractions of an induced culture of E.faecium BM4147 were separated by SDS-PAGE.
- the gel was electrotransferred for 1 hour at 200 mA on a polyvinylidene difluoride membrane (Immobilon Transfer, Millipore) using a transfer device (Electrophoresis Unit LKB 2117 Multiphor II) according to the manufacturer's recommendations.
- the transferred proteins were stained with Ponceau red.
- the portion of membrane carrying the protein of interest was cut, centered on a teflon filter and placed in the cartridge of the block of a sequencer (Sequencer Applied Biosystems model 470A).
- the protein was sequenced by the automated degradation of Edman (1967, Eur. J. Biochem 1; 80-81).
- the plasmid pAT213 (Brisson-No ⁇ l et al, 1990, Antimicrob Agents chemother, 34; 924-927) consists of a 4.0 kb EcoRI DNA fragment from the plasmid pIP816 enterococcus cloned at the EcoRI site of a gram-positive-gram-negative shuttle vector pAT187 (Trieu-Cuot et al, 1987, FEMS Microbiol Lett 48; 289-294). To construct pAT214, the 1761 bp DNA fragment EcoRV-SacII of pAT213 was purified, treated with the Klenow fragment of DNA polymerase I from E.
- restriction DNA fragments were subcloned into the polylinker of the replication forms of the mpl8 and mpl9 derivatives of the bacteriophage M13 (Norrander et al, 1983, Gene 26; 101-106), obtained from Pharmacia PL Biochemicals. E. coli JM103 was transfected with recombinant phages and single stranded DNA was prepared.
- the nucleotide sequencing was carried out by the enzymatic method of di-deoxy nucleotides (Sanger et al, 1977, PNAS USA 74; 5463-5467) using a T7 DNA polymerase (Sequenase, United States Biochemical Corporation, Cleveland Ohio) and l '[ ⁇ 35 S] dATP (Amersham, Great Britain).
- T7 DNA polymerase Sequenase, United States Biochemical Corporation, Cleveland Ohio
- l '[ ⁇ 35 S] dATP Amersham, Great Britain
- the complete DNA sequence was assembled using the computer programs DBCOMP and DBUTIL (Staden, 1980, Nucleic Acids Res 8; 3673-3694).
- the protein database, PSEQIP from the Institut Pasteur was screened using an alogorythm developed by Claverie (1984, Nucleic Acids Res 12; 397-407). Alignments between pairs of amino acid sequences were constructed using the algorithm of Wilbur et al (1983, P.N.A.S USA 80; 726-730). The statistical significance of homology was assessed with the algorithm of Lipman and Pearson (1985, Science 227; 1435-1440).
- the plasmids were introduced by transformation into E. coli ST640, a temperature-sensitive mutant with an unmodified ligase D-ala-D-ala (Lugtenberg et al 1973, J. Bacteriol 110; 26-34).
- the transformants were selected at 30 ° C. on plates containing 100 ⁇ g / ml of ampicillin and the presence of the plasmid DNA of the desired size and the restriction maps were checked.
- the protein band represents the same protein since this band is absent from the membranes of a derivative of BM4147 which has lost the plasmid pIP816.
- the inducible protein, designated VanA was purified after SDS-PAGE and an automated degradation of Edman was carried out on a sample of 50 pmol.
- VanA Nine amino acids of the N-terminal sequence of VanA have been identified: Met Asn Arg Ile Lys Val Ala Ile Leu.
- the 4.0 kb insert of plasmid pAT213 carries the determinant of resistance to glycopeptide from E. faecium BM4147.
- Various restriction fragments of this insert have been subcloned into pUC18 and the Recombinant vanA plasmids in E. coli were identified by SDS-PAGE analysis of the proteins of the cytoplasmic and membrane fractions or extracts of bacterial sacs. This approach was used because E.coli is inherently resistant to the glycopeptide.
- the EcoRV-SacII insert of the plasmid pAT214 (FIG. 2) codes for a single 40 kDa polypeptide which migrates jointly with VanA, derived from the membrane preparations of E. faecium BM4147.
- the nucleotide sequence of the 1761 bp EcoRV-SacII insert in pAT214 was determined on the two strands of DNA according to the strategy described in FIG. 2.
- the location of the termination codons (TGA, TAA, TAG) in three Reading frames on each strand of DNA showed the presence of a single open reading frame (ORF) having a size sufficient to code for the VanA protein.
- This ORF reading frame is located between the TAA codon at position 281 and the TAG codon at position 1406.
- the amino acid sequence deduced from ORF was compared with that of the N-terminal end of VanA.
- the nine amino acids identified by protein sequencing are coded by the nucleotide sequence starting with the ATG codon (methionine) in position 377 (FIG. 3).
- This translation initiation codon is preceded by a sequence (TGAAAGGAGA), characteristic of a ribosome binding site (RBS) of Gram-positive bacteria which is complementary to the 8 bases of the rRNA of the subunit 16S of Bacillus subtilis in its part (3'OH UCUUUCCUCC 5 ') (Moran et al, 1982, Mol. Gen. Genet. 186; 339-346).
- TGAAAGGAGA ribosome binding site
- the 1029 bp sequence which extends from the ATG codon at position 377 to the TGA codon at position 1406 codes for a protein. containing 343 amino acid residues.
