WO2000001825A1 - HELICOBACTER ANTIGEN (η-GLUTAMYLTRANSPEPTIDASE) AND SEQUENCES ENCODING THE SAME - Google Patents

Abstract

This invention provides a purified polynucleotide coding for a transpeptidase such as a gamma (η)-glutamyltranspeptidase, detected naturally in Helicobacter and particularly in H. pylori. The invention also provides biological applications of the polynucleotide or its fragment and the corresponding encoded protein or fragment thereof, for the detection of H. pylori in humans or in food or in the environment and immunogenic compositions for inducing protective antibodies against Helicobacter infection in humans or animals. The invention further relates to methods for screening for molecules capable of inhibiting the activity of H. pylori GGT, the molecules obtained by these methods and to pharmaceutical compositions comprising these molecules.

Description

HELICOBACTER ANTIGEN (γ-GLUTAMYLTRANSPEPTIDASE) AND SEQUENCES ENCODING THE SAME

BACKGROUND OF THE INVENTION

The present invention concerns a polynucleotide coding for a transpeptidase, such as a gamma (γ) glutamyltranspeptidase, and the biological applications of the polynucleotide or its fragment , and the corresponding encoded protein or fragment thereof, notably for the detection and treatment of H. pylori m humans or in foods or m the environment. The invention also relates to immunogenic compositions for inducing protective antibodies against Helicojbacter infection m humans or in animals, such as cats or pigs. The invention also relates to pharmaceutical compositions for the treatment of H. pylori infections .

H. pylori is a Gram-negative bacterium heretofore found exclusively at the mucosal surface of the antral region of the human stomach. This bacterium was initially called Campy lobacter pylori (Warren et al . (1983) Lancet 1: 1273-1275).

H. pylori is a microorganism that infects human gastric mucosa and is associated with active chronic gastritis. It has been shown to be an aetiological agent in gastroduodenal ulceration (Peterson, 1991) , and two recent studies have reported that persons infected with H. pylori had a higher risk of developing gastric cancer (Nomura et al . , 1991; Parsonnet et al . , 1991) . 25% of the population are H. pylori carriers: 8% present an ulcerous illness, 9% suffer from non-ulcerous dyspepsia, and 8% are asymptomatic carriers.

In vivo studies of the bacterium, and consequently, work on the development of appropriate preventive or therapeutic agents, have been severely hindered by the fact that Helicobacter pylori associates with gastric-type epithelium from very few animal hosts .

The H. pylori isolated and described heretofore produce an extremely active urease and adhere very strongly to the epithelial cells of the gastric mucosa, this property being manifested in vi tro by an extremely strong adhesion to HeLa cells. However, the detection of H. pylori in si tu in humans and in the environment, and the study of its pathogenic power - it is considered responsible for active gastritis in humans - is complicated by difficulties in culturing this organism. Its growth is very slow (6 to 7 days on blood-gelosed medium) and must take place in microaeroph.ilic conditions, the oxygen in the air being toxic to the bacterium.

To identify bacterial properties that allow H. pylori to colonize such an unusual niche, efforts have been focused on the genetic and molecular characterization of traits that are known to be expressed by all H. pylori clinical isolates, and yet which are known to be expressed by a restricted number of bacteria belonging to other genera. Among these traits is the synthesis of a catalytically active γ-Glutamyltranspeptidase (GGT) .

In mammalian tissues, GGTs play a major role in glutathione metabolism (Tate and Meister, 1981) (Meister and Anderson, 1983) .

These enzymes catalyze transpeptidation reactions in which a γ-Glutamyl moiety is transferred from γ-Glutamyl compounds, such as glutathione, a nonprotein sulfhydryl molecule, to amino acids.

In addition, GGTs can utilize γ-Glutamyl peptides as substrates in the reciprocal hydrolysis reaction, thus playing a role in the synthesis of glutathione (Tate and Meister, 1981) .

While GGTs from mammalian tissues have been extensively studied (Meister and Tate, 1985) (Goodspeed et al . , 1989) (Coloma and Pitot, 1986) (Laperche et al . , 1986), surprisingly few bacterial GGTs have been characterized at the biochemical and the molecular level (Ishiye et al . , 1993) (Xu and Strauch, 1996) (Suzuki et al . , 1989), and very little is known regarding the physiological role of these enzymes m bacteria.

It is commonly thought that bacterial GGTs might play a role m the transport of ammo acids across cell membranes (Meister, 1973) (Orlowski and Mester, 1970) (Robins and Davies, 1981) ; however, it remains unclear whether the ammo acids are directly transported by transpeptidation, via the γ-glutamyl cycle, or through the hydrolysis of γ-Glutamyl peptides used as substrates together with ammopeptidases (Suzuki et al . , 1993) .

The GGT of H. pylori exhibits several features:

1) unlike the signal peptide of the VacA protein, the GGT signal peptide demonstrates all the classical features of gram-negative signal peptides, i.e., a charged hydrophilic N-terminal sequence (MetArgArg) and a long stretch of hydrophobic ammo acids (20 AA) preceding the Ala cleavage site;

2) the second cleavage site that gives rise to the mature large and small subunits m E. coli (Suzuki et al . , J. Bacteriol . 171 (9) :5169-5172 (1989)) and P . aerugmosa GGTs is conserved in the H. pylori GGT, suggesting that the protein might also be processed H. pylori cells; and

3) the C-terminal domains of the putative large (AA 311 to 401) and small (AA 501 to 615) subunits are species specific. They, therefore, represent specific antigenic targets for the H. pylori isolates. γ-Glutamyltranspeptidase catalyzes a) the transfer of the γ-glutamyl moiety from γ-glutamyl compounds, such as glutathione, to amino acids and peptides, and b) the hydrolysis of γ-glutamyl compounds .

In Escherichia coli , the enzyme is known to be a «cold shock protein» best expressed at 20°C and poorly expressed at 37°C. The enzyme is located in the periplasmic space. The E. coli GGT is expressed as a pro-GGT, processed later into a large and a small subunit. The physiological significance of GGT in E. coli is not yet known; however, it was recently shown that GGT was essential for the utilization of γ-glutamyl peptides as an amino acid source. (Suzuki et al . , J. Bacteriol . 175 (18) : 6038-6040 (1993).

However, unlike E. coli GT, the H. pylori GGT is well expressed at 37°C. Furthermore, the γ-glutamyltranspeptidase activity of H. pylori accounts for one of the key biochemical assays leading to the identification of Helicobacter pylori isolates because it is expressed by all H. pylori isolates. Thus, the determination of the nucleotide sequence of H. pylori GGT will render possible the use of a detection probe as a tool for the specific identification of H. pylori .

SUMMARY OF THE INVENTION

The invention provides polynucleotides that are capable of coding for peptides and proteins carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity such as is expressed in H. pylori and for fragments of this sequence that may be used as detection probes in H. pylori .

The invention relates to recombinant expression and cloning vectors, capable of transforming an appropriate host cell, the vectors containing at least a part of a polynucleotide of this invention under the control of elements of regulation permitting its expression. In addition, the invention provides peptides and proteins carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity such as is expressed in H. pylori , at a high degree of purity, and fragments of the peptides and protein. The invention further relates to monoclonal and polyclonal antibodies capable of specifically recognizing the peptides and proteins of the invention. The invention also provides pharmaceutical and immunogenic compositions comprising the peptides, proteins, or antibodies of this invention.

The invention also includes mutated strains of H. pylori containing an insert of a sequence encoding a heterologous epitope of the ggt gene.

The invention further relates to methods for screening for molecules capable of inhibiting the activity of H. pylori GGT, the molecules obtained by these methods, pharmaceutical compositions comprising these molecules, and methods of treating H. pylori infection by administering these pharmaceutical compositions .

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a restriction map of plasmid pILL308.

Figure 2 contains primer sequences I, II, III, and IV of the present invention.

Figure 3 contains the restriction maps of regions of the plasmids pILL310 and pILL308 hybridizing to probes 1 and 2.

Figure 4 is a restriction map of regions of plasmids pILL310, pILL308, and pILL309 hybridizing with probe 1 or probe 2.

Figure 5 is a restriction map of plasmids pILL309 and pILL311 illustrating the 714 bp-mternal deletion in the ggt open reading frame of plasmid pILL311.

Figure 6 demonstrates the ammo acid sequence alignment of the predicted H. pylori GGT protein with bacterial and mammalian homologs. Multiple sequence alignment has been performed using the Pilup program of G.C.G. (Genetics Computer Group, Inc.). Designations on the left side refer to the origin of the sequences: H.p-85P, this study; H.p26695, HP-1118 of GeneBank AE000511 (Tomb et al . , 1997); E. coli , P18956 (Suzuki et al . , 1989); P. aeruginosa, P36267 (Ishiye et al . , 1993); B . subtilis, P54422 (Xu and Strauch, 1996); human, P19440 (Goodspeed et al . , 1989); pig, P20735 (Papandrikopoulou et al . , 1989); rat, P07314 (Laperche et al . , 1986). Numbers on the left and right sides indicate amino acid positions. (*) represents amino acids that are identical to the one present at the same position in the GGT of H. pylori . Vertical arrows show the putative proteolytic cleavage sites. Black bars correspond to amino acid sequences of the two peptides Pepl and PepII, which were determined by microsequencing. Arrow heads indicate the residues assigned to the catalytic site of the enzyme in the human enzyme (Ikeda et al . , 1995; Ikeda et al . , 1993; Ikeda et al . , 1996) .

Figure 7 depicts a linear restriction map of the inserts of plasmids pILL308, pILL309, pILL311, and pILL312 described in Table 2. The sizes in parentheses indicate the sizes of the insert fragments cloned in the various vectors indicated in Table 2. Restriction sites labeled with an asterisk designate sites that do not belong to the H pylori DNA sequence, but that were introduced during the cloning procedure. The position of the unprocessed pro-GGT, as well as that of the processed GGT, are indicated by white rectangles. The black box represents the signal peptide sequence. The shaded box represents the kanamycin cassette originating from pILL600 (Table 2) .

Figure 8 depicts a Western blot analysis of a) recombinant

H. pylori 6XHis-tagged GGT (lane 1) ; b) whole cell extracts of the parental H. pylori strain SSI and of its isogenic ggt^' mutant

(lanes 2 and 3, respectively); c) whole cell extracts of E. coli , expressing or not expressing H. pylori GGT (lane 4 and lane 5, respectively) ; d) a whole cell extract of E. coli expressing E. coli GGT (lane 6) . Blotted proteins were reacted with a polyclonal rabbit antiserum raised against the recombinant H. pylori 6XHis-tagged GGT shown in lane 1. Note that whole cell extracts in lanes 4 and 5 were prepared from cells grown at 37°C, leading to the absence of synthesis of the two subunits of the E. coli GGT, whereas the extract in lane 6 was prepared from E. coli cells grown at 20°C. One dot designates either the large or the small GGT subunits, while two dots designate the position of the H. pylori pro-GGT. The molecular masses (in kDa) of the protein standards are indicated on the right . The photocomposition of the figure was obtained from the original autoradiograph with a Studioscsan Ilsi scanner (AGFA) . After scanning of the original image, image analysis was performed using Adobe Photoshop, version 3.0 (Adobe System Inc.)

