US20030069404A1 - Helicobacter antigens and corresponding DNA fragments - Google Patents

Helicobacter antigens and corresponding DNA fragments Download PDF

Info

Publication number
US20030069404A1
US20030069404A1 US10/013,315 US1331501A US2003069404A1 US 20030069404 A1 US20030069404 A1 US 20030069404A1 US 1331501 A US1331501 A US 1331501A US 2003069404 A1 US2003069404 A1 US 2003069404A1
Authority
US
United States
Prior art keywords
amino acid
seq
ending
beginning
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/013,315
Inventor
Rainer Haas
Harold Kleanthous
Thomas Meyer
Stefan Odenbreit
Amal Al-Garawi
Charles Miller
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/013,315 priority Critical patent/US20030069404A1/en
Publication of US20030069404A1 publication Critical patent/US20030069404A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/121—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Helicobacter (Campylobacter) (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to Helicobacter antigens and corresponding DNA molecules, which can be used in methods to prevent and treat Helicobacter infection in mammals, such as humans.
  • H. pylori is the species most commonly associated with human infection
  • H. heilmanii and H. felis have also been isolated from humans, but at lower frequencies than H. pylori.
  • Helicobacter infects over 50% of adult populations in developed countries and nearly 100% in developing countries and some Pacific rim countries, making it one of the most prevalent infections worldwide.
  • H. pylori is now recognized as an important pathogen of humans, in that the chronic gastritis it causes is a risk factor for the development of peptic ulcer diseases and gastric carcinoma. It is thus highly desirable to develop safe and effective vaccines for preventing and treating Helicobacter infection.
  • HCV antigens have been characterized or isolated. These include urease, which is composed of two structural subunits of approximately 30 and 67 kDa (Hu et al., Infect. Immun. 58:992, 1990; Dunn et al., J. Biol. Chem. 265:9464, 1990; Evans et al., Microbial Pathogenesis 10:15, 1991; Labigne et al., J. Bact., 173:1920, 1991); the 87 kDa vacuolar cytotoxin (VacA) (Cover et al., J. Biol. Chem. 267:10570, 1992; Phadnis et al., Infect. Immun.
  • urease which is composed of two structural subunits of approximately 30 and 67 kDa (Hu et al., Infect. Immun. 58:992, 1990; Dunn et al., J. Biol. Chem. 265:9464, 1990; Evans et al.
  • urease is believed to be a vaccine candidate (WO 94/9823; WO 95/22987; WO 95/3824; Michetti et al., Gastroenterology 107:1002, 1994). Nevertheless, it is contemplated that several antigens may ultimately be necessary in a vaccine.
  • the present invention provides DNA molecules that encode Helicobacter polypeptides designated HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9, which can be used in methods to prevent, treat, and diagnose Helicobacter infection.
  • the encoded polypeptides include polypeptides having the amino acid sequences shown in SEQ ID NOs:2 to 48 (even numbers) and polypeptides encoded by DNA inserts found in deposited plasmids (see below, e.g., Example 2).
  • the invention also includes DNA molecules that encode mutants and derivatives of such polypeptides, which result from the addition, deletion, or substitution of non-essential amino acids as described herein.
  • the invention also includes RNA molecules corresponding to the DNA molecules of the invention.
  • the invention includes the corresponding polypeptides and monospecific antibodies that specifically bind to such polypeptides.
  • the present invention has wide application and includes expression cassettes, vectors, and cells transformed or transfected with the polynucleotides of the invention. Accordingly, the present invention provides (i) a method for producing a polypeptide of the invention in a recombinant host system and related expression cassettes, vectors, and transformed or transfected cells; (ii) a live vaccine vector, such as a pox virus, Salmonella typhimurium, or Vibrio cholerae vector, containing a polynucleotide of the invention, such vaccine vectors being useful for, e.g., preventing and treating Helicobacter infection, in combination with a diluent or carrier, and related pharmaceutical compositions and associated therapeutic and/or prophylactic methods; (iii) a therapeutic and/or prophylactic method involving administration of an RNA or DNA molecule of the invention, either in a naked form or formulated with a delivery vehicle, a polypeptide or combination of polypeptides, or a monospecific
  • FIG. 1A is a diagrammatic representation of transposon TnMax9, which is a derivative of the TnMax transposon system (Haas et al., Gene 130:23-21, 1993).
  • the mini-transposon carries the blaM gene, which is the ⁇ -lactamase gene lacking a promoter and a signal sequence, next to the inverted repeats (IR) and the M13 forward (M13-FP) and reverse (M13-RP1) primer binding sites.
  • the resolution site (res) and an origin of replication (ori fd ) are located between the blaM gene and the constitutive cat GC -resistance gene.
  • transposase tnpA and resolvase tnpR genes are located outside of the mini-transposon and are under the control of the inducible P trc promoter.
  • the lacIq gene encodes the Lac repressor.
  • FIG. 1B is a diagrammatic representation of plasmid pMin2.
  • pMin2 contains a multiple cloning site, the tetracycline resistance gene (tet), an origin of transfer (oriT), an origin of replication (ori ColE1 ), a transcriptional terminator (t fd ), and a weak, constitutive promoter (P iga ).
  • tet tetracycline resistance gene
  • oriT origin of transfer
  • ori ColE1 origin of replication
  • t fd transcriptional terminator
  • P iga weak, constitutive promoter
  • FIGS. 2 A- 2 E are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO76 (SEQ ID NO:36).
  • FIGS. 3 A- 3 D are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO15 (SEQ ID NO:12).
  • FIGS. 4 A- 4 F are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO42 (SEQ ID NO:18).
  • FIGS. 5 A- 5 D are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO50 (SEQ ID NO:22).
  • FIGS. 6 A- 6 H are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO54 (SEQ ID NO:24).
  • FIGS. 7 A- 7 G are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO57 (SEQ ID NO:26).
  • FIGS. 8 A- 8 G are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO64 (SEQ ID NO:30).
  • ORFs open reading frames encoding full length, membrane-associated secreted/excreted polypeptides
  • These polypeptides include membrane polypeptides permanently found in the membrane structure and polypeptides that are present in the external vicinity of the membrane. These polypeptides can be used in vaccination methods for preventing and treating Helicobacter infection.
  • the ORFs encode secreted polypeptides that can be readily produced in their mature form (polypeptides exported through class II or III secretion pathway) or are initially produced as precursors including a signal peptide that can be removed in the course of excretion/secretion by cleavage at the N-terminal end of the mature form.
  • the cleavage site is located at the C-terminal end of the signal peptide, adjacent to the mature form.
  • these cleavage sites and accordingly the first amino acid of the mature polypeptides were putatively determined.
  • isolated polynucleotides encoding the precursor and mature forms of Helicobacter HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9.
  • An isolated polynucleotide of the invention encodes (i) a polypeptide having an amino acid sequence that is homologous to a Helicobacter amino acid sequence of a polypeptide associated with the Helicobacter membrane, the Helicobacter amino acid sequence being selected from the group consisting of:
  • isolated polynucleotide is defined as a polynucleotide removed from the environment in which it naturally occurs.
  • a naturally-occurring DNA molecule present in the genome of a living bacteria or as part of a gene bank is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated.
  • an isolated DNA molecule is free from DNA regions (e.g., coding regions) with which it is immediately contiguous at the 5′ or 3′ end, in the naturally occurring genome.
  • Such isolated polynucleotides could be part of a vector or a composition and still be isolated in that such a vector or composition is not part of its natural environment.
  • a polynucleotide of the invention can be in the form of RNA or DNA (e.g., cDNA, genomic DNA, or synthetic DNA), or modifications or combinations thereof.
  • the DNA can be double-stranded or single-stranded, and, if single-stranded, can be the coding strand or the non-coding (anti-sense) strand.
  • sequence that encodes a polypeptide of the invention as shown in SEQ ID NOs:2 to 48 (even numbers), or encoded by a deposited DNA molecule can be (a) the coding sequence as shown in SEQ ID NOs:1 to 47 (odd numbers), (b) the coding sequence of a deposited DNA molecule of the invention (see below); (c) a ribonucleotide sequence derived by transcription of (a) or (b); or (d) a different coding sequence; this latter, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptides as the DNA molecules of which the nucleotide sequences are illustrated in SEQ ID NOs:1 to 47 (odd numbers) or the deposited DNA molecules of the invention.
  • the polypeptide is naturally secreted or excreted by Helicobacter felis, H. mustelae, H. heilmanii, or H. pylori; the latter being preferred.
  • polypeptide or “protein” is meant any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation). Both terms are used interchangeably in the present application.
  • homologous amino acid sequence is meant an amino acid sequence that differs from an amino acid sequence shown in SEQ ID NOs:2-48 (even numbers) or encoded by a deposited DNA molecule of the invention, only by one or more conservative amino acid substitutions, or by one or more non-conservative amino acid substitutions, deletions, or additions located at positions at which they do not destroy the specific antigenicity of the polypeptide.
  • such a sequence is at least 75%, more preferably 80%, and most preferably 90% identical to an amino acid sequence shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention.
  • homologous amino acid sequences include sequences that are identical or substantially identical to an amino acid sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention.
  • amino acid sequence substantially identical is meant a sequence that is at least 90%, preferably 95%, more preferably 97%, and most preferably 99% identical to an amino acid sequence of reference and that preferably differs from the sequence of reference, if at all, by a majority of conservative amino acid substitutions.
  • Conservative amino acid substitutions typically include substitutions among amino acids of the same class. These classes include, for example, amino acids having uncharged polar side chains, such as asparagine, glutamine, serine, threonine, and tyrosine; amino acids having basic side chains, such as lysine, arginine, and histidine; amino acids having acidic side chains, such as aspartic acid and glutamic acid; and amino acids having nonpolar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and cysteine.
  • amino acids having uncharged polar side chains such as asparagine, glutamine, serine, threonine, and tyrosine
  • amino acids having basic side chains such as lysine, arginine, and histidine
  • amino acids having acidic side chains such as aspartic acid and glutamic acid
  • amino acids having nonpolar side chains
  • the lysine in position 96 can be substituted with asparagine, glutamine, isoleucine, threonine, glutamic acid, or arginine; the asparagines in positions 120 and 123 can be substituted with isoleucine, threonine, lysine, serine, tyrosine, or asparagine; the lysines in positions 125, 128, and 144 can be substituted with asparagine, glutamine, isoleucine, threonine, glutamic acid, or arginine; or the proline in position 150 can be substituted with serine, threonine, alanine, leucine, arginine, or histidine.
  • the leucine in position 115 can be substituted with phenylalanine, isoleucine, valine, proline, histidine, or arginine.
  • the arginine in position 107 can be substituted with glycine, the asparagine in position 118 can be substituted with isoleucine, threonine, or serine; or the proline in position 130 can be substituted with serine, threonine, alanine, leucine, arginine, or histidine.
  • the asparagine in position 17 can be substituted with isoleucine, threonine, or serine.
  • the asparagine in position 17 can be , substituted with isoleucine, threonine, or serine.
  • the asparagine in position 33 can be substituted with isoleucine, threonine, or serine, and the phenylalanine in position 128 can be substituted with serine, tyrosine, or cysteine.
  • the glutamine in position 10 can be substituted with leucine, proline, or arginine; the leucine in position 26 can be substituted with phenylalanine, and the arginine in position 127 can be substituted with glycine.
  • Homology is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Similar amino acid sequences are aligned to obtain the maximum degree of homology (i.e., identity). To this end, it may be necessary to artificially introduce gaps into the sequence. Once the optimal alignment has been set up, the degree of homology (i.e., identity) is established by recording all of the positions in which the amino acids of both sequences are identical, relative to the total number of positions.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705
  • homologous polynucleotide sequences are defined in a similar way.
  • a homologous sequence is one that is at least 45%, more preferably 60%, and most preferably 85% identical to (i) a coding sequence of SEQ ID NOs:1 to 47 (odd numbers), or (ii) a coding sequence of a deposited DNA molecule of the invention.
  • Polypeptides having a sequence homologous to one of the sequences shown in SEQ ID NOs:2 to 48 (even numbers), include naturally-occurring allelic variants, as well as mutants or any other non-naturally occurring variants that are analogous in terms of antigenicity, to a polypeptide having a sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention.
  • an allelic variant is an alternate form of a polypeptide that is characterized as having a substitution, deletion, or addition of one or more amino acids that does not alter the biological function of the polypeptide.
  • biological function is meant the function of the polypeptide in the cells in which it naturally occurs, even if the function is not necessary for the growth or survival of the cells.
  • the biological function of a porin is to allow the entry into cells of compounds present in the extracellular medium.
  • the biological function is distinct from the antigenic function.
  • a polypeptide can have more than one biological function.
  • Allelic variants are very common in nature.
  • a bacterial species e.g., H. pylori
  • H. pylori is usually represented by a variety of strains that differ from each other by minor allelic variations.
  • a polypeptide that fulfills the same biological function in different strains can have an amino acid sequence that is not identical in each of the strains.
  • Such an allelic variation may be equally reflected at the polynucleotide level.
  • allelic variants of polypeptide antigens comes from, e.g., studies of the Helicobacter urease antigen.
  • the amino acid sequence of Helicobacter urease varies widely from species to species, yet cross-species protection occurs, indicating that the urease molecule, when used as an immunogen, is highly tolerant of amino acid variations. Even among different strains of the single species H. pylori, there are amino acid sequence variations.
  • UreA+UreB apoenzyme expressed from pORV214 (UreA and UreB sequences differ from H. pylori strain CPM630 by one and two amino acid changes, respectively; Lee et al., supra, 1995); a UreA-glutathione-S-transferase fusion protein (UreA sequence from H. pylori strain ATCC 43504; Thomas et al., Acta Gastro-Enterologica Belgica, 56:54, September 1993); UreA+UreB holoenzyme purified from H.
  • pylori strain NCTC11637 (Marchetti et al., Science 267:1655-1658, 1995); a UreA-MBP fusion protein (UreA from H. pylori strain 85P; Ferrero et al., Infection and Immunity 62:4981-4989, 1994); a UreB-MBP fusion protein (UreB from H. pylori strain 85P; Ferrero et al., supra); a UreA-MBP fusion protein (UreA from H. felis strain ATCC 49179; Ferrero et al., supra); a UreB-MBP fusion protein (UreB from H.
  • Polynucleotides e.g., DNA molecules, encoding allelic variants can easily be retrieved by polymerase chain reaction (PCR) amplification of genomic bacterial DNA extracted by conventional methods.
  • PCR polymerase chain reaction
  • Suitable primers can be designed according to the nucleotide sequence information provided in SEQ ID NOs:1 to 47 (odd numbers).
  • a primer can consist of 10 to 40, preferably 15 to 25 nucleotides.
  • primers containing C and G nucleotides in a proportion sufficient to ensure efficient hybridization; e.g., an amount of C and G nucleotides of at least 40%, preferably 50% of the total nucleotide amount.
  • primers useful for cloning by PCR a DNA molecule encoding a polypeptide having the amino acid sequence of HPO76 (SEQ ID NO:36), or encoded by the corresponding deposited DNA molecule (pMin2/76; HPO76, ATCC Deposit Number 98197), are shown in SEQ ID NO:83 (matching at the 5′ end) and in SEQ ID NO:84 (matching at the 3′ end).
  • SEQ ID NO:83 matching at the 5′ end
  • SEQ ID NO:84 matching at the 3′ end.
  • the first aspect of the invention includes (i) isolated DNA molecules that can be amplified and/or cloned by polymerase chain reaction from a Helicobacter, e.g., H. pylori, genome, using either:
  • N denotes a restriction site that contains, typically, 4 to 6 nucleotides. Restriction sites can be selected by those skilled in the art so that the amplified DNA can be conveniently cloned into an appropriately digested plasmid.
  • Useful homologs that do not naturally occur can be designed using known methods for identifying regions of an antigen that are likely to be tolerant of amino acid sequence changes and/or deletions. For example, sequences of the antigen from different species can be compared to identify conserved sequences.
  • Polypeptide derivatives that are encoded by polynucleotides of the invention include, e.g., fragments, polypeptides having large internal deletions derived from full-length polypeptides, and fusion proteins.
  • Polypeptide fragments of the invention can be derived from a polypeptide having a sequence homologous to any of the sequences shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention (see below, e.g., Example 2), to the extent that the fragments retain the substantial antigenicity of the parent polypeptide (specific antigenicity).
  • Polypeptide derivatives can also be constructed by large internal deletions that remove a substantial part of the parent polypeptide, while retaining specific antigenicity.
  • polypeptide derivatives should be about at least 12 amino acids in length to maintain antigenicity.
  • they can be at least 20 amino acids, preferably at least 50 amino acids, more preferably at least 75 amino acids, and most preferably at least 100 amino acids in length.
  • polypeptide derivatives e.g., polypeptide fragments
  • polypeptide fragments can be designed using computer-assisted analysis of amino acid sequences in order to identify sites in protein antigens having potential as surface-exposed, antigenic regions (Hughes et al., Infect. Immun. 60(9):3497, 1992).
  • FIGS. 2 to 8 are graphs showing some of the physical properties of polypeptides HPO76 (SEQ ID NO:36), HPO15 (SEQ ID NO:12), HPO42 (SEQ ID NO:18), HPO50 (SEQ ID NO:22), HPO54 (SEQ ID NO:24), HPO57 (SEQ ID NO:26), and HPO64 (SEQ ID NO:30).
  • the graphs were prepared using the Laser Gene Program from DNA Star, and include, e.g., hydrophilicity, antigenic index, and intensity index plots.
  • spots showing homologies with known protein motifs such as the T-cell recognition motif and the major histocompatibility complex (MHC) IA and IE regions of mice.
  • MHC major histocompatibility complex
  • One skilled in the art can readily use the information provided in such plots to select peptide fragments for use as vaccine antigens. For example, fragments spanning regions of the plots in which the antigenic index is relatively high can be selected. One can also select fragments spanning regions in which both the antigenic index and the intensity plots are relatively high. Fragments containing conserved sequences, particularly hydrophilic conserved sequences, can also be selected.
  • Polypeptide fragments and polypeptides having large internal deletions can be used for revealing epitopes that are otherwise masked in the parent polypeptide and that may be of importance for inducing a protective T cell-dependent immune response. Deletions can also remove immunodominant regions of high variability among strains.
  • Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions can be constructed using standard methods (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994), for example, by PCR, including inverse PCR, by restriction enzyme treatment of the cloned DNA molecules, or by the method of Kunkel et al. (Proc. Natl. Acad. Sci. U.S.A. 82:448, 1985; biological material available at Stratagene).
  • a polypeptide derivative can also be produced as a fusion polypeptide that contains a polypeptide or a polypeptide derivative of the invention fused, e.g., at the N- or C-terminal end, to any other polypeptide (hereinafter referred to as a peptide tail).
  • a peptide tail any other polypeptide (hereinafter referred to as a peptide tail).
  • Such a product can be easily obtained by translation of a genetic fusion, i.e., a hybrid gene.
  • Vectors for expressing fusion polypeptides are commercially available, such as the pMal-c2 or pMal-p2 systems of New England Biolabs, in which the peptide tail is a maltose binding protein, the glutathione-S-transferase system of Pharmacia, or the His-Tag system available from Novagen. These and other expression systems provide convenient means for further purification of polypeptides and derivatives of the invention.
  • fusion polypeptides included in invention includes a polypeptide or polypeptide derivative of the invention fused to a polypeptide having adjuvant activity, such as, e.g., subunit B of either cholera toxin or E. coli heat-labile toxin.
  • a polypeptide having adjuvant activity such as, e.g., subunit B of either cholera toxin or E. coli heat-labile toxin.
  • the polypeptide of the invention can be fused to the N-, or preferably, to the C-terminal end of the polypeptide having adjuvant activity.
  • a polypeptide fragment of the invention can be fused within the amino acid sequence of the polypeptide having adjuvant activity.
  • the polynucleotides of the invention encode Helicobacter polypeptides in precursor or mature form. They can also encode hybrid precursors containing heterologous signal peptides, which can mature into polypeptides of the invention.
  • heterologous signal peptide is meant a signal peptide that is not found in the naturally-occurring precursor of a polypeptide of the invention.
  • a polynucleotide of the invention hybridizes, preferably under stringent conditions, to a polynucleotide having a sequence as shown in SEQ ID NOs:1 to 47 (odd numbers) or to an insert of a deposited DNA molecule (see below, e.g., Example 2).
  • Hybridization procedures are, e.g., described in Ausubel et al., supra; Silhavy et al. (Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, 1984); Davis et al. (A Manual for Genetic Engineering: Advanced Bacterial Genetics, Cold Spring Harbor Laboratory Press, 1980).
  • hybridization temperature is approximately 20 to 40° C., 20 to 25° C., or, preferably 30 to 40° C. below the calculated Tm.
  • stringent conditions can be achieved, both for pre-hybridizing and hybridizing incubations, (i) within 4-16 hours at 42° C., in 6 ⁇ SSC containing 50% formamide or (ii) within 4-16 hours at 65° C. in an aqueous 6 ⁇ SSC solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)).
  • Tm 4 ⁇ (G+C)+2(A+T).
  • G+C the formula for calculating the Tm
  • Plasmids containing nucleic acids encoding HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9 were deposited in E. coli strain DH5 ⁇ under the Budapest Treaty, with the American Type Culture Collection (ATCC; Rockville, Md.) on Oct. 9, 1996 and were designated with accession numbers listed below in Example 2.
  • plasmids were derived from pMin2 by insertion of a genomic DNA BglII-ClaI fragment from H. pylori strain P1 or P12 into the vector. Each of the inserts is disrupted by the presence of transposon TnMax9 (Kahrs et al., Gene 167:53, 1995).
  • HPO101 (497-498), HPO104 (428-429), HPO116 (433-444), HPO121 (463-464), HPO132 (408-409), HPO18 (226-227), HPO38 (347-348), HPO42 (372-373), HPO45 (299-300), HPO50 (29-293), HPO54 (351-352), HPO57 (266-267), HPO58 (434-435), HPO64 (224-225), HPO70 (114-115), HPO71 (274-275), HPO76 (412-413), HPO7 (349-350), HPO80 (105-106), HPO87 (26-27), HPO95 (64-65), HPO98 (43-44), and HPO9 (346-347).
  • DNA molecules lacking the transposon can be amplified from the plasmids using standard PCR techniques, including inverse and recombinant PCR (see, e.g., PCR protocols: A Guide to Methods and Applications (1990) Innis et al., Eds., Academic Press), so that the full-length H. pylori insert is reconstituted.
  • a polynucleotide molecule of the invention can have various applications.
  • a DNA molecule can be used (i) in a process for producing the encoded polypeptide in a recombinant host system, (ii) in the construction of vaccine vectors such as pox viruses, which are further used in methods and compositions for preventing and/or treating Helicobacter infection, (iii) as a vaccine agent (as well as an RNA molecule), in a naked form or formulated with a delivery vehicle and, (iv) in the construction of attenuated Helicobacter strains that can over-express a polynucleotide of the invention or express it in a non-toxic, mutated form.
  • an expression cassette containing a DNA molecule of the invention placed under the control of the elements required for expression, in particular under the control of an appropriate promoter; (ii) an expression vector containing an expression cassette of the invention; (iii) a procaryotic or eucaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, as well as (iv) a process for producing a polypeptide or polypeptide derivative encoded by a polynucleotide of the invention, which involves culturing a procaryotic or eucaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, under conditions that allow expression of the DNA molecule of the invention and, recovering the encoded polypeptide or polypeptide derivative from the cell culture.
  • a recombinant expression system can be selected from procaryotic and eucaryotic hosts.
  • Eucaryotic hosts include yeast cells (e.g., Saccharomyces cerevisiae or Pichia Pastoris ), mammalian cells (e.g., COS1, NIH3T3, or JEG3 cells), arthropods cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells.
  • yeast cells e.g., Saccharomyces cerevisiae or Pichia Pastoris
  • mammalian cells e.g., COS1, NIH3T3, or JEG3 cells
  • arthropods cells e.g., Spodoptera frugiperda (SF9) cells
  • plant cells e.g., a procaryotic host such as E. coli is used.
  • Bacterial and eucaryotic cells are available from a number of different sources to those skilled in the art, e.g., the
  • the choice of the expression system depends on the features desired for the expressed polypeptide. For example, it may be useful to produce a polypeptide of the invention in a particular lipidated form or any other form.
  • an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary, a region encoding a signal peptide, e.g., a lipidation signal peptide; a DNA molecule of the invention; a stop codon; and optionally a 3′ terminal region (translation and/or transcription terminator).
  • ATG start codon
  • the signal peptide-encoding region is adjacent to the polynucleotide of the invention and placed in proper reading frame.
  • the signal peptide-encoding region can be homologous or heterologous to the DNA molecule encoding the mature polypeptide and can be specific to the secretion apparatus of the host used for expression.
  • the open reading frame constituted by the DNA molecule of the invention, solely or together with the signal peptide, is placed under the control of the promoter so that transcription and translation occur in the host system.
  • Promoters, signal peptide encoding regions are widely known and available to those skilled in the art and includes, for example, the promoter of Salmonella typhimurium (and derivatives) that is inducible by arabinose (promoter araB) and is functional in Gram-negative bacteria such as E. coli (as described in U.S. Pat. No.
  • the expression cassette is typically part of an expression vector, which is selected for its ability to replicate in the chosen expression system.
  • Expression vectors e.g., plasmids or viral vectors
  • Expression vectors can be chosen from those described in Pouwels et al. (Cloning Vectors: A Laboratory Manual 1985, Supp. 1987). They can be purchased from various commercial sources.
  • a recombinant polypeptide of the invention (or a polypeptide derivative) is produced and remains in the intracellular compartment, is secreted/excreted in the extracellular medium or in the periplasmic space, or is embedded in the cellular membrane.
  • the polypeptide can then be recovered in a substantially purified form from the cell extract or from the supernatant after centrifugation of the recombinant cell culture.
  • the recombinant polypeptide can be purified by antibody-based affinity purification or by any other method that can be readily adapted by a person skilled in the art, such as by genetic fusion to a small affinity binding domain.
  • Antibody-based affinity purification methods are also available for purifying a polypeptide of the invention extracted from a Helicobacter strain. Antibodies useful for purifying by immunoaffinity the polypeptides of the invention can be obtained as described below.
  • a polynucleotide of the invention can also be useful in the vaccine field, e.g., for achieving DNA vaccination.
  • a viral or bacterial host as gene delivery vehicle (live vaccine vector) or administering the gene in a free form, e.g., inserted into a plasmid.
  • Therapeutic or prophylactic efficacy of a polynucleotide of the invention can be evaluated as described below.
  • a vaccine vector such as a pox virus, containing a DNA molecule of the invention, placed under the control of elements required for expression;
  • a method for inducing an immune response against Helicobacter in a mammal e.g., a human; alternatively, the method can be used in veterinary applications for treating or preventing Helicobacter infection of animals, e.g., cats or birds), which involves administering to the mammal an immunogenically effective amount of a vaccine vector of the invention to elicit an immune response, e.g., a protective or therapeutic immune response to Helicobacter; and particularly, (v) a method for preventing and/or treating a Helicobacter
  • the third aspect of the invention encompasses the use of a vaccine vector of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection.
  • a vaccine vector of the invention can express one or several polypeptides or derivatives of the invention, as well as at least one additional Helicobacter antigen such as a urease apoenzyme or a subunit, fragment, homolog, mutant, or derivative thereof.
  • it can express a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), which enhances the immune response (adjuvant effect).
  • a vaccine vector can include an additional DNA molecule encoding, e.g., urease subunit A, B, or both, or a cytokine, placed under the control of elements required for expression in a mammalian cell.
  • composition of the invention can include several vaccine vectors, each of them being capable of expressing a polypeptide or derivative of the invention.
  • a composition can also contain a vaccine vector capable of expressing an additional Helicobacter antigen such as urease apoenzyme, a subunit, fragment, homolog, mutant, or derivative thereof; or a cytokine such as IL-2 or IL-12.
  • a vaccine vector of the invention can be administered by any conventional route in use in the vaccine field, particularly, to a mucosal (e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route.
  • a mucosal e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract
  • parenteral e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal
  • the administration can be achieved in a single dose or repeated at intervals. The appropriate dosage depends on various parameters understood by skilled artisans such as the vaccine vector itself, the route of administration or the condition of the mammal to be vaccinated (weight, age and the like).
  • Live vaccine vectors available in the art include viral vectors such as adenoviruses and pox viruses as well as bacterial vectors, e.g., Shigella, Salmonella, Vibrio cholerae , Lactobacillus, Bacille bilié de Calmette-Guérin (BCG), and Streptococcus.
  • viral vectors such as adenoviruses and pox viruses
  • bacterial vectors e.g., Shigella, Salmonella, Vibrio cholerae , Lactobacillus, Bacille bilié de Calmette-Guérin (BCG), and Streptococcus.
  • adenovirus vector An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, are described in U.S. Pat. No. 4,920,209.
  • Pox virus vectors that can be used include, e.g., vaccinia and canary pox virus, described in U.S. Pat. Nos. 4,722,848 and 5,364,773, respectively (also see, e.g., Tartaglia et al., Virology 188:217, 1992) for a description of a vaccinia virus vector; and Taylor et al, Vaccine 13:539, 1995, for a reference of a canary pox).
  • Pox virus vectors capable of expressing a polynucleotide of the invention can be obtained by homologous recombination as described in Kieny et al., Nature 312:163, 1984, so that the polynucleotide of the invention is inserted in the viral genome under appropriate conditions for expression in mammalian cells.
  • the dose of vaccine viral vector for therapeutic or prophylactic use, can be of from about 1 ⁇ 10 4 to about 1 ⁇ 10 11 , advantageously from about 1 ⁇ 10 7 to about 1 ⁇ 10 10 , preferably of from about 1 ⁇ 10 7 to about 1 ⁇ 10 9 plaque-forming units per kilogram.
  • viral vectors are administered parenterally; for example, in 3 doses, 4 weeks apart.
  • Non-toxicogenic Vibrio cholerae mutant strains that are useful as a live oral vaccine are described in Mekalanos et al., Nature 306:551, 1983, and U.S. Pat. No. 4,882,278 (strain in which a substantial amount of the coding sequence of each of the two ctxA alleles has been deleted so that no functional cholerae toxin is produced); WO 92/11354 (strain in which the irgA locus is inactivated by mutation; this mutation can be combined in a single strain with ctxA mutations); and WO 94/1533 (deletion mutant lacking functional ctxA and attRS1 DNA sequences).
  • An effective vaccine dose of a Vibrio cholerae strain capable of expressing a polypeptide or polypeptide derivative encoded by a DNA molecule of the invention can contain, e.g., about 1 ⁇ 10 5 to about 1 ⁇ 10 9 , preferably about 1 ⁇ 10 6 to about 1 ⁇ 10 8 viable bacteria in an appropriate volume for the selected route of administration.
  • Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • Attenuated Salmonella typhimurium strains genetically engineered for recombinant expression of heterologous antigens or not, and their use as oral vaccines are described in Nakayama et al. (Bio/Technology 6:693, 1988) and WO 92/11361.
  • Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • polynucleotide of the invention can be inserted into the bacterial genome or can remain in a free state, carried on a plasmid.
  • An adjuvant can also be added to a composition containing a vaccine bacterial vector.
  • a number of adjuvants are known to those skilled in the art. Preferred adjuvants can be selected from the list provided below.
  • a composition of matter containing a polynucleotide of the invention, together with a diluent or carrier containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention
  • a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention
  • a method for inducing an immune response against Helicobacter, in a mammal by administering to the mammal, an immunogenically effective amount of a polynucleotide of the invention to elicit an immune response, e.g., a protective immune response to Helicobacter
  • a method for preventing and/or treating a Helicobacter e.g., H.
  • the fourth aspect of the invention encompasses the use of a polynucleotide of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection.
  • the fourth aspect of the invention preferably includes the use of a DNA molecule placed under conditions for expression in a mammalian cell, e.g., in a plasmid that is unable to replicate in mammalian cells and to substantially integrate in a mammalian genome.
  • Polynucleotides (DNA or RNA) of the invention can also be administered as such to a mammal for vaccine, e.g., therapeutic or prophylactic, purpose.
  • a DNA molecule of the invention can be in the form of a plasmid that is unable to replicate in a mammalian cell and unable to integrate in the mammalian genome.
  • a DNA molecule is placed under the control of a promoter suitable for expression in a mammalian cell.
  • the promoter can function ubiquitously or tissue-specifically. Examples of non-tissue specific promoters include the early Cytomegalovirus (CMV) promoter (described in U.S. Pat. No.
  • the desmin promoter (Li et al., Gene 78:243, 1989, Li et al., J. Biol. Chem. 266:6562, 1991, and Li et al., J. Biol. Chem. 268:10403, 1993) is tissue-specific and drives expression in muscle cells. More generally, useful vectors are described, i.a., WO 94/21797 and Hartikka et al., Human Gene Therapy 7:1205, 1996.
  • the polynucleotide of the invention can encode a precursor or a mature form.
  • the precursor form can be homologous or heterologous.
  • a eucaryotic leader sequence can be used, such as the leader sequence of the tissue-type plasminogen factor (tPA).
  • a composition of the invention can contain one or several polynucleotides of the invention. It can also contain at least one additional polynucleotide encoding another Helicobacter antigen such as urease subunit A, B, or both; or a fragment, derivative, mutant, or analog thereof.
  • a polynucleotide encoding a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) can also be added to the composition so that the immune response is enhanced.
  • IL-2 interleukin-2
  • IL-12 interleukin-12
  • DNA molecules of the invention and/or additional DNA molecules to be included in the same composition can be carried in the same plasmid.
  • Standard techniques of molecular biology for preparing and purifying polynucleotides can be used in the preparation of polynucleotide therapeutics of the invention.
  • a polynucleotide of the invention can be formulated according to various methods.
  • a polynucleotide can be used in a naked form, free of any delivery vehicles, such as anionic liposomes, cationic lipids, microparticles, e.g., gold microparticles, precipitating agents, e.g., calcium phosphate, or any other transfection-facilitating agent.
  • the polynucleotide can be simply diluted in a physiologically acceptable solution, such as sterile saline or sterile buffered saline, with or without a carrier.
  • the carrier preferably is isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as provided by a sucrose solution, e.g., a solution containing 20% sucrose.
  • a polynucleotide can be associated with agents that assist in cellular uptake. It can be, i.a., (i) complemented with a chemical agent that modifies the cellular permeability, such as bupivacaine (see, e.g., WO 94/16737), (ii) encapsulated into liposomes, or (iii) associated with cationic lipids or silica, gold, or tungsten microparticles.
  • bupivacaine see, e.g., WO 94/16737
  • encapsulated into liposomes or iii) associated with cationic lipids or silica, gold, or tungsten microparticles.
  • liposomes are well known in the art (see, e.g., Liposomes: A Practical Approach, RPC New Ed, IRL press (1990), for a detailed description of methods for making liposomes) and are useful for delivering a large range of products, including polynucleotides.
  • Cationic lipids are also known in the art and are commonly used for gene delivery.
  • Such lipids include LipofectinTM also known as DOTMA (N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB (dimethyldioctadecylammonium bromide), DOGS (dioctadecylamidologlycyl spermine) and cholesterol derivatives such as DC-Chol (3 beta-(N-(N′,N′-dimethyl aminomethane)-carbamoyl) cholesterol).
  • DC-Chol beta-(N-(N′,N′-dimethyl aminomethane)-carbamoyl) cholesterol
  • Cationic lipids for gene delivery are preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine), as, for example, described in WO 90/11092.
  • DOPE dioleyl phosphatidylethanolamine
  • transfection-facilitating compounds can be added to a formulation containing cationic liposomes.
  • a number of them are described in, e.g., WO 93/18759, WO 93/19768, WO 94/25608, and WO 95/2397. They include, i.a., spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO 93/18759) and membrane-permeabilizing compounds such as GALA, Gramicidine S, and cationic bile salts (see, for example, WO 93/19768).
  • Gold or tungsten microparticles can also be used for gene delivery, as described in WO 91/359, WO 93/17706, and Tang et al. (Nature 356:152, 1992).
  • the microparticle-coated polynucleotides can be injected via intradermal or intraepidermal routes using a needleless injection device (“gene gun”), such as those described in U.S. Pat. Nos. 4,945,050, 5,015,580, and WO 94/24263.
  • the amount of DNA to be used in a vaccine recipient depends, e.g., on the strength of the promoter used in the DNA construct, the immunogenicity of the expressed gene product, the condition of the mammal intended for administration (e.g., the weight, age, and general health of the mammal), the mode of administration, and the type of formulation.
  • a therapeutically or prophylactically effective dose from about 1 ⁇ g to about 1 mg, preferably, from about 10 ⁇ g to about 800 ⁇ g and, more preferably, from about 25 ⁇ g to about 250 ⁇ g, can be administered to human adults.
  • the administration can be achieved in a single dose or repeated at intervals.
  • the route of administration can be any conventional route used in the vaccine field.
  • a polynucleotide of the invention can be administered via a mucosal surface, e.g., an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface; or via a parenteral route, e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal, or intramuscular route.
  • the choice of the administration route will depend on, e.g., the formulation that is selected.
  • a polynucleotide formulated in association with bupivacaine is advantageously administered into muscles.
  • the formulation can be advantageously injected via intravenous, intranasal (aerosolization), intramuscular, intradermal, and subcutaneous routes.
  • a polynucleotide in a naked form can advantageously be administered via the intramuscular, intradermal, or sub-cutaneous routes.
  • such a composition can also contain an adjuvant.
  • a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferable such as, e.g., QS21, which is described in U.S. Pat. No. 5,057,546.
  • nucleotide probe or primer having a sequence found in or derived by degeneracy of the genetic code from a sequence shown in SEQ ID NO:1 to 47 (odd numbers).
  • probe refers to DNA (preferably single stranded) or RNA molecules (or modifications or combinations thereof) that hybridize under the stringent conditions, as defined above, to nucleic acid molecules having sequences homologous to those shown in SEQ ID NOs:1 to 47 (odd numbers), or to a complementary or anti-sense sequence.
  • probes are significantly shorter than full-length sequences shown in SEQ ID NOs:1 to 47 (odd numbers); for example, they can contain from about 5 to about 100, preferably from about 10 to about 80 nucleotides.
  • probes have sequences that are at least 75%, preferably at least 85%, more preferably 95% homologous to a portion of a sequence as shown in SEQ ID NOs:1 to 47 (odd numbers) or that are complementary to such sequences.
  • Probes can contain modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, or diamino-2,6-purine. Sugar or phosphate residues can also be modified or substituted.
  • a deoxyribose residue can be replaced by a polyamide (Nielsen et al., Science 254:1497, 1991) and phosphate residues can be replaced by ester groups such as diphosphate, alkyl, arylphosphonate and phosphorothioate esters.