- the calculated molecular weight of this protein is 37400 Da which is in agreement with the estimate of 40 kDa obtained by the SDS-PAGE analysis.
- the E. coli ST640 strain is a thermosensitive mutant exhibiting deficient D-ala-D- ala ligase activity (Lugtenberg et al, 1973, J. Bacteriol 113: 96-104).
- the plasmids pUC18 and pAT214 were introduced by transformation into E.coli ST640.
- Strains ST640 and ST640 (pUC18) normally grew only at the permissive temperature (30oC) while E. coli ST640 (pAT214) grew at both the permissive temperature and the non-permissive temperature (42oC).
- VANA is functionally related to D-Ala-D-Ala ligases in E.coli and is probably capable of catalyzing the same ligation reaction as DALIG.
- restriction fragments of pIP816 were cloned into derivatives of the vector pAT29 which constitutes a shuttle vector between the gram-positive and gram-negative bacteria (oriR pAM / 31, oriR pUC, oriT RK2, spc, lacZ ⁇ ) (Trieu-Cuot et al, 1990, Nucleic Acids Res. 18: 4296).
- This vector was constructed by the inventors and used to transform the E.
- Plasmid DNA was prepared by a small-scale alkaline lysis protocol (Sambrook et al, 1982, Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor NY) and introduced by electrotransformation (Cruz-Rodz AL et al, 1990, Mol. Gen. Genet. 224: 152-154) in E.
- the integrative plasmid pAT113 (Mob + , Em R , Km R , oriR PACYC184, attTnl545, LacZ ⁇ ) (Trieu-Cuot et al. Gene 106: 21-27) carries the joined ends of the Tn1545 transposon.
- This vector does not replicate in gram-positive bacteria but integrates with the host chromosome by illegitimate recombination mediated by the integrase of Tnl545 or Tn916 (Trieu-Cuot et al above).
- the integrative plasmids were introduced by electrotransformation into E. faecalis BM4148 (strain JH2-2:: Tn916). This strain is modified by the transposon Tn916 described by Frangue AE et al (1981, J. Bacteriol. 145: 494-502).
- the cultures were carried out in a heart-brain broth (BHI - Brain Heart Infusion Broth) or on agar at 37oC.
- BHI heart-brain broth
- the method of Steers et al (Antibiot. Chemother. Basel. 9: 307-311) was used to determine the minimum inhibition concentrations (MICs) of the antibiotics on a Mueller-Hinton agar agar medium.
- the origin of the vectors and of the inserts used for the recombinant plasmids constructed here is as follows:
- vector pAT78 for the recognition of promoter the amplified DNA of the cat gene of chloramphenicol acetyltransferase of the plasmid pC194 of Staphylococcus aureus (Horinouchi et al, 1982, J. Bacteriol. 150: 815-825) was inserted between the sites of restriction PstI and SphI of the shuttle vector pAT29. Amplification by the polymerase chain reaction was carried out using primers A1 and A2 which were synthesized by the methoxy phosphoramidite method (Mecuringt et al, 1990, Plasmid 23: 27-34).
- the A1 primer sequence (5'GCTGCAGATAAAAATTTAGGAGG) is composed of a PstI recognition site (underlined) and 18 bases (positions 6 to 23) of pC194 which include the ribosome binding site (RBS; AGGAGG positions 18 23) of the cat gene.
- the primer sequence A2 (5'CGCATGCTATTATAAAA GCCAGTC) contains the SphI cleavage site (underlined) and is complementary (positions 8 to 24) to 17 bases from the 3 'end of the cat gene.
- the ATT triplet at positions 9 to 11 corresponds to the TAA stop codon of cat.
- the DNA fragments amplified with primers A1 and A2 therefore consist of an open reading phase (orf) and of a ribosome binding site for CAT (positions 1234 to 1912 according to the numbering of Horinouchi et al (1982, J. Bacteriol. 150: 815-825) flanked by the PstI and SphI sites.
- Position 1234 is located inside the loop of the secondary structure of the mRNA which blocks translation in the absence of chloramphenicol. amplified does not contain the cat promoter or the RBS complementary sequence which is essential for the regulation of translation Ambulos, N. P et al, 1984, Gene 28: 171-176).
- expression vector pAT79 the 243 bp Clal-BssHII fragment carrying the promoter P2 of the aphA-3 gene of the enterococcal plasmid pJH1 (Caillaud et al, 1987, Mol. Gen. Genêt. 202: 509-513 ) was inserted between the EcoRI and SacI restriction sites of pAT78.
- (iii) plasmid pAT80 and its derivatives the 5.5 kb BglII-Xbal fragment from pIP816 was inserted between the BamHI and Xbal sites of pAT78.
- the resulting plasmid called pAT80 was partially digested with HincII and ligated with the EcoRV fragment containing a gene related to the apha-I gene of the Tn903 transposon (Oka A. et al, 1981, J. Mol. Biol. 147: 217-226 ).
- This fragment contains the gene aphA-I which codes for the 3'aminoglycoside phosphotransferase type I conferring resistance to kanamycin.
- aphA-I was carried out at three different sites in pAT80, generating the plasmids pAT81, pAT83 and pAT85.