DETAILED DESCRIPTION OF THE INVENTION

The purified polynucleotide according to the invention is characterized in that it comprises at least a part of a coding sequence for a protein carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity such as is expressed in H. pylori .

The invention particularly concerns a polynucleotide that is capable of hybridizing with genes coding for a protein carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity such as is expressed in H. pylori , under the following stringent conditions; 68°C, 6 x SSC (1 x SSC contains 0.15M of NaCl and 0.015M of sodium citrate, pH7) , in Denhardt medium (1% Ficoll, 1% polyvinylpyrrolidone, 1% bovine serum albumin) or with any nucleotide sequence having at least 51% identity with that polynucleotide, preferably at least 75% identity and more preferably, at least 90% identity with that polynucleotide .

According to another aspect of the invention, the polynucleotide is characterized m that it carries the information required for the production of a protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity, or the transfer activity of one of its fragments, which protein or fragment is capable of forming an lmmunologic complex with antibodies directed against, respectively, a protein carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity such as is expressed m H. pylori , or a fragment of the protein.

According to the invention, the sequence is also characterized m that it comprises at least a part of a fragment of about 2 kb corresponding to the restriction fragment containing at least four restriction sites among the following: Sau3A , Hindl l l , Pstl , Sau3A, Ps l , Hmdl l l , Sphl , Sau3A .

The enzymatic restriction map of this fragment is represented m Figure 1.

A more specifically preferred sequence comprises at least a part of a fragment of about 1.8 kb (+ 5%) limited by the end nucleotides respectively situated at a distance of approximately 0.3 kb upstream of the restriction site Pstl, as represented in Figure 1, and of approximately 0.1 kb downstream of site Sphl , as represented m Figure 1. This sequence is contained m the recombinant plasmid pILL308.

Any fragment of the nucleotide sequence inserted m pILL308 or any genetic construct containing such a fragment or the 1.8 kb to 2 kb fragment is considered a "derivative" of pILL308 m the present invention.

The sequences constituted by this fragment of 1.8 kb to 2 kb carry the coding and regulatory regions necessary for the expression of a protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity as expressed naturally in H. pylori . A variant of the preferred sequence is contained in the plasmid pILL309.

According to yet another aspect, the invention concerns a recombinant sequence comprising one of the above-defined sequences, possibly in association with a promoter capable of controlling the transcription of a sequence and a DNA coding sequence for the termination signals of the transcription.

The invention also concerns probes for detecting the possible presence of H. pylori in a biological sample, characterized in that they comprise at least a part of an above- defined sequence of nucleotides .

The invention also covers any probe which, with regard to its sequence of nucleotides, is distinguished from the previously-mentioned probes only by substitutions and alterations not causing any modification to its hybridization properties with the genome of H. pylori .

The above-mentioned probes may be used in in vi tro processes for diagnosing the presence of H. pylori in a biological sample such as described above .

The DNA fragment used as a probe contains a sufficient number of nucleotides to obtain the required specificity and the formation of a stable hybrid. It is possible to use fragments attaining several kb, but high specificity results are also obtained with shorter fragments of approximately 25 to 40 nucleotides .

Appropriate probes for this type of detection are advantageously marked by a radioactive element or by any other marker allowing its recognition in the hybridized state with the preparation enclosing the DNA to be studied. According to the standard techniques, these probes are brought into contact with a biological specimen containing the bacteria, or directly with these bacteria or other nucleic acids, in conditions permitting the hybridization of a polynucleotide of the probe with a complementary sequence contained in the tested product .

The hybridization method may, for example, be implemented on spots. This method involves, after denaturation of the DNA previously obtained from bacteria originating from antral biopsies, deposit of an aliquot quantity of this DNA on nitrocellulose membranes, hybridization of each membrane in usual conditions with the probe, and detection, in standard fashion, of the hybrid formed.

Hybridization method may also be conducted according to the Southern technique. This method involves the electrophoretic separation in agarose gel of the fragments of DNA engendered after treatment of the DNA by restriction enzymes, transfer after alkaline denaturation on appropriate membranes, and hybridization with the probe in usual conditions. It is not always necessary to proceed to the preliminary expression of the DNA; it is enough that the DNA should be rendered accessible to the probe.

Detection for the specific identification of the H. pylori may also be carried out by DNA amplification techniques (PCR) . These techniques are notably described in U.S. Patent Nos. 4,683,202 and 4,683,195.

Thus, the invention also concerns nucleotide primers of approximately 10 to approximately 40 nucleotides, these primers being included in one of the above-defined nucleotide sequences or being likely to hybridize with a part of the above- mentioned nucleotide sequences or with their complementary sequences (particularly in the above-mentioned conditions of hybridization) . The invention also concerns the use of these primers an in vi tro assay for the diagnosis of H. Pylori infection, for the preliminary amplification of the quantity of nucleotides of H. pylori likely to be contained in the biological specimen according to the above-described process.

The above-defined protein production process may, if required, comprise a preliminary amplification step of the coding gene for the protein whose production is sought, this step being carried out with primer couples of the invention m accordance with the above-described process.

To implement these techniques, four primers of 20 to 30 nucleotides are used, preferably approximately 25 nucleotides. These primers are included one of the above-defined sequences of nucleotides are likely to hybridize with a part of one of the above-defined nucleotide sequences, or of their complementary sequences. One of the sequences is capable of being linked to a nucleotide sequence of one of the DNA fragment strains to be amplified, this sequence being situated at an end of this fragment, for example the 5' end. The other sequence is capable of being linked to a nucleotide sequence of the second DNA fragment strain to be amplified; this latter sequence being situated at the end opposite the above-mentioned end of this fragment (the 3 ' end the given example) .

Preferred primers are included the nucleotide sequence of restriction fragment Hind III-Sau 3A m Figure 2.

In particular, the fragments concerned are those situated respectively at each end of the restriction sequence Hmd IV- Pstl .

A process for the m vi tro detection of the presence of H. pylori in a biological sample includes the following steps:

1) optionally, the prior amplification of the amount of nucleotide sequences likely to be contained in the sample by bringing this sample into contact with the previously described primers, these primers being likely to be linked respectively to the 5 ' end of one strain of the said sequence of nucleotides and to the 3 ' end of the other strain of the said sequence of nucleotides, this contact being followed by a genie amplification step in the presence of a DNA-dependent polymerase and of the four triphosphate nucleosides dATP, dCTP, dGTP and dTTP, with these primers and genie amplification- hybridization steps being repeated several times;

2) the biological sample in question is brought into contact with a nucleotide probe according to the invention, in conditions permitting the production of an hybridization complex formed between the probe and the sequence of nucleotides; and

3) the detection of the hybridization complex.

The invention thus provides the tools necessary for rapid detection of H. pylori , both in si tu and in the environment, with a high degree of specificity and without having recourse to culturing.

Such detection tools are particularly useful in studying the natural reservoir of these bacteria, as well as the methods of transmission, circulation, and contamination. Furthermore, in the in vi tro diagnosis performed on the biopsies, the use of these probes makes it possible to gain a considerable amount of time compared to current techniques, which said techniques, moreover, require a technology that can only be applied in specialized services, i.e. bacteriological techniques or the use of electronic microscopy.

Reproducible results have been obtained using the above- defined fragment of approximately 0.6kb as an intragenic probe as shown in Figure 2. Given their specificity with regard to H. pylori , these probes are also tools of considerable interest. The nucleotide sequences of the invention are characterized in that they are capable of hybridizing with a probe formed from the sequence presenting:

1) primer sequence I of Figure 2 (oligo I) ;

2) primer sequence II of Figure 2 (oligo I reverse);

3) primer sequence III of Figure 2 (oligo II);

4) primer sequence IV of Figure 2 (oligo II reverse) ; or

5) nucleotides that are complementary to any one of the above-mentioned nucleotides.

After amplification with the primers "oligo I" and "oligo II reverse", a 600 bp probe was obtained as probe 1. This nucleotide sequence hybridizes with pILL310 and pILL308, as shown on Figure 3.

Probe 2 is obtained by amplification with the use of the oligo II and oligo I reverse primers. Polynucleotides according to the invention comprise the above-defined "nucleotide chains" or at least part of the chains or the amplified sequences obtained by the use of the said nucleotide chains or primers.

It is of course understood that the bases of the nucleotide sequences may be in a different order from that found in the genes, and/or that the bases may possibly be substituted when a probe elaborated from such sequences gives a characteristic and unequivocal answer with respect to the ability to recognize the presence of coding genes for the protein carrying transfer catalytic activity, for example, γ-glutamyl residues transfer activity of H. pylori .

According to the invention, the purified polynucleotide is characterized in that it is modified by deletion, addition, substitution, or inversion of one or more nucleotides so that the functional properties of the protein encoded by these modified sequences is either conserved or attenuated, or even deleted, as compared with the properties of the protein γ-glutamyltranspeptidase detected naturally in H. pylori .

The invention also covers any sequence of nucleotides, hybridizable with that of the above-mentioned chains of nucleotides, such as that obtained by reverse enzymatic transcription of the corresponding RNA or by chemical synthesis.

The invention also concerns a polynucleotide that corresponds, according to the universal genetic code, to at least a part of the following amino acid sequence, which is included in the present invention:

MRRSFLKTIG LGVIALSLGL LSPLSA

The invention also concerns recombinant expression and cloning vectors, capable of transforming an appropriate host cell, the vectors containing at least a part of a polynucleotide defined above under the control of elements of regulation permitting its expression.

Preferred recombinant vectors include at least a part of the above-mentioned nucleotide sequence of approximately 2 kb .

The invention also includes the strains of the transformed microorganisms. These strains contain one of the above-defined polynucleotides or a recombinant vector such as previously defined.

Strain E. coli MC1061 (pILL308) deposited on October 16, 1996, under number 1-1775 at the Collection Nationale de Culture de Microorganismes (C.N.C.N.) at the Institut Pasteur in PARIS (FRANCE) , carries plasmid pILL308 of approximately 2 kb comprising the previously mentioned restriction fragment.

The invention also encompasses an amino acid sequence of a protein presenting a γ-glutamyl residues transfer activity of the type expressed naturally in H. pylori , as well as the peptide fragments of this protein encoded by the polynucleotide or any nucleotide sequence having at least 51% of homology with this sequence. The encoded protein comprises the sequence of Figure 6 and a molecular weight of 53 kDa ± 10%. The molecular weight of the antigen of the invention has been measured on an electrophoresis gel (SDS PAGE) with a standard molecular weight kit commercialized by BIORAD.

The invention also includes mutated strains of H. pylori containing an insert of a sequence encoding a heterologous epitope m the ggt gene. Such a mutant may be created by the methods described in WO96/14408 and WO90/11354. Such H. pylori attenuated strains can be used, for example, to induce an immune response against the heterologous epitope. The immune response can be a cellular response. Mosman et al . , J. Immunol. 136:2348- 2357 (1986); Klenerman et al . , Nature 369:403-407 (1994).