  • ester groups such as diphosphate, alkyl, arylphosphonate and phosphorothioate esters.
  • the 2′-hydroxyl group on ribonucleotides can be modified by including, e.g., alkyl groups.
  • Probes of the invention can be used in diagnostic tests, as capture or detection probes.
  • capture probes can be conventionally immobilized on a solid support, directly or indirectly, by covalent means or by passive adsorption.
  • a detection probe can be labeled by a detection marker selected from radioactive isotopes; enzymes such as peroxidase, alkaline phosphatase, and enzymes able to hydrolyze a chromogenic, fluorogenic, or luminescent substrate; compounds that are chromogenic, fluorogenic, or luminescent; nucleotide base analogs; and biotin.
  • Probes of the invention can be used in any conventional hybridization technique, such as dot blot (Maniatis et al., Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), Southern blot (Southern, J. Mol. Biol. 98:503, 1975), northern blot (identical to Southern blot to the exception that RNA is used as a target), or the sandwich technique (Dunn et al., Cell 12:23, 1977).
  • the latter technique involves the use of a specific capture probe and/or a specific detection probe with nucleotide sequences that at least partially differ from each other.
  • a primer is usually a probe of about 10 to about 40 nucleotides that is used to initiate enzymatic polymerization of DNA in an amplification process (e.g., PCR), in an elongation process, or in a reverse transcription method. In a diagnostic method involving PCR, primers can be labeled.
  • the invention also encompasses (i) a reagent containing a probe of the invention for detecting and/or identifying the presence of Helicobacter in a biological material; (ii) a method for detecting and/or identifying the presence of Helicobacter in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA or RNA is extracted from the material and denatured, and (c) exposed to a probe of the invention, for example, a capture, detection probe or both, under stringent hybridization conditions, such that hybridization is detected; and (iii) a method for detecting and/or identifying the presence of Helicobacter in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA is extracted therefrom, (c) the extracted DNA is primed with at least one, and preferably two, primers of the invention and amplified by polymerase chain reaction, and (d) the amplified DNA fragment is produced.
  • polypeptides that can be produced upon expression of the newly identified open reading frames are useful vaccine agents.
  • a sixth aspect of the invention features a substantially purified polypeptide or polypeptide derivative having an amino acid sequence encoded by a polynucleotide of the invention.
  • a “substantially purified polypeptide” is defined as a polypeptide that is separated from the environment in which it naturally occurs and/or that is free of the majority of the polypeptides that are present in the environment in which it was synthesized.
  • a substantially purified polypeptide is free from cytoplasmic polypeptides.
  • a substantiall purified polypeptide can be, for example, at least 60%, 70%, 80%, 90%, 95%, or 100% pure, with respect to, for example, other Helicobacter components.
  • the polypeptides of the invention can be purified from a natural source, i.e., a Helicobacter strain, or can be produced by recombinant means.
  • Homologous polypeptides or polypeptide derivatives encoded by polynucleotides of the invention can be screened for specific antigenicity by testing cross-reactivity with an antiserum raised against the polypeptide of reference having an amino acid sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by one of the deposited DNA molecules.
  • an antiserum raised against the polypeptide of reference having an amino acid sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by one of the deposited DNA molecules.
  • a monospecific hyperimmune antiserum can be raised against a purified reference polypeptide as such or as a fusion polypeptide, for example, an expression product of MBP, GST, or His-tag systems or a synthetic peptide predicted to be antigenic.
  • the homologous polypeptide or derivative screened for specific antigenicity can be produced as such or as a fusion polypeptide. In this latter case and if the antiserum is also raised against a fusion polypeptide, two different fusion systems are employed. Specific antigenicity can be determined according to a number of methods, including Western blot (Towbin et al., Proc. Natl. Acad. Sci. U.S.A. 76:4350, 1979), dot blot, and ELISA, as described below.
  • the product to be screened is submitted to SDS-Page electrophoresis as described by Laemmli (Nature 227:680, 1970).
  • SDS-Page electrophoresis as described by Laemmli (Nature 227:680, 1970).
  • the material is further incubated with the monospecific hyperimmune antiserum diluted in the range of dilutions from about 1:50 to about 1:5000, preferably from about 1:100 to about 1:500.
  • Specific antigenicity is shown once a band corresponding to the product exhibits reactivity at any of the dilutions in the above range.
  • the product to be screened is preferably used as the coating antigen.
  • a purified preparation is preferred, although a whole cell extract can also be used. Briefly, about 100 ⁇ l of a preparation at about 10 ⁇ g protein/ml are distributed into wells of a 96-well polycarbonate ELISA plate. The plate is incubated for 2 hours at 37° C. then overnight at 4° C. The plate is washed with phosphate buffer saline (PBS) containing 0.05% Tween 20 (PBS/Tween buffer). The wells are saturated with 250 ⁇ l PBS containing 1% bovine serum albumin (BSA) to prevent non-specific antibody binding.
  • PBS phosphate buffer saline
  • BSA bovine serum albumin
  • a purified product is preferred, although a whole cell extract can also be used.
  • a solution of the product at about 100 ⁇ g/ml is serially two-fold diluted in 50 mM Tris-HCl (pH 7.5). 100 ⁇ l of each dilution are applied to a nitrocellulose membrane 0.45 ⁇ m set in a 96-well dot blot apparatus (Biorad). The buffer is removed by applying vacuum to the system. Wells are washed by addition of 50 mM Tris-HCl (pH 7.5) and the membrane is air-dried.
  • the membrane is saturated in blocking buffer (50 mM Tris-HCl (pH 7.5) 0.15 M NaCl, 10 ⁇ g/L skim milk) and incubated with an antiserum dilution from about 1:50 to about 1:5000, preferably about 1:500.
  • the reaction is revealed according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when rabbit antibodies are used. Incubation is carried out 90 minutes at 37° C. and the blot is washed. The reaction is developed with the appropriate substrate and stopped. The reaction is measured visually by the appearance of a colored spot, e.g., by colorimetry. Under the above experimental conditions, a positive reaction is shown once a colored spot is associated with a dilution of at least about 1:50, preferably of at least about 1:500.
  • Therapeutic or prophylactic efficacy of a polypeptide or derivative of the invention can be evaluated as described below.
  • a composition of matter containing a polypeptide of the invention together with a diluent or carrier in particular, (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polypeptide of the invention; (iii) a method for inducing an immune response against Helicobacter in a mammal, by administering to the mammal an immunogenically effective amount of a polypeptide of the invention to elicit an immune response, e.g., a protective immune response to Helicobacter; and particularly, (iv) a method for preventing and/or treating a Helicobacter (e.g., H. pylori, H.
  • a Helicobacter e.g., H. pylori, H.
  • the seventh aspect of the invention encompasses the use of a polypeptide of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection.
  • the immunogenic compositions of the invention can be administered by any conventional route in use in the vaccine field, in particular to a mucosal (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route.
  • a mucosal adjuvant e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract
  • parenteral e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal
  • the choice of the administration route depends upon a number of parameters, such as the adjuvant associated with the polypeptide. For example, if a mucosal adjuvant is used, the intranasal or oral route will be preferred and if a lipid formulation or an aluminum compound
  • a composition of the invention can contain one or several polypeptides or derivatives of the invention. It can also contain at least one additional Helicobacter antigen such as the urease apoenzyme or a subunit, fragment, homolog, mutant, or derivative thereof.
  • a polypeptide or derivative thereof can be formulated into or with liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like-particles (VLPs) to facilitate delivery and/or enhance the immune response.
  • liposomes preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like-particles (VLPs) to facilitate delivery and/or enhance the immune response.
  • Adjuvants other than liposomes and the like can also be used and are known in the art. An appropriate selection can conventionally be made by those skilled in the art, for example, from the list provided below.
  • Administration can be achieved in a single dose or repeated as necessary at intervals as can be determined by one skilled in the art.
  • a priming dose can be followed by three booster doses at weekly or monthly intervals.
  • An appropriate dose depends on various parameters including the recipient (e.g., adult or infant), the particular vaccine antigen, the route and frequency of administration, the presence/absence or type of adjuvant, and the desired effect (e.g., protection and/or treatment), as can be determined by one skilled in the art.
  • a vaccine antigen of the invention can be administered by a mucosal route in an amount from about 10 ⁇ g to about 500 mg, preferably from about 1 mg to about 200 mg.
  • the dose usually should not exceed about 1 mg, preferably about 100 ⁇ g.
  • polynucleotides and polypeptides of the invention can be used sequentially as part of a multistep immunization process.
  • a mammal can be initially primed with a vaccine vector of the invention such as a pox virus, e.g., via the parenteral route, and then boosted twice with the polypeptide encoded by the vaccine vector, e.g., via the mucosal route.
  • liposomes associated with a polypeptide or derivative of the invention can also be used for priming, with boosting being carried out mucosally using a soluble polypeptide or derivative of the invention in combination with a mucosal adjuvant (e.g., LT).
  • a mucosal adjuvant e.g., LT
  • a polypeptide derivative of the invention is also useful as a diagnostic reagent for detecting the presence of anti-Helicobacter antibodies, e.g., in a blood sample.
  • Such polypeptides are about 5 to about 80, preferably about 10 to about 50 amino acids in length and can be labeled or unlabeled, depending upon the diagnostic method. Diagnostic methods involving such a reagent are described below.
  • a polypeptide or polypeptide derivative Upon expression of a DNA molecule of the invention, a polypeptide or polypeptide derivative is produced and can be purified using known laboratory techniques.
  • the polypeptide or polypeptide derivative can be produced as a fusion protein containing a fused tail that facilitates purification.
  • the fusion product can be used to immunize a small mammal, e.g., a mouse or a rabbit, in order to raise antibodies against the polypeptide or polypeptide derivative (monospecific antibodies).
  • the eighth aspect of the invention thus provides a monospecific antibody that binds to a polypeptide or polypeptide derivative of the invention.
  • monospecific antibody an antibody that is capable of reacting with a unique naturally-occuring Helicobacter polypeptide.
  • An antibody of the invention can be polyclonal or monoclonal.
  • Monospecific antibodies can be recombinant, e.g., chimeric (e.g., constituted by a variable region of murine origin associated with a human constant region), humanized (a human immunoglobulin constant backbone together with hypervariable region of animal, e.g., murine, origin), and/or single chain. Both polyclonal and monospecific antibodies can also be in the form of immunoglobulin fragments, e.g., F(ab)′2 or Fab fragments.
  • the antibodies of the invention can be of any isotype, e.g., IgG or IgA, and polyclonal antibodies can be of a single isotype or can contain a mixture of isotypes.
  • the antibodies of the invention which are raised to a polypeptide or polypeptide derivative of the invention, can be produced and identified using standard immunological assays, e.g., Western blot analysis, dot blot assay, or ELISA (see, e.g., Coligan et al., Current Protocols in Immunology (1994) John Wiley & Sons, Inc., New York, N.Y.).
  • the antibodies can be used in diagnostic methods to detect the presence of a Helicobacter antigen in a sample, such as a biological sample.
  • the antibodies can also be used in affinity chromatography methods for purifying a polypeptide or polypeptide derivative of the invention. As is discussed further below, such antibodies can be used in prophylactic and therapeutic passive immunization methods.
  • a ninth aspect of the invention provides (i) a reagent for detecting the presence of Helicobacter in a biological sample that contains an antibody, polypeptide, or polypeptide derivative of the invention; and (ii) a diagnostic method for detecting the presence of Helicobacter in a biological sample, by contacting the biological sample with an antibody, a polypeptide, or a polypeptide derivative of the invention, such that an immune complex is formed, and by detecting such complex to indicate the presence of Helicobacter in the sample or the organism from which the sample is derived.
  • the immune complex is formed between a component of the sample and the antibody, polypeptide, or polypeptide derivative, whichever is used, and that any unbound material can be removed prior to detecting the complex.
  • a polypeptide reagent is useful for detecting the presence of anti-Helicobacter antibodies in a sample, e.g., a blood sample, while an antibody of the invention can be used for screening a sample, such as a gastric extract or biopsy, for the presence of Helicobacter polypeptides.
  • the reagent i.e., the antibody, polypeptide, or polypeptide derivative of the invention
  • a solid support such as a tube, a bead, or any other conventional support used in the field. Immobilization can be achieved using direct or indirect means. Direct means include passive adsorption (non-covalent binding) or covalent binding between the support and the reagent. By “indirect means” is meant that an anti-reagent compound that interacts with a reagent is first attached to the solid support.
  • an antibody that binds to it can serve as an anti-reagent, provided that it binds to an epitope that is not involved in the recognition of antibodies in biological samples.
  • Indirect means can also employ a ligand-receptor system, for example, a molecule such as a vitamin can be grafted onto the polypeptide reagent and the corresponding receptor can be immobilized on the solid phase. This is illustrated by the biotin-streptavidin system.
  • indirect means can be used, e.g., by adding to the reagent a peptide tail, chemically or by genetic engineering, and immobilizing the grafted or fused product by passive adsorption or covalent linkage of the peptide tail.
  • a process for purifying, from a biological sample, a polypeptide or polypeptide derivative of the invention which involves carrying out antibody-based affinity chromatography with the biological sample, wherein the antibody is a monospecific antibody of the invention.
  • the antibody can be polyclonal or monospecific, and preferably is of the IgG type.
  • Purified IgGs can be prepared from an antiserum using standard methods (see, e.g., Coligan et al., supra). Conventional chromatography supports, as well as standard methods for grafting antibodies, are disclosed in, e.g., Antibodies: A Laboratory Manual, D. Lane, E. Harlow, Eds. (1988).
  • a biological sample such as an H. pylori extract, preferably in a buffer solution
  • a chromatography material preferably equilibrated with the buffer used to dilute the biological sample so that the polypeptide or polypeptide derivative of the invention (i.e., the antigen) is allowed to adsorb onto the material.
  • the chromatography material such as a gel or a resin coupled to an antibody of the invention, can be in batch form or in a column.
  • the unbound components are washed off and the antigen is then eluted with an appropriate elution buffer, such as a glycine buffer or a buffer containing a chaotropic agent, e.g., guanidine HCl, or high salt concentration (e.g., 3 M MgCl 2 ).
  • an appropriate elution buffer such as a glycine buffer or a buffer containing a chaotropic agent, e.g., guanidine HCl, or high salt concentration (e.g., 3 M MgCl 2 ).
  • Eluted fractions are recovered and the presence of the antigen is detected, e.g., by measuring the absorbance at 280 nm.
  • an antibody of the invention can be screened for therapeutic efficacy as described as follows.
  • a composition of matter containing a monospecific antibody of the invention together with a diluent or carrier;
  • a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a monospecific antibody of the invention and
  • a method for treating or preventing a Helicobacter e.g., H. pylori, H. felis, H. mustelae, or H. heilmanii
  • the eleventh aspect of the invention encompasses the use of a monospecific antibody of the invention in the preparation of a medicament for treating or preventing Helicobacter infection.
  • the monospecific antibody can be polyclonal or monoclonal, preferably of the IgA isotype (predominantly).
  • the antibody can be administered to a mucosal surface of a mammal, e.g., the gastric mucosa, e.g., orally or intragastrically, advantageously, in the presence of a bicarbonate buffer.
  • systemic administration not requiring a bicarbonate buffer, can be carried out.
  • a monospecific antibody of the invention can be administered as a single active component or as a mixture with at least one monospecific antibody specific for a different Helicobacter polypeptide.
  • the amount of antibody and the particular regimen used can readily be determined by those skilled in the art. For example, daily administration of about 100 to 1,000 mg of antibodies over one week, or three doses per day of about 100 to 1,000 mg of antibodies over two or three days, can be an effective regimens for most purposes.
  • Therapeutic or prophylactic efficacy can be evaluated using standard methods in the art, e.g., by measuring induction of a mucosal immune response or induction of protective and/or therapeutic immunity, using, e.g., the H. felis mouse model and the procedures described in Lee et al. (Eur. J. Gastroenterology and Hepatology 7:303, 1995) or Lee et al. (J. Infect. Dis. 172:161, 1995).
  • the H. felis strain of the model can be replaced with another Helicobacter strain.
  • the efficacy of DNA molecules and polypeptides from H. pylori is preferably evaluated in a mouse model using an H. pylori strain.
  • Protection can be determined by comparing the degree of Helicobacter infection in the gastric tissue (assessed by urease activity, bacterial counts or gastritis) to that of a control group. Protection is shown when infection is reduced by comparison to the control group. Such an evaluation can be made for polynucleotides, vaccine vectors, polypeptides and derivatives thereof, as well as antibodies of the invention.
  • an antibody of the invention can be administered to the gastric mucosa of mice previously challenged with an H. pylori strain, as described, e.g., in Lee et al (supra). Then, after an appropriate period of time, the bacterial load of the mucosa is estimated by assessing the urease activity, as compared to a control. Reduced urease activity indicates that the antibody is therapeutically effective.
  • Adjuvants useful in any of the vaccine compositions described above are as follows.
  • Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxy phosphate.
  • the antigen can be precipitated with, or adsorbed onto, the aluminum compound according to standard protocols.
  • Other adjuvants such as RIBI (ImmunoChem, Hamilton, Mont.), can be used in parenteral administration.
  • Adjuvants for mucosal administration include bacterial toxins, e.g., the cholera toxin (CT), the E. coli heat-labile toxin (LT), the Clostridium difficile toxin A and the pertussis toxin (PT), or combinations, subunits, toxoids, or mutants thereof.
  • CT cholera toxin
  • LT E. coli heat-labile toxin
  • PT pertussis toxin
  • a purified preparation of native cholera toxin subunit B (CTB) can be of use. Fragments, homologs, derivatives, and fusions to any of these toxins are also suitable, provided that they retain adjuvant activity.
  • a mutant having reduced toxicity is used.
  • Suitable mutants are described, e.g., in WO 95/17211 (Arg-7-Lys CT mutant), WO 96/6627 (Arg-192-Gly LT mutant), and WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant).
  • Additional LT mutants that can be used in the methods and compositions of the invention include, e.g., Ser-63-Lys, Ala-69-Gly, Glu-110-Asp, and Glu-112-Asp mutants.
  • Other adjuvants such as a bacterial monophosphoryl lipid A (MPLA) of, e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; saponins, or polylactide glycolide (PLGA) microspheres, can also be used in mucosal administration.
  • MPLA bacterial monophosphoryl lipid A
  • PLGA polylactide glycolide
  • Adjuvants useful for both mucosal and parenteral administrations include polyphosphazene (WO 95/2415), DC-chol (3 ⁇ -(N-(N′,N′-dimethyl aminomethane)-carbamoyl) cholesterol; U.S. Pat. No. 5,283,185 and WO 96/14831) and QS-21 (WO 88/9336).
  • any pharmaceutical composition of the invention containing a polynucleotide, a polypeptide, a polypeptide derivative, or an antibody of the invention, can be manufactured in a conventional manner.
  • it can be formulated with a pharmaceutically acceptable diluent or carrier, e.g., water or a saline solution such as phosphate buffer saline, optionally complemented with a bicarbonate salt, such as sodium bicarbonate, e.g., 0.1 to 0.5 M.
  • Bicarbonate can be advantageously added to compositions intended for oral or intragastric administration.
  • a diluent or carrier can be selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical necessities for their use in pharmaceutical formulations, are described in Remington's Pharmaceutical Sciences, a standard reference text in this field and in the USP/NF.
  • the invention also includes methods in which gastroduodenal infections, such as Helicobacter infection, are treated by oral administration of a Helicobacter polypeptide of the invention and a mucosal adjuvant, in combination with an antibiotic, an antisecretory agent, a bismuth salt, an antacid, sucralfate, or a combination thereof.
  • antibiotics including, e.g., macrolides, tetracyclines, ⁇ -lactams, aminoglycosides, quinolones, penicillins, and derivatives thereof
  • antibiotics include, e.g., amoxicillin, clarithromycin, tetracycline, metronidizole, erythromycin, cefuroxime, and erythromycin
  • antisecretory agents including, e.g., H 2 -receptor antagonists (e.g., cimetidine, ranitidine, famotidine, nizatidine, and roxatidine), proton pump inhibitors (e.g., omeprazole, lansoprazole, and pantoprazole), prostaglandin analogs (e.g., misoprostil and enprostil), and anticholinergic agents (e.g., piren
  • compositions for carrying out these methods i.e., compositions containing a Helicobacter antigen (or antigens) of the invention, an adjuvant, and one or more of the above-listed compounds, in a pharmaceutically acceptable carrier or diluent.
  • Amounts of the above-listed compounds used in the methods and compositions of the invention can readily be determined by those skilled in the art.
  • one skilled in the art can readily design treatment/immunization schedules.
  • the non-vaccine components can be administered on days 1-14
  • the vaccine antigen+adjuvant can be administered on days 7, 14, 21, and 28.
  • Methods and pharmaceutical compositions of the invention can be used to treat or prevent Helicobacter infections and, accordingly, gastroduodenal diseases associated with these infections, including acute, chronic, and atrophic gastritis; and peptic ulcer diseases, e.g., gastric and duodenal ulcers.
  • All twenty-four clones of the invention were isolated by a transposon shuttle mutagenesis method. Briefly, in this method, a TnMax9 mini-blaM transposon was used for insertional mutagenesis of an H. pylori gene library established in E. coli. 192 E. coli clones expressing active ⁇ -lactamase fusion proteins were obtained, indicating that the corresponding target plasmids carry H. pylori genes encoding extracytoplasmic proteins. Individual mutants were transferred onto the chromosome of H. pylori P1 or P12 by natural transformation, resulting in 135 distinct H. pylori mutants. This method is described in further detail, as follows.
  • TnMax9 The transposon TnMax9 (Kahrs et al., Gene 167:53, 1995) was used to generate mutations in an H. pylori library in E. coli. As illustrated in FIG. 1A, TnMax9 contains, in addition to a cat GC -resistance gene close to the inverted repeat (IR), an unexpressed open reading frame encoding ⁇ -lactamase without a promoter or leader sequence (mature ⁇ -lactamase, blaM; Kahrs et al., supra). For production of extracytoplasmic BlaM fusion proteins resulting in ampicillin-resistant (amp R ) clones, expression of the cloned H. pylori genes in E.
  • IR inverted repeat
  • the minimal vector pMin2 (Kahrs et al., supra; see FIG. 1B), containing a weak constitutive promoter (P iga ) upstream of the multiple cloning site, was used for construction of the H. pylori library to ensure expression of H. pylori genes in E. coli.
  • H. pylori DNA was partially digested with Sau3A and HpaII, size fractionated by preparative agarose gel electrophoresis, and 3-6 kb fragments were ligated into the BglII and ClaI sites of pMin2.
  • the library was introduced into E. coli strain E181(pTnMax9), which is a derivative of HB101 containing the TnMax9 transposon, by electroporation. This generated approximately 2,400 independent transformants. More than 95% of the plasmids contained an insert of between 3 and 6 kb, showing that the 1.7 Mb H. pylori chromosome was statistically covered.
  • the library was partitioned into a total of 198 pools (24 pools of 20 clones and 174 pools of 11 clones). Using a cotton swab, either eleven or twenty individual colonies were inoculated in 0.5 ml LB medium in a eppendorf tubes, vortexed, and 100 ml of the suspension was spread on LB agar plates supplemented with tetracycline and chloramphenicol to select for maintenance of both plasmids.
  • IPTG isopropyl-b-D-thiogalactoside
  • TnMax9 To analyze the mutant library, it was determined whether defined gene sequences inactivated by TnMax9 were represented once or several times in the whole library.
  • Five transposon-containing plasmids conferring an amp R phenotype to E145 (pMu7, pMu13, pMu75, pMu94, and pMu110) were randomly selected and DNA fragments flanking the TnMax9 insert were isolated and used as probes in Southern hybridization of 120 amp R clones.
  • the hybridization probes isolated from clones pMu7, pMu75, and pMu94 were between 0.9 and 1.1 kb in size, and hybridized exclusively with the inserts of the homologous plasmids.
  • TnMax9 flanking regions of clones pMu13 and pMu110 were 4.0 kb and 5.5 kb, respectively. They each hybridized with the homologous plasmids, and with one additional clone of the library. Such a result was expected, since the chance of a probe to find a homologous sequence in the library should be higher, the longer the hybridization probes.
  • mutants Two mutants were identified, which no longer produced the cytotoxin antigen (mutants P1-26 and P1-47) and partial DNA sequencing of the insertion sites revealed that TnMax9 was inserted at distinct positions in the vacA gene, 56 and 53 codons downstream of the ATG start codon, respectively.
  • the transformation frequency for a given mutant was calculated as the number of chloramphenicol-, streptomycin-, or erythromycin-resistant colonies per cfu (average of three experiments).
  • the blaM gene was deleted by NotI digestion, and the plasmid religated, in those plasmids that did not transform strain P1 directly. This procedure, which resulted in a twenty to thirty-fold higher frequency of transformation, as compared to the same plasmid containing blaM, resulted in 36 additional mutants strain P1.
  • the blaM-deletion plasmids that still did not transform strain P1 were used to transform the heterologous H. pylori strain P12, possessing an approximately 10-fold higher transformation frequency compared to P1. This resulted in thirteen further mutants.
  • TnMax9-based shuttle mutagenesis of H. pylori Consistent with our previous experience concerning TnMax9-based shuttle mutagenesis of H. pylori, the mini-transposon was, in all cases, inserted into the chromosome without integration of the vector DNA, which probably means by a double cross-over, rather than by a single cross-over event. As judged from the hybridization pattern obtained with the cat gene as a probe, it appears that TnMax9 is located in different regions of the chromosome, showing that distinct target genes have been interrupted in individual mutants.
  • mutants were analyzed for motility, transformation competence, and adherence to KatoIII cells. Screening of the H. pylori mutant collection allowed identification of mutants impaired in motility, natural transformation competence, and adherence to gastric epithelial cell lines. Motility mutants could be grouped into distinct classes: (i) mutants lacking the major flagellin subunit FlaA and intact flagella; (ii) mutants with apparently normal flagella, but reduced motility; and (iii) mutants with obviously normal flagella, but completely abolished motility. Two independent mutations, which exhibited defects in natural competence for genetic transformation, mapped to different genetic loci. In addition, two independent mutants were isolated by their failure to bind to the human gastric carcinoma cell line KatoIII. Both mutants carried a transposon in the same gene, approximately 0.8 kb apart, and showed decrease autoagglutination, when compared to the wild type strain.
  • Example 1 describes isolation of DNA encoding a polypeptide of the invention, HPO76.
  • the methods described in Example 1 can be adapted for isolating nucleic acids encoding the other polypeptides of the invention.
  • Example 2 describes methods for obtaining the nucleic acids of the invention from the deposited clones.
  • the DNA fragment is amplified from genomic DNA, as prepared above, by the Polymerase Chain Reaction (PCR) using the following primers: -N-terminal primer: 5′-GCC[GAGCTC]I TATCGTATGGACTTAGAACAT -3′ (SEQ ID NO:145) -C-terminal primer: 5′-GCC[CTCGAG] ATTAGAATAAGTGTTGTTTAAAATC -3′. (SEQ ID NO:146)
  • Both primers include a clamp (GCC) and a restriction enzyme recognition sequence for cloning purposes (SacI (GAGCTC) and XhoI (CTCGAG) recognition sequences).
  • GCC clamp
  • ScI a restriction enzyme recognition sequence for cloning purposes
  • CCGAG XhoI
  • the underlined sequences in both primers represent clone 76-specific sequences.
  • the N-terminal primer is designed so that the amplified product does not encode the leader sequence and the potential cleavage site.
  • Amplification of gene-specific DNA is carried out using Pwo DNA Polymerase (Boehringer Mannheim), which is a proof-reading polymerase, according to general guidance provided by the manufacturer. Because of the exonuclease activity of the polymerase, two reaction mixtures (mixtures 1 and 2) are first prepared separately and combined just prior to amplification. These mixtures are as follows: Ingredient (final conc.) Mixture 1 (l) Mixture 2 (l) distilled H 2 O 160 79 dNTPs (200 M each) 40 — 10x PCR buffer — 20 primers (100 nM each) 1 — DNA template (200 ng) 2 — as obtained in 1.A.
  • Pwo DNA Polymerase Boehringer Mannheim
  • Amplification is carried out as follows: Number of Cycling conditions Temp. (° C.) Time (min.) cycles Initial denaturing 96 4 1 step Denaturing step 94 0.5 20 Annealing step 50 1 20 Extension step 72 1 20 Final extension step 72 5 1
  • a single PCR product of 522 basepairs is thus amplified and is then digested at 37° C. for 2 hours with SacI and XhoI concurrently in a 20 ⁇ l reaction volume.
  • the digested product is ligated to similarly cleaved pET28a (Novagen) that is dephosphorylated prior to the ligation by treatment with Calf Intestinal Alkaline Phosphatase (CIP).
  • CIP Calf Intestinal Alkaline Phosphatase
  • the ligation reaction (20 ⁇ l) is carried out at 14° C. overnight and then is used to transform 100 ⁇ l fresh E. coli XL1-blue competent cells (Novagen). The cells are incubated on ice for 2 hours, then heat-shocked at 42° C. for 30 seconds, and returned to ice for 90 seconds. The samples are then added to 1 ml LB broth in the absence of selection and grown at 37° C. for 2 hours. The cells are then plated out on LB agar plus kanamycin (50 ⁇ g/ml final concentration) at a 10 ⁇ and neat dilution and incubated overnight at 37° C. The following day, 50 colonies are picked onto secondary plates and incubated at 37° C. overnight.
  • Plasmid DNA is extracted using the Quiagen mini-prep. method and quantitated by agarose gel electrophoresis.
  • PCR is performed with the gene-specific primers under the conditions stated above and transformant DNA is confirmed to contain the desired insert.
  • the cells are grown to an OD 600 of 1.0, a sample is harvested for SDS-PAGE (pre-induction sample), and the remaining culture is induced with 1 mM IPTG.
  • the cultures are grown for 4 hours and samples are taken every hour.
  • the culture is spun in a centrifuge at 6000 ⁇ g for 20 minutes at 4° C. The supernatant is discarded and the pellets are resuspended in 50 ml of cold 50 mM Tris-HCl (pH 8.0), 2 mM EDTA, and spun as is described above. The supernatant is discarded and the cells are stored at ⁇ 70° C.
  • Pellets obtained from a 1 liter culture prepared as described in 1.D. are thawed and resuspended in 20 ml of ice cold 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole. Lysozyme is added to a concentration of 0.1 mg/ml and the suspension is homogenized using a high speed homogenizer (Turrax), and subsequently is treated in a sonicator (Branson, Sonifier 450). To remove DNA, Benzonase (Merck) is used at a final concentration of 1 U/ml.
  • the suspension is centrifuged at 40,000 ⁇ g for 20 minutes and the supernatant is filtered through a 0.45 ⁇ m membrane.
  • the supernatant is loaded onto an IMAC column (12 ml of resin) that has been prepared by immobilizing Ni ++ according to the recommendations of the manufacturer (Pharmacia).
  • the column is washed with 10 column volumes of 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 60 mM Imidazole.
  • the recombinant protein is eluted with 6 volumes of 20 mM Tris-HCl (pH 7.9), 0.5 M NaCl, 500 mM Imidazole, 0.1% Zwittergent 3-14.
  • the elution profile is monitored by measuring the absorbance of the fractions at OD 280 nm. An aliquot of each fraction is analyzed on SDS-PAGE gels and stained with Coomassie blue (Phast System—Pharmacia), and the fractions corresponding to the protein peak are then pooled and concentrated. To remove elution buffer, the fraction is passed over a G25 Sephadex column (Pharmacia), equilibrated in PBS (pH 7.4). The protein solution is filter-sterilized through a 0.45 ⁇ m membrane, and the protein concentration is determined by the BCA micromethod (Pierce). The protein solution is stored at ⁇ 70° C.
  • mice Groups of 8 Swiss-Webster mice (Taconic) are immunized orally with 25 ⁇ g of the purified recombinant protein, admixed with 5 ⁇ g of cholera toxin (Calbiochem) in physiological buffer. Mice are immunized on days 0, 7, 14, and 21. Fourteen days after the last immunization, the mice are challenged with H. pylori strain ORV2001 grown in liquid media (the cells are grown on agar plates as described in 1.1. and, after harvest, the cells are resuspended in Brucella broth; the flasks are incubated overnight at 37° C.). Fourteen days after challenge, the mice are sacrificed and their stomachs are removed. The amount of H. pylori is determined by measuring the urease activity in the stomach and by culture.
  • New Zealand rabbits are injected both subcutaneously and intramuscularly with 100 ⁇ g (in total) of the purified fusion polypeptide as obtained in 1.E., in the presence of Freund's complete adjuvant in a total volume of approximately 2 ml. Twenty-one and 42 days after the initial injection, booster doses, which are identical to priming doses, except that Freund's incomplete adjuvant is used, are administered in the same way. Fifteen days after the last injection, animal serum is recovered, decomplemented, and filtered through a 0.45 ⁇ m membrane.
  • mice are injected subcutaneously with 10-50 ⁇ g of the purified fusion polypeptide as obtained in 1.E., in the presence of Freund's complete adjuvant in a volume of approximately 200 ⁇ l. 7 and 14 days after the initial injection, booster doses, which are identical to priming doses, except that Freund's incomplete adjuvant is used, are administered in the same way. 21 and 28 days after the initial infection, mice receive 50 ⁇ g of the antigen alone intraperitoneally. On day 21, mice are also injected intraperitoneally with sarcoma 180/TG cells CM26684 (Lennette et al., Diagnostic procedures for viral, rickettsial, and chlamydial infections, (1979) 5 th Ed. Washington D.C., American Public Health Association). Ascites are collected 10-13 days after the last injection.
  • An immune serum as prepared in section 1.G. is applied to a protein A Sepharose 4 Fast Flow column (Pharmacia) equilibrated in 100 mM Tris-HCl (pH 8.0). The resin is washed by applying 10 column volumes of 100 mM Tris-HCl and 10 volumes of 10 mM Tris-HCl (pH 8.0) to the column. IgGs are eluted with a 0.1 M glycine buffer (pH 3.0) and are collected as 5 ml fractions to which is added 0.25 ml 1 M Tris-HCl (pH 8.0). The optical density of the eluate is measured at 280 nm and the fractions containing the IgGs are pooled, and, if necessary, stored frozen at ⁇ 70° C.
  • CNBr-activated Sepharose 4B gel (1 g of dried gel provides for approximately 3.5 ml of hydrated gel; gel capacity is of from 5 to 10 mg coupled IgGs per ml of gel) manufactured by Pharmacia (17-0430-01) is suspended in 1 mM HCl buffer and washed with a buchner by adding small quantities of 1 mM HCl buffer. The total volume of buffer is 200 ml per gram of gel.
  • Purified IgGs are dialyzed for 4 hours at 20 ⁇ 5° C. against 50 volumes of 500 mM sodium phosphate buffer (pH 7.5). Then they are diluted in 500 mM phosphate buffer (pH 7.5) to a final concentration of 3 mg/ml.
  • IgGs are incubated with the gel overnight at 5 ⁇ 3° C., under stirring.
  • the gel is packed into a chromatography column and washed with 2 column volumes of 500 mM phosphate buffer (pH 7.5), then 1 volume of 50 mM sodium phosphate buffer, 500 mM NaCl (pH 7.5).
  • the gel is then transferred to a tube and further incubated in 100 mM ethanolamine, (pH 7.5) for 4 hours at room temperature under stirring, then washed twice with 2 column volumes of PBS.
  • the gel is then stored in 1/10,000 PBS merthiolate.
  • the amount of IgGs coupled to the gel is determined by measuring the optical density (OD) at 280 nm of the IgG solution and the direct eluate, plus washings.
  • OD optical density
  • the gel is washed with 2 to 6 volumes of 10 mM sodium phosphate buffer (pH 6.8).
  • the antigen is eluted with 100 mM glycine buffer (pH 2.5).
  • the eluate is recovered in 3 ml fractions to which is added 150 ⁇ l 1 M sodium phosphate buffer (pH 8.0). OD is measured at 280 nm for each fraction; those containing the antigen are pooled and stored at ⁇ 20° C.
  • E. coli strains including plasmids containing nucleic acids encoding HPO76 (98197), HPO18 (98210), HPO121(98201), HPO45 (98208), HPO101(98198), HPO116 (98200), HPO7 (98211), HPO104 (98199), HPO15 (98214), HPO58 (98206), HPO132 (98202), HPO9 (98203), HPO38 (98204), HPO87 (98205), HPO71(98217), HPO70 (98219), HPO80 (98215), HPO95 (98216), HPO98 (98218), HPO57 (98220), HPO50 (98207), HPO64 (98213), HPO54 (98212), and HPO42 (98209) were deposited in E.
  • coli strain DH5 ⁇ under the Budapest Treaty with the American Type Culture Collection (ATCC; Rockville, Md.) on Oct. 9, 1996 and were designated with accession numbers indicated in parentheses above.
  • ATCC American Type Culture Collection
  • These plasmids each contain a genomic DNA BglII-ClaI insert from H. pylori strain P1 or P12 (referred to as 69-A and 888-0 in Haas et al., Mol. Microbiol. 8:753, 1993).
  • Each of the inserts are disrupted by the presence of transposon TnMax9 (Kahrs et al., Gene 167:53, 1995).
  • DNA molecules lacking the transposon can be amplified from the plasmids using standard PCR techniques, such as inverse and recombinant PCR (see, e.g., Innis et al., supra), so that a full-length H. pylori insert is reconstituted.
  • the H. pylori sequences flanking the transposon can each be amplified by PCR, and then ligated together to form the full-length H. pylori gene lacking the transposon.
  • Primers that can be used in these methods for each of the twenty-four clones of the invention are shown in Table 1.
  • a pellet of E. coli expressing HPO76 is homogenized in 5 mM imidazole, 500 mM sodium chloride, 20 mM Tris-HCl (pH 7.9) by microfluidization at a pressure of 15,000 psi, and clarified by centrifugation at 4000-5000 g.
  • the pellet containing cloned protein is suspended in buffer containing 2% N-octyl glucoside (NOG) and is homogenized.
  • NOG N-octyl glucoside
  • the NOG soluble protein is removed by centrifugation.
  • the pellet is extracted one more time with 2% NOG.
  • After centrifugation the pellet is dissolved in 8 M urea.
  • the urea-solubilized protein is diluted with an equal volume of 2 M arginine and dialyzed against 1 M arginine for 24-48 hours to remove urea.
  • the cloned protein remains in solution.
  • SDS-PAGE and Coomassie staining, followed by densitometric scanning shows that the protein is 80-85% pure cloned antigen.
  • the pellet containing cloned protein is solubilized in 6 M guanidine hydrochloride and is passed through an IMAC column charged with Ni ++ .
  • the bound antigen is eluted with 8 M urea (pH 8.5).