- the BamHI and EcoRI cassettes containing aphA-I were inserted at the BamHI (to form the plasmid pAT84) and EcoRI (to form the plasmid pAT82) sites of pAT80.
- plasmid pAT86, pAT87, pAT88 and pAT89 the plasmid pAT86 was constructed by cloning the fragment of 2.803 bp, EcoRI-SacII of pAT80 coding for VanH and VanA, at a Smal site of pAT79.
- pAT87 was obtained by inserting the 3.4 kb EcoRI-Xbal fragment from pAT80 upstream of the cat gene of the promoter detection vector pAT78.
- the plasmid pAT88 resulted from the ligation of pAT78 digested with EcoRI and BamHI with the EcoRI-BamHI fragment of 1.731 bp of pAT80.
- the BglII-AccI fragment (positions 1 to 2356) of pAT80 was inserted into the polylinker of the integrative vector pAT113, generating pAT89.
- the restriction DNA fragments were subcloned into a polylinker of replicative derivatives of bacteriophage M13, these derivatives being called mp18 and mp19 (Norrander et al, 1963, Gene 26: 101-106).
- E.coli JM103 was transfected with the recombinant phages and single stranded DNA was prepared.
- the nucleotide sequencing was carried out according to the conditions described by Sanger et al (Proc. Natl. Acad. Sci. USA, 1977, 74: 5463-5467) using the modified T7 DNA polymerase (Sequenase, United States, Biochemical Corporation Cliveland OH) and [ ⁇ -35S] dATP (Amersham).
- the reaction products were resolved on gradient gels in a 6% polyacrylamide buffer.
- the JH2-2 derivatives of E. faecalis were cultured at an OD 600 optical density of 0.7 in a BHI broth medium supplemented with spectinomycin (300 ⁇ g / ml). The cells were treated with a lysozyme, lysed by sonication and the cell debris were centrifuged for 45 minutes at 100,000 g according to the description by Courvalin et al (1978, Antimicrob. Agents Chemother. 13: 716-725).
- the vanH and vanA genes of plP816 were cloned into a plasmid pAT79 under the control of the heterologous promoter P2 (Caillaud et al, 1987, Mol. Gen. Genet. 207: 509-513) and the plasmid pAT86 formed did not confer on the strain E. faecalis JH2-2 resistance to vancomycin. These genes are therefore not sufficient for the synthesis of peptidoglycan in the absence of the antibiotic.
- Different restriction fragments of pIP816 were cloned into the vector pAT78.
- the 5.5 kb BglII-Xbal fragment of pAT80 is the most small fragment obtained which conferred resistance to vancomycin.
- the sequence of the insert in pAT80 was determined on the two strands of DNA from the BglII site to the ATH translation initiation codon of VanH.
- Two open reading phases (orf) were highlighted within the 2475 bp sequence: the first open reading phase extends from nucleotide 366 to nucleotide 1123; at position 431 there is a sequence characteristic of the RBS sequences of gram-positive bacteria, 6 base pairs upstream of the ATG translation initiation codon (TGAAAGGGTG); the other translation initiation codons in this orf are not preceded by this type of sequence.
- the 693 bp sequence from the ATG codon at level 431 to the TAA codon at position 1124 is capable of coding for a protein of 231 amino acids with a molecular mass of 26.612 Da and which is designated by VanR.
- the amino acid sequence deduced from the first phase initiation codon (TTG at position 1104) would code for a protein of 384 amino acids having a molecular mass of 43.847 Da and designated by VanS.
- the codons TTG at position 1116 and ATG at position 1164 are initiation codons for phase translation preceded by sequences with poor complementarity with the 3'OH termination of the 16S subunit of the RNA of B. subtilis (GGGGGGTTGG- N8-TTG and AGAACGAAAA-N6-ATG respectively).
- GGGGGGTTGG- N8-TTG and AGAACGAAAA-N6-ATG respectively.
- VanS has two groups of hydrophobic amino acids in the N-terminal region.
- the Histidine 164 residue from VanS is aligned with the His216 residue from PhoR (Makino et al, 1986, J. Mol. Biol. 192: 549-556) and His 243 from EnvZ (Comeau et al, 1985, 164: 578-584 ) which are suspected sites of autophosphorylation in these proteins.
- VanR aspartic acid 53 could be a phosphorylation site since this residue is aligned with Asp 57 of Che Y which is phosphorylated by HPK associated with CheA and corresponds to an invariant position in other proteins of the RR type (Stock et al cited above). VanR could belong to the OmpR-PhoB subclass of RR which activates the initiation of transcription mediated by RNA polymerase comprising the ⁇ 70S factor of E. coli (Stock et al supra). Inactivation by insertion of van genes
- VanS is a transcription activator necessary for the expression of genes for resistance to vancomycin. Inactivation of vanS leads to a reduction of twice the minimum inhibitory concentration (MIC) of chloramphenicol and to a reduction of three of the specific CAT activity but the minimum inhibitory concentration of vancomycin remains unchanged. Therefore VanS is necessary to obtain a high level of transcription of genes for resistance to vancomycin although it is not required for the expression of the phenotype of resistance to vancomycin.
- MIC minimum inhibitory concentration
- the integrative plasmid pAT89 encoding VanR and VanS was introduced into the chromosome of E. faecalis BM4138.