In another embodiment, the protein and its fragments correspond, according to the universal genetic code, to the above-defined sequences of nucleotides, particular to at least a part of the sequence of approximately 2 kb and preferably a 1646 bp corresponding to gamma glutamyl transferase of H. pylori (GGT) .

The protein of the invention is also characterized m that it can be obtained through: 1) transforming host cells, bacteria, or eukaryotic cells, including yeast, such as Saccharomyces cerevisae or Pi chia pas tori s by means of a recombinant vector as previously defined; 2) cultunng, in an appropriate medium, the transformed host cells; and 3) recovering the protein from these cells or directly from the culture. The invention also concerns the production of GGT or of fragments of GGT by this process .

The protein and its fragments, which may also be obtained by chemical synthesis, advantageously have a high degree of purity and may be used to form monoclonal and polyclonal antibodies according to standard techniques.

This synthesis can be realized, for example, in homogenous solutions as described by Houbenweyl in "Method der organischen Chemie" (Organic Chemistry Method) edited by E. Wunch, vol. 15-1 and II, Thieme (Stuttgart 1974) or in solid phase as described by R.D. Merrifield in an article entitled "Solid Phase Peptide Synthesis," J. Am. Soc, 45, 2149-2154.

The invention thus also encompasses immunological applications of the protein or protein fragments of this invention, particularly for the elaboration of specific antiserum and of polyclonal and monoclonal antibodies. The polyclonal antibodies are formed, according to standard techniques, by injecting the protein into animals obtaining the antiserums from the animals, and then obtaining the antibodies from the serums, e . g. by affinity chromatography.

The monoclonal antibodies are produced in the usual manner by fusing myeloma cells with the cells of animals previously immunized by means of the proteins of this invention. Preferably, splenic cells from female rats are used.

The monoclonal and polyclonal antibodies of this invention are capable of recognizing specifically the above-mentioned protein and its fragments. Preferably, the monoclonal or polyclonal antibodies of this invention are directed against all or part of the above-described protein and form an immunologic complex the protein or fragment .

In particular, the invention concerns the antibodies, especially monoclonal antibodies, obtained by means of a peptide sequence of at least approximately 10 to 15 amino acids of the sequence that comprises amino acids 550 to 615 and/or amino acids 311 to 401 of Figure 6. Preferred monoclonal antibodies of the invention are directed against all or part of the sequence limited by the amino acids situated at positions 501 to 615 and/or 311 to 401 of the sequence of Figure 6.

The invention also relates to the use of the above-mentioned antibodies to implement the in vi tro methods and the in vi tro kits as described above for diagnosing the infection of an individual by H. pylori .

The invention also concerns immunogenic compositions comprising all or part of the above-described protein encoded by the polynucleotide corresponding to the nucleotide sequence inserted in plasmid pILL308, and in particular all or part of a polypeptide sequence limited by the amino acids situated at positions 501 to 615 and/or 311 to 401 of the sequence depicted in Figure 6 in association with a pharmaceutically acceptable vehicle .

A preferred immunogenic composition of this invention comprises all or part of the GGT in association with a mixture of antigens of H. pylori as urease A or B (URE A or URE B) and/or HspA. One of the advantages of this immunogenic composition is that it is directed to complementary targets because GGT, is located differently from URE B and HspA (WO 95/714093) .

Such immunogenic compositions may be used as vaccine compositions in preventing the infection of an individual by H. pylori , and can be administered by any route, such as oral, intravenous, intramuscular, in combination with an adjuvant or not, and in a liposomal vesicle or not.

For veterinary purposes, the invention is adapted to the animal to be treated. For example, in the case of a vaccine useful for cats, the urease will be prepared according to the teachings of PCT/WO95/14093. The composition can contain the antigen of the invention associated with a urease and/or HspA specific to the Helicobacter strains specific to the animal to be infected or treated.

The invention also concerns pharmaceutical compositions comprising one (or several) antibodies such as described above, and m particular, antibodies likely to form an immunologic complex with all or part of the peptide sequence limited by the ammo acids situated at positions 501 to 615 and/or 311 to 401 of the sequence of Figure 6 m association with a pharmaceutically acceptable vehicle.

Such pharmaceutical compositions, according to the invention, may be used m the treatment of pathologies linked to the infection of an individual by H. pylori , notably gastritis, and gastric and duodenal ulcers.

The invention further encompasses a sequence of nucleotides located upstream of the coding region and corresponding to a peptide signal sequence.

It is characterized by the following chain of ammo acids:

MRRSFLKTIG LGVIALSLGL LSPLSA

The invention covers the use of such a signal peptide and its corresponding nucleotide sequence for the preparation of hybrid molecules corresponding to a foreign nucleotide sequence coding for a foreign protein or peptide and the peptide signal or its corresponding nucleotide sequence of the invention obtainable from H. pylori genome.

The above-defined sequences of nucleotides are obtained, according to the standard techniques of genetic engineering, by cloning and identification of the genes responsible for the synthesis of a protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity m H. pylori . As noted above, the invention encompasses methods for the m vi tro detection of the presence of H. pylori m a biological sample in which it is likely to be contained. This procedure is characterized m that it comprises:

1) bringing the sample into contact with an antibody according to the invention m conditions allowing for the production of an immunologic complex formed between all or part of the protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity produced by H. pylori , and the antibody; and

2) the detection of the immunologic complex.

For the implementation of the m vi tro detection methods considered above and based on the use of nucleotide probes recourse is advantageously made to equipment or kits comprising:

1) possibly, at least two primers according to the invention;

2) a determined quantity of a nucleotide probe according to the invention;

3) advantageously, a medium that is appropriate to the formation of a hybridization reaction between the sequence to be detected and the probe; and

4) advantageously, reagents allowing the detection of hybridization complexes formed between the nucleotide sequence and the probe during the hybridization reaction.

For the implementation of the m vi tro detection methods defined above and based on the use of antibodies, recourse is advantageously made to equipment or kits comprising:

1) a determined quantity of an antibody according to the invention;

2) advantageously, an appropriate medium for the formation of an immunologic reaction between at least a part of the protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity produced by a strain of H. pylori , and the antibody; and

3) advantageously, reagents permitting the detection of the immunologic complexes formed between at least a part of the protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity, and the antibody during the immunologic reaction.

As one aspect of this invention, it has been demonstrated that the activity of the γ-glutamyltranspeptidase is essential for the survival of H. pylori in vivo. Thus, GGT is an important target for therapeutic compositions designed to treat or prevent H. pylori infection.

Accordingly, this invention provides a method for screening molecules capable of specifically inhibiting the activity of Heli cobacter GGT, and particularly, Helicobacter pylori GGT, without inhibiting or interacting with the activity of host (such as human) GGT. The invention also encompasses molecules capable of inhibiting the enzymatic activity of the Helicobacter γ-glutamyltranspeptidase and pharmaceutical compositions comprising these molecules, without inhibiting the enzymatic activity of human GGT.

The screening methods for identifying drugs which are antagonists of the normal cellular function employ the purified and recombinant Helicobacter GGT of this invention. The inhibitors identified may be useful as new therapeutic agents to combat H. pylori infections in humans, or Helicobacter infections in animals. A variety of assay formats will suffice and, in light of the present invention, will be readily understood by the skilled artisan.

In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell- free systems, such as may be derived with purified or semi- purified proteins, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound.

Screening assays can be constructed in vi tro with a purified H. pylori GGT polypeptide or fragment thereof having enzymatic activity, such that the activity of the polypeptide or fragment produces a detectable reaction product. The efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. The Helicobacter GGT used in the screening methods of this invention may be selected from the group consisting of Helicobacter pylori GGT, Helicobacter felis GGT, Helicojbacter helmannii GGT, Helicobacter mustalae GGT, Helicobacter caniε GGT, Helicobacter bilis GGT, and Helicobacter hepaticus GGT.

As used herein, the term "primer" means the sequences I, II, III or IV described herein, and the term "probe" means probe 1 or 2 described herein or any sequence capable of hybridizing under stringent conditions with the polynucleotide according to the invention.

As used herein, the term "protein" is to be understood in the context of the invention as a chain of amino acids, whatever its length, and includes the term "peptide."

As used herein, the term "fragment" means any amino acid sequence shorter by at least one amino acid than the parent sequence and comprising a length of amino acids, preferably at least 6 residues, that are consecutive in the parent sequence. Other advantages and characteristics are detailed in the following description relating to the cloning of genes responsible for the production of the protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity m H. pylori , the sequencing of the region associated with the expression of the protein carrying transfer catalytic activity, for example γ-glutamyl residues transfer activity and the specificity of nucleotide probes for detecting H. pylori .

The accompanying drawings, which are incorporated and constitute a part of this specification, illustrate the invention and, together with the description serve to explain the principles of the invention.

Reference will now be made to the following Examples. The Examples are purely exemplary of the invention and are not to be construed as limiting of the invention.

EXAMPLES

All the H. pylori isolates encode a GGT that catalyzes the transfer of gamma glutamyl residues from glutathione to ammo acids, and might therefore participate to the mtracellular translocation of ammo acids. This enzymatic activity accounts for one of the key biochemical assays that leads to the identification of H. pylori . Using a polyclonal rabbit antiserum raised against a mammalian transferase, a 53 kDa band was revealed by Western blot in the cytoplasmic fraction of strain 85P described m J. Bacteriol . 173:1920-1931 (1991). The protein was purified by serial chromatography and the immunoreactive fractions were pooled at each step. The partially purified 53- kDa protein was submitted to enzymatic endoproteolysis and the N-ammo acid sequences of two of the peptides thus generated were determined.

The principle of the activity test of Glutamyltransferase (γ-GT) is: L-γ-glutamyl carboxy- 3 nitro-4 anilide + glycylglycine

γ-GT

>

L-γ-glutamyl -glycylglycine + amino-5 nitro-2 benzoate

The action of γ-GT produces a colored product whose intensity is measured by spectrophotometry .

Four degenerated oligonucleotides were synthesized and used to amplify the H. pylori chromosomal DNA. A unique combination of two of the oligonucleotides gave a PCR product that was then used as a probe to identify a recombinant cosmid within the genomic library, and subclones of the cosmid. The identified gene encodes a 555 amino-acid protein that showed high similarity with the E. coli and human GGTs and resembles the cephalosporin acylase from Pseudomonas and Bacillus with respect to their molecular organization and amino acid sequence. Whether the GGT in H. pylori consists of two polypeptide chains (a and b chains, 365 and 190 kDa, respectively) that result from the maturation of the 555 kDa precursor protein remains to be determined.

A 0.7 kb fragment internal to the ggt gene was replaced by a kanamycin cassette and the recombinant plasmid was used to generate a knocked out mutant of H. pylori . This mutant was viable despite the fact that no residual gamma- glutamyltranspeptidase activity was detectable.