  • ⁇ -mercaptoethanol is added to eluted protein to a final concentration of 1 mM, then passed through a Sephadex G-25 column equilibrated in 0.1 M acetic acid. Protein eluted from Sephadex G-25 column is slowly added to 4 volumes of 50 mM phosphate (pH 7.0). The protein remains in solution.
  • Recombinant proteins expressed as Histidine-tagged fusion proteins can be solubilized and purified by using a metal affinity column (nickel column).
  • the bound protein can be eluted with imidazole buffer, with or without urea, or by using low pH buffers, with or without urea.
  • Urea or guanidine hydrochloride-denatured proteins can then be renatured using appropriate renaturing buffers.
  • H. pylori antigens HpaA and clone 76
  • renaturation conditions using arginine hydrochloride (0.25-1 M) have been determined.
  • Recombinant proteins without a His-tag can be solubilized and purified using immunoaffinity, ion-exchange, sizing, and/or hydrophobic chromatography. Proteins expressed as insoluble aggregates in inclusion bodies can be solubilized in denaturing agents, such as 8 M urea or 6 M guanidine hydrochloride. Appropriate folding and renaturation can readily be determined by one skilled in the art.
  • the above pellet containing cloned protein is suspended in 50 mM NaPO 4 (pH 7.5) containing 1% weight/volume N-octyl glucoside (NOG) and mixed vigorously.
  • the NOG soluble impurities are removed by centrifugation.
  • the remaining pellet is extracted one more time with the 1% NOG solution to further remove impurities.
  • the pellet is solubilized in 8 M urea, 50 mM Tris (pH 8.0).
  • the Urea solubilized protein is diluted with an equal volume of 2 M Arginine, 50 mM Tris (pH 8.0), and is dialyzed against 1 M Arginine, 50 mM Tris, 50 mM NaCl (pH 8.0) for 24-48 hours to remove urea.
  • the cloned protein remains in solution following dialysis. SDS-PAGE and Coomassie staining followed by densitometric scanning shows that the protein is 80-85% pure cloned antigen.
  • the N-terminal primer (FC1) is designed to include the ribosome binding site of the target gene (underlined), the ATG start site (bold), and the leader sequence (with cleavage site). It includes a clamp (GCC) at the 5′ most end, and a SacI recognition sequence (GAGCTC) for cloning purposes.
  • the C-terminal primer (RN2) includes an XhoI recognition sequence for cloning purposes, and the natural TAA stop codon (bold).
  • N-terminal primer (FC1) 5′GCC[GAGCTC]C AAG CAAAAAA ATG TCAATTAAAAGGG3′ (SEQ ID NO:)
  • C-terminal primer (RN2) 5′GCC[CTCGAG]GTC TAA ATTAGAATAAGTGTTGTT 3′ (SEQ ID NO:)
  • Amplification of each specified gene can be achieved by employing FC1/RN2 primers for any of the genes described (see Table 1).
  • Amplification of gene-specific DNA is carried out using Pwo DNA Polymerase (Boehringer Mannheim) under the following conditions. Due to the exonuclease activity of the polymerase, two reaction mixtures are prepared separately and combined just prior to amplification.
  • a single PCR product of 624 basepairs is amplified and cloned into SacI-XhoI cleaved pET 24, allowing construction of a transcriptional fusion and expression of HPO76 antigen in the absence of a His-tag.
  • expressed product can be purified as a denatured protein that is re-folded by dialysis into 1 M arginine.
  • Cloning into pET 24 allows transcription from the T7 promoter, supplied by the vector, but relies upon binding of the RNA-specific DNA polymerase to the intrinsic ribosome binding site for HPO76, and thereby expression of the complete ORF.
  • the amplification, restriction, and cloning protocols are as previously described for constructing translational fusions.
  • Prtmer type nt positions Primer sequence (5′-3′) of gene seq.
  • Tm (oC) 76 FC1 304-330 GCC[x] CAAGCAAAAAAATGTCAATTAAAAGGG 27 70 RN1 413-391 TAAGTCCATACGATAGCCTATG 22 62 FC2 404-436 (TATGGAACTTA) GAACATTTTAACACGCTCTATTA 33 60 RN2 927-904 GCC [X] GTCTAAATTAGAATAAGTGTTGTT 24 60 18 FC1 101-124 GCC[X] AATATATGGGAACTTAATGAGAAT 24 60 RN1 227-206 TGCGAGATTTAACCTGTTTTCA 22 60 FC2 218-249 (AAATCTCGCA) GAAATCTTTCACAAGCGAGCAA 32 60 RN2 922-901 GCC [X] ATGTCATGTCAAACTATGAAGC 22 60 121 FC1 141-164 GCC [X] TCACAATGGATAAAAACAACAACA 24 62

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides Helicobacter polypeptides that can be used in vaccination methods for preventing or treating Helicobacter infection, and polynucleotides that encode these polypeptides.

Description

    PRIORITY INFORMATION
  • This application is a continuation of, and claims priority from, U.S. Ser. No. 08/749,051, filed Nov. 14, 1996, which is incorporated by reference herein.[0001]
    • FIELD OF THE INVENTION
  • The invention relates to Helicobacter antigens and corresponding DNA molecules, which can be used in methods to prevent and treat Helicobacter infection in mammals, such as humans. [0002]
    • BACKGROUND OF THE INVENTION
  • Helicobacter is a genus of spiral, gram-negative bacteria that colonize the gastrointestinal tracts of mammals. Several species colonize the stomach, most notably [0003] H. pylori, H. heilmanii, H. felis, and H. mustelae. Although H. pylori is the species most commonly associated with human infection, H. heilmanii and H. felis have also been isolated from humans, but at lower frequencies than H. pylori. Helicobacter infects over 50% of adult populations in developed countries and nearly 100% in developing countries and some Pacific rim countries, making it one of the most prevalent infections worldwide.
  • Helicobacter is routinely recovered from gastric biopsies of humans with histological evidence of gastritis and peptic ulceration. Indeed, [0004] H. pylori is now recognized as an important pathogen of humans, in that the chronic gastritis it causes is a risk factor for the development of peptic ulcer diseases and gastric carcinoma. It is thus highly desirable to develop safe and effective vaccines for preventing and treating Helicobacter infection.
  • A number of Helicobacter antigens have been characterized or isolated. These include urease, which is composed of two structural subunits of approximately 30 and 67 kDa (Hu et al., Infect. Immun. 58:992, 1990; Dunn et al., J. Biol. Chem. 265:9464, 1990; Evans et al., Microbial Pathogenesis 10:15, 1991; Labigne et al., J. Bact., 173:1920, 1991); the 87 kDa vacuolar cytotoxin (VacA) (Cover et al., J. Biol. Chem. 267:10570, 1992; Phadnis et al., Infect. Immun. 62:1557, 1994; WO 93/18150); a 128 kDa immunodominant antigen associated with the cytotoxin (CagA, also called TagA) (WO 93/18150; U.S. Pat. No. 5,403,924); 13 and 58 kDa heat shock proteins HspA and HspB (Suerbaum et al., Mol. Microbiol. 14:959, 1994; WO 93/18150); a 54 kDa catalase (Hazell et al., J. Gen. Microbiol. 137:57, 1991); a 15 kDa histidine-rich protein (Hpn) (Gilbert et al., Infect. Immun. 63:2682, 1995); a 20 kDa membrane-associated lipoprotein (Kostrcynska et al., J. Bact. 176:5938, 1994), an 30 kDa outer membrane protein (Bölin et al., J. Clin. Microbiol. 33:381, 1995); a lactoferrin receptor (FR 2,724,936), and several porins, referred to as HopA, HopB, HopC, HopD, and HopE, which have molecular weights of 48-67 kDa (Exner et al., Infect. Immun. 63:1567, 1995; Doig et al., J. Bact. 177:5447, 1995). [0005]
  • Some of these proteins have been proposed as potential vaccine antigens. In particular, urease is believed to be a vaccine candidate (WO 94/9823; [0006] WO 95/22987; WO 95/3824; Michetti et al., Gastroenterology 107:1002, 1994). Nevertheless, it is contemplated that several antigens may ultimately be necessary in a vaccine.
    • SUMMARY OF THE INVENTION
  • The present invention provides DNA molecules that encode Helicobacter polypeptides designated HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9, which can be used in methods to prevent, treat, and diagnose Helicobacter infection. The encoded polypeptides include polypeptides having the amino acid sequences shown in SEQ ID NOs:2 to 48 (even numbers) and polypeptides encoded by DNA inserts found in deposited plasmids (see below, e.g., Example 2). Those skilled in the art will appreciate that the invention also includes DNA molecules that encode mutants and derivatives of such polypeptides, which result from the addition, deletion, or substitution of non-essential amino acids as described herein. The invention also includes RNA molecules corresponding to the DNA molecules of the invention. [0007]
  • In addition to the DNA and RNA molecules, the invention includes the corresponding polypeptides and monospecific antibodies that specifically bind to such polypeptides. [0008]
  • The present invention has wide application and includes expression cassettes, vectors, and cells transformed or transfected with the polynucleotides of the invention. Accordingly, the present invention provides (i) a method for producing a polypeptide of the invention in a recombinant host system and related expression cassettes, vectors, and transformed or transfected cells; (ii) a live vaccine vector, such as a pox virus, [0009] Salmonella typhimurium, or Vibrio cholerae vector, containing a polynucleotide of the invention, such vaccine vectors being useful for, e.g., preventing and treating Helicobacter infection, in combination with a diluent or carrier, and related pharmaceutical compositions and associated therapeutic and/or prophylactic methods; (iii) a therapeutic and/or prophylactic method involving administration of an RNA or DNA molecule of the invention, either in a naked form or formulated with a delivery vehicle, a polypeptide or combination of polypeptides, or a monospecific antibody of the invention, and related pharmaceutical compositions; (iv) a method for diagnosing the presence of Helicobacter in a biological sample, which can involve the use of a DNA or RNA molecule, a monospecific antibody, or a polypeptide of the invention; and (v) a method for purifying a polypeptide of the invention by antibody-based affinity chromatography.
    •  BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1A is a diagrammatic representation of transposon TnMax9, which is a derivative of the TnMax transposon system (Haas et al., Gene 130:23-21, 1993). The mini-transposon carries the blaM gene, which is the β-lactamase gene lacking a promoter and a signal sequence, next to the inverted repeats (IR) and the M13 forward (M13-FP) and reverse (M13-RP1) primer binding sites. The resolution site (res) and an origin of replication (ori[0010] fd) are located between the blaM gene and the constitutive catGC-resistance gene. The transposase tnpA and resolvase tnpR genes are located outside of the mini-transposon and are under the control of the inducible Ptrc promoter. The lacIq gene encodes the Lac repressor.
  • FIG. 1B is a diagrammatic representation of plasmid pMin2. pMin2 contains a multiple cloning site, the tetracycline resistance gene (tet), an origin of transfer (oriT), an origin of replication (ori[0011] ColE1), a transcriptional terminator (tfd), and a weak, constitutive promoter (Piga). H. pylori chromosome fragments were introduced into the BglII and ClaI sites of pMin2.
  • FIGS. [0012] 2A-2E are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO76 (SEQ ID NO:36).
  • FIGS. [0013] 3A-3D are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO15 (SEQ ID NO:12).
  • FIGS. [0014] 4A-4F are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO42 (SEQ ID NO:18).
  • FIGS. [0015] 5A-5D are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO50 (SEQ ID NO:22).
  • FIGS. [0016] 6A-6H are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO54 (SEQ ID NO:24).
  • FIGS. [0017] 7A-7G are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO57 (SEQ ID NO:26).
  • FIGS. [0018] 8A-8G are a series of graphs showing an analysis of some of the physical properties of polypeptide HPO64 (SEQ ID NO:30).
    • DETAILED DESCRIPTION
  • In the [0019] H. pylori genome, open reading frames (ORFs) encoding full length, membrane-associated secreted/excreted polypeptides have been newly identified. These polypeptides include membrane polypeptides permanently found in the membrane structure and polypeptides that are present in the external vicinity of the membrane. These polypeptides can be used in vaccination methods for preventing and treating Helicobacter infection. The ORFs encode secreted polypeptides that can be readily produced in their mature form (polypeptides exported through class II or III secretion pathway) or are initially produced as precursors including a signal peptide that can be removed in the course of excretion/secretion by cleavage at the N-terminal end of the mature form. (The cleavage site is located at the C-terminal end of the signal peptide, adjacent to the mature form.) In the sequences disclosed in the present application, these cleavage sites and accordingly the first amino acid of the mature polypeptides, were putatively determined.
  • According to a first aspect of the invention, there are provided isolated polynucleotides encoding the precursor and mature forms of Helicobacter HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9. [0020]
  • An isolated polynucleotide of the invention encodes (i) a polypeptide having an amino acid sequence that is homologous to a Helicobacter amino acid sequence of a polypeptide associated with the Helicobacter membrane, the Helicobacter amino acid sequence being selected from the group consisting of: [0021]
  • (a) the amino acid sequences as shown: [0022]
  • in SEQ ID NO:2, beginning with an amino acid in any one of the positions from −27 to 5, preferably in position −27 or [0023] position 1, and ending with an amino acid in position 160 (HPO101);
  • in SEQ ID NO:4, beginning with an amino acid in [0024] position 1 and ending with an amino acid in position 172 (HPO104);
  • in SEQ ID NO:6, beginning with an amino acid in any one of the positions from −17 to 5, preferably in position −17 or [0025] position 1, and ending with an amino acid in position 169 (HPO116);
  • in SEQ ID NO:8, beginning with an amino acid in any one of the positions from −21 to 5, preferably in position −20 or [0026] position 1, and ending with an amino acid in position 198 (HPO121);
  • in SEQ ID NO:10, beginning with an amino acid in any one of the positions from −20 to 5, preferably in position −20 or [0027] position 1, and ending with an amino acid in position 132 (HPO132);
  • in SEQ ID NO:12, beginning with an amino acid in 1 to 5, preferably in [0028] position 1, and ending with an amino acid in position 114 (HPO15);
  • in SEQ ID NO:14, beginning with an amino acid in any one of the positions from −17 to 5, preferably in position −17 or [0029] position 1, and ending with an amino acid in position 248 (HPO18);
  • in SEQ ID NO:16, beginning with an amino acid in any one of the positions from −40 to 5, preferably in position −40 or [0030] position 1, and ending with an amino acid in position 74 (HPO38);
  • in SEQ ID NO:18, beginning with an amino acid in any one of the positions from −34 to 5, preferably in position −34 or [0031] position 1, and ending with an amino acid in position 226 (HPO42);
  • in SEQ ID NO:20, beginning with an amino acid in any one of the positions from −21 to 5, preferably in position −21 or [0032] position 1, and ending with an amino acid in position 179 (HPO45);
  • in SEQ ID NO:22, beginning with an amino acid in any one of the positions from −33 to 5, preferably in position −33 or [0033] position 1, and ending with an amino acid in position 114 (HPO50);
  • in SEQ ID NO:24, beginning with an amino acid in any one of the positions from −60 to 5, preferably in position −60 or [0034] position 1, and ending with an amino acid in position 349 (HPO54);
  • in SEQ ID NO:26, beginning with an amino acid in any one of the positions from −18 to 5, preferably in position −18 or [0035] position 1, and ending with an amino acid in position 288 (HPO57);
  • in SEQ ID NO:28, beginning with an amino acid in any one of the positions from −21 to 5, preferably in position −21 or [0036] position 1, and ending with an amino acid in position 150 (HPO58);
  • in SEQ ID NO:30, beginning with an amino acid in any one of the positions from −20 to 5, preferably in position −20 or [0037] position 1, and ending with an amino acid in position 309 (HPO64);
  • in SEQ ID NO:32, beginning with an amino acid in any one of the positions from −35 to 5, preferably in position −35 or [0038] position 1, and ending with an amino acid in position 129 (HPO70);
  • in SEQ ID NO:34, beginning with an amino acid in any one of the positions from −19 to 5, preferably in position −19 or [0039] position 1, and ending with an amino acid in position 153 (HPO71);
  • in SEQ ID NO:36, beginning with an amino acid in any one of the positions from −25 to 5, preferably in position −25 or [0040] position 1, and ending with an amino acid in position 176 (HPO76);
  • in SEQ ID NO:38, beginning with an amino acid in any one of the positions from −21 to 5, preferably in position −21 or [0041] position 1, and ending with an amino acid in position 156 (HPO7);
  • in SEQ ID NO:40, beginning with an amino acid in [0042] position 1 and ending with an amino acid in position 144 (HPO80);
  • in SEQ ID NO:42, beginning with an amino acid in any one of the positions from −20 to 5, preferably in position −20 or [0043] position 1, and ending with an amino acid in position 152 (HPO87);
  • in SEQ ID NO:44, beginning with an amino acid in any one of the positions from −31 to 5, preferably in position −31 or [0044] position 1, and ending with an amino acid in position 112 (HPO95);
  • in SEQ ID NO:46, beginning with an amino acid in any one of the positions from −20 to 5, preferably in position −20 or [0045] position 1, and ending with an amino acid in position 91 (HPO98);
  • in SEQ ID NO:48, beginning with an amino acid in any one of the positions from −21 to 5, preferably in position −21 or [0046] position 1, and ending with an amino acid in position 129 (HPO9); and
  • (b) the precursor or mature amino acid sequences encoded by the [0047] H. pylori DNA inserts found in American Type Culture Collection deposit numbers HPO76 (98197), HPO18 (98210), HPO121 (98201), HPO45 (98208), HPO101 (98198), HPO116 (98200), HPO7 (98211), HPO104 (98199), HPO15 (98214), HPO58 (98206), HPO132 (98202), HPO9 (98203), HPO38 (98204), HPO87 (98205), HPO71 (98217), HPO70 (98219), HPO80 (98215), HPO95 (98216), HPO98 (98218), HPO57 (98220), HPO50 (98207), HPO64 (98213), HPO54 (98212), and HPO42 (98209); or (ii) a derivative of the polypeptide.
  • The term “isolated polynucleotide” is defined as a polynucleotide removed from the environment in which it naturally occurs. For example, a naturally-occurring DNA molecule present in the genome of a living bacteria or as part of a gene bank is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated. Typically, an isolated DNA molecule is free from DNA regions (e.g., coding regions) with which it is immediately contiguous at the 5′ or 3′ end, in the naturally occurring genome. Such isolated polynucleotides could be part of a vector or a composition and still be isolated in that such a vector or composition is not part of its natural environment. [0048]
  • A polynucleotide of the invention can be in the form of RNA or DNA (e.g., cDNA, genomic DNA, or synthetic DNA), or modifications or combinations thereof. The DNA can be double-stranded or single-stranded, and, if single-stranded, can be the coding strand or the non-coding (anti-sense) strand. The sequence that encodes a polypeptide of the invention as shown in SEQ ID NOs:2 to 48 (even numbers), or encoded by a deposited DNA molecule, can be (a) the coding sequence as shown in SEQ ID NOs:1 to 47 (odd numbers), (b) the coding sequence of a deposited DNA molecule of the invention (see below); (c) a ribonucleotide sequence derived by transcription of (a) or (b); or (d) a different coding sequence; this latter, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptides as the DNA molecules of which the nucleotide sequences are illustrated in SEQ ID NOs:1 to 47 (odd numbers) or the deposited DNA molecules of the invention. [0049]
  • Advantageously, the polypeptide is naturally secreted or excreted by [0050] Helicobacter felis, H. mustelae, H. heilmanii, or H. pylori; the latter being preferred.
  • By “polypeptide” or “protein” is meant any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation). Both terms are used interchangeably in the present application. [0051]
  • By “homologous amino acid sequence” is meant an amino acid sequence that differs from an amino acid sequence shown in SEQ ID NOs:2-48 (even numbers) or encoded by a deposited DNA molecule of the invention, only by one or more conservative amino acid substitutions, or by one or more non-conservative amino acid substitutions, deletions, or additions located at positions at which they do not destroy the specific antigenicity of the polypeptide. [0052]
  • Preferably, such a sequence is at least 75%, more preferably 80%, and most preferably 90% identical to an amino acid sequence shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention. [0053]
  • Homologous amino acid sequences include sequences that are identical or substantially identical to an amino acid sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention. By “amino acid sequence substantially identical” is meant a sequence that is at least 90%, preferably 95%, more preferably 97%, and most preferably 99% identical to an amino acid sequence of reference and that preferably differs from the sequence of reference, if at all, by a majority of conservative amino acid substitutions. [0054]
  • Conservative amino acid substitutions typically include substitutions among amino acids of the same class. These classes include, for example, amino acids having uncharged polar side chains, such as asparagine, glutamine, serine, threonine, and tyrosine; amino acids having basic side chains, such as lysine, arginine, and histidine; amino acids having acidic side chains, such as aspartic acid and glutamic acid; and amino acids having nonpolar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and cysteine. [0055]
  • As an illustration of substitutive variations, particular examples are provided as follows. In the sequence shown in SEQ ID NO:4, the lysine in [0056] position 96 can be substituted with asparagine, glutamine, isoleucine, threonine, glutamic acid, or arginine; the asparagines in positions 120 and 123 can be substituted with isoleucine, threonine, lysine, serine, tyrosine, or asparagine; the lysines in positions 125, 128, and 144 can be substituted with asparagine, glutamine, isoleucine, threonine, glutamic acid, or arginine; or the proline in position 150 can be substituted with serine, threonine, alanine, leucine, arginine, or histidine. In the sequence shown in SEQ ID NO:8, the leucine in position 115 can be substituted with phenylalanine, isoleucine, valine, proline, histidine, or arginine. In the sequence shown in SEQ ID NO:10, the arginine in position 107 can be substituted with glycine, the asparagine in position 118 can be substituted with isoleucine, threonine, or serine; or the proline in position 130 can be substituted with serine, threonine, alanine, leucine, arginine, or histidine. In the sequence shown in SEQ ID NO:12, the asparagine in position 17 can be substituted with isoleucine, threonine, or serine. In the sequence shown in SEQ ID NO:12, the asparagine in position 17 can be , substituted with isoleucine, threonine, or serine. In the sequence shown in SEQ ID NO:40, the asparagine in position 33 can be substituted with isoleucine, threonine, or serine, and the phenylalanine in position 128 can be substituted with serine, tyrosine, or cysteine. In the sequence shown in SEQ ID NO:50, the glutamine in position 10 can be substituted with leucine, proline, or arginine; the leucine in position 26 can be substituted with phenylalanine, and the arginine in position 127 can be substituted with glycine.
  • Homology is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Similar amino acid sequences are aligned to obtain the maximum degree of homology (i.e., identity). To this end, it may be necessary to artificially introduce gaps into the sequence. Once the optimal alignment has been set up, the degree of homology (i.e., identity) is established by recording all of the positions in which the amino acids of both sequences are identical, relative to the total number of positions. [0057]
  • Homologous polynucleotide sequences are defined in a similar way. Preferably, a homologous sequence is one that is at least 45%, more preferably 60%, and most preferably 85% identical to (i) a coding sequence of SEQ ID NOs:1 to 47 (odd numbers), or (ii) a coding sequence of a deposited DNA molecule of the invention. [0058]
  • Polypeptides having a sequence homologous to one of the sequences shown in SEQ ID NOs:2 to 48 (even numbers), include naturally-occurring allelic variants, as well as mutants or any other non-naturally occurring variants that are analogous in terms of antigenicity, to a polypeptide having a sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention. [0059]
  • As is known in the art, an allelic variant is an alternate form of a polypeptide that is characterized as having a substitution, deletion, or addition of one or more amino acids that does not alter the biological function of the polypeptide. By “biologic function” is meant the function of the polypeptide in the cells in which it naturally occurs, even if the function is not necessary for the growth or survival of the cells. For example, the biological function of a porin is to allow the entry into cells of compounds present in the extracellular medium. The biological function is distinct from the antigenic function. A polypeptide can have more than one biological function. [0060]
  • Allelic variants are very common in nature. For example, a bacterial species, e.g., [0061] H. pylori, is usually represented by a variety of strains that differ from each other by minor allelic variations. Indeed, a polypeptide that fulfills the same biological function in different strains can have an amino acid sequence that is not identical in each of the strains. Such an allelic variation may be equally reflected at the polynucleotide level.
  • Support for the use of allelic variants of polypeptide antigens comes from, e.g., studies of the Helicobacter urease antigen. The amino acid sequence of Helicobacter urease varies widely from species to species, yet cross-species protection occurs, indicating that the urease molecule, when used as an immunogen, is highly tolerant of amino acid variations. Even among different strains of the single species [0062] H. pylori, there are amino acid sequence variations.
  • For example, although the amino acid sequences of the UreA and UreB subunits of [0063] H. pylori and H. felis ureases differ from one another by 26.5% and 11.8%, respectively (Ferrero et al., Molecular Microbiology 9(2):323-333, 1993), it has been shown that H. pylori urease protects mice from H. felis infection (Michetti et al., Gastroenterology 107:1002-1011, 1994). In addition, it has been shown that the individual structural subunits of urease, UreA and UreB, which contain distinct amino acid sequences, are both protective antigens against Helicobacter infection (Michetti et al., supra). Similarly, Cuenca et al. (Gastroenterology 110: 1770-1775, 1996) showed that therapeutic immunization of H. mustelae-infected ferrets with H. pylori urease was effective at eradicating H. mustelae infection. Further, several urease variants have been reported to be effective vaccine antigens, including, e.g., recombinant UreA+UreB apoenzyme expressed from pORV142 (UreA and UreB sequences derived from H. pylori strain CPM630; Lee et al., J. Infect. Dis. 172:161-172, 1995); recombinant UreA+UreB apoenzyme expressed from pORV214 (UreA and UreB sequences differ from H. pylori strain CPM630 by one and two amino acid changes, respectively; Lee et al., supra, 1995); a UreA-glutathione-S-transferase fusion protein (UreA sequence from H. pylori strain ATCC 43504; Thomas et al., Acta Gastro-Enterologica Belgica, 56:54, September 1993); UreA+UreB holoenzyme purified from H. pylori strain NCTC11637 (Marchetti et al., Science 267:1655-1658, 1995); a UreA-MBP fusion protein (UreA from H. pylori strain 85P; Ferrero et al., Infection and Immunity 62:4981-4989, 1994); a UreB-MBP fusion protein (UreB from H. pylori strain 85P; Ferrero et al., supra); a UreA-MBP fusion protein (UreA from H. felis strain ATCC 49179; Ferrero et al., supra); a UreB-MBP fusion protein (UreB from H. felis strain ATCC 49179; Ferrero et al., supra); and a 37 kD fragment of UreB containing amino acids 220-569 (Dore-Davin et al., “A 37 kD fragment of UreB is sufficient to confer protection against Helicobacter felis infection in mice”). Finally, Thomas et al. (supra) showed that oral immunization of mice with crude sonicates of H. pylori protected mice from subsequent challenge with H. felis.
  • Polynucleotides, e.g., DNA molecules, encoding allelic variants can easily be retrieved by polymerase chain reaction (PCR) amplification of genomic bacterial DNA extracted by conventional methods. This involves the use of synthetic oligonucleotide primers matching upstream and downstream of the 5′ and 3′ ends of the encoding domain. Suitable primers can be designed according to the nucleotide sequence information provided in SEQ ID NOs:1 to 47 (odd numbers). Typically, a primer can consist of 10 to 40, preferably 15 to 25 nucleotides. It may be also advantageous to select primers containing C and G nucleotides in a proportion sufficient to ensure efficient hybridization; e.g., an amount of C and G nucleotides of at least 40%, preferably 50% of the total nucleotide amount. [0064]
  • As an example, primers useful for cloning by PCR a DNA molecule encoding a polypeptide having the amino acid sequence of HPO76 (SEQ ID NO:36), or encoded by the corresponding deposited DNA molecule (pMin2/76; HPO76, ATCC Deposit Number 98197), are shown in SEQ ID NO:83 (matching at the 5′ end) and in SEQ ID NO:84 (matching at the 3′ end). Experimental conditions for carrying out PCR can readily be determined by one skilled in the art and an illustration of carrying out PCR is provided in Example 1. [0065]
  • Thus, the first aspect of the invention includes (i) isolated DNA molecules that can be amplified and/or cloned by polymerase chain reaction from a Helicobacter, e.g., [0066] H. pylori, genome, using either:
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:49, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:50; [0067]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:51, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:52; [0068]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:53, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:54; [0069]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:55, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:56; [0070]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:57, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:58; [0071]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:59, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:60; [0072]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:61, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:62; [0073]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:63, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:64; [0074]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:65, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:66; [0075]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:67, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:68; [0076]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:69, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:70; [0077]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:71, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:72; [0078]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:73, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:74; [0079]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:75, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:76; [0080]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:77, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:78; [0081]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:79, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:80; [0082]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:81, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:82; [0083]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:83, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:84; [0084]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:85, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:86; [0085]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:87, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:88; [0086]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:89, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:90; [0087]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:91, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:93; [0088]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:95, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:94; [0089]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:97, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:96; or [0090]
  • A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:99, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:98; and [0091]
  • (ii) isolated DNA molecules encoding the mature forms of the polypeptides encoded by the DNA molecules amplified as above. [0092]
  • In the sequences provided in SEQ ID NOs:49 to 96, the letter “N” denotes a restriction site that contains, typically, 4 to 6 nucleotides. Restriction sites can be selected by those skilled in the art so that the amplified DNA can be conveniently cloned into an appropriately digested plasmid. [0093]
  • Useful homologs that do not naturally occur can be designed using known methods for identifying regions of an antigen that are likely to be tolerant of amino acid sequence changes and/or deletions. For example, sequences of the antigen from different species can be compared to identify conserved sequences. [0094]
  • Polypeptide derivatives that are encoded by polynucleotides of the invention include, e.g., fragments, polypeptides having large internal deletions derived from full-length polypeptides, and fusion proteins. [0095]
  • Polypeptide fragments of the invention can be derived from a polypeptide having a sequence homologous to any of the sequences shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by a deposited DNA molecule of the invention (see below, e.g., Example 2), to the extent that the fragments retain the substantial antigenicity of the parent polypeptide (specific antigenicity). Polypeptide derivatives can also be constructed by large internal deletions that remove a substantial part of the parent polypeptide, while retaining specific antigenicity. Generally, polypeptide derivatives should be about at least 12 amino acids in length to maintain antigenicity. Advantageously, they can be at least 20 amino acids, preferably at least 50 amino acids, more preferably at least 75 amino acids, and most preferably at least 100 amino acids in length. [0096]
  • Useful polypeptide derivatives, e.g., polypeptide fragments, can be designed using computer-assisted analysis of amino acid sequences in order to identify sites in protein antigens having potential as surface-exposed, antigenic regions (Hughes et al., Infect. Immun. 60(9):3497, 1992). [0097]
  • Computer-assisted analysis of some polypeptides of the invention is illustrated in FIGS. [0098] 2 to 8, which are graphs showing some of the physical properties of polypeptides HPO76 (SEQ ID NO:36), HPO15 (SEQ ID NO:12), HPO42 (SEQ ID NO:18), HPO50 (SEQ ID NO:22), HPO54 (SEQ ID NO:24), HPO57 (SEQ ID NO:26), and HPO64 (SEQ ID NO:30). The graphs were prepared using the Laser Gene Program from DNA Star, and include, e.g., hydrophilicity, antigenic index, and intensity index plots. Also included in the graphs are spots showing homologies with known protein motifs, such as the T-cell recognition motif and the major histocompatibility complex (MHC) IA and IE regions of mice. One skilled in the art can readily use the information provided in such plots to select peptide fragments for use as vaccine antigens. For example, fragments spanning regions of the plots in which the antigenic index is relatively high can be selected. One can also select fragments spanning regions in which both the antigenic index and the intensity plots are relatively high. Fragments containing conserved sequences, particularly hydrophilic conserved sequences, can also be selected.
  • Polypeptide fragments and polypeptides having large internal deletions can be used for revealing epitopes that are otherwise masked in the parent polypeptide and that may be of importance for inducing a protective T cell-dependent immune response. Deletions can also remove immunodominant regions of high variability among strains. [0099]
  • It is an accepted practice in the field of immunology to use fragments and variants of protein immunogens as vaccines, as all that is required to induce an immune response to a protein is a small (e.g., 8 to 10 amino acid) immunogenic region of the protein. This has been done for a number of vaccines against pathogens other than Helicobacter. For example, short synthetic peptides corresponding to surface-exposed antigens of pathogens such as murine mammary tumor virus (peptide containing 11 amino acids; Dion et al., Virology 179:474-477, 1990), Semliki Forest virus (peptide containing 16 amino acids; Snijders et al., J. Gen. Virol. 72:557-565, 1991), and canine parvovirus (2 overlapping peptides, each containing 15 amino acids; Langeveld et al., Vaccine 12(15): 1473-1480, 1994) have been shown to be effective vaccine antigens against their respective pathogens. [0100]
  • Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions can be constructed using standard methods (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994), for example, by PCR, including inverse PCR, by restriction enzyme treatment of the cloned DNA molecules, or by the method of Kunkel et al. (Proc. Natl. Acad. Sci. U.S.A. 82:448, 1985; biological material available at Stratagene). [0101]
  • A polypeptide derivative can also be produced as a fusion polypeptide that contains a polypeptide or a polypeptide derivative of the invention fused, e.g., at the N- or C-terminal end, to any other polypeptide (hereinafter referred to as a peptide tail). Such a product can be easily obtained by translation of a genetic fusion, i.e., a hybrid gene. Vectors for expressing fusion polypeptides are commercially available, such as the pMal-c2 or pMal-p2 systems of New England Biolabs, in which the peptide tail is a maltose binding protein, the glutathione-S-transferase system of Pharmacia, or the His-Tag system available from Novagen. These and other expression systems provide convenient means for further purification of polypeptides and derivatives of the invention. [0102]
  • Another particular example of fusion polypeptides included in invention includes a polypeptide or polypeptide derivative of the invention fused to a polypeptide having adjuvant activity, such as, e.g., subunit B of either cholera toxin or [0103] E. coli heat-labile toxin. Several possibilities are can be used for achieving fusion. First, the polypeptide of the invention can be fused to the N-, or preferably, to the C-terminal end of the polypeptide having adjuvant activity. Second, a polypeptide fragment of the invention can be fused within the amino acid sequence of the polypeptide having adjuvant activity.
  • As stated above, the polynucleotides of the invention encode Helicobacter polypeptides in precursor or mature form. They can also encode hybrid precursors containing heterologous signal peptides, which can mature into polypeptides of the invention. By “heterologous signal peptide” is meant a signal peptide that is not found in the naturally-occurring precursor of a polypeptide of the invention. [0104]
  • A polynucleotide of the invention, having a homologous coding sequence, hybridizes, preferably under stringent conditions, to a polynucleotide having a sequence as shown in SEQ ID NOs:1 to 47 (odd numbers) or to an insert of a deposited DNA molecule (see below, e.g., Example 2). Hybridization procedures are, e.g., described in Ausubel et al., supra; Silhavy et al. (Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, 1984); Davis et al. (A Manual for Genetic Engineering: Advanced Bacterial Genetics, Cold Spring Harbor Laboratory Press, 1980). Important parameters that can be considered for optimizing hybridization conditions are reflected in a formula that allows calculation of a critical value, the melting temperature above which two complementary DNA strands separate from each other (Casey et al., Nucl. Acid Res. 4:1539, 1997). This formula is as follows: Tm=81.5+0.5×(% G+C)+1.6 log (positive ion concentration) −0.6×(% formamide). Under appropriate stringency conditions, hybridization temperature (Th) is approximately 20 to 40° C., 20 to 25° C., or, preferably 30 to 40° C. below the calculated Tm. Those skilled in the art will understand that optimal temperature and salt conditions can be readily determined empirically in preliminary experiments using conventional procedures. [0105]
  • For example, stringent conditions can be achieved, both for pre-hybridizing and hybridizing incubations, (i) within 4-16 hours at 42° C., in 6× SSC containing 50% formamide or (ii) within 4-16 hours at 65° C. in an aqueous 6× SSC solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)). [0106]
  • For polynucleotides containing 30 to 600 nucleotides, the above formula is used and then is corrected by subtracting (600/polynucleotide size in base pairs). Stringency conditions are defined by a Th that is 5 to 10° C. below Tm. [0107]
  • Hybridization conditions with oligonucleotides shorter than 20-30 bases do not exactly follow the rules set forth above. In such cases, the formula for calculating the Tm is as follows: Tm=4×(G+C)+2(A+T). For example, an 18 nucleotide fragment of 50% G+C would have an approximate Tm of 54° C. [0108]
  • Plasmids containing nucleic acids encoding HPO101, HPO104, HPO116, HPO121, HPO132, HPO15, HPO18, HPO38, HPO42, HPO45, HPO50, HPO54, HPO57, HPO58, HPO64, HPO70, HPO71, HPO76, HPO7, HPO80, HPO87, HPO95, HPO98, and HPO9 were deposited in [0109] E. coli strain DH5α under the Budapest Treaty, with the American Type Culture Collection (ATCC; Rockville, Md.) on Oct. 9, 1996 and were designated with accession numbers listed below in Example 2. These plasmids were derived from pMin2 by insertion of a genomic DNA BglII-ClaI fragment from H. pylori strain P1 or P12 into the vector. Each of the inserts is disrupted by the presence of transposon TnMax9 (Kahrs et al., Gene 167:53, 1995). The locations of insertion of the transposon in each of the deposited clones (see below) are between the nucleotides indicated in parentheses after the name of each clone, as follows: HPO101 (497-498), HPO104 (428-429), HPO116 (433-444), HPO121 (463-464), HPO132 (408-409), HPO18 (226-227), HPO38 (347-348), HPO42 (372-373), HPO45 (299-300), HPO50 (29-293), HPO54 (351-352), HPO57 (266-267), HPO58 (434-435), HPO64 (224-225), HPO70 (114-115), HPO71 (274-275), HPO76 (412-413), HPO7 (349-350), HPO80 (105-106), HPO87 (26-27), HPO95 (64-65), HPO98 (43-44), and HPO9 (346-347). As is discussed further below in Example 2, DNA molecules lacking the transposon can be amplified from the plasmids using standard PCR techniques, including inverse and recombinant PCR (see, e.g., PCR protocols: A Guide to Methods and Applications (1990) Innis et al., Eds., Academic Press), so that the full-length H. pylori insert is reconstituted.