- the plasmid pAT67 carrying the vanH, vanA and vanX genes cloned upstream of the cat gene lacking the pAT78 promoter, conferred resistance to vancomycin on this strain but not on E. faecalis JH2-2.
- the protein VanA necessary for the expression of a high level of resistance to glycopeptides in E. faecium BM4147 shares approximately 28 to 36% of amino acid similarity with the ligases D-Ala-D- Ala of E. coli but has a specificity of substrates different from that of these ligases.
- Peptides designated by 1 and 2 which are conserved in the sequences of the ligands DdlA and DdlB (Zawadzke, 1991 Biochemistry 30: 1673-1682) of E. coli and in the protein VanA were selected to synthesize the universal primers intended to amplify internal fragments of genes encoding D-Ala-D-Ala ligases or related enzymes.
- the target peptides GEDd (S / T) (I / L) QG and NT (I / L) PGFT were translated in return as shown in Figure IV. 1, to obtain degenerate oligonucleotides V1 and V2. Since VanA, DdlA and DdlB peptides 1 and 2 are separated by amino acid sequences of similar length, the predicted size for the amplification product was approximately 640 bp.
- a probe generated from a recombinant phage obtained with the amplification fragment of BM4147 was used for the Southern analysis of a DNA of BM4147 and BM4147-1 which is a derivative of BM4147 sensitive to vancomycin and which is devoid of the plasmid pIP816 (Leclercq et al, 1988, N. Engl. J. Med. 319: 157-161).
- the probe hybridized with the 4 kb EcoRI DNA fragment of BM4147 but not with the DNA of E. faecium BM4147-1.
- vanA gene is carried by the 4 kb EcoRI fragment of pIP816, these results indicate that the primers also allow the amplification of a part of vanA.
- the oligonucleotides V1 and V2 can amplify fragments of genes coding for different proteins related to D-Ala-D-Ala ligases, and this in different species.
- Amplification, cloning and sequencing of the vanC gene PCR amplification was carried out on the total DNA of E. gallinarum BM4174 and the amplification product obtained, of approximately 640 bp, was cloned into the bacteriophage M13mpl0. Single stranded DNA isolated from the recombinant phage was used to construct a C probe (Hu et al, 1962, Gene 17: 2171-2177). In Southern analysis, the probe hybridized with a 1.7 kb PstI fragment of BM4174 but not with the DNA of BM4147 and BM4147-1.
- BM4174 DNA was digested with PstI and 1.5 and 2 kb fragments were purified by agarose gel electrophoresis and cloned in pUC18 (Norrander et al, 1983, supra).
- the recombinant plasmids were introduced into E.coli JM83 by transformation and screening by hybridization on colonies (Sambrook et al, 1989, Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) using probe C. Homology was detected with a transformant hosting a plasmid , called pAT216, which contained a 1.7 kb PstI insert.
- the sequence of the 1347 bp SacI-PstI part of the pAT216 insert was demonstrated on the two DNA strands.
- the location of the termination codons in the three reading frames of each DNA strand revealed the presence of an ORF phase located between the TGA codons at positions 47 and 1244.
- the ATG transcription initiation codon at position 215 is preceded by a GAAAGGAAGA sequence characteristic of RBS sequences complementary to the RNA of the 16S subunit of B. subtilis (Moran et al, 1982, Mol. Gen. Genet. 186: 339-346).
- the sequence of 1029 bp which extends from the ATG codon at position 215 to the TGA codon at position 1244 could code a protein of 343 amino acids having a calculated molecular mass of 37504Da designated by VanC. Sequence similarity was detected between VanC, VanA and the E. coli D-Ala-D-Ala ligases. In particular, four domains of strong homology previously found between VanA and the D-Ala-D-Ala ligases of enterobacteria are also present in VanC. The percentage of identical amino acids calculated for these proteins taken in pairs was between 29 and 38%. The alignment of the four sequences revealed the presence of 57 invariant amino acids which include the conserved residues of peptides 1 and 2 used to define the oligonucleotide probes V1 and V2. Inactivation by insertion of the vanC gene
- vanC gene was knocked out by insertion.
- a fragment of 690 bp EcoRI-HincII, internal to vanC has been cloned in pAT114 which does not replicate in gramp positive bacteria.
- the resulting plasmid pAT217 was introduced into BM4174 by electrotransformation (Cruz-Rodz et al, 1990, Mol. Gen. Genet. 224: 152-154) and the clones supposed to result from a homologous recombination leading to the integration of pAT217 into vanC were selected on erythromycin.
- the clone BM4175 was compared with BM4174 by Southern hybridization using the probe C and aphA-3 specific for pAT114. The two probes hybridized with the 8.6 kb EcoRI fragment of BM4175. Probe C hybridized with a 2.5 kb fragment of BM4174 while no signal was observed with the aphA-3 probe. The results indicate that the 6.1 kb pAT217 plasmid was integrated into the vanC gene. Determination of the minimum inhibitory concentration of vancomycin for BM4174 (16 mg / 1) and BM4175 (2 mg / 1) indicated that inactivation by insertion into vanC abolishes resistance to vancomycin.