The invention also covers the production of recombinant large and small subunits of the GGT. EXPERIMENTAL PROCEDURES Bacterial strains and cul ture condi tions H. pylori strain 85P was used for the initial cloning steps (Labigne et al . , 1991). H. pylori strain 26695, the strain used by TIGR for the genome sequencing project (Tomb et al . , 1997) was obtained from D. Berg (Tomb, et al . , 1997). H. pylori strain SSI is an isolate capable of colonizing the gastric mucosa of mice and was first described by Lee et al . (Lee et al . , 1997) . Strain NCTC 12032 and strain ATCC49179 were used as representatives of the H. mustelae and H. felis species, respectively. Helicobacter hepaticus (ATCC451448) , Helicobacter muridarum (ATCC49282) , Helicobacter bilis (ATCC51630) and Helicobacter canis (ATCC51401) were from the "Collection de bacteries de 1 ' Institut Pasteur". Helicobacter strains were grown on horse blood agar plates (Oxoid Base N°2 , ref . CM271), supplemented with vancomycin (5 mg l^"1) , polymyxin B (2500 U l^"1) , trimethoprim (5 mg l^"1) and amphotericin B (4 mg l^"1) . Plates were incubated in an anaerobic jar with a microaerobic gas generating kit (Oxoid BR56) in the presence of a catalyst. E. coli strains MPC1061 (Casadaban and Cohen, 1980) and HB101 (Boyer and Roulland-Dussoix, 1969) were used as hosts for plasmid cloning experiments, and were grown in L-broth (10 g tryptone, 5 g yeast extract and 5 g NaCl per litre, pH 7.0) or on L-agar plates (1.5% agar) at 37°C. E. coli M15 strain harboring the pREP4 plasmid (expressing the Lacl^q repressor) was used for the expression of His-tag fused GGT into the pQE30 cloning vector (Qiagen) . Carbenicillin, spectinomycin and kanamycin were used for the selection of recombinant clones at concentrations of 100 mg l^"1, 100 mg l^"1 and 20 mg l^"1, respectively. Gamma -Glut amyl transpeptidase activi ty

Qualitative detection of gamma-Glutamyltranspeptidase activity was achieved by resuspending 10⁹ bacteria (whole cells) into 200 μl of water, to which was added 200 μl of reagent (Boehringer Mannheim, N° 1 087 584) containing 100 mM Tris (pH 8.25), 2.9 mM L-γ-glutamyl-carboxy-3 nitro-4 anilide, and 100 mM glycylglycine. The suspension was then incubated for 30 mm at 37°C. Cleavage of the substrate due to GGT activity induced the appearance of a yellow color. Quantitative determination of GGT activity was performed from cellular fraction extracts, or whole cells at 37°C in 0.1M Tπs-HCl buffer (pH 8.0) using 1 mM L-γ- glutamyl -p-mtroanilide as the donor substrate, in the presence or absence of 20 mM glycylglycine as the acceptor, as previously described (Orlowski and Meister, 1963) . The absorbance of p- nitroamlme liberated from γ-glutamyl -p-NA was measured at 385 nm. One unit of activity was defined as the quantity of enzyme that released 1 μmol of p-nitroanilme per mm and per mg of protein at 37°C. Polymerase chain reaction

PCR was performed as follows: target DNA was heat- denaturated prior to its addition to 50 μl amplification reactions, containing 50 pmol of each primer (for non degenerate primers, and up to 500 pmol for degenerate primers) , 10 mM Tris- HC1 (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, 0.01% (w/v) gelatin, 0.2 mM of each deoxynucleotide (Pharmacia) and 2.5 U Taq DNA polymerase (Amersham) . Gene amplification was carried out using either a Perkm-Elmer or an Eppendorf thermal cycler, for 30 cycles. Each cycle consisted of a denaturation step at 94°C for 1 mm, a primer annealing step ranging from 45 to 56°C for 1 mm (depending upon the melting temperatures of the various primers) , and an extension step at 72°C for 2 mm. Construction of recombinant plasmids

Vectors and recombinant plasmids used m this study are listed m Table 2. All standard methods of DNA manipulation were performed according to the protocols of Sambrook et al . (Sambrook et al . , 1989) . The alkaline lysis procedure was used for small- scale plasmid preparations. MAXI and MIDI Qiagen columns (Qiagen) were used for cosmid and large-scale plasmid preparation, respectively. The ggt truncated gene was overexpressed in E. coli from plasmid pILL313 which was constructed as follows. A 160 bp-PCR fragment generated using the GGT17 and GGT18 primers, which contained BamHI and Pstl restriction sites, respectively, was cloned into the BamHI-Pstl site of plasmid pQE30 (Qiagen). Then, the 1.4 kb Pstl fragment from plasmid pILL308 was cloned into the Pstl site of that plasmid, resulting in pILL313. The nucleotide sequence of the region of the recombinant plasmid that was generated by PCR was determined to verify the absence of error during the PCR reaction. Plasmid pILL310-2, containing the whole GGT gene, was obtained as follows. The Clal - Sphl fragment of pILL308 was first cloned into the Clal-Sp l restriction sites of plasmid pHEL2 ; the resulting recombinant plasmid was then restricted with BamHI and Sphl . A PCR fragment, that was generated with oligonucleotides GGT27 and GGT29 (Table 1) , was restricted with the same two enzymes and cloned into that plasmid. Finally, a PCR fragment generated with oligonucleotides GGT26 and GGT27 (Table 1) was restricted with BamHI and cloned into the BamHI site of the previous construct, giving rise to pILL310-2. The nucleotide sequence of the DNA fragments generated by PCR was determined to confirm that no modification of the sequence was introduced by this cloning procedure. Finally, the 2.2 kb-Bglll fragment of pILL310-2 was cloned into the pILL570 vector to generate pILL312.

Plasmid pILL314 was constructed by amplifying two fragments using oligonucleotides GAG1 and GAG2 , as well as GAG3 and GAG4.

The two generated fragments were restricted with Pstl and BamHI and EcoRI and BamHI, respectively, and were cloned into pUC19 linearized with Pstl and EcoRI. The resulting plasmid was restricted with BamHI and the BamHI -digested kanamycin cassette from pILL600 was introduced to generate pILL314. Semi -purification of native GGT protein from H. pylori cells

H. pylori 85P was grown and harvested in phosphate-buffered saline (PBS) from 60 blood agar plates incubated for 72 hours.

The cells were centrifuged for 30 min at 5,000 x g and the pellet was resuspended in 10 ml of PBS containing 1% NOG

(n-octylglucose) . After incubation for one hour, at room temperature, with gentle shaking, the suspension was centrifuged at 12,000 x g for 30 min. The pellet was suspended in 10 ml of PBS and sonication was carried out in a Sonifier-250 (Branson) for 10 min. The sonicate was centrifuged 10,000 x g for 20 min. To 10 ml of supernatant, 20 ml of Buffer A (Tris-HCl 1M, pH8.0 - 25 mM NaCl) was added prior to loading on a HP Q-sepharose

(Pharmacia) column previously equilibrated with Buffer A. The column was washed with 45 ml of Buffer A. Proteins were eluted with a linear gradient of 25 mM-500 mM NaCl in 1M Tris-HCl

(pH8.0). Fractions (2 ml) were collected and used for SDS-PAGE analysis as well as for qualitative GGT determinations. Expression and purification of His - tag recombinant GGT

The His-tag fusion protein was produced from pILL313 described above. Purification of the fusion proteins was performed by affinity chromatography using a nitrilo-tri-acetic acid chelating nickel resin (Ni-NTA, Qiagen) as follows. Two hundred ml of Luria medium containing carbenicillin and were inoculated with 2 ml of an overnight culture of E. coli M15(pREP4) freshly transformed with pILL313 and incubated with shaking at 37°C. When the OD₆₀₀ of the culture reached 0.5, isopropyl β-D-thiogalactopyranoside (IPTG) (final concentration 1 mM) was added and the culture was incubated with shaking (200 rpm) for a further 4 h. Cells were harvested by centrifugation (5000 rpm for 20 min at 4°C) , suspended in 20 ml of Buffer A (8M urea, 0.1 M Na phosphate, 0.01 M Tris-HCl, pH8.0), and sonicated for 5 min. Following centrifugation (15,000 x g for 15 min at 4°C) , supernatants were added to 5 ml of a 50% slurry of Ni-NTA resin, that had been previously equilibrated in Buffer A, and stirred at room temperature for 45 min. The mixture was centrifuged for 10 min at 5,000 x g to remove Buffer A. The resin was then washed twice with 10 volumes of Buffer A and the fusion protein eluted twice with 10 volumes of Buffer B (Buffer A containing lOOmM imidazole) . The supernatants were pooled and dialyzed against PBS. Concentration and purity of the preparations were determined by a Bradford protein assay (Bio Rad) and by SDS-PAGE gels (Laemmli and Favre, 1973) . Five mg of the recombinant 6XHis-tagged GGT protein was purified from a 200 ml culture of E. coli cells. Recombinant GGT preparations

(equivalent to 500 μg of protein) were injected in the presence of complete (first immunization) then incomplete Freund adjuvant

(second and third injections) to raise a polyclonal rabbit antiserum. DNA sequence determination

Methods including subcloning into M13mpl8/19 vectors and sequencing on single-stranded DNA were as previously described

(Sanger et al . , 1977), (Yanisch-Perron et al . , 1985). The Thermo Sequenase Radiolabeled Terminator cycle sequencing kit (Amersham, ref . US79750) was used for direct sequencing of cosmid DNA with oligonucleotides GGT2 and GGT21 (Table 1) . Sequence processing and interpretation were done with the sequence analysis software package G. C. G. (Genetics Computer Group, Inc.) . SDS/Page and Immunoblotting techniques

Solubilized protein preparations were analyzed on slab gels, comprising a 4.5% acrylamide stacking gel and 10% or 12.5 % resolving gels, according to the procedure of Laemmli (Laemmli and Favre, 1973) . Electrophoresis was performed at 200 V on a mini-slab gel apparatus (Bio-Rad) . Proteins were either stained with Coomassie brilliant blue or transferred to nitrocellulose membranes in a mini Trans-Blot transfer cell (Bio-Rad) set at 100 V for 1 h, with cooling. Membranes were blocked with 5% (wt/vol) milk powder ("Regilait") in phosphate-buffered saline (PBS) and Tween 1% (vol/vol) with gentle shaking at room temperature for 2 hours. Membranes were reacted at 4°C overnight with antisera diluted in 5% powder milk in PBS and 0.2% Tween, and washed in PBS - 0.2% Tween. Rabbit antibodies raised against the 6xHis- tagged GGT were diluted 1:5,000, and donkey anti-rabbit- peroxidase secondary antibodies (Amersham) were diluted 1:20,000. For subcellular fractionation studies, anti 6xHis-GGT rabbit antiserum was preabsorbed with a sonicated extract of GGT- deficient SSI cells. Immunoreactants were detected by chemiluminescence (ECL system; Amersham) as previously described

(Ferrero et al . , 1994). Elec r-oporation of H. pylori

Electroporation of the H. pylori strain SSI was performed as previously described (Ferrero et al . , 1992) . Approximately 10 μg of pILL311 and pILL314 was concentrated by ethanol precipitation

(without salt) and the pellets dissolved in 5 μl of double distilled water. One μl of this solution was used for each electroporation experiment.