  • A polynucleotide molecule of the invention, containing RNA, DNA, or modifications or combinations thereof, can have various applications. For example, a DNA molecule can be used (i) in a process for producing the encoded polypeptide in a recombinant host system, (ii) in the construction of vaccine vectors such as pox viruses, which are further used in methods and compositions for preventing and/or treating Helicobacter infection, (iii) as a vaccine agent (as well as an RNA molecule), in a naked form or formulated with a delivery vehicle and, (iv) in the construction of attenuated Helicobacter strains that can over-express a polynucleotide of the invention or express it in a non-toxic, mutated form. [0110]
  • According to a second aspect of the invention, there is therefore provided (i) an expression cassette containing a DNA molecule of the invention placed under the control of the elements required for expression, in particular under the control of an appropriate promoter; (ii) an expression vector containing an expression cassette of the invention; (iii) a procaryotic or eucaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, as well as (iv) a process for producing a polypeptide or polypeptide derivative encoded by a polynucleotide of the invention, which involves culturing a procaryotic or eucaryotic cell transformed or transfected with an expression cassette and/or vector of the invention, under conditions that allow expression of the DNA molecule of the invention and, recovering the encoded polypeptide or polypeptide derivative from the cell culture. [0111]
  • A recombinant expression system can be selected from procaryotic and eucaryotic hosts. Eucaryotic hosts include yeast cells (e.g., [0112] Saccharomyces cerevisiae or Pichia Pastoris), mammalian cells (e.g., COS1, NIH3T3, or JEG3 cells), arthropods cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells. Preferably, a procaryotic host such as E. coli is used. Bacterial and eucaryotic cells are available from a number of different sources to those skilled in the art, e.g., the American Type Culture Collection (ATCC; Rockville, Md.).
  • The choice of the expression system depends on the features desired for the expressed polypeptide. For example, it may be useful to produce a polypeptide of the invention in a particular lipidated form or any other form. [0113]
  • The choice of the expression cassette will depend on the host system selected as well as the features desired for the expressed polypeptide. Typically, an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary, a region encoding a signal peptide, e.g., a lipidation signal peptide; a DNA molecule of the invention; a stop codon; and optionally a 3′ terminal region (translation and/or transcription terminator). The signal peptide-encoding region is adjacent to the polynucleotide of the invention and placed in proper reading frame. The signal peptide-encoding region can be homologous or heterologous to the DNA molecule encoding the mature polypeptide and can be specific to the secretion apparatus of the host used for expression. The open reading frame constituted by the DNA molecule of the invention, solely or together with the signal peptide, is placed under the control of the promoter so that transcription and translation occur in the host system. Promoters, signal peptide encoding regions are widely known and available to those skilled in the art and includes, for example, the promoter of [0114] Salmonella typhimurium (and derivatives) that is inducible by arabinose (promoter araB) and is functional in Gram-negative bacteria such as E. coli (as described in U.S. Pat. No. 5,028,530, and in Cagnon et al., Protein Engineering 4(7):843, 1991); the promoter of the gene of bacteriophage T7 encoding RNA polymerase, that is functional in a number of E. coli strains expressing T7 polymerase (described in U.S. Pat. No. 4,952,496); OspA lipidation signal peptide; and RlpB lipidation signal peptide (Takase et al., J. Bact. 169:5692, 1987).
  • The expression cassette is typically part of an expression vector, which is selected for its ability to replicate in the chosen expression system. Expression vectors (e.g., plasmids or viral vectors) can be chosen from those described in Pouwels et al. (Cloning Vectors: A Laboratory Manual 1985, Supp. 1987). They can be purchased from various commercial sources. [0115]
  • Methods for transforming/transfecting host cells with expression vectors will depend on the host system selected as described in Ausubel et al., supra. [0116]
  • Upon expression, a recombinant polypeptide of the invention (or a polypeptide derivative) is produced and remains in the intracellular compartment, is secreted/excreted in the extracellular medium or in the periplasmic space, or is embedded in the cellular membrane. The polypeptide can then be recovered in a substantially purified form from the cell extract or from the supernatant after centrifugation of the recombinant cell culture. Typically, the recombinant polypeptide can be purified by antibody-based affinity purification or by any other method that can be readily adapted by a person skilled in the art, such as by genetic fusion to a small affinity binding domain. Antibody-based affinity purification methods are also available for purifying a polypeptide of the invention extracted from a Helicobacter strain. Antibodies useful for purifying by immunoaffinity the polypeptides of the invention can be obtained as described below. [0117]
  • A polynucleotide of the invention can also be useful in the vaccine field, e.g., for achieving DNA vaccination. There are two major possibilities, either using a viral or bacterial host as gene delivery vehicle (live vaccine vector) or administering the gene in a free form, e.g., inserted into a plasmid. Therapeutic or prophylactic efficacy of a polynucleotide of the invention can be evaluated as described below. [0118]
  • Accordingly, in a third aspect of the invention, there is provided (i) a vaccine vector such as a pox virus, containing a DNA molecule of the invention, placed under the control of elements required for expression; (ii) a composition of matter containing a vaccine vector of the invention, together with a diluent or carrier; particularly, (iii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a vaccine vector of the invention; (iv) a method for inducing an immune response against Helicobacter in a mammal (e.g., a human; alternatively, the method can be used in veterinary applications for treating or preventing Helicobacter infection of animals, e.g., cats or birds), which involves administering to the mammal an immunogenically effective amount of a vaccine vector of the invention to elicit an immune response, e.g., a protective or therapeutic immune response to Helicobacter; and particularly, (v) a method for preventing and/or treating a Helicobacter (e.g., [0119] H. pylori, H. felis, H. mustelae, or H. heilmanii) infection, which involves administering a prophylactic or therapeutic amount of a vaccine vector of the invention to an individual in need. Additionally, the third aspect of the invention encompasses the use of a vaccine vector of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection.
  • A vaccine vector of the invention can express one or several polypeptides or derivatives of the invention, as well as at least one additional Helicobacter antigen such as a urease apoenzyme or a subunit, fragment, homolog, mutant, or derivative thereof. In addition, it can express a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), which enhances the immune response (adjuvant effect). Thus, a vaccine vector can include an additional DNA molecule encoding, e.g., urease subunit A, B, or both, or a cytokine, placed under the control of elements required for expression in a mammalian cell. [0120]
  • Alternatively, a composition of the invention can include several vaccine vectors, each of them being capable of expressing a polypeptide or derivative of the invention. A composition can also contain a vaccine vector capable of expressing an additional Helicobacter antigen such as urease apoenzyme, a subunit, fragment, homolog, mutant, or derivative thereof; or a cytokine such as IL-2 or IL-12. [0121]
  • In vaccination methods for treating or preventing infection in a mammal, a vaccine vector of the invention can be administered by any conventional route in use in the vaccine field, particularly, to a mucosal (e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. Preferred routes depend upon the choice of the vaccine vector. The administration can be achieved in a single dose or repeated at intervals. The appropriate dosage depends on various parameters understood by skilled artisans such as the vaccine vector itself, the route of administration or the condition of the mammal to be vaccinated (weight, age and the like). [0122]
  • Live vaccine vectors available in the art include viral vectors such as adenoviruses and pox viruses as well as bacterial vectors, e.g., Shigella, Salmonella, [0123] Vibrio cholerae, Lactobacillus, Bacille bilié de Calmette-Guérin (BCG), and Streptococcus.
  • An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, are described in U.S. Pat. No. 4,920,209. Pox virus vectors that can be used include, e.g., vaccinia and canary pox virus, described in U.S. Pat. Nos. 4,722,848 and 5,364,773, respectively (also see, e.g., Tartaglia et al., Virology 188:217, 1992) for a description of a vaccinia virus vector; and Taylor et al, Vaccine 13:539, 1995, for a reference of a canary pox). Pox virus vectors capable of expressing a polynucleotide of the invention can be obtained by homologous recombination as described in Kieny et al., Nature 312:163, 1984, so that the polynucleotide of the invention is inserted in the viral genome under appropriate conditions for expression in mammalian cells. Generally, the dose of vaccine viral vector, for therapeutic or prophylactic use, can be of from about 1×10[0124] 4 to about 1×1011, advantageously from about 1×107 to about 1×1010, preferably of from about 1×107 to about 1×109 plaque-forming units per kilogram. Preferably, viral vectors are administered parenterally; for example, in 3 doses, 4 weeks apart. Those skilled in the art recognize that it is preferable to avoid adding a chemical adjuvant to a composition containing a viral vector of the invention and thereby minimizing the immune response to the viral vector itself.
  • Non-toxicogenic [0125] Vibrio cholerae mutant strains that are useful as a live oral vaccine are described in Mekalanos et al., Nature 306:551, 1983, and U.S. Pat. No. 4,882,278 (strain in which a substantial amount of the coding sequence of each of the two ctxA alleles has been deleted so that no functional cholerae toxin is produced); WO 92/11354 (strain in which the irgA locus is inactivated by mutation; this mutation can be combined in a single strain with ctxA mutations); and WO 94/1533 (deletion mutant lacking functional ctxA and attRS1 DNA sequences). These strains can be genetically engineered to express heterologous antigens, as described in WO 94/19482. An effective vaccine dose of a Vibrio cholerae strain capable of expressing a polypeptide or polypeptide derivative encoded by a DNA molecule of the invention can contain, e.g., about 1×105 to about 1×109, preferably about 1×106 to about 1×108 viable bacteria in an appropriate volume for the selected route of administration. Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • Attenuated [0126] Salmonella typhimurium strains, genetically engineered for recombinant expression of heterologous antigens or not, and their use as oral vaccines are described in Nakayama et al. (Bio/Technology 6:693, 1988) and WO 92/11361. Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • Others bacterial strains useful as vaccine vectors are described in High et al., EMBO 11:1991, 1992, and Sizemore et al., Science 270:299, 1995 ([0127] Shigella flexneri); Medaglini et al., Proc. Natl. Acad. Sci. U.S.A. 92:6868, 1995 (Streptococcus gordonii); and Flynn, Cell. Mol. Biol. 40 (suppl. I):31, 1994, WO 88/6626, WO 90/0594, WO 91/13157, WO 92/1796, and WO 92/21376 (Bacille Calmette Guerin).
  • In bacterial vectors, polynucleotide of the invention can be inserted into the bacterial genome or can remain in a free state, carried on a plasmid. [0128]
  • An adjuvant can also be added to a composition containing a vaccine bacterial vector. A number of adjuvants are known to those skilled in the art. Preferred adjuvants can be selected from the list provided below. [0129]
  • According to a fourth aspect of the invention, there is also provided (i) a composition of matter containing a polynucleotide of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polynucleotide of the invention; (iii) a method for inducing an immune response against Helicobacter, in a mammal, by administering to the mammal, an immunogenically effective amount of a polynucleotide of the invention to elicit an immune response, e.g., a protective immune response to Helicobacter; and particularly, (iv) a method for preventing and/or treating a Helicobacter (e.g., [0130] H. pylori, H. felis, H. mustelae, or H. heilmanii) infection, by administering a prophylactic or therapeutic amount of a polynucleotide of the invention to an individual in need. Additionally, the fourth aspect of the invention encompasses the use of a polynucleotide of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection. The fourth aspect of the invention preferably includes the use of a DNA molecule placed under conditions for expression in a mammalian cell, e.g., in a plasmid that is unable to replicate in mammalian cells and to substantially integrate in a mammalian genome.
  • Polynucleotides (DNA or RNA) of the invention can also be administered as such to a mammal for vaccine, e.g., therapeutic or prophylactic, purpose. When a DNA molecule of the invention is used, it can be in the form of a plasmid that is unable to replicate in a mammalian cell and unable to integrate in the mammalian genome. Typically, a DNA molecule is placed under the control of a promoter suitable for expression in a mammalian cell. The promoter can function ubiquitously or tissue-specifically. Examples of non-tissue specific promoters include the early Cytomegalovirus (CMV) promoter (described in U.S. Pat. No. 4,168,062) and the Rous Sarcoma Virus promoter (described in Norton et al., Molec. Cell Biol. 5:281, 1985). The desmin promoter (Li et al., Gene 78:243, 1989, Li et al., J. Biol. Chem. 266:6562, 1991, and Li et al., J. Biol. Chem. 268:10403, 1993) is tissue-specific and drives expression in muscle cells. More generally, useful vectors are described, i.a., WO 94/21797 and Hartikka et al., Human Gene Therapy 7:1205, 1996. [0131]
  • For DNA/RNA vaccination, the polynucleotide of the invention can encode a precursor or a mature form. When it encodes a precursor form, the precursor form can be homologous or heterologous. In the latter case, a eucaryotic leader sequence can be used, such as the leader sequence of the tissue-type plasminogen factor (tPA). [0132]
  • A composition of the invention can contain one or several polynucleotides of the invention. It can also contain at least one additional polynucleotide encoding another Helicobacter antigen such as urease subunit A, B, or both; or a fragment, derivative, mutant, or analog thereof. A polynucleotide encoding a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12), can also be added to the composition so that the immune response is enhanced. These additional polynucleotides are placed under appropriate control for expression. Advantageously, DNA molecules of the invention and/or additional DNA molecules to be included in the same composition, can be carried in the same plasmid. [0133]
  • Standard techniques of molecular biology for preparing and purifying polynucleotides can be used in the preparation of polynucleotide therapeutics of the invention. For use as a vaccine, a polynucleotide of the invention can be formulated according to various methods. [0134]
  • First, a polynucleotide can be used in a naked form, free of any delivery vehicles, such as anionic liposomes, cationic lipids, microparticles, e.g., gold microparticles, precipitating agents, e.g., calcium phosphate, or any other transfection-facilitating agent. In this case, the polynucleotide can be simply diluted in a physiologically acceptable solution, such as sterile saline or sterile buffered saline, with or without a carrier. When present, the carrier preferably is isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as provided by a sucrose solution, e.g., a solution containing 20% sucrose. [0135]
  • Alternatively, a polynucleotide can be associated with agents that assist in cellular uptake. It can be, i.a., (i) complemented with a chemical agent that modifies the cellular permeability, such as bupivacaine (see, e.g., WO 94/16737), (ii) encapsulated into liposomes, or (iii) associated with cationic lipids or silica, gold, or tungsten microparticles. [0136]
  • Anionic and neutral liposomes are well known in the art (see, e.g., Liposomes: A Practical Approach, RPC New Ed, IRL press (1990), for a detailed description of methods for making liposomes) and are useful for delivering a large range of products, including polynucleotides. [0137]
  • Cationic lipids are also known in the art and are commonly used for gene delivery. Such lipids include Lipofectin™ also known as DOTMA (N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB (dimethyldioctadecylammonium bromide), DOGS (dioctadecylamidologlycyl spermine) and cholesterol derivatives such as DC-Chol (3 beta-(N-(N′,N′-dimethyl aminomethane)-carbamoyl) cholesterol). A description of these cationic lipids can be found in EP 187,702, WO 90/11092, U.S. Pat. No. 5,283,185, WO 91/15501, WO 95/26356, and U.S. Pat. No. 5,527,928. Cationic lipids for gene delivery are preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine), as, for example, described in WO 90/11092. [0138]
  • Other transfection-facilitating compounds can be added to a formulation containing cationic liposomes. A number of them are described in, e.g., WO 93/18759, WO 93/19768, WO 94/25608, and WO 95/2397. They include, i.a., spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO 93/18759) and membrane-permeabilizing compounds such as GALA, Gramicidine S, and cationic bile salts (see, for example, WO 93/19768). [0139]
  • Gold or tungsten microparticles can also be used for gene delivery, as described in WO 91/359, WO 93/17706, and Tang et al. (Nature 356:152, 1992). In this case, the microparticle-coated polynucleotides can be injected via intradermal or intraepidermal routes using a needleless injection device (“gene gun”), such as those described in U.S. Pat. Nos. 4,945,050, 5,015,580, and WO 94/24263. [0140]
  • The amount of DNA to be used in a vaccine recipient depends, e.g., on the strength of the promoter used in the DNA construct, the immunogenicity of the expressed gene product, the condition of the mammal intended for administration (e.g., the weight, age, and general health of the mammal), the mode of administration, and the type of formulation. In general, a therapeutically or prophylactically effective dose from about 1 μg to about 1 mg, preferably, from about 10 μg to about 800 μg and, more preferably, from about 25 μg to about 250 μg, can be administered to human adults. The administration can be achieved in a single dose or repeated at intervals. [0141]
  • The route of administration can be any conventional route used in the vaccine field. As general guidance, a polynucleotide of the invention can be administered via a mucosal surface, e.g., an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface; or via a parenteral route, e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal, or intramuscular route. The choice of the administration route will depend on, e.g., the formulation that is selected. A polynucleotide formulated in association with bupivacaine is advantageously administered into muscles. When a neutral or anionic liposome or a cationic lipid, such as DOTMA or DC-Chol, is used, the formulation can be advantageously injected via intravenous, intranasal (aerosolization), intramuscular, intradermal, and subcutaneous routes. A polynucleotide in a naked form can advantageously be administered via the intramuscular, intradermal, or sub-cutaneous routes. [0142]
  • Although not absolutely required, such a composition can also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferable such as, e.g., QS21, which is described in U.S. Pat. No. 5,057,546. [0143]
  • The sequence information provided in the present application enables the design of specific nucleotide probes and primers that can be useful in diagnosis. Accordingly, in a fifth aspect of the invention, there is provided a nucleotide probe or primer having a sequence found in or derived by degeneracy of the genetic code from a sequence shown in SEQ ID NO:1 to 47 (odd numbers). [0144]
  • The term “probe” as used in the present application refers to DNA (preferably single stranded) or RNA molecules (or modifications or combinations thereof) that hybridize under the stringent conditions, as defined above, to nucleic acid molecules having sequences homologous to those shown in SEQ ID NOs:1 to 47 (odd numbers), or to a complementary or anti-sense sequence. Generally, probes are significantly shorter than full-length sequences shown in SEQ ID NOs:1 to 47 (odd numbers); for example, they can contain from about 5 to about 100, preferably from about 10 to about 80 nucleotides. In particular, probes have sequences that are at least 75%, preferably at least 85%, more preferably 95% homologous to a portion of a sequence as shown in SEQ ID NOs:1 to 47 (odd numbers) or that are complementary to such sequences. Probes can contain modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, or diamino-2,6-purine. Sugar or phosphate residues can also be modified or substituted. For example, a deoxyribose residue can be replaced by a polyamide (Nielsen et al., Science 254:1497, 1991) and phosphate residues can be replaced by ester groups such as diphosphate, alkyl, arylphosphonate and phosphorothioate esters. In addition, the 2′-hydroxyl group on ribonucleotides can be modified by including, e.g., alkyl groups. [0145]
  • Probes of the invention can be used in diagnostic tests, as capture or detection probes. Such capture probes can be conventionally immobilized on a solid support, directly or indirectly, by covalent means or by passive adsorption. A detection probe can be labeled by a detection marker selected from radioactive isotopes; enzymes such as peroxidase, alkaline phosphatase, and enzymes able to hydrolyze a chromogenic, fluorogenic, or luminescent substrate; compounds that are chromogenic, fluorogenic, or luminescent; nucleotide base analogs; and biotin. [0146]
  • Probes of the invention can be used in any conventional hybridization technique, such as dot blot (Maniatis et al., Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), Southern blot (Southern, J. Mol. Biol. 98:503, 1975), northern blot (identical to Southern blot to the exception that RNA is used as a target), or the sandwich technique (Dunn et al., Cell 12:23, 1977). The latter technique involves the use of a specific capture probe and/or a specific detection probe with nucleotide sequences that at least partially differ from each other. [0147]
  • A primer is usually a probe of about 10 to about 40 nucleotides that is used to initiate enzymatic polymerization of DNA in an amplification process (e.g., PCR), in an elongation process, or in a reverse transcription method. In a diagnostic method involving PCR, primers can be labeled. [0148]
  • Thus, the invention also encompasses (i) a reagent containing a probe of the invention for detecting and/or identifying the presence of Helicobacter in a biological material; (ii) a method for detecting and/or identifying the presence of Helicobacter in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA or RNA is extracted from the material and denatured, and (c) exposed to a probe of the invention, for example, a capture, detection probe or both, under stringent hybridization conditions, such that hybridization is detected; and (iii) a method for detecting and/or identifying the presence of Helicobacter in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA is extracted therefrom, (c) the extracted DNA is primed with at least one, and preferably two, primers of the invention and amplified by polymerase chain reaction, and (d) the amplified DNA fragment is produced. [0149]
  • As previously mentioned, polypeptides that can be produced upon expression of the newly identified open reading frames are useful vaccine agents. [0150]
  • Therefore, a sixth aspect of the invention features a substantially purified polypeptide or polypeptide derivative having an amino acid sequence encoded by a polynucleotide of the invention. [0151]
  • A “substantially purified polypeptide” is defined as a polypeptide that is separated from the environment in which it naturally occurs and/or that is free of the majority of the polypeptides that are present in the environment in which it was synthesized. For example, a substantially purified polypeptide is free from cytoplasmic polypeptides. A substantiall purified polypeptide can be, for example, at least 60%, 70%, 80%, 90%, 95%, or 100% pure, with respect to, for example, other Helicobacter components. Those skilled in the art will understand that the polypeptides of the invention can be purified from a natural source, i.e., a Helicobacter strain, or can be produced by recombinant means. [0152]
  • Homologous polypeptides or polypeptide derivatives encoded by polynucleotides of the invention can be screened for specific antigenicity by testing cross-reactivity with an antiserum raised against the polypeptide of reference having an amino acid sequence as shown in SEQ ID NOs:2 to 48 (even numbers) or encoded by one of the deposited DNA molecules. Briefly, a monospecific hyperimmune antiserum can be raised against a purified reference polypeptide as such or as a fusion polypeptide, for example, an expression product of MBP, GST, or His-tag systems or a synthetic peptide predicted to be antigenic. The homologous polypeptide or derivative screened for specific antigenicity can be produced as such or as a fusion polypeptide. In this latter case and if the antiserum is also raised against a fusion polypeptide, two different fusion systems are employed. Specific antigenicity can be determined according to a number of methods, including Western blot (Towbin et al., Proc. Natl. Acad. Sci. U.S.A. 76:4350, 1979), dot blot, and ELISA, as described below. [0153]
  • In a Western blot assay, the product to be screened, either as a purified preparation or a total [0154] E. coli extract, is submitted to SDS-Page electrophoresis as described by Laemmli (Nature 227:680, 1970). After transfer to a nitrocellulose membrane, the material is further incubated with the monospecific hyperimmune antiserum diluted in the range of dilutions from about 1:50 to about 1:5000, preferably from about 1:100 to about 1:500. Specific antigenicity is shown once a band corresponding to the product exhibits reactivity at any of the dilutions in the above range.
  • In an ELISA assay, the product to be screened is preferably used as the coating antigen. A purified preparation is preferred, although a whole cell extract can also be used. Briefly, about 100 μl of a preparation at about 10 μg protein/ml are distributed into wells of a 96-well polycarbonate ELISA plate. The plate is incubated for 2 hours at 37° C. then overnight at 4° C. The plate is washed with phosphate buffer saline (PBS) containing 0.05% Tween 20 (PBS/Tween buffer). The wells are saturated with 250 μl PBS containing 1% bovine serum albumin (BSA) to prevent non-specific antibody binding. After 1 hour of incubation at 37° C., the plate is washed with PBS/Tween buffer. The antiserum is serially diluted in PBS/Tween buffer containing 0.5% BSA. 100 μl of dilutions are added per well. The plate is incubated for 90 minutes at 37° C., washed and evaluated according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when specific antibodies were raised in rabbits. Incubation is carried out for 90 minutes at 37° C. and the plate is washed. The reaction is developed with the appropriate substrate and the reaction is measured by colorimetry (absorbance measured spectrophotometrically). Under the above experimental conditions, a positive reaction is shown once an O.D. value of 1.0 is associated with a dilution of at least about 1:50, preferably of at least about 1:500. [0155]
  • In a dot blot assay, a purified product is preferred, although a whole cell extract can also be used. Briefly, a solution of the product at about 100 μg/ml is serially two-fold diluted in 50 mM Tris-HCl (pH 7.5). 100 μl of each dilution are applied to a nitrocellulose membrane 0.45 μm set in a 96-well dot blot apparatus (Biorad). The buffer is removed by applying vacuum to the system. Wells are washed by addition of 50 mM Tris-HCl (pH 7.5) and the membrane is air-dried. The membrane is saturated in blocking buffer (50 mM Tris-HCl (pH 7.5) 0.15 M NaCl, 10 μg/L skim milk) and incubated with an antiserum dilution from about 1:50 to about 1:5000, preferably about 1:500. The reaction is revealed according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when rabbit antibodies are used. Incubation is carried out 90 minutes at 37° C. and the blot is washed. The reaction is developed with the appropriate substrate and stopped. The reaction is measured visually by the appearance of a colored spot, e.g., by colorimetry. Under the above experimental conditions, a positive reaction is shown once a colored spot is associated with a dilution of at least about 1:50, preferably of at least about 1:500. [0156]
  • Therapeutic or prophylactic efficacy of a polypeptide or derivative of the invention can be evaluated as described below. [0157]
  • According to a seventh aspect of the invention, there is provided (i) a composition of matter containing a polypeptide of the invention together with a diluent or carrier; in particular, (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polypeptide of the invention; (iii) a method for inducing an immune response against Helicobacter in a mammal, by administering to the mammal an immunogenically effective amount of a polypeptide of the invention to elicit an immune response, e.g., a protective immune response to Helicobacter; and particularly, (iv) a method for preventing and/or treating a Helicobacter (e.g., [0158] H. pylori, H. felis, H. mustelae, or H. heilmanii) infection, by administering a prophylactic or therapeutic amount of a polypeptide of the invention to an individual in need. Additionally, the seventh aspect of the invention encompasses the use of a polypeptide of the invention in the preparation of a medicament for preventing and/or treating Helicobacter infection.
  • The immunogenic compositions of the invention can be administered by any conventional route in use in the vaccine field, in particular to a mucosal (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. The choice of the administration route depends upon a number of parameters, such as the adjuvant associated with the polypeptide. For example, if a mucosal adjuvant is used, the intranasal or oral route will be preferred and if a lipid formulation or an aluminum compound is used, the parenteral route will be preferred. In the latter case, the subcutaneous or intramuscular route is most preferred. The choice can also depend upon the nature of the vaccine agent. For example, a polypeptide of the invention fused to CTB or LTB will be best administered to a mucosal surface. [0159]
  • A composition of the invention can contain one or several polypeptides or derivatives of the invention. It can also contain at least one additional Helicobacter antigen such as the urease apoenzyme or a subunit, fragment, homolog, mutant, or derivative thereof. [0160]
  • For use in a composition of the invention, a polypeptide or derivative thereof can be formulated into or with liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like-particles (VLPs) to facilitate delivery and/or enhance the immune response. These compounds are readily available to one skilled in the art; for example, see Liposomes: A Practical Approach (supra). [0161]
  • Adjuvants other than liposomes and the like can also be used and are known in the art. An appropriate selection can conventionally be made by those skilled in the art, for example, from the list provided below. [0162]
  • Administration can be achieved in a single dose or repeated as necessary at intervals as can be determined by one skilled in the art. For example, a priming dose can be followed by three booster doses at weekly or monthly intervals. An appropriate dose depends on various parameters including the recipient (e.g., adult or infant), the particular vaccine antigen, the route and frequency of administration, the presence/absence or type of adjuvant, and the desired effect (e.g., protection and/or treatment), as can be determined by one skilled in the art. In general, a vaccine antigen of the invention can be administered by a mucosal route in an amount from about 10 μg to about 500 mg, preferably from about 1 mg to about 200 mg. For the parenteral route of administration, the dose usually should not exceed about 1 mg, preferably about 100 μg. [0163]
  • When used as vaccine agents, polynucleotides and polypeptides of the invention can be used sequentially as part of a multistep immunization process. For example, a mammal can be initially primed with a vaccine vector of the invention such as a pox virus, e.g., via the parenteral route, and then boosted twice with the polypeptide encoded by the vaccine vector, e.g., via the mucosal route. In another example, liposomes associated with a polypeptide or derivative of the invention can also be used for priming, with boosting being carried out mucosally using a soluble polypeptide or derivative of the invention in combination with a mucosal adjuvant (e.g., LT). [0164]
  • A polypeptide derivative of the invention is also useful as a diagnostic reagent for detecting the presence of anti-Helicobacter antibodies, e.g., in a blood sample. Such polypeptides are about 5 to about 80, preferably about 10 to about 50 amino acids in length and can be labeled or unlabeled, depending upon the diagnostic method. Diagnostic methods involving such a reagent are described below. [0165]
  • Upon expression of a DNA molecule of the invention, a polypeptide or polypeptide derivative is produced and can be purified using known laboratory techniques. For example, the polypeptide or polypeptide derivative can be produced as a fusion protein containing a fused tail that facilitates purification. The fusion product can be used to immunize a small mammal, e.g., a mouse or a rabbit, in order to raise antibodies against the polypeptide or polypeptide derivative (monospecific antibodies). The eighth aspect of the invention thus provides a monospecific antibody that binds to a polypeptide or polypeptide derivative of the invention. [0166]
  • By “monospecific antibody” is meant an antibody that is capable of reacting with a unique naturally-occuring Helicobacter polypeptide. An antibody of the invention can be polyclonal or monoclonal. Monospecific antibodies can be recombinant, e.g., chimeric (e.g., constituted by a variable region of murine origin associated with a human constant region), humanized (a human immunoglobulin constant backbone together with hypervariable region of animal, e.g., murine, origin), and/or single chain. Both polyclonal and monospecific antibodies can also be in the form of immunoglobulin fragments, e.g., F(ab)′2 or Fab fragments. The antibodies of the invention can be of any isotype, e.g., IgG or IgA, and polyclonal antibodies can be of a single isotype or can contain a mixture of isotypes. [0167]
  • The antibodies of the invention, which are raised to a polypeptide or polypeptide derivative of the invention, can be produced and identified using standard immunological assays, e.g., Western blot analysis, dot blot assay, or ELISA (see, e.g., Coligan et al., Current Protocols in Immunology (1994) John Wiley & Sons, Inc., New York, N.Y.). The antibodies can be used in diagnostic methods to detect the presence of a Helicobacter antigen in a sample, such as a biological sample. The antibodies can also be used in affinity chromatography methods for purifying a polypeptide or polypeptide derivative of the invention. As is discussed further below, such antibodies can be used in prophylactic and therapeutic passive immunization methods. [0168]
  • Accordingly, a ninth aspect of the invention provides (i) a reagent for detecting the presence of Helicobacter in a biological sample that contains an antibody, polypeptide, or polypeptide derivative of the invention; and (ii) a diagnostic method for detecting the presence of Helicobacter in a biological sample, by contacting the biological sample with an antibody, a polypeptide, or a polypeptide derivative of the invention, such that an immune complex is formed, and by detecting such complex to indicate the presence of Helicobacter in the sample or the organism from which the sample is derived. [0169]
  • Those skilled in the art will understand that the immune complex is formed between a component of the sample and the antibody, polypeptide, or polypeptide derivative, whichever is used, and that any unbound material can be removed prior to detecting the complex. As can be easily understood, a polypeptide reagent is useful for detecting the presence of anti-Helicobacter antibodies in a sample, e.g., a blood sample, while an antibody of the invention can be used for screening a sample, such as a gastric extract or biopsy, for the presence of Helicobacter polypeptides. [0170]
  • For use in diagnostic applications, the reagent (i.e., the antibody, polypeptide, or polypeptide derivative of the invention) can be in a free state or immobilized on a solid support, such as a tube, a bead, or any other conventional support used in the field. Immobilization can be achieved using direct or indirect means. Direct means include passive adsorption (non-covalent binding) or covalent binding between the support and the reagent. By “indirect means” is meant that an anti-reagent compound that interacts with a reagent is first attached to the solid support. For example, if a polypeptide reagent is used, an antibody that binds to it can serve as an anti-reagent, provided that it binds to an epitope that is not involved in the recognition of antibodies in biological samples. Indirect means can also employ a ligand-receptor system, for example, a molecule such as a vitamin can be grafted onto the polypeptide reagent and the corresponding receptor can be immobilized on the solid phase. This is illustrated by the biotin-streptavidin system. Alternatively, indirect means can be used, e.g., by adding to the reagent a peptide tail, chemically or by genetic engineering, and immobilizing the grafted or fused product by passive adsorption or covalent linkage of the peptide tail. [0171]
  • According to a tenth aspect of the invention, there is provided a process for purifying, from a biological sample, a polypeptide or polypeptide derivative of the invention, which involves carrying out antibody-based affinity chromatography with the biological sample, wherein the antibody is a monospecific antibody of the invention. [0172]
  • For use in a purification process of the invention, the antibody can be polyclonal or monospecific, and preferably is of the IgG type. Purified IgGs can be prepared from an antiserum using standard methods (see, e.g., Coligan et al., supra). Conventional chromatography supports, as well as standard methods for grafting antibodies, are disclosed in, e.g., Antibodies: A Laboratory Manual, D. Lane, E. Harlow, Eds. (1988). [0173]
  • Briefly, a biological sample, such as an [0174] H. pylori extract, preferably in a buffer solution, is applied to a chromatography material, preferably equilibrated with the buffer used to dilute the biological sample so that the polypeptide or polypeptide derivative of the invention (i.e., the antigen) is allowed to adsorb onto the material. The chromatography material, such as a gel or a resin coupled to an antibody of the invention, can be in batch form or in a column. The unbound components are washed off and the antigen is then eluted with an appropriate elution buffer, such as a glycine buffer or a buffer containing a chaotropic agent, e.g., guanidine HCl, or high salt concentration (e.g., 3 M MgCl2). Eluted fractions are recovered and the presence of the antigen is detected, e.g., by measuring the absorbance at 280 nm.
  • An antibody of the invention can be screened for therapeutic efficacy as described as follows. According to an eleventh aspect of the invention, there is provided (i) a composition of matter containing a monospecific antibody of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a monospecific antibody of the invention, and (iii) a method for treating or preventing a Helicobacter (e.g., [0175] H. pylori, H. felis, H. mustelae, or H. heilmanii) infection, by administering a therapeutic or prophylactic amount of a monospecific antibody of the invention to an individual in need. Additionally, the eleventh aspect of the invention encompasses the use of a monospecific antibody of the invention in the preparation of a medicament for treating or preventing Helicobacter infection.
  • To this end, the monospecific antibody can be polyclonal or monoclonal, preferably of the IgA isotype (predominantly). In passive immunization, the antibody can be administered to a mucosal surface of a mammal, e.g., the gastric mucosa, e.g., orally or intragastrically, advantageously, in the presence of a bicarbonate buffer. Alternatively, systemic administration, not requiring a bicarbonate buffer, can be carried out. A monospecific antibody of the invention can be administered as a single active component or as a mixture with at least one monospecific antibody specific for a different Helicobacter polypeptide. The amount of antibody and the particular regimen used can readily be determined by those skilled in the art. For example, daily administration of about 100 to 1,000 mg of antibodies over one week, or three doses per day of about 100 to 1,000 mg of antibodies over two or three days, can be an effective regimens for most purposes. [0176]
  • Therapeutic or prophylactic efficacy can be evaluated using standard methods in the art, e.g., by measuring induction of a mucosal immune response or induction of protective and/or therapeutic immunity, using, e.g., the [0177] H. felis mouse model and the procedures described in Lee et al. (Eur. J. Gastroenterology and Hepatology 7:303, 1995) or Lee et al. (J. Infect. Dis. 172:161, 1995). Those skilled in the art will recognize that the H. felis strain of the model can be replaced with another Helicobacter strain. For example, the efficacy of DNA molecules and polypeptides from H. pylori is preferably evaluated in a mouse model using an H. pylori strain. Protection can be determined by comparing the degree of Helicobacter infection in the gastric tissue (assessed by urease activity, bacterial counts or gastritis) to that of a control group. Protection is shown when infection is reduced by comparison to the control group. Such an evaluation can be made for polynucleotides, vaccine vectors, polypeptides and derivatives thereof, as well as antibodies of the invention.
  • For example, various doses of an antibody of the invention can be administered to the gastric mucosa of mice previously challenged with an [0178] H. pylori strain, as described, e.g., in Lee et al (supra). Then, after an appropriate period of time, the bacterial load of the mucosa is estimated by assessing the urease activity, as compared to a control. Reduced urease activity indicates that the antibody is therapeutically effective.
  • Adjuvants useful in any of the vaccine compositions described above are as follows. [0179]
  • Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxy phosphate. The antigen can be precipitated with, or adsorbed onto, the aluminum compound according to standard protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton, Mont.), can be used in parenteral administration. [0180]
  • Adjuvants for mucosal administration include bacterial toxins, e.g., the cholera toxin (CT), the [0181] E. coli heat-labile toxin (LT), the Clostridium difficile toxin A and the pertussis toxin (PT), or combinations, subunits, toxoids, or mutants thereof. For example, a purified preparation of native cholera toxin subunit B (CTB) can be of use. Fragments, homologs, derivatives, and fusions to any of these toxins are also suitable, provided that they retain adjuvant activity. Preferably, a mutant having reduced toxicity is used. Suitable mutants are described, e.g., in WO 95/17211 (Arg-7-Lys CT mutant), WO 96/6627 (Arg-192-Gly LT mutant), and WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant). Additional LT mutants that can be used in the methods and compositions of the invention include, e.g., Ser-63-Lys, Ala-69-Gly, Glu-110-Asp, and Glu-112-Asp mutants. Other adjuvants, such as a bacterial monophosphoryl lipid A (MPLA) of, e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; saponins, or polylactide glycolide (PLGA) microspheres, can also be used in mucosal administration.
  • Adjuvants useful for both mucosal and parenteral administrations include polyphosphazene (WO 95/2415), DC-chol (3 β-(N-(N′,N′-dimethyl aminomethane)-carbamoyl) cholesterol; U.S. Pat. No. 5,283,185 and WO 96/14831) and QS-21 (WO 88/9336). [0182]
  • Any pharmaceutical composition of the invention, containing a polynucleotide, a polypeptide, a polypeptide derivative, or an antibody of the invention, can be manufactured in a conventional manner. In particular, it can be formulated with a pharmaceutically acceptable diluent or carrier, e.g., water or a saline solution such as phosphate buffer saline, optionally complemented with a bicarbonate salt, such as sodium bicarbonate, e.g., 0.1 to 0.5 M. Bicarbonate can be advantageously added to compositions intended for oral or intragastric administration. In general, a diluent or carrier can be selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical necessities for their use in pharmaceutical formulations, are described in [0183] Remington's Pharmaceutical Sciences, a standard reference text in this field and in the USP/NF.