- VanC is therefore required for resistance to vancomycin. It may therefore be thought that this protein synthesizes a dipeptide or a depsipeptide which is incorporated into the precursors of peptidoglycans and is not recognized by vancomycin.
- sequences which are the subject of the invention are given in the following pages after the list of sequences containing the description of these sequences.
- sequence list the proteins are identified with respect to the position of the nucleotide bases corresponding to the amino acids of the ends of the proteins.
- SEQ ID NO 1 sequence of the first resistance protein, corresponding to the amino acid sequence of the open reading phase no. 3, starting at base 3501 and ending at base 4529, containing the coding sequence of the vanH gene between bases 3564 and 4529, with respect to the sequence of FIG. 5 or corresponding to the sequence between the positions of nucleotides 6018 and 6983 of the sequence la.
- SEQ ID NO 2 sequence of the VanA protein, corresponding to the amino acid sequence of the open reading phase no. 1, starting at base 4429 and ending at base 5553, relative to the sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 6977 and 7807 of the sequence la.
- SEQ ID NO 3 sequence of the third resistance protein, corresponding to the amino acid sequence of the open reading phase no. 3, starting at base 5526 and ending at base 6167, relative to sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 7816 and 6621 of the sequence la.
- SEQ ID NO 4 sequence of the regulatory protein R, corresponding to the amino acid sequence of reading phase no. 1, starting at the base 1477 and ending at the base 2214, with respect to the sequence of FIG. 5 or corresponding to the sequence between the positions of nucleotides 3976 and 4668 of the sequence la.
- SEQ ID NO 5 sequence of the sensor protein S, corresponding to the amino acid sequence of the open reading phase no. 2, starting at base 2180 and ending at base 3346, relative to the sequence of Figure 5 or corresponding to the sequence between the positions of nucleotides 4648 and 5800 of the sequence la.
- SEQ ID NO 16 transposase sequence corresponding to the amino acids between nucleotides 150 and 3112 of the sequence Ib.
- SEQ ID NO 17 resolvase sequence comprising the amino acids located between the nucleotide positions 3187 and 3759 of the sequence la.
- SEQ ID NO 18 VanY sequence comprising the amino acids located between the positions of nucleotides 9046 to 9960 in the sequence la.
- SEQ ID NO 19 VanZ sequence comprising the amino acids located between the positions of nucleotides 10116 and 10598 in the sequence la.
- SEQ ID NO 20 VanC amino acid sequence shown in list II. - Nucleotide sequences
- SEQ ID NO 6 nucleotide sequence containing the sequence coding for the 5 proteins, as well as the flanking sequences, represented in FIG. 5.
- SEQ ID NO 7 sequence containing the sequence coding for the 3 resistance proteins, as well as the flanking sequences and starting at base 3501 and ending at base 6167, shown in FIG. 5.
- SEQ ID NO 8 sequence of the van A gene, starting at base 4429 and ending at base 5553, of the sequence presented in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 6977 and 7807 of sequence la .
- SEQ ID NO 9 sequence coding for the first resistance protein called VanH, starting at base 3501 and ending at base 4529, in particular the sequence vanH, the coding sequence of which is located between bases 3564 and 4529, of the sequence presented in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 6018 and 6983 of the sequence la.
- SEQ ID NO 10 sequence coding for the third VanX resistance protein, starting at base 5526 and ending at base 6167, of the sequence presented in FIG. 5, or corresponding to the nucleotide sequence located between nucleotides 7816 and 8621 of the sequence la.
- SEQ ID NO 11 sequence of the transposon coding for transposase, resolvase, VanR, VanS, VanH, VanA, VanX, VanY and VanZ and containing the reverse sequence repeated 38 bp at its N- and C-terminal ends, and corresponding to the sequence la.
- SEQ ID NO 12 sequence coding for transposase, starting at base 150 and ending at base 3112 of sequence Ib.
- SEQ ID NO 13 sequence coding for resolvase, starting at base 3187 and ending at base 3759 of sequence la.
- SEQ ID NO 14 sequence coding for VanY starting at the base 9046 and ending at the base 9960 of the sequence la.
- SEQ ID NO 15 sequence coding for VanZ starting at the base 10116 and ending at the base 10596 of the sequence la.
- SEQ ID NO 21 sequence coding for VanC, represented in list II in correspondence with the protein VanC.
- SEQ ID NO 22 complete sequence of the E. faecium transposon starting at base 1 and ending at base 10851.
- SEQ ID NO 23 sequence coding for the VanR protein, starting at base 3976 and ending at base 4668 of sequence la.