Animal colonization

Six- to 8-week-old Swiss specific-pathogen-free mice (Centre d'Elevage R. Janvier) were fed a commercial pellet diet with water ad libitum. Aliquots of 100 μl containing 10⁷ H. pylori strain SSI bacteria prepared from a low subculture stock suspension (between 6 and 20 in vi tro passages) in peptone broth, were administered orogastrically to mice as described elsewhere (Ferrero et al . , ) . Four weeks following inoculation, mice were sacrificed, and stomachs were removed for assessment of colonization by H. pylori . The presence of H. pylori bacteria was determined by a biopsy urease test (Ferrero et al . , 1995) performed on half of each stomach, and by quantitative culturing of the remaining gastric tissues. Viable counts of H. pylori were estimated by serial dilutions of the homogenized tissues in peptone broth, and plating on 2.0% agar plates supplemented with decomplemented fetal calf serum (7%) , bacitracin (200 μg ml^"1) and nalidixic acid (10 μgml^"1) (Ferrero et al . , ) . Kanamycin (20 μg ml^"1) was also added to the medium, for the enumeration of H. pylori isogenic mutants. High - throughput drug screening

The assay measures the transfer of L-γ-glutamyl moiety from L-γ-glutamyl -p-nitroanilide used as the donor substrate, to glycylglycine used as an acceptor. The absorbance of p- nitroaniline liberated from γ-glutamyl -p-nitroanilide is measured at 385 nm. Assays are carried out in 0.1M Tris-HCl buffer (pH 8.0), in the presence of 20 mM glycylglycine, and 10 nM recombinant or purified H. pylori GGT, or 10 nM of purified human GGT in a final volume of 190 μl in microtiter polates in the presence or absence of the pharmaceutical or natural compounds. To initiate the reaction, 10 μl of the substrate (1 mM L-γ- glutamyl -p-nitroanilide) is added to 190 μl of reaction mixture at room temperature. Compounds that inhibit the H. pylori GGT and do not alter the human GGT activity are selected as compounds of interest .

Example 1 : Purification of the Gamma-Glutamyltranspeptidase from H. vylori crude extract

Fractions were tested by Immunoblotting, and reactive fractions were pooled, concentrated, and loaded on SDS-PAGE gels. A major protein band was cut out of a Coomassie-blue stained gel and digested by endoprotease Lys-C. The N-terminal amino acid sequences of two of the major generated peptides, VGLALSSHPLATEIGQK (peptide I) and GFYQGQVAELIEK (peptide II) , was determined by microsequencing (Figure 6) . Two degenerate oligonucleotides were designed from each peptide (Table 1, forward and reverse) and were used in combination for PCR- amplification of chromosomal DNA from H. pylori strain 85P. The deduced amino acid sequence (Figure 6) encoded by the 600 bp-PCR- product , generated with oligonucleotides I forward + II reverse, was similar to an internal sequence of the GGT proteins of Escherichia coli and Pseudomonas aeruginosa, indicating that we had partially purified and proteolyzed the GGT of H. pylori .

TABLE 1: Oligonucleotide primers used for PCR, cloning and sequencing

Nucleotide Position in Length Sequence (5 ' -3 ' ) name sequence (bp)

I forward 130- -158 29 CAYCCNYTNGCNACNGARATHGGNCARAA

I reverse 158- -130 29TTYTGNCCDATYTCNGTNGCNTRNGGRTG

II forward 689- -714 26 GGNTTYTAYCARGGNCARGTNGCNGA

II reverse 714- -689 26 TCNGCNACYTGNCCYTGRTARAANCC

GGT 2 1579- -1598 20 CTCACTAAAATGGGCTATCA

GGT 17 82- -103 23 cgcggatccAGTTACCCCCCCATTAAAAACAC

GGT 18 242- -213 25 TTGCCTGCTGCAGGATGGACGACCG

GGT 21 1819- -1794 26 AGATCTAATATCGTCTCTTGTAATGAG

GGT 23 238- -260 23 GGNAAYATHGGNGGNGGNGGNTT

GGT 26 1675- -1702 28 GGATCAACGGATCCAAGGAAAGAATTTT

GGT 28 426- -403 23 CCNGCNACNGTNCCNGGNACNCC

CAG 1 18759- -18787 36 aaactqcagtaqCCTTTAGACGCCTGCAACGATCGG

CAG 2 19275- -19251 34 cgcqqatccAAGATTCTACATCAATGAGATTGTC

CAG 3 21831- -21856 35 qcqqqatccGGGCTTTCAAGGAATCAAGAATTGGC

CAG 4 22295- -22275 31 CCq aattcGCGTAAAGCCTGAATTAGTGTC

Underlining indicates BamHI (GGATCC) , Pstl (CTGCAG), EcoRI (GAATTC), Bgrlll (AGATCT) . Lower case letters in the primer sequences indicate nucleotides that were added at the 5'- end to create a restriction site. Capital letters correspond to the nucleotide sequences taken from the sources indicated in the last column, where Y stands for T or C, R for A or G, H for A or T or C and N for A, or T, or C, or G, respectively. Example 2 ; Cloning and expression of the gene encoding H. Oylori GGT (σσt) in E. coli

The 600 bp-PCR-product was randomly labeled with α³²P(dCTP) and used as a probe to screen the cosmid library of H. pylori strain 85P (Labigne et al . , 1991). Five of 480 colonies hybridized with the probe. E . coli HB101 cells harboring the cosmids exhibited GGT activity following growth at 37°C, whereas E. coli HB101 cells harboring the cosmid vector alone (pILL575) expressed no detectable activity at 37°C. This observation is consistent with previous data indicating that the E. coli GGT is a cold shock protein (Suzuki et al . , 1989; Suzuki et al . , 1986).

One recombinant cosmid (VH12) was identified, purified, and partially restricted with restriction enzyme Sau3A to generate fragments with a size ranging from 2 to 4 kilobases. Subclones hybridizing with the 600 bp-PCR probe (probe 1) were mapped. See, Figure 4.

Determination of the nucleotide sequence of the subclones allowed the inventors to identify an open reading frame, 1646 bp m length, encoding a polypeptide partly homologous to the ggt gene of E. coli .

A second cosmid (IVE8, Table 2) was partially digested with Sau3A to generate fragments ranging from 3 to 5 kb that were ligated with the BamHI lmeaπzed-pILL570 vector (Table 2) . After transformation into E. coli MC1061, each spectmomycm- resistant transformant was subsequently tested by colony hybridization using the same 600 bp- PCR-product-probe . Determination of the nucleotide sequence of the insert of one of the recombinant plasmids, pILL308 (Figure 7) , and alignment of the deduced ammo acid sequence with that of the known GGT homologs (Figure 6), demonstrated that pILL308 lacked the 3' end of the H. pylori ggt gene. The complete sequence of the gene was then obtained by direct sequencing of the IVE8 cosmid using oligonucleotide GGT2 and GGT21 (Table 1) as primers. This nucleotide sequence determination allowed us to construct plasmid pILL312 (Figure 7) according to the procedure described in Experimental procedures . Plasmid pILL312 harbored the complete H. pylori ggt gene flanked by 350 bp and 114 bp non-coding sequences upstream and downstream, respectively. This plasmid led to the expression of GGT activity in E. coli cells grown at 37°C, with an activity of 0.22 units (see Experimental procedure for unit definition) (Table 3) . Due to the presence of a series of transcriptional stops upstream from the ggt gene within the pILL570 cloning vector, we concluded that the H. pylori ggt gene, when present in E. coli , was expressed from a promoter located in the 350 bp region upstream from the gene.

TABLE 2 : Vectors and hybrid plasmids used in this study

Plasmid Vector Size (kb) Antibiotic resistance, comments pILL570 5.3 Sp^R pILL575 10 Km^R, Cos pQE30 3.5 Ap^R,QIAexpress expression vector, (όxHis)tag fusion pUC19 2.7 Ap^R pUC18* 2,7 Ap^R, a pUC18 derivative deprived of Pstl site pHel2 5.0 Cm^R

IV E8 pILL575 >40 Km^R; cosmid: Sau 3A from 85P chromosome pILL600 pBR322 5.7 Tc^R, Km^R; source of Km cassette pILL308 pILL570 7.1 Sp^R; plasmid containing partial ggt gene of H.pylori pILL309 pUC18* 5.5 Ap^R; plasmid containing the Eco/Sphl from IVE8 pILL310-2 pHel2 7.2 Cm^R; plasmid containing the whole ggt gene of H. pylori pILL311 pUC18* 6.2 Ap^R; Km^R; H. pylori ggt ΩKm pILL312 pILL570 7.5 Sp^R; plasmid containing the whole ggt gene of H.pylori

pILL313 PQE30 5.0 Ap^R; plasmid for overexpression of (6xHis) tagged GGT protein

PILL314 pUC19 3.7 Ap^R;Km^R; H.pylori vagAΩKm

Ap^R, resistance to ampicillin; Cm^R, resistance to c loramphenicol; Km^R, resistance to kanamycin; Sp^R, resistance to spectinomycin, Cos, presence of cos site. TABLE 3 : Quantitative determination of Gamma-Glutamyltranspeptidase activity *

Strains Characteristics Activity (units

H. felis (ATCC49179) parental isolate, GGT⁺ 0.60

H. mustelae (NCTC12032) parental isolate, GGT⁺ 0.4 400

H. canis (ATCC51401) parental isolate, GGT⁺ 0.5511

H. bilis (ATCC51630) parental isolate, GGT⁺ 0.4400

H. hepati cuε (ATCC451448 parental isolate, GGT⁺ 1.6622

H. pylori strain SSI parental isolate, GGT⁺ 0.4488

H. pylori SSI grgt^Km disrupted ggt gene, , GGT^" 0.0000

HB101 ** host strain 0.0000

MC1061** host strain 0.0000

HB101 (IVE8)** Km^R, GGT⁺ 0.2266

MC1061 (pILL312)** Sp^R, GGT⁺ 0.2222

MC1061 (pILL311)** Sp^R, GGT^" 0.0000

*One unit of activity was defined as the quantity of enzyme that released 1 μmol of p-nitroaniline per minute and per mg of protein at 37°C.

** Determinations were achieved following growth of E. coli strains at 37°C, in order to repress the E. coli Gamma-

Glutamyltranspeptidase activity.

Example 3 ; Construction of an isogenic mutant of H. pylori

Plasmid pIL311 (a pUclδ derivative plasmid) m which a 714 bp-mternal detection has been introduced within the ggt open reading frame, was electroporated into H. pylori strain N6. See, Figure 5. Kanamycm transformants were selected on kanamycm (20 μg/ml) .

The y-glutamyltransferase activity of the N6 kanamycm derivative transformants as well as that of the original isolate (N6) has been determined spectrophotometrically by measuring the p-nitroamlme released from L-y-glytamyl-3 -carboxy-4- nitroanilide used together with glycylglycine. No residual y- glytamyltransferase activity was detectable m the N6 isogenic mutants. Thus, the synthesis of y-glutamyltranspeptidase is not essential for H. pylori in vi tro growth.