  • The invention also includes methods in which gastroduodenal infections, such as Helicobacter infection, are treated by oral administration of a Helicobacter polypeptide of the invention and a mucosal adjuvant, in combination with an antibiotic, an antisecretory agent, a bismuth salt, an antacid, sucralfate, or a combination thereof. Examples of such compounds that can be administered with the vaccine antigen and the adjuvant are antibiotics, including, e.g., macrolides, tetracyclines, β-lactams, aminoglycosides, quinolones, penicillins, and derivatives thereof (specific examples of antibiotics that can be used in the invention include, e.g., amoxicillin, clarithromycin, tetracycline, metronidizole, erythromycin, cefuroxime, and erythromycin); antisecretory agents, including, e.g., H[0184] 2-receptor antagonists (e.g., cimetidine, ranitidine, famotidine, nizatidine, and roxatidine), proton pump inhibitors (e.g., omeprazole, lansoprazole, and pantoprazole), prostaglandin analogs (e.g., misoprostil and enprostil), and anticholinergic agents (e.g., pirenzepine, telenzepine, carbenoxolone, and proglumide); and bismuth salts, including colloidal bismuth subcitrate, tripotassium dicitrate bismuthate, bismuth subsalicylate, bicitropeptide, and pepto-bismol (see, e.g., Goodwin et al., Helicobacter pylori, Biology and Clinical Practice, CRC Press, Boca Raton, Fla., pp 366-395, 1993; Physicians' Desk Reference, 49th edn., Medical Economics Data Production Company, Montvale, N.J., 1995). In addition, compounds containing more than one of the above-listed components coupled together, e.g., ranitidine coupled to bismuth subcitrate, can be used. The invention also includes compositions for carrying out these methods, i.e., compositions containing a Helicobacter antigen (or antigens) of the invention, an adjuvant, and one or more of the above-listed compounds, in a pharmaceutically acceptable carrier or diluent.
  • Amounts of the above-listed compounds used in the methods and compositions of the invention can readily be determined by those skilled in the art. In addition, one skilled in the art can readily design treatment/immunization schedules. For example, the non-vaccine components can be administered on days 1-14, and the vaccine antigen+adjuvant can be administered on [0185] days 7, 14, 21, and 28.
  • Methods and pharmaceutical compositions of the invention can be used to treat or prevent Helicobacter infections and, accordingly, gastroduodenal diseases associated with these infections, including acute, chronic, and atrophic gastritis; and peptic ulcer diseases, e.g., gastric and duodenal ulcers. [0186]
  • All twenty-four clones of the invention were isolated by a transposon shuttle mutagenesis method. Briefly, in this method, a TnMax9 mini-blaM transposon was used for insertional mutagenesis of an [0187] H. pylori gene library established in E. coli. 192 E. coli clones expressing active β-lactamase fusion proteins were obtained, indicating that the corresponding target plasmids carry H. pylori genes encoding extracytoplasmic proteins. Individual mutants were transferred onto the chromosome of H. pylori P1 or P12 by natural transformation, resulting in 135 distinct H. pylori mutants. This method is described in further detail, as follows.
  • The transposon TnMax9 (Kahrs et al., Gene 167:53, 1995) was used to generate mutations in an [0188] H. pylori library in E. coli. As illustrated in FIG. 1A, TnMax9 contains, in addition to a catGC-resistance gene close to the inverted repeat (IR), an unexpressed open reading frame encoding β-lactamase without a promoter or leader sequence (mature β-lactamase, blaM; Kahrs et al., supra). For production of extracytoplasmic BlaM fusion proteins resulting in ampicillin-resistant (ampR) clones, expression of the cloned H. pylori genes in E. coli is obligatory. The minimal vector pMin2 (Kahrs et al., supra; see FIG. 1B), containing a weak constitutive promoter (Piga) upstream of the multiple cloning site, was used for construction of the H. pylori library to ensure expression of H. pylori genes in E. coli.
  • In construction of the library, [0189] H. pylori DNA was partially digested with Sau3A and HpaII, size fractionated by preparative agarose gel electrophoresis, and 3-6 kb fragments were ligated into the BglII and ClaI sites of pMin2. The library was introduced into E. coli strain E181(pTnMax9), which is a derivative of HB101 containing the TnMax9 transposon, by electroporation. This generated approximately 2,400 independent transformants. More than 95% of the plasmids contained an insert of between 3 and 6 kb, showing that the 1.7 Mb H. pylori chromosome was statistically covered. Since not every plasmid could be expected to contain a target gene carrying an export signal, the library was partitioned into a total of 198 pools (24 pools of 20 clones and 174 pools of 11 clones). Using a cotton swab, either eleven or twenty individual colonies were inoculated in 0.5 ml LB medium in a eppendorf tubes, vortexed, and 100 ml of the suspension was spread on LB agar plates supplemented with tetracycline and chloramphenicol to select for maintenance of both plasmids. Insertion of TnMax9 into the target plasmids was induced with 100 mM isopropyl-b-D-thiogalactoside (IPTG) separately for each pool (Haas et al., Gene 130:23-21, 1993). Plasmids were transferred into E145 by triparental mating, in which 25 ml of the donor strain (E181), 25 ml of the mobilisator (KB101(pRK2013)), and 50 ml of the recipient strain (E145) were mixed from corresponding bacterial suspensions (O.D.550=10). The matings were performed for 2-3 hours at 37° C. on nitrocellulose filters, which were placed on LB plates. Bacteria were suspended in 1 ml LB and aliquots were spread on LB plates containing chloramphenicol, tetracycline, and rifampicin. Each pool gave rise to chloramphenicol-resistant transconjugates in E145, demonstrating that both transposition and conjugation were successful. Generally, several thousand chloramphenicol-resistant transconjugates were obtained, but the number of ampR colonies varied in different pools, ranging from one to several hundred colonies. Two ampR colonies from each positive pool were isolated, plasmid DNA was extracted, and the DNA was characterized by further restriction analysis. Only those TnMax9 insertions of a single pool that mapped in obviously different plasmid clones, or in markedly different regions of the same clone, were used further.
  • From 158 of the 198 pools, ampicillin-resistant E145 transconjugates were obtained (80%), showing that in several pools, TnMax9 inserted into expressed genes, resulting in production of extracytoplasmic BlaM fusion proteins. Thus, a total of 192 amp[0190] R E145 clones could be isolated by conjugal transfer of plasmids from 198 pools.
  • To analyze the mutant library, it was determined whether defined gene sequences inactivated by TnMax9 were represented once or several times in the whole library. Five transposon-containing plasmids conferring an amp[0191] R phenotype to E145 (pMu7, pMu13, pMu75, pMu94, and pMu110) were randomly selected and DNA fragments flanking the TnMax9 insert were isolated and used as probes in Southern hybridization of 120 ampR clones. The hybridization probes isolated from clones pMu7, pMu75, and pMu94 were between 0.9 and 1.1 kb in size, and hybridized exclusively with the inserts of the homologous plasmids. In contrast, the TnMax9 flanking regions of clones pMu13 and pMu110 were 4.0 kb and 5.5 kb, respectively. They each hybridized with the homologous plasmids, and with one additional clone of the library. Such a result was expected, since the chance of a probe to find a homologous sequence in the library should be higher, the longer the hybridization probes.
  • In order to verify the insertion of the transposon into distinct ORFs encoding putative exported proteins, the TnMax9-flanking DNA of five representative amp[0192] R mutant clones (pMu7, pMu12, pMu18, pMu20, and pMu26) was sequenced, taking advantage of the M13 forward and reverse primers on TnMax9 (FIG. 1A). This analysis revealed that the mini-transposon was inserted into different sequences in each plasmid, thereby interrupting ORFs encoding putative proteins. For two clones, the sequences located upstream of the blaM gene revealed a putative ribosome-binding site and a potential translational start codon (ATG). Other clones either revealed an ORF spanning the complete sequence (approximately 400 basepairs upstream and downstream of the TnMax9 insertion) or termninating shortly after the site of TnMax9 insertion. The partial protein sequences from different ORFs were used for database searches, but no significant homologies with known proteins were found.
  • In a further approach, it was determined whether a known gene, like vacA, encoding the extracellular vacuolating cytotoxin of [0193] H. pylori, could be identified using this method and how often such a mutation would be represented in the mutant library. A total cell lysates of the 135 mutants were tested in an immunoblot using the H. pylori cytotoxin-specific rabbit antiserum AK197 (Schmitt et al., Mol. Microbiol. 12:307-319, 1994). Two mutants were identified, which no longer produced the cytotoxin antigen (mutants P1-26 and P1-47) and partial DNA sequencing of the insertion sites revealed that TnMax9 was inserted at distinct positions in the vacA gene, 56 and 53 codons downstream of the ATG start codon, respectively.
  • Thus, the characterization of the mutant collection confirmed that a representative gene library was constructed in [0194] E. coli, in which target genes encoding exported H. pylori proteins were efficiently tagged by TnMax9.
  • In order to establish a collection of mutants lacking distinct exported proteins, the mutations had to be transferred back into the [0195] H. pylori chromosome. By means of natural transformation, 86 plasmids could be transformed into the original strain P1. H. pylori strains P1 or P12, which were naturally competent for DNA transformation, were transformed with circular plasmid DNA (0.2-0.5 mg/transformation). Transformations to streptomycin resistance were performed with chromosomal DNA (1 mg/transformation), isolated from a streptomycin-resistant NCTC11637H. pylori mutant according to the procedure described in Haas et al. (Mol. Microbiol. 8:753-760). Selection was performed on serum plates containing 4 mg/ml chloramphenicol or 500 mg/ml streptomycin. The transformation frequency for a given mutant was calculated as the number of chloramphenicol-, streptomycin-, or erythromycin-resistant colonies per cfu (average of three experiments). The blaM gene was deleted by NotI digestion, and the plasmid religated, in those plasmids that did not transform strain P1 directly. This procedure, which resulted in a twenty to thirty-fold higher frequency of transformation, as compared to the same plasmid containing blaM, resulted in 36 additional mutants strain P1. The blaM-deletion plasmids that still did not transform strain P1 were used to transform the heterologous H. pylori strain P12, possessing an approximately 10-fold higher transformation frequency compared to P1. This resulted in thirteen further mutants.
  • Thus, from the 192 amp[0196] R plasmids a total of 135H. pylori mutants (122 mutants in P1 and 13 mutants in P12) were finally obtained by selection on chloramphenicol resistance (70%). The transformation frequency varied between different plasmids in the range of 1×10−5-1×10−7. The remaining plasmids did not result in any transformants. The collection was frozen as individual mutants in stock cultures at −70° C. To verify the correct insertion of the mini-transposon into the H. pylori chromosome, ten representative mutants were tested by Southern hybridization of chromosomal DNA using catGC DNA and the vector pMin2 as probes. Consistent with our previous experience concerning TnMax9-based shuttle mutagenesis of H. pylori, the mini-transposon was, in all cases, inserted into the chromosome without integration of the vector DNA, which probably means by a double cross-over, rather than by a single cross-over event. As judged from the hybridization pattern obtained with the cat gene as a probe, it appears that TnMax9 is located in different regions of the chromosome, showing that distinct target genes have been interrupted in individual mutants.
  • The mutants were analyzed for motility, transformation competence, and adherence to KatoIII cells. Screening of the [0197] H. pylori mutant collection allowed identification of mutants impaired in motility, natural transformation competence, and adherence to gastric epithelial cell lines. Motility mutants could be grouped into distinct classes: (i) mutants lacking the major flagellin subunit FlaA and intact flagella; (ii) mutants with apparently normal flagella, but reduced motility; and (iii) mutants with obviously normal flagella, but completely abolished motility. Two independent mutations, which exhibited defects in natural competence for genetic transformation, mapped to different genetic loci. In addition, two independent mutants were isolated by their failure to bind to the human gastric carcinoma cell line KatoIII. Both mutants carried a transposon in the same gene, approximately 0.8 kb apart, and showed decrease autoagglutination, when compared to the wild type strain.
  • The invention is further illustrated by the following examples. Example 1 describes isolation of DNA encoding a polypeptide of the invention, HPO76. The methods described in Example 1 can be adapted for isolating nucleic acids encoding the other polypeptides of the invention. Example 2 describes methods for obtaining the nucleic acids of the invention from the deposited clones. [0198]
    • EXAMPLE 1 Preparation of Isolated DNA Encoding HPO76
  • 1.A. Preparation of Genomic DNA from [0199] Helicobacter Pylori
  • [0200] Helicobacter pylori strain ORV2001, stored in LB medium containing 50% glycerol at −70° C., is grown on Colombia agar containing 7% sheep blood for 48 hours under microaerophilic conditions (8-10% CO2, 5-7% O2, 85-87% N2). Cells are harvested, washed with phosphate buffer saline (PBS; pH 7.2), and DNA is then extracted using the Rapid Prep Genomic DNA Isolation kit (Pharmacia Biotech).
  • 1.B. PCR Amplification [0201]
  • The DNA fragment is amplified from genomic DNA, as prepared above, by the Polymerase Chain Reaction (PCR) using the following primers: [0202]
    -N-terminal primer: 5′-GCC[GAGCTC]ITATCGTATGGACTTAGAACAT-3′ (SEQ ID NO:145)
    -C-terminal primer: 5′-GCC[CTCGAG]ATTAGAATAAGTGTTGTTTAAAATC-3′. (SEQ ID NO:146)
  • Both primers include a clamp (GCC) and a restriction enzyme recognition sequence for cloning purposes (SacI (GAGCTC) and XhoI (CTCGAG) recognition sequences). The underlined sequences in both primers represent clone 76-specific sequences. The N-terminal primer is designed so that the amplified product does not encode the leader sequence and the potential cleavage site. [0203]
  • Amplification of gene-specific DNA is carried out using Pwo DNA Polymerase (Boehringer Mannheim), which is a proof-reading polymerase, according to general guidance provided by the manufacturer. Because of the exonuclease activity of the polymerase, two reaction mixtures ([0204] mixtures 1 and 2) are first prepared separately and combined just prior to amplification. These mixtures are as follows:
    Ingredient (final conc.) Mixture 1 (l) Mixture 2 (l)
    distilled H2O 160 79
    dNTPs (200 M each) 40 —
    10x PCR buffer — 20
    primers (100 nM each) 1 —
    DNA template (200 ng) 2 —
    as obtained in 1.A.
  • Amplification is carried out as follows: [0205]
    Number of
    Cycling conditions Temp. (° C.) Time (min.) cycles
    Initial denaturing 96 4  1
    step
    Denaturing step
    94   0.5 20
    Annealing step 50 1 20
    Extension step 72 1 20
    Final extension step 72 5  1
  • 1.C. Transformation and Selection of Transformants [0206]
  • A single PCR product of 522 basepairs is thus amplified and is then digested at 37° C. for 2 hours with SacI and XhoI concurrently in a 20 μl reaction volume. The digested product is ligated to similarly cleaved pET28a (Novagen) that is dephosphorylated prior to the ligation by treatment with Calf Intestinal Alkaline Phosphatase (CIP). The gene fusion constructed in this manner allows one-step affinity purification of the resulting fusion protein because of the presence of histidine residues at the N-terminus of the fusion protein, which are encoded by the vector. [0207]
  • The ligation reaction (20 μl) is carried out at 14° C. overnight and then is used to transform 100 μl fresh [0208] E. coli XL1-blue competent cells (Novagen). The cells are incubated on ice for 2 hours, then heat-shocked at 42° C. for 30 seconds, and returned to ice for 90 seconds. The samples are then added to 1 ml LB broth in the absence of selection and grown at 37° C. for 2 hours. The cells are then plated out on LB agar plus kanamycin (50 μg/ml final concentration) at a 10× and neat dilution and incubated overnight at 37° C. The following day, 50 colonies are picked onto secondary plates and incubated at 37° C. overnight.
  • Five colonies are picked into 3 ml LB broth supplemented with kanamycin (100 μg/ml) and grown overnight at 37° C. Plasmid DNA is extracted using the Quiagen mini-prep. method and quantitated by agarose gel electrophoresis. [0209]
  • PCR is performed with the gene-specific primers under the conditions stated above and transformant DNA is confirmed to contain the desired insert. [0210]
  • If PCR-positive, one of the five plasmid DNA samples (500 ng) extracted from the [0211] E. coli XL1-blue cells is used to transform competent BL21 (IDE3) E. coli competent cells (Novagen; as described previously). Transformants (10) are picked onto selective kanamycin (50 μg/ml) containing LB agar plates and stored as a research stock in LB containing 50% glycerol.
  • 1.D. Recombinant Production of the Protein [0212]
  • Frozen stock (10 μl) is plated onto selection plates and grown for single colonies overnight at 37° C. A few cells are harvested from the plate and used as the inoculum for an overnight starter culture (3 ml) at 37° C. The following day, a sample (time ‘t’=0) is collected and centrifuged at 14,000 rpm for 3 minutes (samples are standardized by OD[0213] 600 for each time-point). The supernatant is discarded and the cells are stored at −20° C. for SDS-PAGE. This allows detection of leaky expression in the absence of the inducer IPTG. The overnight starter culture is then used to inoculate LB medium containing kanamycin (100 μg/ml) at a dilution of 1:50 (starting OD600=0.05−0.1). The cells are grown to an OD600 of 1.0, a sample is harvested for SDS-PAGE (pre-induction sample), and the remaining culture is induced with 1 mM IPTG. The cultures are grown for 4 hours and samples are taken every hour.
  • The culture is spun in a centrifuge at 6000× g for 20 minutes at 4° C. The supernatant is discarded and the pellets are resuspended in 50 ml of cold 50 mM Tris-HCl (pH 8.0), 2 mM EDTA, and spun as is described above. The supernatant is discarded and the cells are stored at −70° C. [0214]
  • 1.E. Protein Purification [0215]
  • Pellets obtained from a 1 liter culture prepared as described in 1.D. are thawed and resuspended in 20 ml of ice cold 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole. Lysozyme is added to a concentration of 0.1 mg/ml and the suspension is homogenized using a high speed homogenizer (Turrax), and subsequently is treated in a sonicator (Branson, Sonifier 450). To remove DNA, Benzonase (Merck) is used at a final concentration of 1 U/ml. The suspension is centrifuged at 40,000× g for 20 minutes and the supernatant is filtered through a 0.45 μm membrane. The supernatant is loaded onto an IMAC column (12 ml of resin) that has been prepared by immobilizing Ni[0216] ++ according to the recommendations of the manufacturer (Pharmacia). The column is washed with 10 column volumes of 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 60 mM Imidazole. The recombinant protein is eluted with 6 volumes of 20 mM Tris-HCl (pH 7.9), 0.5 M NaCl, 500 mM Imidazole, 0.1% Zwittergent 3-14.
  • The elution profile is monitored by measuring the absorbance of the fractions at OD 280 nm. An aliquot of each fraction is analyzed on SDS-PAGE gels and stained with Coomassie blue (Phast System—Pharmacia), and the fractions corresponding to the protein peak are then pooled and concentrated. To remove elution buffer, the fraction is passed over a G25 Sephadex column (Pharmacia), equilibrated in PBS (pH 7.4). The protein solution is filter-sterilized through a 0.45 μm membrane, and the protein concentration is determined by the BCA micromethod (Pierce). The protein solution is stored at −70° C. [0217]
  • 1.F. Evaluation of the Protective Activity of the Purified Protein [0218]
  • Groups of 8 Swiss-Webster mice (Taconic) are immunized orally with 25 μg of the purified recombinant protein, admixed with 5 μg of cholera toxin (Calbiochem) in physiological buffer. Mice are immunized on [0219] days 0, 7, 14, and 21. Fourteen days after the last immunization, the mice are challenged with H. pylori strain ORV2001 grown in liquid media (the cells are grown on agar plates as described in 1.1. and, after harvest, the cells are resuspended in Brucella broth; the flasks are incubated overnight at 37° C.). Fourteen days after challenge, the mice are sacrificed and their stomachs are removed. The amount of H. pylori is determined by measuring the urease activity in the stomach and by culture.
  • 1.G. Production of Monospecific Polyclonal Antibodies [0220]
  • 1.G.1. Hyperimmune Rabbit Antiserum [0221]
  • New Zealand rabbits are injected both subcutaneously and intramuscularly with 100 μg (in total) of the purified fusion polypeptide as obtained in 1.E., in the presence of Freund's complete adjuvant in a total volume of approximately 2 ml. Twenty-one and 42 days after the initial injection, booster doses, which are identical to priming doses, except that Freund's incomplete adjuvant is used, are administered in the same way. Fifteen days after the last injection, animal serum is recovered, decomplemented, and filtered through a 0.45 μm membrane. [0222]
  • 1.G.2. Mouse Hyperimmune Ascitic Fluid [0223]
  • Ten mice are injected subcutaneously with 10-50 μg of the purified fusion polypeptide as obtained in 1.E., in the presence of Freund's complete adjuvant in a volume of approximately 200 μl. 7 and 14 days after the initial injection, booster doses, which are identical to priming doses, except that Freund's incomplete adjuvant is used, are administered in the same way. 21 and 28 days after the initial infection, mice receive 50 μg of the antigen alone intraperitoneally. On day 21, mice are also injected intraperitoneally with [0224] sarcoma 180/TG cells CM26684 (Lennette et al., Diagnostic procedures for viral, rickettsial, and chlamydial infections, (1979) 5th Ed. Washington D.C., American Public Health Association). Ascites are collected 10-13 days after the last injection.
  • 1.H. Purification by Immunoaffinity [0225]
  • 1.H.1. Purification of Specific IgGs [0226]
  • An immune serum as prepared in section 1.G. is applied to a [0227] protein A Sepharose 4 Fast Flow column (Pharmacia) equilibrated in 100 mM Tris-HCl (pH 8.0). The resin is washed by applying 10 column volumes of 100 mM Tris-HCl and 10 volumes of 10 mM Tris-HCl (pH 8.0) to the column. IgGs are eluted with a 0.1 M glycine buffer (pH 3.0) and are collected as 5 ml fractions to which is added 0.25 ml 1 M Tris-HCl (pH 8.0). The optical density of the eluate is measured at 280 nm and the fractions containing the IgGs are pooled, and, if necessary, stored frozen at −70° C.
  • 1.H.2. Preparation of the Column [0228]
  • An appropriate amount of CNBr-activated Sepharose 4B gel (1 g of dried gel provides for approximately 3.5 ml of hydrated gel; gel capacity is of from 5 to 10 mg coupled IgGs per ml of gel) manufactured by Pharmacia (17-0430-01) is suspended in 1 mM HCl buffer and washed with a buchner by adding small quantities of 1 mM HCl buffer. The total volume of buffer is 200 ml per gram of gel. [0229]
  • Purified IgGs are dialyzed for 4 hours at 20±5° C. against 50 volumes of 500 mM sodium phosphate buffer (pH 7.5). Then they are diluted in 500 mM phosphate buffer (pH 7.5) to a final concentration of 3 mg/ml. [0230]
  • IgGs are incubated with the gel overnight at 5±3° C., under stirring. The gel is packed into a chromatography column and washed with 2 column volumes of 500 mM phosphate buffer (pH 7.5), then 1 volume of 50 mM sodium phosphate buffer, 500 mM NaCl (pH 7.5). The gel is then transferred to a tube and further incubated in 100 mM ethanolamine, (pH 7.5) for 4 hours at room temperature under stirring, then washed twice with 2 column volumes of PBS. The gel is then stored in 1/10,000 PBS merthiolate. The amount of IgGs coupled to the gel is determined by measuring the optical density (OD) at 280 nm of the IgG solution and the direct eluate, plus washings. [0231]
  • 1.H.3. Adsorption and Elution of the Antigen [0232]
  • An antigen solution in 50 mM Tris-HCl (pH 8.0), 2 mM EDTA, for example, the supernatant obtained in 1.E. after the Benzonase treatment, centrifugation, and filtration through a 0.45 μm membrane, is applied to a column equilibrated with 50 mM Tris-HCl (pH 8.0), 2 mM EDTA, at a flow rate of about 10 ml/hour. Then the column is washed with 20 [0233] volumes 50 mM Tris-HCl (pH 8.0), 2 mM EDTA. Alternatively, adsorption can be achieved in a batch that is let to stand overnight at 5±3° C., under stirring.
  • The gel is washed with 2 to 6 volumes of 10 mM sodium phosphate buffer (pH 6.8). The antigen is eluted with 100 mM glycine buffer (pH 2.5). The eluate is recovered in 3 ml fractions to which is added 150 μl 1 M sodium phosphate buffer (pH 8.0). OD is measured at 280 nm for each fraction; those containing the antigen are pooled and stored at −20° C. [0234]
    • EXAMPLE 2 Preparation of Isolated DNA Encoding the Polypeptides of the Invention from the Deposited Clones.
  • As mentioned above, [0235] E. coli strains including plasmids containing nucleic acids encoding HPO76 (98197), HPO18 (98210), HPO121(98201), HPO45 (98208), HPO101(98198), HPO116 (98200), HPO7 (98211), HPO104 (98199), HPO15 (98214), HPO58 (98206), HPO132 (98202), HPO9 (98203), HPO38 (98204), HPO87 (98205), HPO71(98217), HPO70 (98219), HPO80 (98215), HPO95 (98216), HPO98 (98218), HPO57 (98220), HPO50 (98207), HPO64 (98213), HPO54 (98212), and HPO42 (98209) were deposited in E. coli strain DH5α under the Budapest Treaty with the American Type Culture Collection (ATCC; Rockville, Md.) on Oct. 9, 1996 and were designated with accession numbers indicated in parentheses above. These plasmids each contain a genomic DNA BglII-ClaI insert from H. pylori strain P1 or P12 (referred to as 69-A and 888-0 in Haas et al., Mol. Microbiol. 8:753, 1993). Each of the inserts are disrupted by the presence of transposon TnMax9 (Kahrs et al., Gene 167:53, 1995). DNA molecules lacking the transposon can be amplified from the plasmids using standard PCR techniques, such as inverse and recombinant PCR (see, e.g., Innis et al., supra), so that a full-length H. pylori insert is reconstituted. For example, the H. pylori sequences flanking the transposon can each be amplified by PCR, and then ligated together to form the full-length H. pylori gene lacking the transposon. Primers that can be used in these methods for each of the twenty-four clones of the invention are shown in Table 1.
    • EXAMPLE 3 Purification of Recombinant H. Pylori Antigen from Clone 76 (HPO76)
  • A pellet of [0236] E. coli expressing HPO76 is homogenized in 5 mM imidazole, 500 mM sodium chloride, 20 mM Tris-HCl (pH 7.9) by microfluidization at a pressure of 15,000 psi, and clarified by centrifugation at 4000-5000 g.
  • [0237] Method 1
  • The pellet containing cloned protein is suspended in buffer containing 2% N-octyl glucoside (NOG) and is homogenized. The NOG soluble protein is removed by centrifugation. The pellet is extracted one more time with 2% NOG. After centrifugation, the pellet is dissolved in 8 M urea. The urea-solubilized protein is diluted with an equal volume of 2 M arginine and dialyzed against 1 M arginine for 24-48 hours to remove urea. The cloned protein remains in solution. SDS-PAGE and Coomassie staining, followed by densitometric scanning, shows that the protein is 80-85% pure cloned antigen. [0238]
  • [0239] Method 2
  • The pellet containing cloned protein is solubilized in 6 M guanidine hydrochloride and is passed through an IMAC column charged with Ni[0240] ++. The bound antigen is eluted with 8 M urea (pH 8.5). β-mercaptoethanol is added to eluted protein to a final concentration of 1 mM, then passed through a Sephadex G-25 column equilibrated in 0.1 M acetic acid. Protein eluted from Sephadex G-25 column is slowly added to 4 volumes of 50 mM phosphate (pH 7.0). The protein remains in solution.
  • Purification of Recombinant Proteins [0241]
  • Recombinant proteins expressed as Histidine-tagged fusion proteins can be solubilized and purified by using a metal affinity column (nickel column). The bound protein can be eluted with imidazole buffer, with or without urea, or by using low pH buffers, with or without urea. Urea or guanidine hydrochloride-denatured proteins can then be renatured using appropriate renaturing buffers. With a number of recombinant [0242] H. pylori antigens (HpaA and clone 76), renaturation conditions using arginine hydrochloride (0.25-1 M) have been determined.
  • Recombinant proteins without a His-tag can be solubilized and purified using immunoaffinity, ion-exchange, sizing, and/or hydrophobic chromatography. Proteins expressed as insoluble aggregates in inclusion bodies can be solubilized in denaturing agents, such as 8 M urea or 6 M guanidine hydrochloride. Appropriate folding and renaturation can readily be determined by one skilled in the art. [0243]
  • The above pellet containing cloned protein is suspended in 50 mM NaPO[0244] 4 (pH 7.5) containing 1% weight/volume N-octyl glucoside (NOG) and mixed vigorously. The NOG soluble impurities are removed by centrifugation. The remaining pellet is extracted one more time with the 1% NOG solution to further remove impurities. After centrifugation, the pellet is solubilized in 8 M urea, 50 mM Tris (pH 8.0). The Urea solubilized protein is diluted with an equal volume of 2 M Arginine, 50 mM Tris (pH 8.0), and is dialyzed against 1 M Arginine, 50 mM Tris, 50 mM NaCl (pH 8.0) for 24-48 hours to remove urea. The cloned protein remains in solution following dialysis. SDS-PAGE and Coomassie staining followed by densitometric scanning shows that the protein is 80-85% pure cloned antigen.
    • EXAMPLE 4 Method for Production of Transcriptional Fusions Lacking His-Tags
  • Methods for amplification and cloning of DNA encoding HPO76 as a transcriptional fusion lacking His-tags are described as follows. These methods can readily be adapted by one skilled in the art for similar amplification and cloning of DNA encoding the other polypeptides of the invention. [0245]
  • Amplification of [0246] Clone 76 DNA
  • Design of PCR Primers for Cloning [0247]
  • Two PCR primers are designed based on the complete gene sequence (see table 1). [0248]
  • The N-terminal primer (FC1) is designed to include the ribosome binding site of the target gene (underlined), the ATG start site (bold), and the leader sequence (with cleavage site). It includes a clamp (GCC) at the 5′ most end, and a SacI recognition sequence (GAGCTC) for cloning purposes. [0249]
  • The C-terminal primer (RN2) includes an XhoI recognition sequence for cloning purposes, and the natural TAA stop codon (bold). [0250]
    N-terminal primer (FC1) 5′GCC[GAGCTC]CAAGCAAAAAAATGTCAATTAAAAGGG3′ (SEQ ID NO:)
    C-terminal primer (RN2) 5′GCC[CTCGAG]GTCTAAATTAGAATAAGTGTTGTT 3′ (SEQ ID NO:)
  • Amplification of each specified gene can be achieved by employing FC1/RN2 primers for any of the genes described (see Table 1). [0251]
  • PCR Conditions [0252]
  • Amplification of gene-specific DNA is carried out using Pwo DNA Polymerase (Boehringer Mannheim) under the following conditions. Due to the exonuclease activity of the polymerase, two reaction mixtures are prepared separately and combined just prior to amplification. [0253]
    Reaction ingredients:
    Ingredient (final conc.) Mixture 1 (μl) Mixture 2 (μl)
    distilled H2O 160 79
    dNTPs (200 μM each) 40 —
    10X buffer — 20
    primer 1 (100 nM) 1 —
    primer 2 (100 nM) 1 —
    Template (200 ng) 2 0
    Cycling condition Temp (° C.) Time (min.) Number of cycles
    Initial denaturing step 96 4  1
    Denaturing step 94   0.5 20
    Annealing step 50 1 20
    Extension step 72 1 20
    Final extension step 72 1  1
  • A single PCR product of 624 basepairs is amplified and cloned into SacI-XhoI cleaved [0254] pET 24, allowing construction of a transcriptional fusion and expression of HPO76 antigen in the absence of a His-tag. In this instance, expressed product can be purified as a denatured protein that is re-folded by dialysis into 1 M arginine.
  • Cloning into [0255] pET 24 allows transcription from the T7 promoter, supplied by the vector, but relies upon binding of the RNA-specific DNA polymerase to the intrinsic ribosome binding site for HPO76, and thereby expression of the complete ORF. The amplification, restriction, and cloning protocols are as previously described for constructing translational fusions.
    TABLE 1
    RE-CONSTRUCTION OF A COMPLETE ORF BY RECOMBINANT PCR
    F′ denotes forward primer
    R′ denotes reverse primer
    C′ denotes coding strand
    N′ denotes non-coding strand
    Alt FC1 and RN2 primers have incorporated at their 5′ end a clamp and a recognition sequence
    for cloning purposes
    GGC clamp present for amplification and cloning of entire gene sequence from chromosomal DNA
    [X] denotes any nucleotide sequence not present in the completed gene sequence
    () Identifies region of overlap between the two original PCR products, and is consistently 10
    nucleotides long for each clone
    Length
    CLONE No. Prtmer type nt positions Primer sequence (5′-3′) of gene seq. Tm (oC)
    76 FC1 304-330 GCC[x] CAAGCAAAAAAATGTCAATTAAAAGGG 27 70
    RN1 413-391 TAAGTCCATACGATAGCCTATG 22 62
    FC2 404-436 (TATGGAACTTA) GAACATTTTAACACGCTCTATTA 33 60
    RN2 927-904 GCC [X] GTCTAAATTAGAATAAGTGTTGTT 24 60
    18 FC1 101-124 GCC[X] AATATATGGGAACTTAATGAGAAT 24 60
    RN1 227-206 TGCGAGATTTAACCTGTTTTCA 22 60
    FC2 218-249 (AAATCTCGCA) GAAATCTTTCACAAGCGAGCAA 32 60
    RN2 922-901 GCC [X] ATGTCATGTCAAACTATGAAGC 22 60
    121 FC1 141-164 GCC [X] TCACAATGGATAAAAACAACAACA 24 62
    RN1 451-473 GCCCTTTTGTTTAGGGGTTAG 21 62
    FC2 455-485 (ACAAAAGGGC) TTTTTAGAGCATGTGAGCCATC 32 62
    RN2 814-796 GCC [X] CTGTCCAAATCAGCCACCC 19 60
    45 FC1  1-26 GCC [X] ATGAAAAGATTTGATTTGTTTTTATC 26 62
    RN1 299-278 AAGCCGTATTGTTTGTTTTGGC 22 62
    FC2 290-323 (AATACGGCTTTAAAGCTATAGAAAATTTAAACGC) 34 60
    RN2 603-582 GCC[X] TTAAATATCCCAATCCTGCCAC 22 62
    101 FC1 308-332 GCC[X] GAAGGATTTATTATGATTAAAAGAA 25 60
    RN1 497-474 AACCTAATTTGAAATTCAAACCAT 24 60
    FC2 488-519 (AAATTAGGTT) TTGTAGGCTTTGCCAATAAATG 32 60
    RN2 893-869 GCC[X] AAGGAATAAATTAGAAAGTGAAGAA 25 62
    116 FC1 236-259 GCC [X] CGCATTGATTTGATGAATAAACC 23 62
    RN1 434-416 CGCCTATAACCGCTCCATT 19 60
    FC2 425-456 (GTTATAGGCG) ATAAAGGTTTAACGCAGCTAAG 32 60
    RN2 812-790 GCC [X] CTCACTAAAAAGCAATTTTTGAG 23 60
    7 FC1 195-220 GCC [X] TAAGGAATGAAGTTGATAAAATTTGT 26 64
    RN1 349-327 GCATTTTCATTCATTCTTTGGAC 23 60
    FC2 339-371 (ATGAAAATGC) ACGCCCAAATAATAAGGAAGTA 32 60
    RN2 738-717 GCC [X] GGATTTATTGAGCTTTCCCCTT 22 62
    104 FC1 251-271 GCC [X] AAAGGGCGAAAATGAGCAAGA 21 60
    RN1 429-407 TAAAATAACCAACAGAGTGATCA 23 60
    FC2 420-452 (GGTTATTTTA) GTGGATATTTGGGTTTATAGCGA 33 62
    RN2 784-761 GCC [X] TTTTTTAAGAATCACTTTCTTCGG 24 62
    58 GC1 118-143 GCC [X] ATAGGAACAAGCATGTTTTTTAAAAC 26 66
    RN1 434-413 TGAAGTCTTGCGATTTTTGCTT 22 60
    FC2 425-454 (CAAGACTTCA) AAAAAGAAGGAGCGGTTGCC 30 60
    RN2 650-630 GCC [X] CTGGCTTATTGCGTATCATC 20 60
    132 FC1 294-314 GGC [X] GGAAGAATAATGCTCGCTTCC 21 62
    RN1 409-378 ACTGGAGTGTGGATAAAACTAT 22 60
    FC2 400-430 (ACACTCCAGT) AGATGCTTTCCCGGATATTTC 31 60
    RN2 761-741 GCC [X] CTATTCTCCAGGGATATGGCC 21 64
    9 FC1 211-233 GCC [X] GATGGATTTTTTATGGGGGTGAG 23 64
    RN1 347-328 GGCACTGCCGCAGATTCTA 19 60
    FC2 338-370 (CGGCAGTGCC) TTTAGCCTATTATTTAGAAGCGA 33 60
    RN2 686-665 GCC [X] ATGGTATTTGTCTAAGACCCTC 22 62
    38 FC1 220-242 GCC [X] AAAAGGGTTTTAAATAATGGCTG 23 60
    RN1 348-327 ACAAGGATAAAAAACGCGCTAA 22 60
    FC2 239-371 (TTATCCTTGT) TGCTGGCTTGGTTTTTTTTAATT 33 60
    RN2 597-575 GCC [X] AAGATTCTAAAAGGGCTTCAAAT 23 60
    71 FC1  1-25 GCC [X] ATGTTGAAATTTAAATATGGTTTGA 25 60
    RN1 274-254 AAACCCCACTCTTATCATCGG 21 62
    FC2 265-294 (AGTGGGGTTT) TTTTAGGGGGTGGGTATGCT 30 60
    RN2 524-505 GCC [X] GAGCCTACAGGTTGCTTGC 20 60
    70 FC1  1-23 GCC [X] ATGGTATTTGACAGAACAATCAG 23 62
    RN1 115-96  GAAAAGCCACCCCGCTTATT 20 60
    FC2 106-137 (GTGGCTTTTC) AAAAAGAGTGGGTGCAACAATT 32 60
    RN2 495-471 GCC [X] TTAGGAATAGCATAACAAACAAACG 25 66
    80 FC1  1-25 GCC [X] ATGTTAGAAAAATTGATTGAAAGAG 25 62
    RN1 106-95  TGAACACATAGCCTAAAACCAC 21 62
    FC2  97-127 (TATGTGTTCA) TGAAAGAGTTGTGGCACATGC 31 62
    RN2 435-415 GCC [X] TTATGCGATAGGGGGCGTATC 21 66
    95 FC1  1-27 GCC [X] ATGAAAAAATTTTTTTCTCAATCTTT 27 60
    RN1 64-46 TGGCCAGTAGCGCGTTCAT 19 60
    FC2 55-98 (CTACTGGCCA) TGGATGGCAATGGCGTTTTTTTAG 34 68
    RN2 432-408 GCC [X] TTATTGATGAACATTAACCATTAAA 25 60
    98 FC1  1-22 GCC [X] ATGAAAACCTTTAAAAACCTGC 22 58
    RN1 43-23 TAGCGATCAGGCTAAAACAGA 21 60
    FC2 34-62 (CTGATCGCTA) TGAGTTGGCTCCAAGCGGA 29 60
    RN2 336-313 GCC [X] TTAAAACTCATAGCGTTTTTCAAT 24 60
    42 FC1 18-51 GCC [X] GAGAGTAGTGGCAGAGTTTATGCTGATTCCC 34 98
    RN1 380-351 (AACTTTTC)TCTATCCCAATTCGTTACGCTC 30 64
    FC2 366-396 (GGATAGA)GAAAAGTTTGGCGTCAAAAGTTGG 31 68
    RN2 822-801 GCC [X] GGCTTAAACTGGAACGGATTTC 22 64
    50 FC1 140-170 GCC [X] TAAAGTTTGCTAAAAAGATGGTTTTAATTTC 31 76
    RN1 297-270 (GACTTCTAAAG)CGTCCTTTTTTTCTTTA 28 56
    FC2 287-314 (CTTTA)GAAGTCATTAAACAAAGAGGGGT 29 64
    RN2 607-584 GCC [X] CCCATCTTTAGAAATCAACCCCCA 24 70
    64 FC1 23-50 GCC [X] GAAATAAGGAGTTTGTATGCAACAGCG 28 80
    RN1 225-149 (A)AGCTTTTCATTATCTTCCCCATAAGC 27 74
    FC2 216-244 (TGAAAAGCT)TTTAGCGAAGCGATCAAGCC 29 60
    RN2 1039-1012 GCC [X] CCCAATACTTTTATTGATTCACCATTTC 28 74
    54 FC1 21-48 GCC [X] CAATAAAACACCAAAATGAATGAGTTAC 28 68
    RN1 352-327 (A)GATTTTGTTTTGAGCGTTAGAAATG 26 66
    FC2 345-376 (CAAAATC)TATAAACTCAATCAAGTCAAAAATG 32 62
    RN2 1280-1255 GCC [X] GCATTTACCCCCTAAAAACTATAAAC 26 70
    15 FC1 14-35 GCC [X] CTGAAGGGTGTATGGTATTAGG 22 64
    RN1 157-132 (C)ACCATACATGTATCCTGCATTAATG 26 68
    FC2 147-179 (CATGTATGGT)GTAGCAAAGAATTTTAAGGAGGC 33 64
    RN2 377-349 GCC [X] CGTTAAAACTAAAGTTCTATTTTTAATTC 29 70
    57 FC1 13-39 GCC [X] GTAAGGAATGAGATGATAAAGAGTTGG 27 74
    RN1 267-244 (T)GGAATATTCTGATCCACGCCATC 24 68
    FC2 258-294 (GAATATTCC)AAAAGCCGTTTTTTATTACAGAAGAGC 37 76
    RN2 957-934 GCC [X] CTAAACTCTGGCTTATTGCGTATC 24 68
    87 FC1  1-22 GCC [X] ATGCGTTTATTATTGTGGTGGG 22 62
    RN1 27-3  (C)AATACCCACCACAATAATAAACGCAT 25 66
    FC2 18-50 (GTGGGTATT)GGTATTATCGCTCTTTTTAAATCC 33 64
    RN2 519-498 GCC [X] TTAAATTTTTAGGGAAAGGGTA 22 62
    CONDITIONS FOR RECOMBINANT PCR
    Two independent PCR reactions are carried out for FC1/RN1 and fC2/RN2 primers under the same
    conditions proposed for cloning genes for expression.