- SEQ ID NO 24 sequence coding for the VanS protein, starting at base 4648 and ending at base 5800 of sequence la. I. Nucleotide sequence of the transposon and translation. the. strand "+" 1
- TCT GAG TTA AAA TGG TAT TCT CCT AGT AAA TTA ATA TGT TCC CAA CCT AAG GGC GAC ATA
- GCT TTA TCT ATC GTA AAT AAT TTT GAG TCC GAT AAA TCC CTT ATT CTT GGG GCA AAT TTA
- TGT TCC TCT ATG TTT AGA TCC GTC TCA TGA TGT AAC AAA CCA TCC AAA ACA TGA ATC GCA
- GAA ATA GTA CAC GGT GTT CGT TGG GAC GCT AAA TAT GCC ACT TGG GAT AAT TTC ACC GGA
- TGT AAT TTA CGG GGC AAA ACG GCA CAA TCT CAA ACG AGA TTG TGC CGT TTA AGG GGA AGA
- GGA AAG TGG ATA GAA GAA AAT GCT TGG AAA TAC GGG TTC ATT TTA CGT TAT CCA GAG GAC
- AAA CTC GCC CGT AGG TGT GAA GTG AGG GGA AAA CCG GTG ATA AAG TAA AAA GCT TAC
- CAC CGT AAC CGC CTG TTG CAG CTG TCT CGC TTA GGC TCA AGA TAC GAG CCG TAT GCA TTC
- CAG GAG CTA ACG GAT AAA GCG TTT GAA ATT CAT GAT AGG CAA ATA CTT AGT TTG TTA TCA
- VAL ILE LYS GLU ASN TYR GLU ASP VAL LEU ARG LEU ALA HIS SER ILE ARG GLU GLY THR GTC ATT AAA GAA AAT TAT GAG GAT GTT TTG CGA TTA GCT CAT TCT ATA AGG GAG GGA ACA
- TCT CCA CCT AAC AAC AGC AGT TGA ATA TAA AAA ACG GAC AGG TAG CTT TAA TGA AGA TTT
- ASN SER GLU LYS VAL VAL SER LEU ASN SER LEU ARG PRO LEU LYS LEU SER AAC TCA GAG AAA GTA GTC TCA TTA AAT TCT TTA AGA CCA CTA AAA CTT TCT TAA CGT TG
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP50003892A JP3404533B2 (ja) | 1990-10-31 | 1991-10-29 | 特にグラム陽性バクテリアのグリコペプタイドに対する抵抗力の発現に係るポリペプタイド、ポリペプタイドをコードするヌクレオチドシーケンスおよび診断への使用 |
| DK91920753T DK0507934T3 (da) | 1990-10-31 | 1991-10-29 | Polypeptider der er involveret i ekspression af resistens over for glycopeptidantibiotika |
| CA002072350A CA2072350C (fr) | 1990-10-31 | 1991-10-29 | Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques |
| DE69133555T DE69133555T2 (de) | 1990-10-31 | 1991-10-29 | Polypeptide die in der exprimierung der glykopeptidantibiotikaresistenz einbegriffen sind |
| EP91920753A EP0507934B1 (fr) | 1990-10-31 | 1991-10-29 | Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques |
| US09/357,375 US6916906B1 (en) | 1990-10-31 | 1999-07-20 | Polypeptides implicated in the expression of resistance to glycopeptides, in particular in gram-positive bacteria, nucleotide sequence coding for these polypeptides and use for diagnosis |
| US10/952,915 US20050112641A1 (en) | 1990-10-31 | 2004-09-30 | Polypeptides implicated in the expression of resistance to glycopeptides, in particular in Gram-positive bacteria, nucleotide sequence coding for these polypeptides and use for diagnosis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR9013579A FR2668489A1 (fr) | 1990-10-31 | 1990-10-31 | Sequences nucleotidiques et polypeptidiques impliquees dans l'expression de la resistance aux glycopeptides. utilisation pour le diagnostic. |
| FR90/13579 | 1990-10-31 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US07917146 A-371-Of-International | 1991-10-29 | ||
| US91714692A Continuation | 1990-10-31 | 1992-08-10 | |
| US17468293A Continuation | 1990-10-31 | 1993-12-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1992007942A1 true WO1992007942A1 (fr) | 1992-05-14 |
Family
ID=9401774
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR1991/000855 Ceased WO1992007942A1 (fr) | 1990-10-31 | 1991-10-29 | Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US6013508A (https=) |
| EP (2) | EP1785487A3 (https=) |
| JP (3) | JP3404533B2 (https=) |
| CA (3) | CA2475116C (https=) |
| DE (1) | DE69133555T2 (https=) |
| DK (1) | DK0507934T3 (https=) |
| ES (1) | ES2280079T3 (https=) |
| FR (1) | FR2668489A1 (https=) |
| WO (1) | WO1992007942A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2699537A1 (fr) * | 1992-12-18 | 1994-06-24 | Pasteur Institut | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquences de nucléotides codant pour cette protéine. |
| FR2699539A1 (fr) * | 1992-12-18 | 1994-06-24 | Pasteur Institut | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquence de nucléotides codant pour cette protéine. |
| US5770690A (en) * | 1995-06-27 | 1998-06-23 | Neurex Corporation | Bax omega protein and methods |
| EP0837133A3 (en) * | 1996-09-24 | 2000-05-31 | Smithkline Beecham Corporation | DNA strand resolution proteins of the resolvase family |
| US6270992B1 (en) * | 1997-07-29 | 2001-08-07 | Smithkline Beecham Corporation | Histidine kinase of Staphylococcus aureus |
| WO2001012803A3 (en) * | 1999-08-17 | 2001-10-18 | Beth Israel Hospital | Methods and compositions for restoring antibiotic susceptibility in glycopeptide-resistant enterococcus |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2616281C (en) | 2005-07-21 | 2014-04-22 | Isis Pharmaceuticals, Inc. | Methods for rapid identification and quantitation of mitochondrial dna variants |