Example 4 : Evidence for processing and maturation of the H. vγlori γ-qlutaπryltranspeptidase

We wanted to determine whether the H. pylori GGT was synthesized as a pro-GGT and subsequently processed as a large and a small subunit, as has been reported for eukaryotic (Coloma and Pitot, 1986; Goodspeed et al . , 1989; Papandrikopoulou et al . , 1989) and bacterial GGTs (Ishiye et al . , 1993; Suzuki et al . , 1989; Xu and Strauch, 1996), which are first translated as a precursor protein (prepro-GGT) . Two proteolytic cleavages then occur: the first one results m cleavage of the signal peptide (peptidase I) and the second processes the pro-GGT into large and small subunits. Therefore, a 6xHιs-tagged-GGT recombinant protein was produced from plasmid pILL313 in E. coli (Figure 7) . The recombinant protein corresponded to the fusion of 6 histidme residues to the pro-GGT protein (i.e. the precursor GGT without the first 26 ammo acids of the signal sequence) and lacked the last 21 ammo acids of the carboxy terminus of the pro-GGT protein. The purified protein was used to immunize a rabbit. Immunoblot analysis of whole cell extracts of H. pylori with an anti -GGT rabbit serum allowed vizualization of two major bands with apparent molecular masses of 38 kDa and 23 kDa (Figure 8) . These two bands were absent from extracts from an isogenic H. pylori strain in which the ggt gene was disrupted (see below for the construction of the isogenic mutant) . This result suggested that in H. pylori , the pro-GGT is very efficiently processed into large and small subunits, as the pro-GGT form was not detected in H. pylori whole cell extracts. In contrast, in E. coli , the H. pylori GGT protein was not secreted and processed as efficiently as in H. pylori , nor as efficiently as the E . coli GGT in E . coli . It was also observed that the recombinant 6XHis-tagged-GGT deprived of signal sequence was not processed at all in the cytoplasm of E. coli cells, indicating that successful maturation of the pro-GGT into two subunits requires either the presence of the C-terminal end of the pro-GGT and/or that processing only occurs after secretion within the periplasmic space. The anti-H. pylori GGT rabbit serum cross -reacted with the two subunits of the E. coli GGT, that were produced only when the E. coli host strain was grown at 20°C. Finally, this anti -GGT serum did not neutralize the GGT activity associated with H. pylori intact or sonicated cells.

Example 5: Sequence analyses of H.pylori GGT and comparison with bacterial and eukaryotic homologs

The sequence alignment of the unprocessed pro-GGT from a variety of bacteria and mammals is shown m Figure 6. The deduced ammo acid sequence of the ggt gene of H. pylori strain 26695, recently published by TIGR (Tomb et al . , 1997), has also been included. Comparison of the latter sequence with that of 85P confirms the very high degree of conservation of GGT within H. pylori species. Indeed, only 5 of the 567 ammo acids of the whole GGT molecule are different; two of these are located within the signal sequence, and 3 within the large subunit of the GGT. The multiple alignment of the GGTs illustrates that H. pylori GGT has a similar overall structure as the well described mammalian GGTs. The gene codes for a protein consisting of 567 ammo acids, with a calculated molecular mass of 61,082 Da. H. pylori GGT exhibits a typical signal sequence at its N-terminal end (26 ammo acids with the cleavage site occurring between Ala-26 and Ala-27) . The position of the second cleavage site (between ammo acid 379 and 380) which results in the processing of the pro-GGT into a large and a small subunit, with calculated molecular masses of 38,270 Da and 20,378 Da, was deduced for H. pylori GGT by comparison to other GGTs. This position is compatible with the apparent molecular masses of the two subunits observed on SDS-PAGE; however, the N-terminal ammo acid sequence of the small subunit will need to be determined to confirm the position of the cleavage site. H. pylori GGT shares 52.5%, 47.7%, and 38% of identity with the ammo acid sequences of the E. coli , P. aeruginosa, and Bacillus subtilis GGTs, respectively, and 22% with the human GGT. The small subunit, which has previously been shown to contain the catalytic site of the enzyme, is slightly more conserved than the large subunit. The small subunit has 26.1% identity and the large 20.6% identity with human GGT. The most striking difference of the H. pylori GGT when compared to other GGTs is the absence of the GY residues at the C-terminal end of the small subunit, a feature observed in both sequenced H. pylori genes. Finally, this alignment emphasizes the presence of highly conserved and potentially reactive ammo acids (Figure 6, consensus line); some of these (such as Arg-107 and Glu-108 (Ikeda et al . , 1993), Hιs-382, and Hιs-504 (Ikeda et al . , 1996), Ser-451, and Ser-452 (Ikeda et al . , 1995)), have already been proposed to have a role m the catalytic function of the mammalian GGTs. Example 6 : Presence of GGT activity and distribution of the crcrt gene among other Helicobacter species

To test whether the GGT activity was specific, and thus restricted, to the gastric bacteria or whether it was a property shared by all the bacteria belonging to the genus, GGT activity was determined on isolates of different Helicobacter species. Table 3 summarizes the GGT activity associated with various Heli cobacter species, including Helicobacter felis and Heli cobacter mustelae, bacteria that naturally colonize the gastric mucosa of cats and ferrets, respectively; Helicobacter cams, which naturally colonizes the intestinal tract of dogs; and Helicobacter bilis and Helicobacter hepaticus, which colonize both the intestine and the livers of mice. All Helicobacter isolates exhibited similar levels of GGT activity, with a significantly higher activity detected in H. hepaticus (1.62 units versus an average of 0.5 units for the other Helicobacter spp . ) . Using degenerate oligonucleotides GGT23 and GGT28 (Table 1) , that target a sequence encoding ammo acids 80 to 87 and ammo acids 135 to 142, respectively, we were able to amplify from lysates of each of these bacteria 186 bp-PCR products similar to that generated from pILL312. This result suggests that the gene coding for GGT is highly conserved within bacteria of the Heli cobacter genus. Example 7 : Construction of an isogenic mutant of H. pylori deficient in GGT activity -- evidence for an essential role of the enzyme in vivo

In order to construct isogenic mutants of H. pylori deficient m GGT activity, a 700 bp deletion was generated withm the ggt gene m plasmid pILL309 by removing the Pstl fragment encoding ammo acids 76 to 324. This Pstl fragment was replaced by a Pstl -kanamycm cassette originating from plasmid pILL600 (Table 2) . The resulting plasmid pILL311 was then introduced by electroporation into a mouse-adapted H. pylori strain SSI (Lee et al . , 1997). Six independent electroporations were performed and the different kanamycm transformants were independently tested to verify that gene disruption and gene replacement had occurred.

The mutants had no residual GGT activity, and grew normally in vi tro. We then tested the role of the GGT in vivo . Groups of 10 mice were inoculated orogastrically with one of the following bacterial suspensions, according to the protocol described m Experimental procedures . a) a low passage SSI parental strain; b) a single GGT deficient mutant; c) a pool of 6 independently constructed GGT deficient mutants; and d) a positive control consisting of a pool of 6 SSI mutants deficient in the production of CagA (Censim et al . , 1996) (independently constructed by introducing plasmid pILL314 (Table 2) by electroporation into strain SSI) . Four weeks following inoculation, the mice were sacrificed and the stomachs removed from the animals. Colonization by the respective SSI and SSI-derivative strains was assessed by the biopsy urease test, and by quantitative cultur g of the stomachs (Ferrero et al . ) . Of the twenty mice inoculated with GGT-deflcient H. pylori SSI mutants, none harbored H. pylori bacteria m their stomachs. In contrast, 10 out of 10 mice that were inoculated with either the SSI parental strain, or the cagA

SSI were colonized with H. pylori , and the bacterial loads m these mice ranged from 5xl0³ to 5xl0⁵ colony-forming units (CFU) per gram of stomach. GGT activity is therefore essential for the colonization of the gastric mucosa or for survival of H. pylori in vivo .

Although the importance of Gamma-Glutamyl-transpeptidases in glutathione metabolism (Meister and Anderson, 1983; Tate and Meister, 1981) , and amino acid transport (Orlowski and Mester, 1970) in mammalian tissues, has been recognized for many years, little data is currently available on the role of this enzyme in bacteria. GGT activity is not detected in all bacteria, and in many cases, it is not clear whether the lack of such an activity is due to the absence of the gene or to the absence of expression under the experimental conditions employed. For example, it is known that only some Nesseria isolates, such N. meningi tidis, but not N. gonorrhoeae species, express GGT activity (Riou et al . , 1982) . However, whether the gene is present in all these strains is still unknown. So far, the sequences of only three bacterial GGT-encoding genes have been reported for the enzymes isolated from E. coli (Suzuki et al . , 1989), P. aeruginosa (Ishiye et al . , 1993) , and B . subtilis (Xu and Strauch, 1996) .

The gene encoding GGT in H. pylori has now been identified, sequenced, and expressed. It has been demonstrated that the expression of the GGT encoding gene was not essential for H. pylori in vi tro growth, but that GGT activity was essential for in vivo multiplication of the bacteria in the gastric mucosa of mice, demonstrating for the first time a physiological role for a bacterial GGT enzyme.

The protein was found to have a similar structure to that of mammalian GGTs. However, the amino acid sequence of H. pylori

GGT differs from eukaryotic homologs with only 22 % of amino acids conserved between these enzymes. As with other GGTs, H. pylori GGT is encoded by a single gene and is translated as a unique 61 kDa polypeptide that is processed into two polypeptides with calculated masses of 38 and 20, respectively. This finding confirms the existence of a postranslational maturation process which is rare m prokaryotic cells. When present, it is commonly associated with an auto-endoproteolytic activity of the protein.

The H. pylori ggt gene is constitutively expressed during m vi tro growth, a feature that correlates with the fact that GGT activity is a trait common to all H. pylori isolates and allows it to be used as a diagnostic marker for identifying H. pylori isolates .

Isogenic ggt-negative mutants of the mouse-adapted H. pylori SSI consistently failed to colonize the gastric mucosa of mice, indicating that the GGT activity is necessary for m vivo survival. As for E. coli (Susuki et al . , 1987) and B . subtilis

(Xu and Strauch, 1996) GGT-deflcient mutants, growth of the H. pylori mutants m vi tro was not affected. To eliminate the possibility that the electroporation procedure had resulted in the introduction of an undesired mutation a vital gene, various independent electroporation experiments were performed. In addition, the same procedure was used to construct an SSI strain m which the cagA gene was disrupted with the same Km cassette. The cagA gene is a gene encoding a highly immunogenic protein of unknown function, contained withm the recently described eag Pathogenicity Island (PAI) of Helicobacter pylori

(Censini et al . , 1996) . This gene is non-essential for the survival of bacteria in vivo as 40% of clinical isolates do not carry the gene. Attempts to colonize mice with these cagA mutants were 100% successful, demonstrating that the procedure used for the construction of the isogenic mutants was not responsible for the lack of colonization by the GGT-deflcient mutant . Given that the ggt gene is not part of a polycistronic operon, and is followed by a putative transcriptional Rho- independent terminator, the absence of colonization of murine gastric mucosa can be attributed to the creation of an isogenic mutant deficient in GGT production.