    After 20 cycles, the product of each reaction is used as template for a further 20 cycles with
    FC1/RN2 only
    The product will encompass the full length gene minus the transposon.
    The presence of restriction sites at the 5′ ends of these primers allows for cloning/expression
    studies.
  • [0256]
  • 0
    SEQUENCE LISTING
    <160> NUMBER OF SEQ ID NOS: 146
    <210> SEQ ID NO 1
    <211> LENGTH: 982
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (320)...(880)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (320)...(400)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (401)...(880)
    <400> SEQUENCE: 1
    agattagcag cagcagggat ttttaaattc ctggccaaca ggggcggttg gaaaaaaata 60
    cgattaaaaa ggcaaacgct ttgaaagtat tttttcatag aaattccctt ttgttaaatg 120
    attgaagttg gtgattatac ctatttgtat cttaaaaatt tgattttaaa agtttgagat 180
    ggttttgtag gtgtatccca cttatccaat ttatatcaat attttcactc taaaaccctc 240
    atccttgata aaaaattaaa ccttttagaa aaataaccga ttttagggtg taactttaat 300
    tcaacaagaa ggatttatt atg att aaa aga att gct tgt att tta agc ttg 352
    Met Ile Lys Arg Ile Ala Cys Ile Leu Ser Leu
    -25 -20
    agt gcg agt tta gcg ctg gct ggc gaa gtg aat ggg ttt ttc atg ggt 400
    Ser Ala Ser Leu Ala Leu Ala Gly Glu Val Asn Gly Phe Phe Met Gly
    -15 -10 -5
    gcg ggt tat cag caa ggt cgt tat ggt cct tat aac agc aat tac tct 448
    Ala Gly Tyr Gln Gln Gly Arg Tyr Gly Pro Tyr Asn Ser Asn Tyr Ser
    1 5 10 15
    gat tgg cgc cat ggc aat gat ctt tat ggt ttg aat ttc aaa tta ggt 496
    Asp Trp Arg His Gly Asn Asp Leu Tyr Gly Leu Asn Phe Lys Leu Gly
    20 25 30
    ttt gta ggc ttt gcc aat aaa tgg ttt ggg gct agg gtg tat ggc ttt 544
    Phe Val Gly Phe Ala Asn Lys Trp Phe Gly Ala Arg Val Tyr Gly Phe
    35 40 45
    tta gat tgg ttt aac act tca ggg aca gaa cac acc aaa acc aat ttg 592
    Leu Asp Trp Phe Asn Thr Ser Gly Thr Glu His Thr Lys Thr Asn Leu
    50 55 60
    ctc acc tat ggt ggc ggt ggc gat ttg att gtc aat ctc att cct ttg 640
    Leu Thr Tyr Gly Gly Gly Gly Asp Leu Ile Val Asn Leu Ile Pro Leu
    65 70 75 80
    gat aaa ttc gct cta ggt ctc atc ggt ggc gtt caa tta gcc gga aac 688
    Asp Lys Phe Ala Leu Gly Leu Ile Gly Gly Val Gln Leu Ala Gly Asn
    85 90 95
    act tgg atg ttc cct tat gat gtc aat caa acg aga ttc cag ttc tta 736
    Thr Trp Met Phe Pro Tyr Asp Val Asn Gln Thr Arg Phe Gln Phe Leu
    100 105 110
    tgg aat tta ggc gga aga atg cgt gtt ggg gat cgc agt gcg ttt gaa 784
    Trp Asn Leu Gly Gly Arg Met Arg Val Gly Asp Arg Ser Ala Phe Glu
    115 120 125
    gca ggc gtg aaa ttc cct atg gtt aat caa ggc aac aaa gat gtt agg 832
    Ala Gly Val Lys Phe Pro Met Val Asn Gln Gly Asn Lys Asp Val Arg
    130 135 140
    gct tat ccg cta cta ttc ttg ggt atg tgg att atg ttc ttc act ttc 880
    Ala Tyr Pro Leu Leu Phe Leu Gly Met Trp Ile Met Phe Phe Thr Phe
    145 150 155 160
    taatttattc ctttcattcg ctcttcttca tcaaatcaac cctaacccac tcttaaaagg 940
    ttggggttca aaaatctttt tcataaataa aatttgcctt aa 982
    <210> SEQ ID NO 2
    <211> LENGTH: 187
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 2
    Met Ile Lys Arg Ile Ala Cys Ile Leu Ser Leu Ser Ala Ser Leu Ala
    1 5 10 15
    Leu Ala Gly Glu Val Asn Gly Phe Phe Met Gly Ala Gly Tyr Gln Gln
    20 25 30
    Gly Arg Tyr Gly Pro Tyr Asn Ser Asn Tyr Ser Asp Trp Arg His Gly
    35 40 45
    Asn Asp Leu Tyr Gly Leu Asn Phe Lys Leu Gly Phe Val Gly Phe Ala
    50 55 60
    Asn Lys Trp Phe Gly Ala Arg Val Tyr Gly Phe Leu Asp Trp Phe Asn
    65 70 75 80
    Thr Ser Gly Thr Glu His Thr Lys Thr Asn Leu Leu Thr Tyr Gly Gly
    85 90 95
    Gly Gly Asp Leu Ile Val Asn Leu Ile Pro Leu Asp Lys Phe Ala Leu
    100 105 110
    Gly Leu Ile Gly Gly Val Gln Leu Ala Gly Asn Thr Trp Met Phe Pro
    115 120 125
    Tyr Asp Val Asn Gln Thr Arg Phe Gln Phe Leu Trp Asn Leu Gly Gly
    130 135 140
    Arg Met Arg Val Gly Asp Arg Ser Ala Phe Glu Ala Gly Val Lys Phe
    145 150 155 160
    Pro Met Val Asn Gln Gly Asn Lys Asp Val Arg Ala Tyr Pro Leu Leu
    165 170 175
    Phe Leu Gly Met Trp Ile Met Phe Phe Thr Phe
    180 185
    <210> SEQ ID NO 3
    <211> LENGTH: 843
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (262)...(777)
    <400> SEQUENCE: 3
    ccaatggagg cgtttccaaa aacccaaacg ggcgcttttt aaagaaaaat ctcaaaaaat 60
    tcagggagca agcggtaaaa atcgtagaaa aacgcttgat aaaagagaat atgcaactga 120
    gcgattttaa tgaagaagaa ttaaaaatca tgtttgaagc tgaagaaaaa aggttgttag 180
    agcaaatcca cgctaaagaa ttgaaagaaa agcaagaaaa aaccaccaag cattttaaag 240
    aagtttggga aaagggcgaa a atg agc aag aaa aat agc gta att tct ggt 291
    Met Ser Lys Lys Asn Ser Val Ile Ser Gly
    1 5 10
    tta atg aat ttt ttt agc gaa aag aat gaa cgc tgg ctc tta gcc cac 339
    Leu Met Asn Phe Phe Ser Glu Lys Asn Glu Arg Trp Leu Leu Ala His
    15 20 25
    agg cac acg aga ggg ttt gtg ata gtg gcg tgg ctt ttt cgg ttt aaa 387
    Arg His Thr Arg Gly Phe Val Ile Val Ala Trp Leu Phe Arg Phe Lys
    30 35 40
    agc att gcg ttt tct att ttg atc act ctg ttg gtt att tta gtg gat 435
    Ser Ile Ala Phe Ser Ile Leu Ile Thr Leu Leu Val Ile Leu Val Asp
    45 50 55
    att tgg gtt tat agc gat gtg cgt cag ttt tta ttg gac act tct agc 483
    Ile Trp Val Tyr Ser Asp Val Arg Gln Phe Leu Leu Asp Thr Ser Ser
    60 65 70
    tct ttt att tgg ctt ttg atc gct tta cta atc aag tgg ggc gtg att 531
    Ser Phe Ile Trp Leu Leu Ile Ala Leu Leu Ile Lys Trp Gly Val Ile
    75 80 85 90
    gtc ata agc gca cgt aaa tgc tac caa ttc agc caa aaa atg ttt acg 579
    Val Ile Ser Ala Arg Lys Cys Tyr Gln Phe Ser Gln Lys Met Phe Thr
    95 100 105
    ctc att caa aga aaa agg caa atc aga gag aat tta aaa aac cgc tcc 627
    Leu Ile Gln Arg Lys Arg Gln Ile Arg Glu Asn Leu Lys Asn Arg Ser
    110 115 120
    aac tac aaa gat acc aaa aat gcg gaa aaa ctc tct agc atc gct gaa 675
    Asn Tyr Lys Asp Thr Lys Asn Ala Glu Lys Leu Ser Ser Ile Ala Glu
    125 130 135
    gaa atc att tca aaa aaa caa gaa gag tcc cgc ccc aaa gaa gat tct 723
    Glu Ile Ile Ser Lys Lys Gln Glu Glu Ser Arg Pro Lys Glu Asp Ser
    140 145 150
    aat cat gaa aac cat aaa gaa aag ctt tct aac att acc gaa gaa agt 771
    Asn His Glu Asn His Lys Glu Lys Leu Ser Asn Ile Thr Glu Glu Ser
    155 160 165 170
    gat tct taaaaaacaa gaggaattga aaagctaaaa aggatagggg gggattaccc 827
    Asp Ser
    aaagcatatt ggaggg 843
    <210> SEQ ID NO 4
    <211> LENGTH: 172
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 4
    Met Ser Lys Lys Asn Ser Val Ile Ser Gly Leu Met Asn Phe Phe Ser
    1 5 10 15
    Glu Lys Asn Glu Arg Trp Leu Leu Ala His Arg His Thr Arg Gly Phe
    20 25 30
    Val Ile Val Ala Trp Leu Phe Arg Phe Lys Ser Ile Ala Phe Ser Ile
    35 40 45
    Leu Ile Thr Leu Leu Val Ile Leu Val Asp Ile Trp Val Tyr Ser Asp
    50 55 60
    Val Arg Gln Phe Leu Leu Asp Thr Ser Ser Ser Phe Ile Trp Leu Leu
    65 70 75 80
    Ile Ala Leu Leu Ile Lys Trp Gly Val Ile Val Ile Ser Ala Arg Lys
    85 90 95
    Cys Tyr Gln Phe Ser Gln Lys Met Phe Thr Leu Ile Gln Arg Lys Arg
    100 105 110
    Gln Ile Arg Glu Asn Leu Lys Asn Arg Ser Asn Tyr Lys Asp Thr Lys
    115 120 125
    Asn Ala Glu Lys Leu Ser Ser Ile Ala Glu Glu Ile Ile Ser Lys Lys
    130 135 140
    Gln Glu Glu Ser Arg Pro Lys Glu Asp Ser Asn His Glu Asn His Lys
    145 150 155 160
    Glu Lys Leu Ser Asn Ile Thr Glu Glu Ser Asp Ser
    165 170
    <210> SEQ ID NO 5
    <211> LENGTH: 904
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (248)...(805)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (248)...(298)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (299)...(805)
    <400> SEQUENCE: 5
    aaaaaggccc ccatttttaa aagaaaatgg ggggctttaa caaggaagtg aacttgttgt 60
    atgaagaaaa ttctaaagaa cgcgatcaaa aaagcgcatc aaagtttatc cactatccct 120
    ctaagttctt cactctatgc tataatctct gttttaaaac attatggcgt gttagaagat 180
    attcagcaaa acccttccaa accaaccaat ctaaagaaag aaaccattca aggaacgcat 240
    tgatttg atg aat aaa cca ttt tta atc tta ctc ata gcc cta att gtc 289
    Met Asn Lys Pro Phe Leu Ile Leu Leu Ile Ala Leu Ile Val
    -15 -10 -5
    ttt agc ggc tgt aac atg aga aaa tat ttc aaa ccc gct aaa cac caa 337
    Phe Ser Gly Cys Asn Met Arg Lys Tyr Phe Lys Pro Ala Lys His Gln
    1 5 10
    gtt aaa ggc gaa gcg tat ttc cct aat cat ttg caa gaa agt atc gtt 385
    Val Lys Gly Glu Ala Tyr Phe Pro Asn His Leu Gln Glu Ser Ile Val
    15 20 25
    tcg tct aat cgt tat gga gcc att ttg aaa aat gga gcg gtt ata ggc 433
    Ser Ser Asn Arg Tyr Gly Ala Ile Leu Lys Asn Gly Ala Val Ile Gly
    30 35 40 45
    gat aaa ggt tta acg cag cta aga atc ggt aag aat ttc aat tat gaa 481
    Asp Lys Gly Leu Thr Gln Leu Arg Ile Gly Lys Asn Phe Asn Tyr Glu
    50 55 60
    agc agt ttt tta aat gag agt cag ggg ttt ttc atc ctt gcg caa gat 529
    Ser Ser Phe Leu Asn Glu Ser Gln Gly Phe Phe Ile Leu Ala Gln Asp
    65 70 75
    tgt ttg aac aag att gat aaa aaa aca agc aaa aac aag gtg gct aaa 577
    Cys Leu Asn Lys Ile Asp Lys Lys Thr Ser Lys Asn Lys Val Ala Lys
    80 85 90
    agt gag gaa acg gag ctg aaa tta aag ggc gtt gaa gcc gaa gtc caa 625
    Ser Glu Glu Thr Glu Leu Lys Leu Lys Gly Val Glu Ala Glu Val Gln
    95 100 105
    gat aaa gtc tgt cat caa gtg gaa ttg att agc aat aac cct aac gcc 673
    Asp Lys Val Cys His Gln Val Glu Leu Ile Ser Asn Asn Pro Asn Ala
    110 115 120 125
    agc caa caa tct atc gtt atc cct ttg gag act ttt gcc ttg agc gca 721
    Ser Gln Gln Ser Ile Val Ile Pro Leu Glu Thr Phe Ala Leu Ser Ala
    130 135 140
    agc gtt aaa ggg aat ctt tta gcg gtg gtg ttt agc gga caa ttc agc 769
    Ser Val Lys Gly Asn Leu Leu Ala Val Val Phe Ser Gly Gln Phe Ser
    145 150 155
    gaa ttt ata cga cat cac ttc tca aaa att gct ttt tagtgagaaa 815
    Glu Phe Ile Arg His His Phe Ser Lys Ile Ala Phe
    160 165
    ggttccccaa gcaccacgat caattcttta atggcgaatg cctattttta atggatacgg 875
    tccttgtgtt tcccccaagc caaaatggg 904
    <210> SEQ ID NO 6
    <211> LENGTH: 186
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 6
    Met Asn Lys Pro Phe Leu Ile Leu Leu Ile Ala Leu Ile Val Phe Ser
    1 5 10 15
    Gly Cys Asn Met Arg Lys Tyr Phe Lys Pro Ala Lys His Gln Val Lys
    20 25 30
    Gly Glu Ala Tyr Phe Pro Asn His Leu Gln Glu Ser Ile Val Ser Ser
    35 40 45
    Asn Arg Tyr Gly Ala Ile Leu Lys Asn Gly Ala Val Ile Gly Asp Lys
    50 55 60
    Gly Leu Thr Gln Leu Arg Ile Gly Lys Asn Phe Asn Tyr Glu Ser Ser
    65 70 75 80
    Phe Leu Asn Glu Ser Gln Gly Phe Phe Ile Leu Ala Gln Asp Cys Leu
    85 90 95
    Asn Lys Ile Asp Lys Lys Thr Ser Lys Asn Lys Val Ala Lys Ser Glu
    100 105 110
    Glu Thr Glu Leu Lys Leu Lys Gly Val Glu Ala Glu Val Gln Asp Lys
    115 120 125
    Val Cys His Gln Val Glu Leu Ile Ser Asn Asn Pro Asn Ala Ser Gln
    130 135 140
    Gln Ser Ile Val Ile Pro Leu Glu Thr Phe Ala Leu Ser Ala Ser Val
    145 150 155 160
    Lys Gly Asn Leu Leu Ala Val Val Phe Ser Gly Gln Phe Ser Glu Phe
    165 170 175
    Ile Arg His His Phe Ser Lys Ile Ala Phe
    180 185
    <210> SEQ ID NO 7
    <211> LENGTH: 874
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (146)...(802)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (146)...(208)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (209)...(802)
    <400> SEQUENCE: 7
    gcaaaaattt ggctggaaag cccctaggtt ggatccaatt ttgataagga tttttaaccg 60
    gcaatttaaa aactattact ccctgggatg gttcataatg caaaaaagcc aacgcaactt 120
    aatacttcat taaggtttaa tcaca atg gat aaa aac aac aac acg aat ctt 172
    Met Asp Lys Asn Asn Asn Thr Asn Leu
    -20 -15
    att tta gcg atc gct ctg tct ttc ttg ttt atc gct ctt tat agg tat 220
    Ile Leu Ala Ile Ala Leu Ser Phe Leu Phe Ile Ala Leu Tyr Arg Tyr
    -10 -5 1
    ttt ttc caa aaa cca aac aaa aca aca acc caa acc aca aag caa gaa 268
    Phe Phe Gln Lys Pro Asn Lys Thr Thr Thr Gln Thr Thr Lys Gln Glu
    5 10 15 20
    aca gcc aac aac cac aca gca aca agt cct aac gcg ccc aac gcc caa 316
    Thr Ala Asn Asn His Thr Ala Thr Ser Pro Asn Ala Pro Asn Ala Gln
    25 30 35
    aat ttt agc gtt act caa acc atc ccc caa gag agt ttg tta agc acg 364
    Asn Phe Ser Val Thr Gln Thr Ile Pro Gln Glu Ser Leu Leu Ser Thr
    40 45 50
    att tct ttt gag cat gcc agg att gaa att gat tct tta ggg cgc atc 412
    Ile Ser Phe Glu His Ala Arg Ile Glu Ile Asp Ser Leu Gly Arg Ile
    55 60 65
    aaa cag gtt tat ctc aag gat aaa aag tat cta acc cct aaa caa aag 460
    Lys Gln Val Tyr Leu Lys Asp Lys Lys Tyr Leu Thr Pro Lys Gln Lys
    70 75 80
    ggc ttt tta gag cat gtg agc cat ctt ttt aac ccc aaa gct aac ccg 508
    Gly Phe Leu Glu His Val Ser His Leu Phe Asn Pro Lys Ala Asn Pro
    85 90 95 100
    caa ccc ccc cta aaa gag ctc ccc ctt tta gcg gcc gat aaa ctc aag 556
    Gln Pro Pro Leu Lys Glu Leu Pro Leu Leu Ala Ala Asp Lys Leu Lys
    105 110 115
    cct tta gaa gtg cgt ttt tta gac ccc acg ctc aat aac aaa gcg ttc 604
    Pro Leu Glu Val Arg Phe Leu Asp Pro Thr Leu Asn Asn Lys Ala Phe
    120 125 130
    aac acc cct tat agt gct tca aaa acc act ctt ggg cct aat gaa cag 652
    Asn Thr Pro Tyr Ser Ala Ser Lys Thr Thr Leu Gly Pro Asn Glu Gln
    135 140 145
    ctt gtt tta acc caa gat tta ggc gct ctt acc atc att aaa acc ctg 700
    Leu Val Leu Thr Gln Asp Leu Gly Ala Leu Thr Ile Ile Lys Thr Leu
    150 155 160
    act ttt tat gat gat ttg cat tat gat tta aga atc gcc ttc aaa tcg 748
    Thr Phe Tyr Asp Asp Leu His Tyr Asp Leu Arg Ile Ala Phe Lys Ser
    165 170 175 180
    cct aac aat att atc cct agc tat gtg atc act aat ggt tac aga ccg 796
    Pro Asn Asn Ile Ile Pro Ser Tyr Val Ile Thr Asn Gly Tyr Arg Pro
    185 190 195
    ggt ggc tgatttggac agctacacct tttcgggcgt gcatattaga aaacaacgac 852
    Gly Gly
    gaaaaattaa gggtattgaa ca 874
    <210> SEQ ID NO 8
    <211> LENGTH: 219
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 8
    Met Asp Lys Asn Asn Asn Thr Asn Leu Ile Leu Ala Ile Ala Leu Ser
    1 5 10 15
    Phe Leu Phe Ile Ala Leu Tyr Arg Tyr Phe Phe Gln Lys Pro Asn Lys
    20 25 30
    Thr Thr Thr Gln Thr Thr Lys Gln Glu Thr Ala Asn Asn His Thr Ala
    35 40 45
    Thr Ser Pro Asn Ala Pro Asn Ala Gln Asn Phe Ser Val Thr Gln Thr
    50 55 60
    Ile Pro Gln Glu Ser Leu Leu Ser Thr Ile Ser Phe Glu His Ala Arg
    65 70 75 80
    Ile Glu Ile Asp Ser Leu Gly Arg Ile Lys Gln Val Tyr Leu Lys Asp
    85 90 95
    Lys Lys Tyr Leu Thr Pro Lys Gln Lys Gly Phe Leu Glu His Val Ser
    100 105 110
    His Leu Phe Asn Pro Lys Ala Asn Pro Gln Pro Pro Leu Lys Glu Leu
    115 120 125
    Pro Leu Leu Ala Ala Asp Lys Leu Lys Pro Leu Glu Val Arg Phe Leu
    130 135 140
    Asp Pro Thr Leu Asn Asn Lys Ala Phe Asn Thr Pro Tyr Ser Ala Ser
    145 150 155 160
    Lys Thr Thr Leu Gly Pro Asn Glu Gln Leu Val Leu Thr Gln Asp Leu
    165 170 175
    Gly Ala Leu Thr Ile Ile Lys Thr Leu Thr Phe Tyr Asp Asp Leu His
    180 185 190
    Tyr Asp Leu Arg Ile Ala Phe Lys Ser Pro Asn Asn Ile Ile Pro Ser
    195 200 205
    Tyr Val Ile Thr Asn Gly Tyr Arg Pro Gly Gly
    210 215
    <210> SEQ ID NO 9
    <211> LENGTH: 761
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (303)...(758)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (303)...(362)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (363)...(758)
    <400> SEQUENCE: 9
    taaaaaatgc aaaaacattt ttgggttatt aaaaagattc cttctaggag tcgaacctgc 60
    caggcatgca aggtagcttt cgcgagcttt gagatccctt caaacgcttt gattagaaac 120
    gggaaagatt acctggtgtt tgtgagaacg cctaaaggtt ttaggcctgt ggtggttcaa 180
    gttttagaag agcgcagcaa gatttttatc gtgaacgctc aaaatttaca ccctaatgac 240
    agcgtggcag tggggtcatt gatagggtta aaaggcatga tcaacaattt aggggaagaa 300
    ta atg ctc gct tcc att att gaa ttt tcc tta cgc cag cga ata atc 347
    Met Leu Ala Ser Ile Ile Glu Phe Ser Leu Arg Gln Arg Ile Ile
    -20 -15 -10
    gtg att gtt ggc gcg att ctt att ttg ttt ttt ggg act tat agt ttt 395
    Val Ile Val Gly Ala Ile Leu Ile Leu Phe Phe Gly Thr Tyr Ser Phe
    -5 1 5 10
    atc cac act cca gta gat gct ttc ccg gat att tcg ccc act caa gtc 443
    Ile His Thr Pro Val Asp Ala Phe Pro Asp Ile Ser Pro Thr Gln Val
    15 20 25
    aaa atc att tta aaa ctc ccc ggt tct agc cct gaa gaa atg gaa aat 491
    Lys Ile Ile Leu Lys Leu Pro Gly Ser Ser Pro Glu Glu Met Glu Asn
    30 35 40
    aac atc gtg cgc cct tta gaa ttg gag ctt tta ggc ttg aaa ggg caa 539
    Asn Ile Val Arg Pro Leu Glu Leu Glu Leu Leu Gly Leu Lys Gly Gln
    45 50 55
    aaa tct tta aga agt att tca aaa tat tct att tca gac atc acg ata 587
    Lys Ser Leu Arg Ser Ile Ser Lys Tyr Ser Ile Ser Asp Ile Thr Ile
    60 65 70 75
    gat ttt gat gac agc gtg gat att tat tta gcg aga aac att gtt aat 635
    Asp Phe Asp Asp Ser Val Asp Ile Tyr Leu Ala Arg Asn Ile Val Asn
    80 85 90
    gag cgc ttg agc agc gtg atg aaa gat tta ccc gtg ggg gtt gaa agg 683
    Glu Arg Leu Ser Ser Val Met Lys Asp Leu Pro Val Gly Val Glu Arg
    95 100 105
    ggc atg gcg ccc att gtt acg ccg cta tca aat atc ttt atg ttt cac 731
    Gly Met Ala Pro Ile Val Thr Pro Leu Ser Asn Ile Phe Met Phe His
    110 115 120
    tat tgg atg ggc cat atc cct gga gaa tag 761
    Tyr Trp Met Gly His Ile Pro Gly Glu
    125 130
    <210> SEQ ID NO 10
    <211> LENGTH: 152
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 10
    Met Leu Ala Ser Ile Ile Glu Phe Ser Leu Arg Gln Arg Ile Ile Val
    1 5 10 15
    Ile Val Gly Ala Ile Leu Ile Leu Phe Phe Gly Thr Tyr Ser Phe Ile
    20 25 30
    His Thr Pro Val Asp Ala Phe Pro Asp Ile Ser Pro Thr Gln Val Lys
    35 40 45
    Ile Ile Leu Lys Leu Pro Gly Ser Ser Pro Glu Glu Met Glu Asn Asn
    50 55 60
    Ile Val Arg Pro Leu Glu Leu Glu Leu Leu Gly Leu Lys Gly Gln Lys
    65 70 75 80
    Ser Leu Arg Ser Ile Ser Lys Tyr Ser Ile Ser Asp Ile Thr Ile Asp
    85 90 95
    Phe Asp Asp Ser Val Asp Ile Tyr Leu Ala Arg Asn Ile Val Asn Glu
    100 105 110
    Arg Leu Ser Ser Val Met Lys Asp Leu Pro Val Gly Val Glu Arg Gly
    115 120 125
    Met Ala Pro Ile Val Thr Pro Leu Ser Asn Ile Phe Met Phe His Tyr
    130 135 140
    Trp Met Gly His Ile Pro Gly Glu
    145 150
    <210> SEQ ID NO 11
    <211> LENGTH: 392
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (25)...(366)
    <400> SEQUENCE: 11
    gaattgaacc atgctgaagg gtgt atg gta tta gga agc tta tac cat cat 51
    Met Val Leu Gly Ser Leu Tyr His His
    1 5
    ggc tta ggc acg cct aag gat tca aga aag gct ctt gat ttg tat gaa 99
    Gly Leu Gly Thr Pro Lys Asp Ser Arg Lys Ala Leu Asp Leu Tyr Glu
    10 15 20 25
    aaa gct tgc gat tta aaa gac agc ccc ggg tgc att aat gca gga tac 147
    Lys Ala Cys Asp Leu Lys Asp Ser Pro Gly Cys Ile Asn Ala Gly Tyr
    30 35 40
    atg tat ggt gta gca aag aat ttt aag gag gct att gtt cgt tat tct 195
    Met Tyr Gly Val Ala Lys Asn Phe Lys Glu Ala Ile Val Arg Tyr Ser
    45 50 55
    aag gca tgc gaa ttg aaa gat ggc agg ggg tgt tat aat tta ggg gtt 243
    Lys Ala Cys Glu Leu Lys Asp Gly Arg Gly Cys Tyr Asn Leu Gly Val
    60 65 70
    atg caa tac aac gcc caa ggc aca gca aag gac gaa aag caa gcg gta 291
    Met Gln Tyr Asn Ala Gln Gly Thr Ala Lys Asp Glu Lys Gln Ala Val
    75 80 85
    gaa aac ttt aaa aaa ggt tgc aaa tca agc gtt aaa gaa gca tgc gac 339
    Glu Asn Phe Lys Lys Gly Cys Lys Ser Ser Val Lys Glu Ala Cys Asp
    90 95 100 105
    gct ctc aag gaa tta aaa ata gaa ctt tagttttaac gaagttaagc 386
    Ala Leu Lys Glu Leu Lys Ile Glu Leu
    110
    taaagg 392
    <210> SEQ ID NO 12
    <211> LENGTH: 114
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 12
    Met Val Leu Gly Ser Leu Tyr His His Gly Leu Gly Thr Pro Lys Asp
    1 5 10 15
    Ser Arg Lys Ala Leu Asp Leu Tyr Glu Lys Ala Cys Asp Leu Lys Asp
    20 25 30
    Ser Pro Gly Cys Ile Asn Ala Gly Tyr Met Tyr Gly Val Ala Lys Asn
    35 40 45
    Phe Lys Glu Ala Ile Val Arg Tyr Ser Lys Ala Cys Glu Leu Lys Asp
    50 55 60
    Gly Arg Gly Cys Tyr Asn Leu Gly Val Met Gln Tyr Asn Ala Gln Gly
    65 70 75 80
    Thr Ala Lys Asp Glu Lys Gln Ala Val Glu Asn Phe Lys Lys Gly Cys
    85 90 95
    Lys Ser Ser Val Lys Glu Ala Cys Asp Ala Leu Lys Glu Leu Lys Ile
    100 105 110
    Glu Leu
    <210> SEQ ID NO 13
    <211> LENGTH: 982
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (117)...(911)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (117)...(167)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (168)...(911)
    <400> SEQUENCE: 13
    ccacatttaa ggtagaaacc actcaattag atgtaaaaat tccaaacggc aaccaaaaaa 60
    tggttaaaaa ggacacaata aaccccaaaa atgaaattta aatatatggg aactta atg 119
    Met
    aga att ttt ttt gtt atc atg gga ctt gtg ttt ttt ggt tgc acc agt 167
    Arg Ile Phe Phe Val Ile Met Gly Leu Val Phe Phe Gly Cys Thr Ser
    -15 -10 -5
    aag gtg cat gag atg aaa aaa agc cct tgc acc ttg tat gaa aac agg 215
    Lys Val His Glu Met Lys Lys Ser Pro Cys Thr Leu Tyr Glu Asn Arg
    1 5 10 15
    tta aat ctc gca gaa atc ttt cac aag cga gca att gat cta ttt aga 263
    Leu Asn Leu Ala Glu Ile Phe His Lys Arg Ala Ile Asp Leu Phe Arg
    20 25 30
    gag ctt tta agc cac caa gaa aag cat tta gaa aac aag ctt tct ggt 311
    Glu Leu Leu Ser His Gln Glu Lys His Leu Glu Asn Lys Leu Ser Gly
    35 40 45
    ttt tcg gtg agt gat ttg gac atg caa agc gtg ttt cgg ctg gaa aga 359
    Phe Ser Val Ser Asp Leu Asp Met Gln Ser Val Phe Arg Leu Glu Arg
    50 55 60
    aac cgc ttg aaa atc gct tac aag ctc tta ggc ttg atg agt ttt atc 407
    Asn Arg Leu Lys Ile Ala Tyr Lys Leu Leu Gly Leu Met Ser Phe Ile
    65 70 75 80
    gct ctt att tta gcg atc gtg tta atc agt ctt cta ccc tta caa aaa 455
    Ala Leu Ile Leu Ala Ile Val Leu Ile Ser Leu Leu Pro Leu Gln Lys
    85 90 95
    acc gaa cac cat ttc gtg gat ttt tta aac cag gac aag cat tac gtc 503
    Thr Glu His His Phe Val Asp Phe Leu Asn Gln Asp Lys His Tyr Val
    100 105 110
    att atc caa aga gcg gat aaa agc att tcc agt aat gaa gcg ttg gct 551
    Ile Ile Gln Arg Ala Asp Lys Ser Ile Ser Ser Asn Glu Ala Leu Ala
    115 120 125
    cgt tcg ctc att ggg gcg tat gtg tta aac cga gag agc att aac cgc 599
    Arg Ser Leu Ile Gly Ala Tyr Val Leu Asn Arg Glu Ser Ile Asn Arg
    130 135 140
    att gac gat aaa tcg cgc tat gaa ttg gtg cgc ttg caa agc agt tct 647
    Ile Asp Asp Lys Ser Arg Tyr Glu Leu Val Arg Leu Gln Ser Ser Ser
    145 150 155 160
    aaa gtg tgg caa cgc ttt gaa gat ttg att aaa acc caa aac agc att 695
    Lys Val Trp Gln Arg Phe Glu Asp Leu Ile Lys Thr Gln Asn Ser Ile
    165 170 175
    tat gtg caa agc cat ttg gaa aga gaa gtc cat atc gtc aat att gcg 743
    Tyr Val Gln Ser His Leu Glu Arg Glu Val His Ile Val Asn Ile Ala
    180 185 190
    atc tat cag caa gac aat aac ccc att gcg agc gtc tcc att gcc gct 791
    Ile Tyr Gln Gln Asp Asn Asn Pro Ile Ala Ser Val Ser Ile Ala Ala
    195 200 205
    aaa ctt ttg aat gaa aac aag ctg gtg tat gaa aag cgt tat aaa atc 839
    Lys Leu Leu Asn Glu Asn Lys Leu Val Tyr Glu Lys Arg Tyr Lys Ile
    210 215 220
    gta ttg agt tat ttg ttt gac acc ccg atg aat tca agc ttg caa gct 887
    Val Leu Ser Tyr Leu Phe Asp Thr Pro Met Asn Ser Ser Leu Gln Ala
    225 230 235 240
    tgc aag ctc tca ggc ttc ata gtt tgacatgaca tatagatgag ctttatgcgg 941
    Cys Lys Leu Ser Gly Phe Ile Val
    245
    tacgattatc acagaatggc taacgcagca ggcaccgagt a 982
    <210> SEQ ID NO 14
    <211> LENGTH: 265
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 14
    Met Arg Ile Phe Phe Val Ile Met Gly Leu Val Phe Phe Gly Cys Thr
    1 5 10 15
    Ser Lys Val His Glu Met Lys Lys Ser Pro Cys Thr Leu Tyr Glu Asn
    20 25 30
    Arg Leu Asn Leu Ala Glu Ile Phe His Lys Arg Ala Ile Asp Leu Phe
    35 40 45
    Arg Glu Leu Leu Ser His Gln Glu Lys His Leu Glu Asn Lys Leu Ser
    50 55 60
    Gly Phe Ser Val Ser Asp Leu Asp Met Gln Ser Val Phe Arg Leu Glu
    65 70 75 80
    Arg Asn Arg Leu Lys Ile Ala Tyr Lys Leu Leu Gly Leu Met Ser Phe
    85 90 95
    Ile Ala Leu Ile Leu Ala Ile Val Leu Ile Ser Leu Leu Pro Leu Gln
    100 105 110
    Lys Thr Glu His His Phe Val Asp Phe Leu Asn Gln Asp Lys His Tyr
    115 120 125
    Val Ile Ile Gln Arg Ala Asp Lys Ser Ile Ser Ser Asn Glu Ala Leu
    130 135 140
    Ala Arg Ser Leu Ile Gly Ala Tyr Val Leu Asn Arg Glu Ser Ile Asn
    145 150 155 160
    Arg Ile Asp Asp Lys Ser Arg Tyr Glu Leu Val Arg Leu Gln Ser Ser
    165 170 175
    Ser Lys Val Trp Gln Arg Phe Glu Asp Leu Ile Lys Thr Gln Asn Ser
    180 185 190
    Ile Tyr Val Gln Ser His Leu Glu Arg Glu Val His Ile Val Asn Ile
    195 200 205
    Ala Ile Tyr Gln Gln Asp Asn Asn Pro Ile Ala Ser Val Ser Ile Ala
    210 215 220
    Ala Lys Leu Leu Asn Glu Asn Lys Leu Val Tyr Glu Lys Arg Tyr Lys
    225 230 235 240
    Ile Val Leu Ser Tyr Leu Phe Asp Thr Pro Met Asn Ser Ser Leu Gln
    245 250 255
    Ala Cys Lys Leu Ser Gly Phe Ile Val
    260 265
    <210> SEQ ID NO 15
    <211> LENGTH: 760
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (236)...(577)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (236)...(355)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (356)...(577)
    <400> SEQUENCE: 15
    ctaaaaatgg aagcctaaaa aggggtaaaa aagctttaaa aagggggcaa aaaattgaag 60
    cgatttcaaa aaaaaaaaaa aaaaacaatt tcagtttctt attagctaga tttgattaga 120
    ataaaaagct tttatgtgtt taaacttcat tgtcttaaaa cttttaagag caattttaaa 180
    attcgttggc gtataatatc aaatttgaat gaactgacta aaagggtttt aaata atg 238
    Met
    -40
    gct gaa aat tct ttc aaa aat gtt tcc aca caa ccc aaa cca ttt ttc 286
    Ala Glu Asn Ser Phe Lys Asn Val Ser Thr Gln Pro Lys Pro Phe Phe
    -35 -30 -25
    tta tta cca gtt aaa acc ctg ttt ctt tta gga ggc gtt ttt agc gcg 334
    Leu Leu Pro Val Lys Thr Leu Phe Leu Leu Gly Gly Val Phe Ser Ala
    -20 -15 -10
    ttt ttt atc ctt gtt gct ggc ttg gtt ttt ttt aat tac act aat tca 382
    Phe Phe Ile Leu Val Ala Gly Leu Val Phe Phe Asn Tyr Thr Asn Ser
    -5 1 5
    atg gac cat gcg att ttt aac ttg atg cgt tca aac tct tct aac cct 430
    Met Asp His Ala Ile Phe Asn Leu Met Arg Ser Asn Ser Ser Asn Pro
    10 15 20 25
    att tta gat caa acg ctc cga cgc gtt gtt ttt tta ggc tct tct caa 478