| EP2473630B1 (en) * | 2009-09-04 | 2017-11-08 | QIAGEN GmbH | Optimized probes and primers and methods of using same for the detection, screening, isolation and sequencing of vancomycin resistance genes and vancomycin resistant enterococci |
| FR2994270B1 (fr) * | 2012-08-01 | 2020-01-03 | Biomerieux | Procede de detection d'au moins un mecanisme de resistance aux glycopeptides par spectrometrie de masse |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0229701A2 (en) * | 1986-01-10 | 1987-07-22 | F. Hoffmann-La Roche Ag | Detection of viruses by amplification and hybridization |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2699537B1 (fr) * | 1992-12-18 | 1995-02-17 | Pasteur Institut | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquences de nucléotides codant pour cette protéine. |
-
1990
- 1990-10-31 FR FR9013579A patent/FR2668489A1/fr active Granted
-
1991
- 1991-10-29 CA CA002475116A patent/CA2475116C/fr not_active Expired - Lifetime
- 1991-10-29 WO PCT/FR1991/000855 patent/WO1992007942A1/fr not_active Ceased
- 1991-10-29 ES ES91920753T patent/ES2280079T3/es not_active Expired - Lifetime
- 1991-10-29 CA CA002072350A patent/CA2072350C/fr not_active Expired - Lifetime
- 1991-10-29 EP EP07000325A patent/EP1785487A3/fr not_active Withdrawn
- 1991-10-29 CA CA2637710A patent/CA2637710C/fr not_active Expired - Lifetime
- 1991-10-29 EP EP91920753A patent/EP0507934B1/fr not_active Expired - Lifetime
- 1991-10-29 DE DE69133555T patent/DE69133555T2/de not_active Expired - Lifetime
- 1991-10-29 JP JP50003892A patent/JP3404533B2/ja not_active Expired - Lifetime
- 1991-10-29 DK DK91920753T patent/DK0507934T3/da active
-
1997
- 1997-11-28 US US08/980,357 patent/US6013508A/en not_active Expired - Lifetime
-
2002
- 2002-02-21 JP JP2002045484A patent/JP2002320494A/ja active Pending
-
2003
- 2003-05-06 JP JP2003128349A patent/JP4128905B2/ja not_active Expired - Lifetime
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0229701A2 (en) * | 1986-01-10 | 1987-07-22 | F. Hoffmann-La Roche Ag | Detection of viruses by amplification and hybridization |
Non-Patent Citations (5)
| Title |
|---|
| ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 33, no. 1, January 1989, American Society for Microbiology; LECLERCQ R. et al.: "Transferable vancomycin and teicoplanin resistance in enterococcus faecium", pages 10-15 * |
| ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 34, no. 10, October 1990, American Society for Microbiology; DUTKA-MALEN S. et al.: "Phenotypic and genotypic heterogeneity of glycopeptide resistance determinants in Gram-positive bacteria", pages 1875, 1879 * |
| ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 34, no. 5, May 1990, American Society for Microbiology; BRISSON-NOEL A. et al.: "Cloning and heterospecific expression of the resistance determinant vanA encoding high-level resistance to glycopeptides in enterococcus faecium BM4147", pages 924-927 * |
| BIOCHEMISTRY, vol. 30, no. 8, 26 February 1991, American Chemical Society; BUGG T.D.H. et al.: "Identification of vancomycin resistance protein VanA as a D-alanine-D-alanine ligase of altered substrate specificity", pages 2017-2021 * |
| MOL. GEN. GENET., vol. 224, no. 3, December 1990, Springer Verlag; DUTKA-MALEN S. et al.: "The VANA glycopeptide resistance protein is related to D-alanyl-D-alanine ligase cell wall biosynthesis enzymes", pages 364-372 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2699537A1 (fr) * | 1992-12-18 | 1994-06-24 | Pasteur Institut | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquences de nucléotides codant pour cette protéine. |
| FR2699539A1 (fr) * | 1992-12-18 | 1994-06-24 | Pasteur Institut | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquence de nucléotides codant pour cette protéine. |
| WO1994014961A1 (fr) * | 1992-12-18 | 1994-07-07 | Institut Pasteur | Proteine conferant une resistance de type inductible a des glycopeptides, notamment chez des bacteries a gram-positif |
| EP2208793A1 (fr) * | 1992-12-18 | 2010-07-21 | Institut Pasteur | Protéine conférant une résistance de type inductible, a des glycopeptides, notamment chez des bactéries à grampositif |
| US5770690A (en) * | 1995-06-27 | 1998-06-23 | Neurex Corporation | Bax omega protein and methods |
| US6140484A (en) * | 1995-06-27 | 2000-10-31 | Elan Pharmaceuticals, Inc. | Bax ω protein and methods |
| EP0837133A3 (en) * | 1996-09-24 | 2000-05-31 | Smithkline Beecham Corporation | DNA strand resolution proteins of the resolvase family |
| US6270992B1 (en) * | 1997-07-29 | 2001-08-07 | Smithkline Beecham Corporation | Histidine kinase of Staphylococcus aureus |
| WO2001012803A3 (en) * | 1999-08-17 | 2001-10-18 | Beth Israel Hospital | Methods and compositions for restoring antibiotic susceptibility in glycopeptide-resistant enterococcus |