The references cited herein are specifically incorporated by reference in their entirety:

Blaser, M. (1992) Hypothesis on the pathogenesis and natural history of Helicobacter- induced inflammation. Gastroenterology 102 : 720-727.

Boyer, H.W. and Roulland-Dussoix, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli . J. Mol . Biol . 41 : 459-472.

Casadaban, M. and Cohen, S.N. (1980) Analysis of gene control signals by DNA fusions and cloning in E. coli . J. Mol . Biol . 138 : 179-207.

Censini, S., Lange, C, Xiang, Z., Crabtree, J.E., Ghiara, P., Borodovsky, M., Rappuoli, R. and Covacci, A. (1996) eag, a pathogenicity island of Helicobacter pylori , encoes typel- specific and disease-associated virulence factors. Proc . Nat . Acad . Sci . USA 94 : 7595-7599.

Chesney, J.A., Eaton, J.W. and Mahoneyn JR, J.R. (1996)

Bacterial glutathione: a sacrificial defense against chlorine compounds. J^". Bacteriol . 178 : 2131-2135. Coloma, J. and Pitot, H.C. (1986) Characterization and sequence of cDNA clone of gamma-glutamyltranspeptidase . Nucleic Acids Res . 14 : 1393-1403.

Elmore, M.J., Lamb, A.J., Ritchie, G.Y., Douglas, R.M., Munro, A., Gajewska, A. and Booth, I.R. (1990) Activation of potassium efflux from Escherichia coli by glutathione metabolites. Molec . Microbiol . 4 : 405-412.

Ferrero, R.L., Cussac, V., Courcoux, P. and Labigne, A. (1992) Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J^". Bacteriol . 174 : 4212-4217.

Ferrero, R.L., Thiberge, J.-M., Huerre, M. and Labigne, A.

Immune responses of specific pathogen- free mice to chronic Helicobacter pylori (strain SSI) infection. Infect._. Immun . Sumbitted

Ferrero, R.L., Thiberge, J.-M., Huerre, M. and Labigne, A. (1994) Recombinant antigens prepared from the urease subunits of Heli cobacter spp : evidence of protection in a mouse model of gastric infection. Infect . Immun . 62 : 4981-4989.

Ferrero, R.L., Thiberge, J.-M., Kansau, I., Wuscher, N. , Huerre, M. and Labigne, A. (1995) The GroES homolog of Helicobacter pylori confers protective immunity against mucosal infection in mice. Proc . Na tl . Acad . Sci . USA 92 : 6499-6503.

Gardell, S.J. and Tate, S.S. (1979) Latent proteinase activity of g-glutamyl transpeptidase light subunit. J. Biol . Chem . 254 : 4942-4945. Goodspeed, D., Dunn, T., Miller, C. and Pitot, H. (1989) Human g-glutamyl transpeptidase cDNA: comparison of hepatoma and kidney mRNA in the human and rat. Gene 16 : 1-9.

Hashimoto, W., Susuki , H., Nohara, S. and Kumagai, H. (1992) Escherichia coli g-glutamyltranspeptidase mutants deficient in processing to subunits. Bi ochem . Bi ophys . Res . Commun . 189 : 173-178.

Hashimoto, W., Suzuki, H., Yamamoto, K. and Kumagai, H. (1995) Effect of site-directed mutations on processing and activity of g-glutamyltranspeptidase of Escherichai coli K- 12. J. Biochem . 118 : 75-80.

Heuermann, D. and Haas, R. (in press) A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation. Mol . Gen . Gen . :

Ikeda, Y., Fujii, J., Anderson, M.E., Taniguchi , N. and Meister, A. (1995) Involvement of Ser-451 and Ser-452 in the catalysis of human g-glutamyl transpeptidase. J. Biol . Chem . 268 : 3980-3985.

Ikeda, Y., Fujii, J. and Taniguchi, N. (1993) Significance of Arg-107 and Glu-108 in the catalytic mechanism of human g- glutamyl transpeptidase: identification by site-directed mutagenesis. J. Biol . Chem . 268 : 3980-3985. Ikeda, Y., Fujii, J. and Taniguchi, N. (1996) Effects of subsstitutions of the conserved histidine residues in human g-glutamyl transpeptidase. J. Biochem . 119 : 1166-1170.

Ishiye, M. , Yamashita, M. and Niwa, M. (1993) Molecular cloning of the gamma-glutamyltranspeptidase gene from a Pseudomonas strain. Biotechnol . Prog . 9 : 323-331.

Labigne, A., Cussac, V. and Courcoux, P. (1991) Shuttle cloning and nucleotide sequence of Helicobacter pylori genes responsible for urease activity. J. Bacteriol . 173 : 1920-

1931.

Labigne, A. and De Reuse, H. (1996) Determinants of Helicobacter pylori pathogenicity . Infect . Agents & Disease 5 : 191-202.

Labigne-Roussel, A., Courcoux, P. and Tompkins , L. (1988) Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter j ej uni . J. Bacteriol . 170 : 1704-1708.

Laemmli, U.K. and Favre, M. (1973) Maturation of the head of bacteriophage T4. J. Mol . Biol . 80 : 575-599.

Laperche, Y., Bulle, F., Aissani, T., M.-N., C, Aggerbeck, M. , Hanoune, J. and Guellaen, G. (1986) Molecular cloning of rat kidney gamma-glutamyl transpeptidase cDNA. Proc . Natl . Acad . Sci . USA 83 : 937-941.

Lee, A., O'Rourke, J., Corazon De Ungria, M., Robertson, B., Daskalopoulos, G. and Dixon, M.F. (1997) A standardized mouse model of Helicobacter pylori infection: introducing the Sydney Strain. Gastroenterology 112 : 1386-1397.

Meister, A. (1973) On the enzymology of amino acid transport. Sci ence 180 : 33-39.

Meister, A. and Anderson, M.E. (1983) Glutathione. Ann. Rev. Biochem . 52 : 711-760.

Meister, A. and Tate, S. (1985) g-glutamyl transpeptidase from kidney. Methods. Enzymol . 113 : 400-419.

Mineyama, R., Mikami , K. and Saito, K. (1995) Partial purification and some properties of g-glutamyl peptide- dhydrolysing enzyme from Actinobacillus actinomycetemcomi tans . Microbios 82 : 7-19.

Nakayama, R. , Kumagai, H. and Tochikura, T. (1984a) Leakage of glutathione from bacterial cells caused by inhibition of γ- glutamyltranspeptidase. Appl . Environ Microbiol . 47 : 653- 657.

Nakayama, R. , Kumagai, H. and Tochikura, T. (1984b) Purification and proterties of g-glutamyltranspeptidase from Proteus mirabilis . J. Bacteriol . 160 : 341_346.

Orlowski, M. and Meister, A. (1963) Gamma-glutamyl-p- nitroanilide : a new convenient substrate for determination and study of L- and D-gamma-glutamyltranspeptidase activities. Biochem . Biophys . Acta 73 : 679-681. Orlowski, M. and Mester, A. (1970) The g-glutamyl cycle: a possible transport system for amino acids. Proc . Nat . Acad. Sci . 67 : 1248-1255.

Papandrikopoulou, A., Frey, A. and Gassen, H.G. (1989) Cloning and expression of gamma-glu amyl transpeptidase from isolated porcine brain capillaries. Eur. J. Biochem . 183 : 693-698.

Parsonnet, J., Friedman, G.D., Vandersteed, D.P., Chang, Y., Vogelman, J.H., Orentreich, N. and Sibley, R.K. (1991) Helicobacter pylori infection and the risk of gastric cancer. N. Engl . J. Med . 325 : 1127-1129.

Parsonnet, J., Hansen, S., Rodriguez, L., Gelb, A.B., Warnke, R.A. , Jellum, E., Orentreich, N., Vogelman, J.H. and Friedman, G.D. (1994) Heli cobacter pylori infection and gastric lymphoma. N. Engl . J. Med . 330 : 1267-1271.

Paster, B.J., Lee, A., Fox, J.G., Dewhirst, F.E., Tordoff, L.A. ,

Fraser, G.J., O'Rourke, J.L., Taylor, Ν.S. and Ferrero, R.

(1991) Phylogeny of Helicobacter felis , sp . nov.,

Heli cobacter mustelae, and related bacteria. Int . J.

System . Bacteriol . 41 : 31-38.

Riou, J.Y., Buissiere, J., Richard, C. and Guibourdenche , M. (1982) Interet de la recherche de la g-glutamyl-transferase chez les Neisseriaceae . Ann . Microbiol . (Inst . Pasteur) 133A : 387-392.

Robins, R. and Davies, D. (1981) The role of glutathione in amino-acid absorption. Biochem . J. 194 : 63-70. Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual . Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc . Natl . Acad . Sci . USA 74 : 5463-5467.

Susuki, H., Hashimoto, W. and Kumagai, H. (1993) Escherichia coli K-12 can utilize an exogenous g-glutamyl peptide as an amino acid source, for which g-glutamyltranspeptidase is essential. J^". Bacteriol . 175 : 6038-6040.

Susuki, H., Kumagai, H. and Tochikura, T. (1986) g- glutamyltranspeptidase from Escherichia coli K-12: formation and localization. J. Bacteriol . 168 : 1332-1335.

Susuki, H., Kumagai, H. and Tochikura, T. (1987) Isolation, genetic mapping, and characterisation of Escherichia coli K-12 mutants lacking g-glutamyltranspeptidase. J. Bacteriol . 169 : 3926-3931.

Suzuki, H., Hashimoto, W. and Kumagai, H. (1993) Escherichia coli K-12 can utilize an exogenous g-glutamyl peptide as a amino source, for which g-glutamyltranspeptidase is essentiel. J^". Bacteriol . 175 : 6038-6040.

Suzuki, H., Kumagai, H. , Echigo, T. and Tochikura, T. (1989) DNA sequence of the Escheri chia coli K-12 g- glutamyltranspeptidase gene, ggt . J. Bacteriol . 171 : 5169- 5172. Suzuki, H., Kumagai, H. and Tochikura, T. (1986) g- glutamyltranspeptidase from Escherichia coli K-12: purification and properties. J. Bacteriol . 168 : 1332-1335.

Tate, S. and Meister, A. (1981) g-glutamyl transpeptidase: catalytic, structural and functional aspects. Mol . Cell . Bioch . 39 : 357-368.

Tomb, J.-F., White, 0., Kerlavage, A.R., Clayton, R.A. , Sutton, G.G., Fleischmann, R.D., Ketchum, K.A. , Klenk, H.P., Gill, S., Dougherty, B.A., Nelson, K. , Quackenbush, J., Zhou, L. , Kirkness, E.F., Peterson, S., Loftus, B., Richardson, D., Dodson, R. , Khalak, H.G., Globek, A., McKenney, K. , Fitzegerald, L.M. , Lee, N. , Adams, M.D. , Hickey, E.K., Berg, D.E., Gocayne, J.D., Utterback, T.R., Peterson, J.D., Kelley, J.M. , Cotton, M.D., Weidman, J.M. , Fuji, C, Bowman, C, Watthey, L., Wallin, E., Hayes, W.S., Borodovsky, M. , Karp, P.D., Smith, H.O., Fraser, CM. and Venter, J.C. (1997) The complete genome sequence of the gastric pathogen Heli cobacter pylori . Nature 388 : 539-547.