    Ile Leu Asp Gln Thr Leu Arg Arg Val Val Phe Leu Gly Ser Ser Gln
    30 35 40
    ttc gtg ttg cct ttg agc ttg tta gtg ggg gtt ttt tta agc ttg tat 526
    Phe Val Leu Pro Leu Ser Leu Leu Val Gly Val Phe Leu Ser Leu Tyr
    45 50 55
    cgt aaa aat tta gca ctt ggg gtg tgg ttt gtg cta aag cgt gat ctt 574
    Arg Lys Asn Leu Ala Leu Gly Val Trp Phe Val Leu Lys Arg Asp Leu
    60 65 70
    att tgaagccctt ttagaatctt taaaacacct tttggcacac tccattcaat 627
    Ile
    gggttttcgg cacaggctaa tttccctagc actatcgggc tttctttgac gggaatttta 687
    tggggtgctt ggttttaatt aataccccat ttgttccacg gatcaaaaat ttcaaaaaca 747
    tttttttcgt aaa 760
    <210> SEQ ID NO 16
    <211> LENGTH: 114
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 16
    Met Ala Glu Asn Ser Phe Lys Asn Val Ser Thr Gln Pro Lys Pro Phe
    1 5 10 15
    Phe Leu Leu Pro Val Lys Thr Leu Phe Leu Leu Gly Gly Val Phe Ser
    20 25 30
    Ala Phe Phe Ile Leu Val Ala Gly Leu Val Phe Phe Asn Tyr Thr Asn
    35 40 45
    Ser Met Asp His Ala Ile Phe Asn Leu Met Arg Ser Asn Ser Ser Asn
    50 55 60
    Pro Ile Leu Asp Gln Thr Leu Arg Arg Val Val Phe Leu Gly Ser Ser
    65 70 75 80
    Gln Phe Val Leu Pro Leu Ser Leu Leu Val Gly Val Phe Leu Ser Leu
    85 90 95
    Tyr Arg Lys Asn Leu Ala Leu Gly Val Trp Phe Val Leu Lys Arg Asp
    100 105 110
    Leu Ile
    <210> SEQ ID NO 17
    <211> LENGTH: 939
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (37)...(816)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (37)...(138)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (139)...(816)
    <400> SEQUENCE: 17
    agtttgcaac cctggatgag agtagtggca gagttt atg ctg att ccg tta aaa 54
    Met Leu Ile Pro Leu Lys
    -30
    aca ttc cta aaa ata tta ttg aaa ata ttc cta aaa act ttc caa aag 102
    Thr Phe Leu Lys Ile Leu Leu Lys Ile Phe Leu Lys Thr Phe Gln Lys
    -25 -20 -15
    att tgg ata gtt tgc gtt gtt att tgg ggg ttg ggt tgt agt ttt tta 150
    Ile Trp Ile Val Cys Val Val Ile Trp Gly Leu Gly Cys Ser Phe Leu
    -10 -5 1
    aac gct aac agc att caa tta gaa gaa acg ctc aga cga aat cct aaa 198
    Asn Ala Asn Ser Ile Gln Leu Glu Glu Thr Leu Arg Arg Asn Pro Lys
    5 10 15 20
    aat ctt att tgg caa cac ttt aaa aag aag ttt aaa aag agc aac acg 246
    Asn Leu Ile Trp Gln His Phe Lys Lys Lys Phe Lys Lys Ser Asn Thr
    25 30 35
    atc cct tat gcc cca aac agc cgt tgg aaa tat tta ggc acg agc ata 294
    Ile Pro Tyr Ala Pro Asn Ser Arg Trp Lys Tyr Leu Gly Thr Ser Ile
    40 45 50
    ggg att tta ggc gtg tcg ttg gtg ata ggg att gtg ggg ttg tat ctc 342
    Gly Ile Leu Gly Val Ser Leu Val Ile Gly Ile Val Gly Leu Tyr Leu
    55 60 65
    atg cca gag agc gta acg aat tgg gat aga gaa aag ttt ggc gtc aaa 390
    Met Pro Glu Ser Val Thr Asn Trp Asp Arg Glu Lys Phe Gly Val Lys
    70 75 80
    agt tgg ttt gaa aat gtc cgc atg ggg cca aaa ctg gac aat gat agt 438
    Ser Trp Phe Glu Asn Val Arg Met Gly Pro Lys Leu Asp Asn Asp Ser
    85 90 95 100
    ttt att ttc aat gaa att ttg cac cct tat ttt ggg gct atg tat tat 486
    Phe Ile Phe Asn Glu Ile Leu His Pro Tyr Phe Gly Ala Met Tyr Tyr
    105 110 115
    atg caa ccg cgc atg gct ggg ttt ggc tgg atg gca tca gcg ttt ttt 534
    Met Gln Pro Arg Met Ala Gly Phe Gly Trp Met Ala Ser Ala Phe Phe
    120 125 130
    tct ttt atc act tct acg ctt ttt tgg gaa tat ggc ttg gaa gcg ttt 582
    Ser Phe Ile Thr Ser Thr Leu Phe Trp Glu Tyr Gly Leu Glu Ala Phe
    135 140 145
    gtg gaa gtg cct agc tgg cag gat tta gtg atc acg cct tta tta ggc 630
    Val Glu Val Pro Ser Trp Gln Asp Leu Val Ile Thr Pro Leu Leu Gly
    150 155 160
    tcc att tta ggg gaa ggg ttt tat cag ctc acg cgc tat atc caa cgg 678
    Ser Ile Leu Gly Glu Gly Phe Tyr Gln Leu Thr Arg Tyr Ile Gln Arg
    165 170 175 180
    aac caa ggc aag ctt ttt ggc tct tta ttt tta ggg cgt tta gcc atc 726
    Asn Gln Gly Lys Leu Phe Gly Ser Leu Phe Leu Gly Arg Leu Ala Ile
    185 190 195
    gct ctt atg gat cct atc ggt ttt gtg atc agg gat tta ggg ctt ggg 774
    Ala Leu Met Asp Pro Ile Gly Phe Val Ile Arg Asp Leu Gly Leu Gly
    200 205 210
    gaa gct tta gga ttc ata ata aac atg aaa tcc gtt cca gtt 816
    Glu Ala Leu Gly Phe Ile Ile Asn Met Lys Ser Val Pro Val
    215 220 225
    taagccctaa tggcttgaat ttgacttaca aattctaaag aataacccgc atcaagcgac 876
    tttaaaaaca ttttcaccaa tgaaataccc cgctctatct atgaaccgac tatacaaacg 936
    aac 939
    <210> SEQ ID NO 18
    <211> LENGTH: 260
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 18
    Met Leu Ile Pro Leu Lys Thr Phe Leu Lys Ile Leu Leu Lys Ile Phe
    1 5 10 15
    Leu Lys Thr Phe Gln Lys Ile Trp Ile Val Cys Val Val Ile Trp Gly
    20 25 30
    Leu Gly Cys Ser Phe Leu Asn Ala Asn Ser Ile Gln Leu Glu Glu Thr
    35 40 45
    Leu Arg Arg Asn Pro Lys Asn Leu Ile Trp Gln His Phe Lys Lys Lys
    50 55 60
    Phe Lys Lys Ser Asn Thr Ile Pro Tyr Ala Pro Asn Ser Arg Trp Lys
    65 70 75 80
    Tyr Leu Gly Thr Ser Ile Gly Ile Leu Gly Val Ser Leu Val Ile Gly
    85 90 95
    Ile Val Gly Leu Tyr Leu Met Pro Glu Ser Val Thr Asn Trp Asp Arg
    100 105 110
    Glu Lys Phe Gly Val Lys Ser Trp Phe Glu Asn Val Arg Met Gly Pro
    115 120 125
    Lys Leu Asp Asn Asp Ser Phe Ile Phe Asn Glu Ile Leu His Pro Tyr
    130 135 140
    Phe Gly Ala Met Tyr Tyr Met Gln Pro Arg Met Ala Gly Phe Gly Trp
    145 150 155 160
    Met Ala Ser Ala Phe Phe Ser Phe Ile Thr Ser Thr Leu Phe Trp Glu
    165 170 175
    Tyr Gly Leu Glu Ala Phe Val Glu Val Pro Ser Trp Gln Asp Leu Val
    180 185 190
    Ile Thr Pro Leu Leu Gly Ser Ile Leu Gly Glu Gly Phe Tyr Gln Leu
    195 200 205
    Thr Arg Tyr Ile Gln Arg Asn Gln Gly Lys Leu Phe Gly Ser Leu Phe
    210 215 220
    Leu Gly Arg Leu Ala Ile Ala Leu Met Asp Pro Ile Gly Phe Val Ile
    225 230 235 240
    Arg Asp Leu Gly Leu Gly Glu Ala Leu Gly Phe Ile Ile Asn Met Lys
    245 250 255
    Ser Val Pro Val
    260
    <210> SEQ ID NO 19
    <211> LENGTH: 603
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(600)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(63)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (64)...(600)
    <400> SEQUENCE: 19
    atg aaa aga ttt gat ttg ttt tta tca ctc atg ggt gtt tgc gtt tgc 48
    Met Lys Arg Phe Asp Leu Phe Leu Ser Leu Met Gly Val Cys Val Cys
    -20 -15 -10
    gtt caa act tac gcc gag caa gat tac ttt ttt agg gat ttt aaa tct 96
    Val Gln Thr Tyr Ala Glu Gln Asp Tyr Phe Phe Arg Asp Phe Lys Ser
    -5 1 5 10
    aaa gac ttg ccc caa aaa ctc cat ctt gat aaa aag ctc tcc caa aca 144
    Lys Asp Leu Pro Gln Lys Leu His Leu Asp Lys Lys Leu Ser Gln Thr
    15 20 25
    ata cag cca tgc gcg caa ctt aac gca tca aaa cac tac act gct acc 192
    Ile Gln Pro Cys Ala Gln Leu Asn Ala Ser Lys His Tyr Thr Ala Thr
    30 35 40
    ggg gtt aga gag cct gat aaa tgc aca aag agt ttt aaa aaa tcc gct 240
    Gly Val Arg Glu Pro Asp Lys Cys Thr Lys Ser Phe Lys Lys Ser Ala
    45 50 55
    atc atg tcc tat gac tta gcg cta ggc tat tgg gtg agc caa aac aaa 288
    Ile Met Ser Tyr Asp Leu Ala Leu Gly Tyr Trp Val Ser Gln Asn Lys
    60 65 70 75
    caa tac ggc ttt aaa gct ata gaa aat tta aac gct tgg gct aaa gag 336
    Gln Tyr Gly Phe Lys Ala Ile Glu Asn Leu Asn Ala Trp Ala Lys Glu
    80 85 90
    ctt caa agc gtg gat act tat cag agc gag gat aat atc aat ttc tac 384
    Leu Gln Ser Val Asp Thr Tyr Gln Ser Glu Asp Asn Ile Asn Phe Tyr
    95 100 105
    atg cct tat atg aac atg gct tat tgg ttt gtc aaa aag gca ttc cct 432
    Met Pro Tyr Met Asn Met Ala Tyr Trp Phe Val Lys Lys Ala Phe Pro
    110 115 120
    agc cca gaa tac gaa gat ttc gtt aag cgg atg cgc caa tat tct caa 480
    Ser Pro Glu Tyr Glu Asp Phe Val Lys Arg Met Arg Gln Tyr Ser Gln
    125 130 135
    tca gct ctt aac act aac cat ggg gcg tgg ggc att ctc ttt gat gtg 528
    Ser Ala Leu Asn Thr Asn His Gly Ala Trp Gly Ile Leu Phe Asp Val
    140 145 150 155
    agc tct gca cta gcg tta gat gat cat gct ctt ttg cac aat agc gct 576
    Ser Ser Ala Leu Ala Leu Asp Asp His Ala Leu Leu His Asn Ser Ala
    160 165 170
    aat cgg tgg cag gat tgg gat att taa 603
    Asn Arg Trp Gln Asp Trp Asp Ile
    175
    <210> SEQ ID NO 20
    <211> LENGTH: 200
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 20
    Met Lys Arg Phe Asp Leu Phe Leu Ser Leu Met Gly Val Cys Val Cys
    1 5 10 15
    Val Gln Thr Tyr Ala Glu Gln Asp Tyr Phe Phe Arg Asp Phe Lys Ser
    20 25 30
    Lys Asp Leu Pro Gln Lys Leu His Leu Asp Lys Lys Leu Ser Gln Thr
    35 40 45
    Ile Gln Pro Cys Ala Gln Leu Asn Ala Ser Lys His Tyr Thr Ala Thr
    50 55 60
    Gly Val Arg Glu Pro Asp Lys Cys Thr Lys Ser Phe Lys Lys Ser Ala
    65 70 75 80
    Ile Met Ser Tyr Asp Leu Ala Leu Gly Tyr Trp Val Ser Gln Asn Lys
    85 90 95
    Gln Tyr Gly Phe Lys Ala Ile Glu Asn Leu Asn Ala Trp Ala Lys Glu
    100 105 110
    Leu Gln Ser Val Asp Thr Tyr Gln Ser Glu Asp Asn Ile Asn Phe Tyr
    115 120 125
    Met Pro Tyr Met Asn Met Ala Tyr Trp Phe Val Lys Lys Ala Phe Pro
    130 135 140
    Ser Pro Glu Tyr Glu Asp Phe Val Lys Arg Met Arg Gln Tyr Ser Gln
    145 150 155 160
    Ser Ala Leu Asn Thr Asn His Gly Ala Trp Gly Ile Leu Phe Asp Val
    165 170 175
    Ser Ser Ala Leu Ala Leu Asp Asp His Ala Leu Leu His Asn Ser Ala
    180 185 190
    Asn Arg Trp Gln Asp Trp Asp Ile
    195 200
    <210> SEQ ID NO 21
    <211> LENGTH: 704
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (157)...(597)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (157)...(255)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (256)...(597)
    <400> SEQUENCE: 21
    aaaatcgctc ataaaatcgt gttttttgat accggtaaga tcgctgaaga aaacagcgct 60
    aaagaatttt ttaaccaccc gaaatctcaa agagtgcaaa aatttttaga aactttccat 120
    tttttaggga gctgttaaat aaagtttgct aaaaag atg gtt tta att tca aaa 174
    Met Val Leu Ile Ser Lys
    -30
    aga ggt gtt ttt atg aaa aca aac ggg ctt ttt aaa atg tgg ggg ctg 222
    Arg Gly Val Phe Met Lys Thr Asn Gly Leu Phe Lys Met Trp Gly Leu
    -25 -20 -15
    ttt tta gtt tta atc gct tta ctc ttt aac gca tgc tct gat agc cat 270
    Phe Leu Val Leu Ile Ala Leu Leu Phe Asn Ala Cys Ser Asp Ser His
    -10 -5 1 5
    aaa gaa aaa aag gac gct tta gaa gtc att aaa caa aga ggg gtt tta 318
    Lys Glu Lys Lys Asp Ala Leu Glu Val Ile Lys Gln Arg Gly Val Leu
    10 15 20
    aaa gtg ggg gtt ttt agc gat aag cct cct ttt gga tct gtg gat tct 366
    Lys Val Gly Val Phe Ser Asp Lys Pro Pro Phe Gly Ser Val Asp Ser
    25 30 35
    aaa ggg aaa tat caa ggc tat gat gtg atc atc gct aaa cgc atg gcc 414
    Lys Gly Lys Tyr Gln Gly Tyr Asp Val Ile Ile Ala Lys Arg Met Ala
    40 45 50
    ctt gat tta ttg ggc gat gaa aat aag att gag ttt ata ccc gta gaa 462
    Leu Asp Leu Leu Gly Asp Glu Asn Lys Ile Glu Phe Ile Pro Val Glu
    55 60 65
    gct tca gct agg gtg gaa ttt tta aaa gcc aat aaa gtg gat att atc 510
    Ala Ser Ala Arg Val Glu Phe Leu Lys Ala Asn Lys Val Asp Ile Ile
    70 75 80 85
    atg gct aat ttc acg cgc act aaa gaa aga gaa aaa gtc gtg gat ttc 558
    Met Ala Asn Phe Thr Arg Thr Lys Glu Arg Glu Lys Val Val Asp Phe
    90 95 100
    gct aat ccg tat atg aaa gtc gct ttg ggg gtt gat ttc taaagatggg 607
    Ala Asn Pro Tyr Met Lys Val Ala Leu Gly Val Asp Phe
    105 110
    gtcattaaaa atatagaaga gttgaaggat aaagagttga ttgtgaataa aggcacgaca 667
    gcggattttt atttcactaa aaattacccc aatatca 704
    <210> SEQ ID NO 22
    <211> LENGTH: 147
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 22
    Met Val Leu Ile Ser Lys Arg Gly Val Phe Met Lys Thr Asn Gly Leu
    1 5 10 15
    Phe Lys Met Trp Gly Leu Phe Leu Val Leu Ile Ala Leu Leu Phe Asn
    20 25 30
    Ala Cys Ser Asp Ser His Lys Glu Lys Lys Asp Ala Leu Glu Val Ile
    35 40 45
    Lys Gln Arg Gly Val Leu Lys Val Gly Val Phe Ser Asp Lys Pro Pro
    50 55 60
    Phe Gly Ser Val Asp Ser Lys Gly Lys Tyr Gln Gly Tyr Asp Val Ile
    65 70 75 80
    Ile Ala Lys Arg Met Ala Leu Asp Leu Leu Gly Asp Glu Asn Lys Ile
    85 90 95
    Glu Phe Ile Pro Val Glu Ala Ser Ala Arg Val Glu Phe Leu Lys Ala
    100 105 110
    Asn Lys Val Asp Ile Ile Met Ala Asn Phe Thr Arg Thr Lys Glu Arg
    115 120 125
    Glu Lys Val Val Asp Phe Ala Asn Pro Tyr Met Lys Val Ala Leu Gly
    130 135 140
    Val Asp Phe
    145
    <210> SEQ ID NO 23
    <211> LENGTH: 1306
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (40)...(1266)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (40)...(219)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (220)...(1266)
    <400> SEQUENCE: 23
    tttgacagct tatcatttgg caataaaaca ccaaaatga atg agt tac aca aaa 54
    Met Ser Tyr Thr Lys
    -60
    aaa tac tca aca cca ccc aac cgg cgt aaa atg caa aac att atc gct 102
    Lys Tyr Ser Thr Pro Pro Asn Arg Arg Lys Met Gln Asn Ile Ile Ala
    -55 -50 -45 -40
    att aaa aga tcc tct aga gtc gac ctg cag gca tgc aag cta gct ttc 150
    Ile Lys Arg Ser Ser Arg Val Asp Leu Gln Ala Cys Lys Leu Ala Phe
    -35 -30 -25
    gcg agc tcg aga tca ccc atg caa ttt caa aaa acc tta ttt cct tta 198
    Ala Ser Ser Arg Ser Pro Met Gln Phe Gln Lys Thr Leu Phe Pro Leu
    -20 -15 -10
    ccc tta tta ttt tta tct tgt tgt atc gct gaa gaa aat ggg gcg tat 246
    Pro Leu Leu Phe Leu Ser Cys Cys Ile Ala Glu Glu Asn Gly Ala Tyr
    -5 1 5
    gcg agc gtg ggg ttt gaa tat tcc att agt cat gcc gtt gag cat aat 294
    Ala Ser Val Gly Phe Glu Tyr Ser Ile Ser His Ala Val Glu His Asn
    10 15 20 25
    aac cct ttt tta aat caa gaa cgc atc caa atc att tct aac gct caa 342
    Asn Pro Phe Leu Asn Gln Glu Arg Ile Gln Ile Ile Ser Asn Ala Gln
    30 35 40
    aac aaa atc tat aaa ctc aat caa gtc aaa aat gaa atc aca agc atg 390
    Asn Lys Ile Tyr Lys Leu Asn Gln Val Lys Asn Glu Ile Thr Ser Met
    45 50 55
    caa aac acc ttt aat tac atc aac aac gct tta aaa aac aat gct aaa 438
    Gln Asn Thr Phe Asn Tyr Ile Asn Asn Ala Leu Lys Asn Asn Ala Lys
    60 65 70
    tta acc ccc act gaa atc caa gct gag aaa tac tac ctc caa tcc acc 486
    Leu Thr Pro Thr Glu Ile Gln Ala Glu Lys Tyr Tyr Leu Gln Ser Thr
    75 80 85
    ctt caa aac att gaa aaa ata gtc aca ctt agc ggt ggc gtt gca tct 534
    Leu Gln Asn Ile Glu Lys Ile Val Thr Leu Ser Gly Gly Val Ala Ser
    90 95 100 105
    aac ccc aaa cta gtc caa gcg ttg gaa aaa atg caa gaa ccc att act 582
    Asn Pro Lys Leu Val Gln Ala Leu Glu Lys Met Gln Glu Pro Ile Thr
    110 115 120
    aac cct tta gaa tta gca gaa aac tta aga aat tta gaa ttg caa ttt 630
    Asn Pro Leu Glu Leu Ala Glu Asn Leu Arg Asn Leu Glu Leu Gln Phe
    125 130 135
    gct caa tct caa aac cgc atg ctt tct tct tta tct tct caa acc gct 678
    Ala Gln Ser Gln Asn Arg Met Leu Ser Ser Leu Ser Ser Gln Thr Ala
    140 145 150
    caa att tca aat tct ttg aac gcg ctt gat ccc agc tct tat tct aaa 726
    Gln Ile Ser Asn Ser Leu Asn Ala Leu Asp Pro Ser Ser Tyr Ser Lys
    155 160 165
    aac att tca agc atg tct ggg gtg agt ttg agc gta ggg tat aag cat 774
    Asn Ile Ser Ser Met Ser Gly Val Ser Leu Ser Val Gly Tyr Lys His
    170 175 180 185
    ttc ttt act aag aaa aaa aat caa ggg ttt cgc tat tac ttg ttt tat 822
    Phe Phe Thr Lys Lys Lys Asn Gln Gly Phe Arg Tyr Tyr Leu Phe Tyr
    190 195 200
    gac tat ggt tac act aac ttt ggt ttt gtg ggt aat ggc ttt gat ggt 870
    Asp Tyr Gly Tyr Thr Asn Phe Gly Phe Val Gly Asn Gly Phe Asp Gly
    205 210 215
    tta ggc aaa atg aat aac cac ctc tat ggg ctt gga ata aac tac ctt 918
    Leu Gly Lys Met Asn Asn His Leu Tyr Gly Leu Gly Ile Asn Tyr Leu
    220 225 230
    tat aat ttc att gat aat gca caa aaa cat tcg agc gtg ggt ttt tat 966
    Tyr Asn Phe Ile Asp Asn Ala Gln Lys His Ser Ser Val Gly Phe Tyr
    235 240 245
    gcg ggt ttt gct ttg gcg ggg aat tcg tgg gta ggg aat ggt tta ggc 1014
    Ala Gly Phe Ala Leu Ala Gly Asn Ser Trp Val Gly Asn Gly Leu Gly
    250 255 260 265
    atg tgg gtg agc caa acg gat ttt atc aac aat tac ttg atg ggc tat 1062
    Met Trp Val Ser Gln Thr Asp Phe Ile Asn Asn Tyr Leu Met Gly Tyr
    270 275 280
    caa gct aaa ata cac acg aac ttt ttc cag atc cct ttg aat ttt ggg 1110
    Gln Ala Lys Ile His Thr Asn Phe Phe Gln Ile Pro Leu Asn Phe Gly
    285 290 295
    gtt cgt gtg aat gtc aat agg cat aac gga ttt gaa atg ggc cta aaa 1158
    Val Arg Val Asn Val Asn Arg His Asn Gly Phe Glu Met Gly Leu Lys
    300 305 310
    atc cct tta gcg gtg aat tcc ttt tat gaa acg cat ggc aaa ggg tta 1206
    Ile Pro Leu Ala Val Asn Ser Phe Tyr Glu Thr His Gly Lys Gly Leu
    315 320 325
    aac act tcc ctc ttt ttc aaa cgc ctt gtg gtg ttt aat gtg agt tat 1254
    Asn Thr Ser Leu Phe Phe Lys Arg Leu Val Val Phe Asn Val Ser Tyr
    330 335 340 345
    gtt tat agt ttt tagggggtaa atgccttcaa acgctctttt gattgaagaa 1306
    Val Tyr Ser Phe
    <210> SEQ ID NO 24
    <211> LENGTH: 409
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 24
    Met Ser Tyr Thr Lys Lys Tyr Ser Thr Pro Pro Asn Arg Arg Lys Met
    1 5 10 15
    Gln Asn Ile Ile Ala Ile Lys Arg Ser Ser Arg Val Asp Leu Gln Ala
    20 25 30
    Cys Lys Leu Ala Phe Ala Ser Ser Arg Ser Pro Met Gln Phe Gln Lys
    35 40 45
    Thr Leu Phe Pro Leu Pro Leu Leu Phe Leu Ser Cys Cys Ile Ala Glu
    50 55 60
    Glu Asn Gly Ala Tyr Ala Ser Val Gly Phe Glu Tyr Ser Ile Ser His
    65 70 75 80
    Ala Val Glu His Asn Asn Pro Phe Leu Asn Gln Glu Arg Ile Gln Ile
    85 90 95
    Ile Ser Asn Ala Gln Asn Lys Ile Tyr Lys Leu Asn Gln Val Lys Asn
    100 105 110
    Glu Ile Thr Ser Met Gln Asn Thr Phe Asn Tyr Ile Asn Asn Ala Leu
    115 120 125
    Lys Asn Asn Ala Lys Leu Thr Pro Thr Glu Ile Gln Ala Glu Lys Tyr
    130 135 140
    Tyr Leu Gln Ser Thr Leu Gln Asn Ile Glu Lys Ile Val Thr Leu Ser
    145 150 155 160
    Gly Gly Val Ala Ser Asn Pro Lys Leu Val Gln Ala Leu Glu Lys Met
    165 170 175
    Gln Glu Pro Ile Thr Asn Pro Leu Glu Leu Ala Glu Asn Leu Arg Asn
    180 185 190
    Leu Glu Leu Gln Phe Ala Gln Ser Gln Asn Arg Met Leu Ser Ser Leu
    195 200 205
    Ser Ser Gln Thr Ala Gln Ile Ser Asn Ser Leu Asn Ala Leu Asp Pro
    210 215 220
    Ser Ser Tyr Ser Lys Asn Ile Ser Ser Met Ser Gly Val Ser Leu Ser
    225 230 235 240
    Val Gly Tyr Lys His Phe Phe Thr Lys Lys Lys Asn Gln Gly Phe Arg
    245 250 255
    Tyr Tyr Leu Phe Tyr Asp Tyr Gly Tyr Thr Asn Phe Gly Phe Val Gly
    260 265 270
    Asn Gly Phe Asp Gly Leu Gly Lys Met Asn Asn His Leu Tyr Gly Leu
    275 280 285
    Gly Ile Asn Tyr Leu Tyr Asn Phe Ile Asp Asn Ala Gln Lys His Ser
    290 295 300
    Ser Val Gly Phe Tyr Ala Gly Phe Ala Leu Ala Gly Asn Ser Trp Val
    305 310 315 320
    Gly Asn Gly Leu Gly Met Trp Val Ser Gln Thr Asp Phe Ile Asn Asn
    325 330 335
    Tyr Leu Met Gly Tyr Gln Ala Lys Ile His Thr Asn Phe Phe Gln Ile
    340 345 350
    Pro Leu Asn Phe Gly Val Arg Val Asn Val Asn Arg His Asn Gly Phe
    355 360 365
    Glu Met Gly Leu Lys Ile Pro Leu Ala Val Asn Ser Phe Tyr Glu Thr
    370 375 380
    His Gly Lys Gly Leu Asn Thr Ser Leu Phe Phe Lys Arg Leu Val Val
    385 390 395 400
    Phe Asn Val Ser Tyr Val Tyr Ser Phe
    405
    <210> SEQ ID NO 25
    <211> LENGTH: 999
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (25)...(942)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (25)...(78)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (79)...(942)
    <400> SEQUENCE: 25
    tgacttagtt ttgtaaggaa tgag atg ata aag agt tgg act aaa aag tgg 51
    Met Ile Lys Ser Trp Thr Lys Lys Trp
    -15 -10
    ttt ttg att tta ttt tta atg gca agc tgt ttc agt tat ttg gtg gct 99
    Phe Leu Ile Leu Phe Leu Met Ala Ser Cys Phe Ser Tyr Leu Val Ala
    -5 1 5
    aca acc ggt gag aaa tat ttt aaa atg gct act caa gcc ttt aag aga 147
    Thr Thr Gly Glu Lys Tyr Phe Lys Met Ala Thr Gln Ala Phe Lys Arg
    10 15 20
    ggg gat tac cat aaa gcg gtg gct ttt tat aag agg agc tgt aat tta 195
    Gly Asp Tyr His Lys Ala Val Ala Phe Tyr Lys Arg Ser Cys Asn Leu
    25 30 35
    agg gtg ggg gtt ggt tgc acg agt ttg ggc tct atg tat gaa gat ggc 243
    Arg Val Gly Val Gly Cys Thr Ser Leu Gly Ser Met Tyr Glu Asp Gly
    40 45 50 55
    gat ggc gtg gat cag aat att cca aaa gcc gtt ttt tat tac aga aga 291
    Asp Gly Val Asp Gln Asn Ile Pro Lys Ala Val Phe Tyr Tyr Arg Arg
    60 65 70
    ggg tgc aat ttg agg aat tat ttg gct tgt gcg agt tta ggc tct atg 339
    Gly Cys Asn Leu Arg Asn Tyr Leu Ala Cys Ala Ser Leu Gly Ser Met
    75 80 85
    tat gaa gat ggc gat ggc gtt caa aaa aac ctt cca aag gct atc tat 387
    Tyr Glu Asp Gly Asp Gly Val Gln Lys Asn Leu Pro Lys Ala Ile Tyr
    90 95 100
    tat tat agg aga ggg tgc cac tta aag ggt ggg gtg agc tgc ggg agt 435
    Tyr Tyr Arg Arg Gly Cys His Leu Lys Gly Gly Val Ser Cys Gly Ser
    105 110 115
    tta ggt ttt atg tat ttt aat ggc acg ggc gtt aag caa aat tat gcc 483
    Leu Gly Phe Met Tyr Phe Asn Gly Thr Gly Val Lys Gln Asn Tyr Ala
    120 125 130 135
    aaa gcc ctt tct ctt tct caa tac gct tgc agt ttg aat tat ggc att 531
    Lys Ala Leu Ser Leu Ser Gln Tyr Ala Cys Ser Leu Asn Tyr Gly Ile
    140 145 150
    agt tgt aac ttt gta ggg tat atg tat agg agc gcc aaa ggc gta cag 579
    Ser Cys Asn Phe Val Gly Tyr Met Tyr Arg Ser Ala Lys Gly Val Gln
    155 160 165
    aag gat ttg aaa aaa gcc ctt acg aat ttt aaa aga ggg tgc cat tta 627
    Lys Asp Leu Lys Lys Ala Leu Thr Asn Phe Lys Arg Gly Cys His Leu
    170 175 180
    aaa gac gga gcg agc tgt gtg agc ttg gga tac atg tat gaa gtc ggc 675
    Lys Asp Gly Ala Ser Cys Val Ser Leu Gly Tyr Met Tyr Glu Val Gly
    185 190 195
    atg tat gtc aga caa aat gaa gag caa gcc ttg aat ctt tat aaa aag 723
    Met Tyr Val Arg Gln Asn Glu Glu Gln Ala Leu Asn Leu Tyr Lys Lys
    200 205 210 215
    ggt tgt cat tta aaa gaa ggg agc ggt tgc cat aat gtg gcg gtg atg 771
    Gly Cys His Leu Lys Glu Gly Ser Gly Cys His Asn Val Ala Val Met
    220 225 230
    tat tac acg ggt aag ggt gct tca aag gat tta gat aaa gcc att tcg 819
    Tyr Tyr Thr Gly Lys Gly Ala Ser Lys Asp Leu Asp Lys Ala Ile Ser
    235 240 245
    tat tat aag aaa ggt tgc act cta ggc ttt agt ggt agc tgt aag gtg 867
    Tyr Tyr Lys Lys Gly Cys Thr Leu Gly Phe Ser Gly Ser Cys Lys Val
    250 255 260
    tta gaa gaa gtg att ggc aag aag tct gat gat ttg caa gat gat gcg 915
    Leu Glu Glu Val Ile Gly Lys Lys Ser Asp Asp Leu Gln Asp Asp Ala
    265 270 275
    caa aac gac acg caa gat gat acg caa taagccagag tttaggggct 962
    Gln Asn Asp Thr Gln Asp Asp Thr Gln
    280 285
    aatgattaaa actcatctta tagaaatctt tctattc 999
    <210> SEQ ID NO 26
    <211> LENGTH: 306
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 26
    Met Ile Lys Ser Trp Thr Lys Lys Trp Phe Leu Ile Leu Phe Leu Met
    1 5 10 15
    Ala Ser Cys Phe Ser Tyr Leu Val Ala Thr Thr Gly Glu Lys Tyr Phe
    20 25 30
    Lys Met Ala Thr Gln Ala Phe Lys Arg Gly Asp Tyr His Lys Ala Val
    35 40 45
    Ala Phe Tyr Lys Arg Ser Cys Asn Leu Arg Val Gly Val Gly Cys Thr
    50 55 60
    Ser Leu Gly Ser Met Tyr Glu Asp Gly Asp Gly Val Asp Gln Asn Ile
    65 70 75 80
    Pro Lys Ala Val Phe Tyr Tyr Arg Arg Gly Cys Asn Leu Arg Asn Tyr
    85 90 95
    Leu Ala Cys Ala Ser Leu Gly Ser Met Tyr Glu Asp Gly Asp Gly Val
    100 105 110
    Gln Lys Asn Leu Pro Lys Ala Ile Tyr Tyr Tyr Arg Arg Gly Cys His
    115 120 125
    Leu Lys Gly Gly Val Ser Cys Gly Ser Leu Gly Phe Met Tyr Phe Asn
    130 135 140
    Gly Thr Gly Val Lys Gln Asn Tyr Ala Lys Ala Leu Ser Leu Ser Gln
    145 150 155 160
    Tyr Ala Cys Ser Leu Asn Tyr Gly Ile Ser Cys Asn Phe Val Gly Tyr
    165 170 175
    Met Tyr Arg Ser Ala Lys Gly Val Gln Lys Asp Leu Lys Lys Ala Leu
    180 185 190
    Thr Asn Phe Lys Arg Gly Cys His Leu Lys Asp Gly Ala Ser Cys Val
    195 200 205
    Ser Leu Gly Tyr Met Tyr Glu Val Gly Met Tyr Val Arg Gln Asn Glu
    210 215 220
    Glu Gln Ala Leu Asn Leu Tyr Lys Lys Gly Cys His Leu Lys Glu Gly
    225 230 235 240
    Ser Gly Cys His Asn Val Ala Val Met Tyr Tyr Thr Gly Lys Gly Ala
    245 250 255
    Ser Lys Asp Leu Asp Lys Ala Ile Ser Tyr Tyr Lys Lys Gly Cys Thr
    260 265 270
    Leu Gly Phe Ser Gly Ser Cys Lys Val Leu Glu Glu Val Ile Gly Lys
    275 280 285
    Lys Ser Asp Asp Leu Gln Asp Asp Ala Gln Asn Asp Thr Gln Asp Asp
    290 295 300
    Thr Gln
    305
    <210> SEQ ID NO 27
    <211> LENGTH: 805
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (130)...(642)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (130)...(192)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (193)...(642)
    <400> SEQUENCE: 27
    tagtgagagt cgcccaattc caatgatgga aagcatgcaa gtctttcatg atatatcgcc 60
    atttttaaaa agttttgaga ctataaccct taaaaaacta tcgcaacaaa tcaattcata 120
    ggaacaagc atg ttt ttt aaa act tat caa aaa tta ctg ggt gca agc tgt 171
    Met Phe Phe Lys Thr Tyr Gln Lys Leu Leu Gly Ala Ser Cys
    -20 -15 -10
    ttg gcg tta tat tta gca ggc tgt ggg ggc gac agt ggc gaa cca cta 219
    Leu Ala Leu Tyr Leu Ala Gly Cys Gly Gly Asp Ser Gly Glu Pro Leu
    -5 1 5
    gtt ggg att gaa aaa aat agc ttc aat tct acc ttg aaa atc att tct 267
    Val Gly Ile Glu Lys Asn Ser Phe Asn Ser Thr Leu Lys Ile Ile Ser
    10 15 20 25
    aaa acc gac aac ata gaa atc caa gac ttg aag ctc aat cgt gag aat 315
    Lys Thr Asp Asn Ile Glu Ile Gln Asp Leu Lys Leu Asn Arg Glu Asn
    30 35 40
    tgc gag cat gat gaa aat ttc ttg gta aag tta ata caa gaa aca gcc 363
    Cys Glu His Asp Glu Asn Phe Leu Val Lys Leu Ile Gln Glu Thr Ala
    45 50 55
    aat aca tac ctg ttt gca tca gaa aaa gaa aaa gcg att aaa aac cac 411
    Asn Thr Tyr Leu Phe Ala Ser Glu Lys Glu Lys Ala Ile Lys Asn His
    60 65 70
    caa gca aaa atc gca aga ctt caa aaa aga agg agc ggt tgc cat aat 459
    Gln Ala Lys Ile Ala Arg Leu Gln Lys Arg Arg Ser Gly Cys His Asn
    75 80 85
    gtg gcg gtg atg tat tac acg ggt aag ggt gct tca aag gat tta gat 507
    Val Ala Val Met Tyr Tyr Thr Gly Lys Gly Ala Ser Lys Asp Leu Asp
    90 95 100 105
    aaa gcc att tcg tat tat aag aaa ggt tgc act cta ggc ttt agt ggt 555
    Lys Ala Ile Ser Tyr Tyr Lys Lys Gly Cys Thr Leu Gly Phe Ser Gly
    110 115 120
    agc tgt aag gtg tta gaa gaa gtg att ggc aag aag tct gat gat ttg 603