Also Published As
| Publication number | Publication date |
|---|---|
| DK0507934T3 (da) | 2007-05-14 |
| US6013508A (en) | 2000-01-11 |
| FR2668489A1 (fr) | 1992-04-30 |
| CA2072350C (fr) | 2004-11-30 |
| EP1785487A2 (fr) | 2007-05-16 |
| DE69133555D1 (de) | 2007-02-22 |
| EP0507934B1 (fr) | 2007-01-10 |
| JPH05503222A (ja) | 1993-06-03 |
| CA2475116C (fr) | 2008-12-02 |
| ES2280079T3 (es) | 2007-09-01 |
| CA2637710A1 (fr) | 1992-05-14 |
| CA2072350A1 (fr) | 1992-05-01 |
| EP0507934A1 (fr) | 1992-10-14 |
| JP2004024251A (ja) | 2004-01-29 |
| JP2002320494A (ja) | 2002-11-05 |
| JP4128905B2 (ja) | 2008-07-30 |
| CA2637710C (fr) | 2010-12-14 |
| JP3404533B2 (ja) | 2003-05-12 |
| DE69133555T2 (de) | 2007-10-25 |
| EP1785487A3 (fr) | 2012-01-11 |
| CA2475116A1 (fr) | 1992-05-14 |
| FR2668489B1 (https=) | 1995-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ullrich et al. | The biosynthetic gene cluster for coronamic acid, an ethylcyclopropyl amino acid, contains genes homologous to amino acid-activating enzymes and thioesterases | |
| JP3581352B2 (ja) | ウレアーゼの調節及び成熟のために必要なHelicobacterpyloriの遺伝子及びその用途 | |
| Arias et al. | vanC cluster of vancomycin-resistant Enterococcus gallinarum BM4174 | |
| EP0367644B1 (fr) | Séquence de nucléotides codant pour une proteine à activité uréasique | |
| Arias et al. | Characterization and modelling of VanT: a novel, membrane‐bound, serine racemase from vancomycin‐resistant Enterococcus gallinarum BM4174 | |
| EP0672147B1 (fr) | Proteine conferant une resistance de type inductible a des glycopeptides, notamment chez des bacteries a gram-positif | |
| Abadía Patiño et al. | vanE gene cluster of vancomycin-resistant Enterococcus faecalis BM4405 | |
| Garnier et al. | Characterization of a bacteriocinogenic plasmid from Clostridium perfringens and molecular genetic analysis of the bacteriocin-encoding gene | |
| Karunakaran et al. | Isolation and characterization of a hemin-regulated gene, hemR, from Porphyromonas gingivalis | |
| EP0507934B1 (fr) | Polypeptides impliques dans l'expression de la resistance aux antibiotiques glycopeptidiques | |
| Brehm et al. | A gene encoding a superoxide dismutase of the facultative intracellular bacterium Listeria monocytogenes | |
| Kataoka et al. | Characterization of a methyl-accepting chemotaxis protein gene, dmcA, from the oral spirochete Treponema denticola | |
| WO1995025738A1 (en) | Recombinase-deficient helicobacter pylori and related methods | |
| EP0770138B1 (fr) | Vecteurs de criblage et/ou d'expression fonctionnels chez les mycobacteries | |
| US5871910A (en) | Probes for the detection of nucleotide sequences implicated in the expression of resistance to glycopeptides, in particular in gram-positive bacteria | |
| FR2699539A1 (fr) | Protéine conférant une résistance de type inductible, à des glycopeptides, notamment chez des bactéries à gram-positif. Séquence de nucléotides codant pour cette protéine. | |
| US6916906B1 (en) | Polypeptides implicated in the expression of resistance to glycopeptides, in particular in gram-positive bacteria, nucleotide sequence coding for these polypeptides and use for diagnosis | |
| Haas et al. | Cloning of a superoxide dismutase gene from Listeria ivanovii by functional complementation in Escherichia coli and characterization of the gene product | |
| EP0772686A1 (fr) | Nouvelle topoisomerase iv, sequences nucleotidiques correspondantes et leurs utilisations | |
| FR2584419A1 (fr) | Sonde et procede pour la detection de facteurs de resistance a l'erythromycine dans des cultures cellulaires, notamment bacteriennes | |
| WO2000001825A1 (en) | HELICOBACTER ANTIGEN (η-GLUTAMYLTRANSPEPTIDASE) AND SEQUENCES ENCODING THE SAME | |
| HK1110887A (en) | Polypeptides involved in the expression of resistance to glycopeptide antibiotics | |
| FR2607827A2 (fr) | Fragment d'adn comprenant au moins une partie d'un gene de resistance aux lincosamides et applications biochimiques et biologiques | |
| EP0219407A1 (fr) | Fragment d'ADN, comportant au moins une partie d'un gène de résistance aux lincosamides, procédé de préparation et application biochimiques |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1991920753 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2072350 Country of ref document: CA |
|
| WWP | Wipo information: published in national office |
Ref document number: 1991920753 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| ENP | Entry into the national phase |
Ref document number: 1997 980357 Country of ref document: US Date of ref document: 19971128 Kind code of ref document: A |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1991920753 Country of ref document: EP |