World Health Organization (1994) Schistosomes, liver flukes and Helicobacter pylori . IARC monographs on the evaluation of carcinogenic risks to humans. 61 : 177-240.

Xu, K. and Strauch, M.A. (1996) Identification, sequence, and expression of the gene encoding g-glutamyltranspeptidase in Bacillus εubtilis . J. Bacteriol . 178 : 4319-4322. Yanisch-Perron, C, Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequence of M13mpl8 and pUC19 vectors. Gene 33 : 103-119.

Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

Claims

CLAIMS We claim:

1. A purified polynucleotide of Helicobacter comprising a coding sequence selected from the group consisting of: a) a sequence coding for a protein carrying transfer catalytic activity; b) a sequence coding for a protein carrying ╬│-glutamyl residues transfer activity or its fragment; and c) a sequence which hybridizes with the approximately 2kb nucleotide sequence inserted m plasmid pILL308.

2. The purified polynucleotide of Heli cobacter according to claim 1, wherein the enzyme activity is detected m Heli cobacter strains.

3. The purified polynucleotide of Helicobacter according to claim 1 comprising the restriction map represented m Figure 3.

4. A fragment of polynucleotide obtainable by restriction enzyme from the polynucleotide according to claim 1.

5. A purified polynucleotide comprising a coding sequence selected from the group of : a) a sequence coding for a protein carrying transfer catalytic activity; and b) a sequence coding for a protein carrying ╬│-glutamyl residues transfer activity such as is expressed by Helicobacter pyl ori .

6. A purified polynucleotide according to anyone of claims 1 to 5 that is modified by deletion, addition, substitution, or inversion of one or more nucleotides such that the functional properties of the protein encoded in these modified sequences is either conserved, attenuated, or deleted, as compared with the properties of the protein ╬│- glutamyltranspeptidase as expressed by H. pylori .

7. A sequence of nucleotides according to anyone of claims 1 to 5 that hybridizes with a nucleotide sequence generated by gene amplification of the chromosome using nucleotides primers selected from the group consisting of: primer sequence I of Figure 2 (oligo I) ; primer sequence II of Figure 2 (oligo I reverse) ; primer sequence III of Figure 2 (oligo II); primer sequence IV of Figure 2; and chains of nucleotides that are complementary to said primer sequence I, II, III, or IV.

8. A purified polynucleotide comprising a chain of nucleotides according to claim 7, or at least a part of this chain that is able to recognize unequivocally the presence of a sequence according to claim 1.

9. A purified polynucleotide according to anyone of claims 1 to 7, comprising a coding and a regulatory region necessary for the production of a protein or a peptide selected from the group consisting of: a) a protein or peptide carrying transfer catalytic activity; b) a protein or peptide carrying ╬│-glutamyl residues transfer activity; and c) any fragments of a) or b) that form an immunological complex with antibodies against the protein carrying transfer catalytic activity as expressed by H. pylori , or against fragments of this protein.

10. A recombinant vector, plasmid, or phage or virus cosmid, capable of transforming an appropriate host cell, comprising a polynucleotide according to anyone of claims 1 to 9, optionally under the control of regulatory elements allowing the expression of the polynucleotide in the host cell.

11. Plasmid pILL308 carried by the strain of E . coli deposited at the CNCM under No. 1-1775 on October 16, 1996.

12. A microorganism strain transformed with at least one vector according to any one of claims 10 or 11 or with a polynucleotide according to anyone of claims 1 to 9.

13. A protein or peptide selected from the group consisting Of: a) a protein or peptide carrying transfer catalytic activity of the type detected in H. pylori and its peptide fragments which correspond, according to the universal genetic code, to the polynucleotide according to claim 1; and b) a protein or peptide carrying ╬│-glutamyl residues transfer activity, of the type detected m H. pylori and its peptide fragments which correspond, according to the universal genetic code, to the polynucleotide according to claim 1.

14. A protein or peptide carrying transfer catalytic activity, of the type expressed m H. pylori , obtained by a) transformation of host cells with a recombinant vector according to claim 10 or 11; b) culturmg the transformed host cells an appropriate environment; and c) recovering ╬│-glutamyltranspeptidase from these cells or directly from the culture medium.

15. A polyclonal or monoclonal antibody directed against all or part of the protein or the peptide or its fragments, according to claim 13 or claim 14.

16. A probe for the detection of H. pylori comprising a polynucleotide according to anyone of claims 1 to 9.

17. A probe for the detection of H. pylori comprising at least one polynucleotide according to claim 7.

18. A process for m vi tro screening of the possible presence of H. pylori m a biological sample likely to contain H. pylori , comprising the steps of: a) optionally amplifying a sequence according to anyone of claims 1 to 9 likely to be contained in the sample by means of primers likely to be linked respectively, on the one hand, to 5' of a strand of the said polynucleotide and, on the other hand, to 3' end of the other strand of the said polynucleotide; b) contacting the biological sample with a probe according to claim 16 or 17 in conditions allowing the production of a hybridization complex formed between said probe and said polynucleotide; and c) detecting the hybridization complex.

19. A process for in vi tro screening of the possible presence of H. pylori in a sample likely to contain H. pylori , comprising : a) contacting the sample with an antibody according to claim 15, in conditions allowing the production of an immunological complex formed between the protein carrying transfer catalytic activity or ╬│-glutamyl residues transfer activity produced by H. pylori and this antibody; and b) detecting the immunological complex.

20. A kit for in vi tro screening of the possible presence of H. pylori in a sample, comprising: a) a given quantity of a nucleotide probe according to claim 16 or 17; b) an appropriate medium for the formation of a hybridization reaction between the sequence to be detected and the aforementioned probe; and c) a reagent allowing the detection of hybridization complexes formed between the polynucleotide and the probe during the hybridization reaction.

21. A kit for in vi tro screening for the possible presence of H. pylori in a sample, comprising a) a given quantity of an antibody according to claim 15; b) an appropriate environment for the formation of an immunological reaction between at least a part of a protein carrying transfer catalytic activity or ╬│-glutamyl residues transfer activity produced by a strain of H. pylori , and the antibody; and c) a reagent allowing the detection of immunological complexes formed between at least a part of a protein and the antibody during the immunological reaction.

22. A method of amplifying DNA, comprising providing two sequences of nucleotides of approximately at least 20 nucleotides according to anyone of claims 1 to 9, that are approximately 200 to 250 nucleotides apart, wherein one of the two sequences attaches to the 5 ' end of a strand of the sequence to be amplified, and the other sequence attaches to the 3 ' end of the other strand.

23. A pharmaceutical composition comprising one or more antibodies according to claim 15 m association with a pharmaceutical acceptable vehicle.

24. An immunogenic composition comprising all or part of a protein carrying transfer catalytic activity or ╬│-glutamyl residues transfer activity according to claim 13 or claim 14, in association with a pharmaceutical acceptable vehicle.

25. An immunogenic composition comprising all or part of a protein carrying transfer catalytic activity, or ╬│-glutamyl residues transfer activity according to claim 13 or claim 14, m association with a mixture of antigens of H. pylori capable of eliciting antibodies recognized by H. pylori , wherein the mixture of antigens comprises all or part of UreB, HspA, or UreB and HspA, or polypeptides having at least 75% and preferably 80 or 90% identity with said Ure B or HspA.

26. An immunogenic composition containing as an active compound the protein according to claim 13 or claim 14, or a fragment of said protein capable of inducing antibodies which recognize H. pylori or induce an immune cellular response, or a purified polynucleotide according to anyone of claims 1 to 9 or a vector according to claim 10 or 11.

27. A method of detecting H. pylori comprising contacting a probe according to claim 16 or claim 17 that allows detection in all the H. pylori strains with a biological sample possibly containing H. pylori .

28. A protein or peptide according to claim 13 or claim 14, wherein the C-terminal domains of the putative large subunit corresponding to amino acids 311 to 401 and of the putative small subunit corresponding to amino acids 501 to 615 are species specific .

29. A recombinant polypeptide comprising the large subunit or the small subunit according to claim 28.

30. A polyclonal or monoclonal antibody, directed against all or part of the sequence determined by the amino acids situated at C-terminal domains at position 311 to 401 equivalent to the large subunit or at position 501 to 615 equivalent to the small subunit according to claim 28.

31. A peptide signal sequence comprising the following amino acid sequence:

MRRSFLKTIG LGVIALSLGL LSPLSA

32. A hybrid molecule comprising a nucleotide sequence encoding the peptide signal sequence of claim 31 and a foreign peptide sequence.

33. A mutated or attenuated H. pylori strain, wherein said strain is mutated in the ggt gene by insertion of a gene encoding a heterologous epitope into said ggt gene.

34. A purified 53 kDa protein of Helicobacter corresponding to a ╬│-glutamyl transferase enzyme.

35. A purified protein according to claim 34, wherein said protein is obtainable from H. pylori .

36. A process of preparation of a protein according to claim 34 or claim 35 comprising culturing a host containing the plasmid pILL308 or a derivative thereof.

37. A method of immunizing animals or humans comprising administration of the purified polynucleotide according to claim 1.

38. A method of immunizing animals or humans comprising administration of a vector according to claim 10 or a plasmid according to claim 11.

39. A method for screening molecules capable of specifically inhibiting the activity of Helicobacter GGT without inhibiting or interacting with the activity of human or animal GGT comprising the steps of:

(a) contacting a parental Helicobacter with a test molecule in a biological sample;

(b) testing the capacity of said test molecule to inhibit the catalytic activity of Heli cobacter GGT;

(c) testing the capacity of said test molecule to inhibit the catalytic activity of a purified human or animal GGT in a biological sample; and

(d) selecting said test molecule that inhibits the activity of Heli cobacter GGT but does not inhibit human or animal GGT.

40. The method according to claim 39, wherein the Heli cobacter strain is selected from the group consisting of Helicobacter pylori , Helicobacter felis, Helicobacter helmannii , Helicobacter mustalae, Helicobacter canis, Helicobacter bilis, and Helicobacter hepati cus .

41. A molecule capable of inhibiting the enzymatic activity of the ╬│-glutamyltranspeptidase of Helicobacter GGT without inhibiting or interacting with the activity of host.

42. The molecule according to claim 41, where in the GGT is selected from the group consisting of Helicojbacter pylori , Helicobacter felis, Helicobacter helmannii , Helicobacter mu╬╡talae, Helicobacter cani╬╡, Helicobacter bilis, and Helicobacter hepaticu╬╡ .

43. A pharmaceutical composition comprising a molecule according to claim 41 or claim 42.

44. A method .of treating or preventing H. pylori infection comprising the steps of administering a pharmaceutically effective dose of the composition according to claim 43, or the molecule according to claim 41 or claim 42.