    Ser Cys Lys Val Leu Glu Glu Val Ile Gly Lys Lys Ser Asp Asp Leu
    125 130 135
    caa gat gat gcg caa aac gac acg caa gat gat acg caa taagccagag 652
    Gln Asp Asp Ala Gln Asn Asp Thr Gln Asp Asp Thr Gln
    140 145 150
    tttaggggct aatgattaaa actcatctta tagaaatctt tctattctct tgctatcaaa 712
    tagggattga gcgtctctat tgatgggtat tgagattaaa aacctgcaaa tctagggttt 772
    ggatttattc tcatatggat aataaaaata ctc 805
    <210> SEQ ID NO 28
    <211> LENGTH: 171
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 28
    Met Phe Phe Lys Thr Tyr Gln Lys Leu Leu Gly Ala Ser Cys Leu Ala
    1 5 10 15
    Leu Tyr Leu Ala Gly Cys Gly Gly Asp Ser Gly Glu Pro Leu Val Gly
    20 25 30
    Ile Glu Lys Asn Ser Phe Asn Ser Thr Leu Lys Ile Ile Ser Lys Thr
    35 40 45
    Asp Asn Ile Glu Ile Gln Asp Leu Lys Leu Asn Arg Glu Asn Cys Glu
    50 55 60
    His Asp Glu Asn Phe Leu Val Lys Leu Ile Gln Glu Thr Ala Asn Thr
    65 70 75 80
    Tyr Leu Phe Ala Ser Glu Lys Glu Lys Ala Ile Lys Asn His Gln Ala
    85 90 95
    Lys Ile Ala Arg Leu Gln Lys Arg Arg Ser Gly Cys His Asn Val Ala
    100 105 110
    Val Met Tyr Tyr Thr Gly Lys Gly Ala Ser Lys Asp Leu Asp Lys Ala
    115 120 125
    Ile Ser Tyr Tyr Lys Lys Gly Cys Thr Leu Gly Phe Ser Gly Ser Cys
    130 135 140
    Lys Val Leu Glu Glu Val Ile Gly Lys Lys Ser Asp Asp Leu Gln Asp
    145 150 155 160
    Asp Ala Gln Asn Asp Thr Gln Asp Asp Thr Gln
    165 170
    <210> SEQ ID NO 29
    <211> LENGTH: 1101
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (40)...(1026)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (40)...(99)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (100)...(1026)
    <400> SEQUENCE: 29
    ggttataccg aaaaaacaat atgaaatcaa ggagtttgt atg caa cag cgt cat 54
    Met Gln Gln Arg His
    -20
    tta ggc cct tta aaa gtg ggt gca tta gct cta ggg tgc atg ggc atg 102
    Leu Gly Pro Leu Lys Val Gly Ala Leu Ala Leu Gly Cys Met Gly Met
    -15 -10 -5 1
    act tat ggg tat ggg gaa gtc cat gat aaa aag cag atg gtt aaa ctt 150
    Thr Tyr Gly Tyr Gly Glu Val His Asp Lys Lys Gln Met Val Lys Leu
    5 10 15
    atc cat aag gct ttg gaa ttg ggt att aac ttt ttt gac act gca gag 198
    Ile His Lys Ala Leu Glu Leu Gly Ile Asn Phe Phe Asp Thr Ala Glu
    20 25 30
    gct tat ggg gaa gat aat gaa aag ctt tta gcg aag cga tca agc ctt 246
    Ala Tyr Gly Glu Asp Asn Glu Lys Leu Leu Ala Lys Arg Ser Ser Leu
    35 40 45
    att aaa gac aag gtt gtg gta gcg agc aag ttt ggg att tac tac gca 294
    Ile Lys Asp Lys Val Val Val Ala Ser Lys Phe Gly Ile Tyr Tyr Ala
    50 55 60 65
    gat cct aat gac aaa tac gca acc atg ttt tta gac tcc agt tct aac 342
    Asp Pro Asn Asp Lys Tyr Ala Thr Met Phe Leu Asp Ser Ser Ser Asn
    70 75 80
    cgc att aag agt gcc att gaa ggg agt ttg aaa cgc tta aaa gta gaa 390
    Arg Ile Lys Ser Ala Ile Glu Gly Ser Leu Lys Arg Leu Lys Val Glu
    85 90 95
    tgc att gat tta tac tac caa cac cgc atg gat act aac acg ccc ata 438
    Cys Ile Asp Leu Tyr Tyr Gln His Arg Met Asp Thr Asn Thr Pro Ile
    100 105 110
    gaa gaa gtg gca gaa gtt atg caa gct ctt att aaa gaa gga aaa att 486
    Glu Glu Val Ala Glu Val Met Gln Ala Leu Ile Lys Glu Gly Lys Ile
    115 120 125
    aaa gct tgg ggg atg agt gag gca ggg tta tct agc atc caa aaa gcc 534
    Lys Ala Trp Gly Met Ser Glu Ala Gly Leu Ser Ser Ile Gln Lys Ala
    130 135 140 145
    cat caa att tgc cct tta agc gcg ttg cag agc gaa tat tcc ttg tgg 582
    His Gln Ile Cys Pro Leu Ser Ala Leu Gln Ser Glu Tyr Ser Leu Trp
    150 155 160
    tgg cgc gaa cct gaa aaa gag att tta ggt ttt tta gaa aaa gaa aaa 630
    Trp Arg Glu Pro Glu Lys Glu Ile Leu Gly Phe Leu Glu Lys Glu Lys
    165 170 175
    att ggc ttt gtc gct ttt tcg cct ttg ggt aag ggg ttt tta ggc gcg 678
    Ile Gly Phe Val Ala Phe Ser Pro Leu Gly Lys Gly Phe Leu Gly Ala
    180 185 190
    aaa ttt gaa aaa aat gct acc ttc gct agt gaa gat ttt aga agc gtt 726
    Lys Phe Glu Lys Asn Ala Thr Phe Ala Ser Glu Asp Phe Arg Ser Val
    195 200 205
    tct cct agg ttt aat caa gaa aat cta gcc aaa aat tac gtc ttg gtg 774
    Ser Pro Arg Phe Asn Gln Glu Asn Leu Ala Lys Asn Tyr Val Leu Val
    210 215 220 225
    gaa tta atc caa gat cat gca cac gct aaa ggc gtt aca cca gcc caa 822
    Glu Leu Ile Gln Asp His Ala His Ala Lys Gly Val Thr Pro Ala Gln
    230 235 240
    ctg gct ctc tcg tgg att ttg cac acg caa aaa atc att gtc cct ctc 870
    Leu Ala Leu Ser Trp Ile Leu His Thr Gln Lys Ile Ile Val Pro Leu
    245 250 255
    ttt ggc acc acc aaa gaa tcc agg ctc ata gaa aat ata ggg gct ttg 918
    Phe Gly Thr Thr Lys Glu Ser Arg Leu Ile Glu Asn Ile Gly Ala Leu
    260 265 270
    cag gtt tct tgg agt caa aaa gaa ttg gag att ttt caa aaa gaa ttg 966
    Gln Val Ser Trp Ser Gln Lys Glu Leu Glu Ile Phe Gln Lys Glu Leu
    275 280 285
    act gca atc aaa ata gaa ggg gcc cgc tac cct gaa aga atc aat gaa 1014
    Thr Ala Ile Lys Ile Glu Gly Ala Arg Tyr Pro Glu Arg Ile Asn Glu
    290 295 300 305
    atg gtg aat caa taaaagtatt gggtatttat aattgcattg gctcttttaa 1066
    Met Val Asn Gln
    aagagattga gcgttatttc ctgtttgtca gtgtg 1101
    <210> SEQ ID NO 30
    <211> LENGTH: 329
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 30
    Met Gln Gln Arg His Leu Gly Pro Leu Lys Val Gly Ala Leu Ala Leu
    1 5 10 15
    Gly Cys Met Gly Met Thr Tyr Gly Tyr Gly Glu Val His Asp Lys Lys
    20 25 30
    Gln Met Val Lys Leu Ile His Lys Ala Leu Glu Leu Gly Ile Asn Phe
    35 40 45
    Phe Asp Thr Ala Glu Ala Tyr Gly Glu Asp Asn Glu Lys Leu Leu Ala
    50 55 60
    Lys Arg Ser Ser Leu Ile Lys Asp Lys Val Val Val Ala Ser Lys Phe
    65 70 75 80
    Gly Ile Tyr Tyr Ala Asp Pro Asn Asp Lys Tyr Ala Thr Met Phe Leu
    85 90 95
    Asp Ser Ser Ser Asn Arg Ile Lys Ser Ala Ile Glu Gly Ser Leu Lys
    100 105 110
    Arg Leu Lys Val Glu Cys Ile Asp Leu Tyr Tyr Gln His Arg Met Asp
    115 120 125
    Thr Asn Thr Pro Ile Glu Glu Val Ala Glu Val Met Gln Ala Leu Ile
    130 135 140
    Lys Glu Gly Lys Ile Lys Ala Trp Gly Met Ser Glu Ala Gly Leu Ser
    145 150 155 160
    Ser Ile Gln Lys Ala His Gln Ile Cys Pro Leu Ser Ala Leu Gln Ser
    165 170 175
    Glu Tyr Ser Leu Trp Trp Arg Glu Pro Glu Lys Glu Ile Leu Gly Phe
    180 185 190
    Leu Glu Lys Glu Lys Ile Gly Phe Val Ala Phe Ser Pro Leu Gly Lys
    195 200 205
    Gly Phe Leu Gly Ala Lys Phe Glu Lys Asn Ala Thr Phe Ala Ser Glu
    210 215 220
    Asp Phe Arg Ser Val Ser Pro Arg Phe Asn Gln Glu Asn Leu Ala Lys
    225 230 235 240
    Asn Tyr Val Leu Val Glu Leu Ile Gln Asp His Ala His Ala Lys Gly
    245 250 255
    Val Thr Pro Ala Gln Leu Ala Leu Ser Trp Ile Leu His Thr Gln Lys
    260 265 270
    Ile Ile Val Pro Leu Phe Gly Thr Thr Lys Glu Ser Arg Leu Ile Glu
    275 280 285
    Asn Ile Gly Ala Leu Gln Val Ser Trp Ser Gln Lys Glu Leu Glu Ile
    290 295 300
    Phe Gln Lys Glu Leu Thr Ala Ile Lys Ile Glu Gly Ala Arg Tyr Pro
    305 310 315 320
    Glu Arg Ile Asn Glu Met Val Asn Gln
    325
    <210> SEQ ID NO 31
    <211> LENGTH: 495
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(492)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(105)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (106)...(492)
    <400> SEQUENCE: 31
    atg gta ttt gac aga aca atc agc gta aga gaa aaa aaa gcg gct aaa 48
    Met Val Phe Asp Arg Thr Ile Ser Val Arg Glu Lys Lys Ala Ala Lys
    -35 -30 -25 -20
    acg ctt ggg att gtg ggg atc gtc ttt ttt att ttg ttt ggc atc gta 96
    Thr Leu Gly Ile Val Gly Ile Val Phe Phe Ile Leu Phe Gly Ile Val
    -15 -10 -5
    ata agc ggg gtg gct ttt caa aaa gag tgg gtg caa caa ttg gat tta 144
    Ile Ser Gly Val Ala Phe Gln Lys Glu Trp Val Gln Gln Leu Asp Leu
    1 5 10
    ttt ttt ata gac ttg atc cac aac cct gcc ccc att caa ggg agc gcg 192
    Phe Phe Ile Asp Leu Ile His Asn Pro Ala Pro Ile Gln Gly Ser Ala
    15 20 25
    tgg ctt tct ttc gtg ttt ttt agc aca tgg ttt gcg caa agc aag ctc 240
    Trp Leu Ser Phe Val Phe Phe Ser Thr Trp Phe Ala Gln Ser Lys Leu
    30 35 40 45
    acc act cct ata gcc tta ctc att ggc ttg tgg ttt ggg ttt caa aaa 288
    Thr Thr Pro Ile Ala Leu Leu Ile Gly Leu Trp Phe Gly Phe Gln Lys
    50 55 60
    cgc atc gct tta ggg gtg tgg ttt ttc ttt agc atc tta tta ggt gaa 336
    Arg Ile Ala Leu Gly Val Trp Phe Phe Phe Ser Ile Leu Leu Gly Glu
    65 70 75
    ttc acc tta aaa tcc ctt aag ctt tta gtg gcg cgc cca cgg cct gta 384
    Phe Thr Leu Lys Ser Leu Lys Leu Leu Val Ala Arg Pro Arg Pro Val
    80 85 90
    acc aat ggc gaa ttg gtt ttt gca cat ggc ttt agt ttc ccc agc ggg 432
    Thr Asn Gly Glu Leu Val Phe Ala His Gly Phe Ser Phe Pro Ser Gly
    95 100 105
    cat gct tta gct tcc agc gct ttt tta cgg ctc ttt ggc gtt tgt ttg 480
    His Ala Leu Ala Ser Ser Ala Phe Leu Arg Leu Phe Gly Val Cys Leu
    110 115 120 125
    tta tgc tat tcc taa 495
    Leu Cys Tyr Ser
    <210> SEQ ID NO 32
    <211> LENGTH: 164
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 32
    Met Val Phe Asp Arg Thr Ile Ser Val Arg Glu Lys Lys Ala Ala Lys
    1 5 10 15
    Thr Leu Gly Ile Val Gly Ile Val Phe Phe Ile Leu Phe Gly Ile Val
    20 25 30
    Ile Ser Gly Val Ala Phe Gln Lys Glu Trp Val Gln Gln Leu Asp Leu
    35 40 45
    Phe Phe Ile Asp Leu Ile His Asn Pro Ala Pro Ile Gln Gly Ser Ala
    50 55 60
    Trp Leu Ser Phe Val Phe Phe Ser Thr Trp Phe Ala Gln Ser Lys Leu
    65 70 75 80
    Thr Thr Pro Ile Ala Leu Leu Ile Gly Leu Trp Phe Gly Phe Gln Lys
    85 90 95
    Arg Ile Ala Leu Gly Val Trp Phe Phe Phe Ser Ile Leu Leu Gly Glu
    100 105 110
    Phe Thr Leu Lys Ser Leu Lys Leu Leu Val Ala Arg Pro Arg Pro Val
    115 120 125
    Thr Asn Gly Glu Leu Val Phe Ala His Gly Phe Ser Phe Pro Ser Gly
    130 135 140
    His Ala Leu Ala Ser Ser Ala Phe Leu Arg Leu Phe Gly Val Cys Leu
    145 150 155 160
    Leu Cys Tyr Ser
    <210> SEQ ID NO 33
    <211> LENGTH: 569
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(516)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(57)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (58)...(516)
    <400> SEQUENCE: 33
    atg ttg aaa ttt aaa tat ggt ttg att tat atc gcg ctc att ata gga 48
    Met Leu Lys Phe Lys Tyr Gly Leu Ile Tyr Ile Ala Leu Ile Ile Gly
    -15 -10 -5
    ctt caa gcg aca gat tat gac aat tta gaa gaa gaa aac caa caa tta 96
    Leu Gln Ala Thr Asp Tyr Asp Asn Leu Glu Glu Glu Asn Gln Gln Leu
    1 5 10
    gac gaa aaa ata aac cat tta aag caa cag ctt acc gaa aaa ggg gtt 144
    Asp Glu Lys Ile Asn His Leu Lys Gln Gln Leu Thr Glu Lys Gly Val
    15 20 25
    tcg ccc aaa gag atg gat aag gat aag ttt gaa gaa gaa tat tta gag 192
    Ser Pro Lys Glu Met Asp Lys Asp Lys Phe Glu Glu Glu Tyr Leu Glu
    30 35 40 45
    cga act tac cca aag att tct tca aag aaa aga aaa aaa tta ctc aaa 240
    Arg Thr Tyr Pro Lys Ile Ser Ser Lys Lys Arg Lys Lys Leu Leu Lys
    50 55 60
    tct ttc tcc ata gcc gat gat aag agt ggg gtt ttt tta ggg ggt ggg 288
    Ser Phe Ser Ile Ala Asp Asp Lys Ser Gly Val Phe Leu Gly Gly Gly
    65 70 75
    tat gct tat ggg gga ttt aat ctt tct tat caa ggg gag atg tta gac 336
    Tyr Ala Tyr Gly Gly Phe Asn Leu Ser Tyr Gln Gly Glu Met Leu Asp
    80 85 90
    aaa tat ggt gcg aat gcc cct agt gtg ttt aaa aac aat att aag att 384
    Lys Tyr Gly Ala Asn Ala Pro Ser Val Phe Lys Asn Asn Ile Lys Ile
    95 100 105
    aac gct cct gtt tct atg att agc gtt aaa ttc ggg tat caa aaa tac 432
    Asn Ala Pro Val Ser Met Ile Ser Val Lys Phe Gly Tyr Gln Lys Tyr
    110 115 120 125
    ttt gtg cct tat ttt ggg aca cga ttt tat ggg gat tta ttg ctt ggg 480
    Phe Val Pro Tyr Phe Gly Thr Arg Phe Tyr Gly Asp Leu Leu Leu Gly
    130 135 140
    ggt gga gcg tta aaa agg atg caa gca agc aac ctg taggctcgtt 526
    Gly Gly Ala Leu Lys Arg Met Gln Ala Ser Asn Leu
    145 150
    tatttatgtt tttaggggct atgaatacgg atttattgtt tga 569
    <210> SEQ ID NO 34
    <211> LENGTH: 172
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 34
    Met Leu Lys Phe Lys Tyr Gly Leu Ile Tyr Ile Ala Leu Ile Ile Gly
    1 5 10 15
    Leu Gln Ala Thr Asp Tyr Asp Asn Leu Glu Glu Glu Asn Gln Gln Leu
    20 25 30
    Asp Glu Lys Ile Asn His Leu Lys Gln Gln Leu Thr Glu Lys Gly Val
    35 40 45
    Ser Pro Lys Glu Met Asp Lys Asp Lys Phe Glu Glu Glu Tyr Leu Glu
    50 55 60
    Arg Thr Tyr Pro Lys Ile Ser Ser Lys Lys Arg Lys Lys Leu Leu Lys
    65 70 75 80
    Ser Phe Ser Ile Ala Asp Asp Lys Ser Gly Val Phe Leu Gly Gly Gly
    85 90 95
    Tyr Ala Tyr Gly Gly Phe Asn Leu Ser Tyr Gln Gly Glu Met Leu Asp
    100 105 110
    Lys Tyr Gly Ala Asn Ala Pro Ser Val Phe Lys Asn Asn Ile Lys Ile
    115 120 125
    Asn Ala Pro Val Ser Met Ile Ser Val Lys Phe Gly Tyr Gln Lys Tyr
    130 135 140
    Phe Val Pro Tyr Phe Gly Thr Arg Phe Tyr Gly Asp Leu Leu Leu Gly
    145 150 155 160
    Gly Gly Ala Leu Lys Arg Met Gln Ala Ser Asn Leu
    165 170
    <210> SEQ ID NO 35
    <211> LENGTH: 1416
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (315)...(917)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (315)...(389)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (390)...(917)
    <400> SEQUENCE: 35
    gtattaccgc ctttgagtga gctgatacga attagatcat taaaggttcc ttttggagcc 60
    tttttttttg aattctcatg tttgacagct tatcatttgg caataaaaca ccaaaatgaa 120
    tgagttacac aaaaaaatac tcaaacacca cccaaccggc gtaaaatgca aaacattatc 180
    gctattaaaa gatcctctag agtcgacctg caggcatgca agctagcttt cgcgagctcg 240
    agatcatttt agccataaaa agcttatgtt ttcattaaaa atgttatgat acgctcaaat 300
    agtcaagcaa aaaa atg tca att aaa agg gtt aga ttg aaa ata ttc gtt 350
    Met Ser Ile Lys Arg Val Arg Leu Lys Ile Phe Val
    -25 -20 -15
    ctg ttg atg tcg gta att tta gga ata tca tta aca ggt tgc ata ggc 398
    Leu Leu Met Ser Val Ile Leu Gly Ile Ser Leu Thr Gly Cys Ile Gly
    -10 -5 1
    tat cgt atg gac tta gaa cat ttt aac acg ctc tat tat gaa gaa agc 446
    Tyr Arg Met Asp Leu Glu His Phe Asn Thr Leu Tyr Tyr Glu Glu Ser
    5 10 15
    cct aaa caa gct tat gaa tat tct aaa caa ttc act aag aaa aaa aag 494
    Pro Lys Gln Ala Tyr Glu Tyr Ser Lys Gln Phe Thr Lys Lys Lys Lys
    20 25 30 35
    aac gct ctt tta tgg gac ttg caa aac ggc ttg agc gct tta tac gcc 542
    Asn Ala Leu Leu Trp Asp Leu Gln Asn Gly Leu Ser Ala Leu Tyr Ala
    40 45 50
    aga gat tac cag act tct tta ggg gtg tta gat caa gcc gag caa cgc 590
    Arg Asp Tyr Gln Thr Ser Leu Gly Val Leu Asp Gln Ala Glu Gln Arg
    55 60 65
    ttt gat aaa acc caa agc gct ttc aca aga ggg gct ggt tat gtg ggc 638
    Phe Asp Lys Thr Gln Ser Ala Phe Thr Arg Gly Ala Gly Tyr Val Gly
    70 75 80
    gct acc atg att aat gat aac gtg cgc gct tat ggg ggg aat att tat 686
    Ala Thr Met Ile Asn Asp Asn Val Arg Ala Tyr Gly Gly Asn Ile Tyr
    85 90 95
    gag ggc gtt tta atc aat tat tac aaa gcg ata gac tac atg ctt tta 734
    Glu Gly Val Leu Ile Asn Tyr Tyr Lys Ala Ile Asp Tyr Met Leu Leu
    100 105 110 115
    aac gat agc gcg aaa gct agg gtg caa ttc aac cgc gcg aac gaa cgc 782
    Asn Asp Ser Ala Lys Ala Arg Val Gln Phe Asn Arg Ala Asn Glu Arg
    120 125 130
    cag cgc agg gct aaa gaa ttt tat tat gag gaa gtg caa aaa gcc att 830
    Gln Arg Arg Ala Lys Glu Phe Tyr Tyr Glu Glu Val Gln Lys Ala Ile
    135 140 145
    aaa gag atc gat tct agc aaa aag cac aat att aat atg gaa cgc tct 878
    Lys Glu Ile Asp Ser Ser Lys Lys His Asn Ile Asn Met Glu Arg Ser
    150 155 160
    agg gct aga agt gag cga gat ttt aaa caa cac tta ttc taatttagac 927
    Arg Ala Arg Ser Glu Arg Asp Phe Lys Gln His Leu Phe
    165 170 175
    aaatacgaag cttatcaagg cttgcttaac ccagcggttt cgtatctttc agggttgttt 987
    tacgctttaa atggggataa gaataagggg ttaggctatc ttaatgaagc ctacgggatc 1047
    agtcaaagcc cttttgtagc ccaagacttg gtttttttta aaaaccctaa taggagtcat 1107
    ttcacttgga tcatcattga agatggtaaa gagccgcaaa aaagccaatt taaaattgat 1167
    gtgcctattt ttatgattga ttcggtttat aacgtgagta tagccttgcc caagctagaa 1227
    aaaggggaag cgttttatca aaatttcact cttaaagatg gagaaaaagt aacgcccttt 1287
    gacactttag cctcaataga tgcggtggtc gctagcgaat ttaggaagca gttaccctat 1347
    attatcacta gagccattct atcggctact tttagaggtg ggcatgcaag cggtagcgaa 1407
    ttattattt 1416
    <210> SEQ ID NO 36
    <211> LENGTH: 201
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 36
    Met Ser Ile Lys Arg Val Arg Leu Lys Ile Phe Val Leu Leu Met Ser
    1 5 10 15
    Val Ile Leu Gly Ile Ser Leu Thr Gly Cys Ile Gly Tyr Arg Met Asp
    20 25 30
    Leu Glu His Phe Asn Thr Leu Tyr Tyr Glu Glu Ser Pro Lys Gln Ala
    35 40 45
    Tyr Glu Tyr Ser Lys Gln Phe Thr Lys Lys Lys Lys Asn Ala Leu Leu
    50 55 60
    Trp Asp Leu Gln Asn Gly Leu Ser Ala Leu Tyr Ala Arg Asp Tyr Gln
    65 70 75 80
    Thr Ser Leu Gly Val Leu Asp Gln Ala Glu Gln Arg Phe Asp Lys Thr
    85 90 95
    Gln Ser Ala Phe Thr Arg Gly Ala Gly Tyr Val Gly Ala Thr Met Ile
    100 105 110
    Asn Asp Asn Val Arg Ala Tyr Gly Gly Asn Ile Tyr Glu Gly Val Leu
    115 120 125
    Ile Asn Tyr Tyr Lys Ala Ile Asp Tyr Met Leu Leu Asn Asp Ser Ala
    130 135 140
    Lys Ala Arg Val Gln Phe Asn Arg Ala Asn Glu Arg Gln Arg Arg Ala
    145 150 155 160
    Lys Glu Phe Tyr Tyr Glu Glu Val Gln Lys Ala Ile Lys Glu Ile Asp
    165 170 175
    Ser Ser Lys Lys His Asn Ile Asn Met Glu Arg Ser Arg Ala Arg Ser
    180 185 190
    Glu Arg Asp Phe Lys Gln His Leu Phe
    195 200
    <210> SEQ ID NO 37
    <211> LENGTH: 738
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (201)...(731)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (201)...(263)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (264)...(731)
    <400> SEQUENCE: 37
    cgcctgattg ttcctttccc tgctatggaa aaagcgaaat aaaaacaaga aagtaaccta 60
    tgatttcgct cgtttgatgg atggggctaa agaagtcaaa tgctctgaat tcgctagcgt 120
    gatgattgaa aacatgtgaa agagcgtttt ttaggctctg gtatttgaat gcgattatta 180
    ggctaatact atcataagga atg aag ttg ata aaa ttt gtg cgt aat gtg gtt 233
    Met Lys Leu Ile Lys Phe Val Arg Asn Val Val
    -20 -15
    tta ttc att tta aca gcg atc ttt tta gca ctc atg ctt tta gtg agc 281
    Leu Phe Ile Leu Thr Ala Ile Phe Leu Ala Leu Met Leu Leu Val Ser
    -10 -5 1 5
    tat tgc atg ccc cat tat agc gtg gct gtc att agc ggg gtg gaa gtc 329
    Tyr Cys Met Pro His Tyr Ser Val Ala Val Ile Ser Gly Val Glu Val
    10 15 20
    caa aga atg aat gaa aat gca cgc cca aat aat aag gaa gta aaa acc 377
    Gln Arg Met Asn Glu Asn Ala Arg Pro Asn Asn Lys Glu Val Lys Thr
    25 30 35
    cta gct aga gat gtc tat ttt gtg caa act tac gac cct aag gat caa 425
    Leu Ala Arg Asp Val Tyr Phe Val Gln Thr Tyr Asp Pro Lys Asp Gln
    40 45 50
    aaa agc gta acc gtc tat cgt aac gaa gac acg cgc ttt ggc ttc cct 473
    Lys Ser Val Thr Val Tyr Arg Asn Glu Asp Thr Arg Phe Gly Phe Pro
    55 60 65 70
    ttt tat ttt aag ttt aat tcg gct gat att tca gcc ctc gct caa agt 521
    Phe Tyr Phe Lys Phe Asn Ser Ala Asp Ile Ser Ala Leu Ala Gln Ser
    75 80 85
    tta gtc aac cag caa gtg gaa gtg caa tac tat ggc tgg cgg atc aat 569
    Leu Val Asn Gln Gln Val Glu Val Gln Tyr Tyr Gly Trp Arg Ile Asn
    90 95 100
    ttg ttt aac atg ttc cct aat gtg att ttt tta aag ccc tta aaa gag 617
    Leu Phe Asn Met Phe Pro Asn Val Ile Phe Leu Lys Pro Leu Lys Glu
    105 110 115
    agt gct gag atg tca aaa ccc att ttt agc tgg att tta tac gcc tgg 665
    Ser Ala Glu Met Ser Lys Pro Ile Phe Ser Trp Ile Leu Tyr Ala Trp
    120 125 130
    cta cta gtg ggg ctt ttt tat caa gcg cgc gtc ctg ttt gga att tta 713
    Leu Leu Val Gly Leu Phe Tyr Gln Ala Arg Val Leu Phe Gly Ile Leu
    135 140 145 150
    ttt aag ggg aaa gct caa taaatcc 738
    Phe Lys Gly Lys Ala Gln
    155
    <210> SEQ ID NO 38
    <211> LENGTH: 177
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 38
    Met Lys Leu Ile Lys Phe Val Arg Asn Val Val Leu Phe Ile Leu Thr
    1 5 10 15
    Ala Ile Phe Leu Ala Leu Met Leu Leu Val Ser Tyr Cys Met Pro His
    20 25 30
    Tyr Ser Val Ala Val Ile Ser Gly Val Glu Val Gln Arg Met Asn Glu
    35 40 45
    Asn Ala Arg Pro Asn Asn Lys Glu Val Lys Thr Leu Ala Arg Asp Val
    50 55 60
    Tyr Phe Val Gln Thr Tyr Asp Pro Lys Asp Gln Lys Ser Val Thr Val
    65 70 75 80
    Tyr Arg Asn Glu Asp Thr Arg Phe Gly Phe Pro Phe Tyr Phe Lys Phe
    85 90 95
    Asn Ser Ala Asp Ile Ser Ala Leu Ala Gln Ser Leu Val Asn Gln Gln
    100 105 110
    Val Glu Val Gln Tyr Tyr Gly Trp Arg Ile Asn Leu Phe Asn Met Phe
    115 120 125
    Pro Asn Val Ile Phe Leu Lys Pro Leu Lys Glu Ser Ala Glu Met Ser
    130 135 140
    Lys Pro Ile Phe Ser Trp Ile Leu Tyr Ala Trp Leu Leu Val Gly Leu
    145 150 155 160
    Phe Tyr Gln Ala Arg Val Leu Phe Gly Ile Leu Phe Lys Gly Lys Ala
    165 170 175
    Gln
    <210> SEQ ID NO 39
    <211> LENGTH: 435
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(432)
    <400> SEQUENCE: 39
    atg tta gaa aaa ttg att gaa aga gtg ttg ttt gcc act cgt tgg ttg 48
    Met Leu Glu Lys Leu Ile Glu Arg Val Leu Phe Ala Thr Arg Trp Leu
    1 5 10 15
    cta gcc cct tta tgt att gcc atg tcg tta gtg ctg gtg gtt tta ggc 96
    Leu Ala Pro Leu Cys Ile Ala Met Ser Leu Val Leu Val Val Leu Gly
    20 25 30
    tat gtg ttc atg aaa gag ttg tgg cac atg ctc agc cat tta aac acg 144
    Tyr Val Phe Met Lys Glu Leu Trp His Met Leu Ser His Leu Asn Thr
    35 40 45
    atc agc gaa acg gat ttg gtt tta tca gcc tta gga tta gtg gat ttg 192
    Ile Ser Glu Thr Asp Leu Val Leu Ser Ala Leu Gly Leu Val Asp Leu
    50 55 60
    ttg ttt atg gcc ggg ctt gtt tta atg gtg tta ctc gcc agt tat gaa 240
    Leu Phe Met Ala Gly Leu Val Leu Met Val Leu Leu Ala Ser Tyr Glu
    65 70 75 80
    agc ttt gtt tct aaa tta gac aag gtg gat gcc agt gaa atc act tgg 288
    Ser Phe Val Ser Lys Leu Asp Lys Val Asp Ala Ser Glu Ile Thr Trp
    85 90 95
    cta aag cac acg gat ttt aac gct tta aaa tta aag gtt tca ctc tcc 336
    Leu Lys His Thr Asp Phe Asn Ala Leu Lys Leu Lys Val Ser Leu Ser
    100 105 110
    att gta gcg att tca gcg att ttc ttg ctc aaa cgc tac atg agt tta 384
    Ile Val Ala Ile Ser Ala Ile Phe Leu Leu Lys Arg Tyr Met Ser Leu
    115 120 125
    gaa aga tgt ttt atc cca gca ttc cct aag gat acg ccc cct atc gca 432
    Glu Arg Cys Phe Ile Pro Ala Phe Pro Lys Asp Thr Pro Pro Ile Ala
    130 135 140
    taa 435
    <210> SEQ ID NO 40
    <211> LENGTH: 144
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 40
    Met Leu Glu Lys Leu Ile Glu Arg Val Leu Phe Ala Thr Arg Trp Leu
    1 5 10 15
    Leu Ala Pro Leu Cys Ile Ala Met Ser Leu Val Leu Val Val Leu Gly
    20 25 30
    Tyr Val Phe Met Lys Glu Leu Trp His Met Leu Ser His Leu Asn Thr
    35 40 45
    Ile Ser Glu Thr Asp Leu Val Leu Ser Ala Leu Gly Leu Val Asp Leu
    50 55 60
    Leu Phe Met Ala Gly Leu Val Leu Met Val Leu Leu Ala Ser Tyr Glu
    65 70 75 80
    Ser Phe Val Ser Lys Leu Asp Lys Val Asp Ala Ser Glu Ile Thr Trp
    85 90 95
    Leu Lys His Thr Asp Phe Asn Ala Leu Lys Leu Lys Val Ser Leu Ser
    100 105 110
    Ile Val Ala Ile Ser Ala Ile Phe Leu Leu Lys Arg Tyr Met Ser Leu
    115 120 125
    Glu Arg Cys Phe Ile Pro Ala Phe Pro Lys Asp Thr Pro Pro Ile Ala
    130 135 140
    <210> SEQ ID NO 41
    <211> LENGTH: 519
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(516)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(60)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (61)...(516)
    <400> SEQUENCE: 41
    atg cgt tta tta ttg tgg tgg gta ttg gta tta tcg ctc ttt tta aat 48
    Met Arg Leu Leu Leu Trp Trp Val Leu Val Leu Ser Leu Phe Leu Asn
    -20 -15 -10 -5
    cct ttg aga gcg gtt gaa gag cat gaa aca gat gcg gtg gat ttg ttt 96
    Pro Leu Arg Ala Val Glu Glu His Glu Thr Asp Ala Val Asp Leu Phe
    1 5 10
    ttg att ttc aat caa atc aac caa ctc aat caa gtc att gaa act tat 144
    Leu Ile Phe Asn Gln Ile Asn Gln Leu Asn Gln Val Ile Glu Thr Tyr
    15 20 25
    aag aaa aac cct gaa aga agt gct gaa atc tct ctg tat aac acc caa 192
    Lys Lys Asn Pro Glu Arg Ser Ala Glu Ile Ser Leu Tyr Asn Thr Gln
    30 35 40
    aag aat gat ttg att aaa agt ttg act tct aaa gtg ttg aat gaa agg 240
    Lys Asn Asp Leu Ile Lys Ser Leu Thr Ser Lys Val Leu Asn Glu Arg
    45 50 55 60
    gat aaa att ggc att gat atc aat caa aat tta aaa gag caa gag aaa 288
    Asp Lys Ile Gly Ile Asp Ile Asn Gln Asn Leu Lys Glu Gln Glu Lys
    65 70 75
    atc aaa aag cgc ttg tct aga agc att aag ggc gat aat ttc tac act 336
    Ile Lys Lys Arg Leu Ser Arg Ser Ile Lys Gly Asp Asn Phe Tyr Thr
    80 85 90
    ttc atg aaa gac aga ttg tct tta gat att ttg ttg ata gat gaa att 384
    Phe Met Lys Asp Arg Leu Ser Leu Asp Ile Leu Leu Ile Asp Glu Ile
    95 100 105
    ttg tat cgt ttt ata gat aaa atc aag agc agt att gat att ttt agc 432
    Leu Tyr Arg Phe Ile Asp Lys Ile Lys Ser Ser Ile Asp Ile Phe Ser
    110 115 120
    gaa caa aaa gat gtg gaa agt ttc agc gat gcc ttc ctt ttg cgt ttt 480
    Glu Gln Lys Asp Val Glu Ser Phe Ser Asp Ala Phe Leu Leu Arg Phe
    125 130 135 140
    agg aca att cca act cat acc ctt tcc cta aaa att taa 519
    Arg Thr Ile Pro Thr His Thr Leu Ser Leu Lys Ile
    145 150
    <210> SEQ ID NO 42
    <211> LENGTH: 172
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 42
    Met Arg Leu Leu Leu Trp Trp Val Leu Val Leu Ser Leu Phe Leu Asn
    1 5 10 15
    Pro Leu Arg Ala Val Glu Glu His Glu Thr Asp Ala Val Asp Leu Phe
    20 25 30
    Leu Ile Phe Asn Gln Ile Asn Gln Leu Asn Gln Val Ile Glu Thr Tyr
    35 40 45
    Lys Lys Asn Pro Glu Arg Ser Ala Glu Ile Ser Leu Tyr Asn Thr Gln
    50 55 60
    Lys Asn Asp Leu Ile Lys Ser Leu Thr Ser Lys Val Leu Asn Glu Arg
    65 70 75 80
    Asp Lys Ile Gly Ile Asp Ile Asn Gln Asn Leu Lys Glu Gln Glu Lys
    85 90 95
    Ile Lys Lys Arg Leu Ser Arg Ser Ile Lys Gly Asp Asn Phe Tyr Thr
    100 105 110
    Phe Met Lys Asp Arg Leu Ser Leu Asp Ile Leu Leu Ile Asp Glu Ile
    115 120 125
    Leu Tyr Arg Phe Ile Asp Lys Ile Lys Ser Ser Ile Asp Ile Phe Ser
    130 135 140
    Glu Gln Lys Asp Val Glu Ser Phe Ser Asp Ala Phe Leu Leu Arg Phe
    145 150 155 160
    Arg Thr Ile Pro Thr His Thr Leu Ser Leu Lys Ile
    165 170
    <210> SEQ ID NO 43
    <211> LENGTH: 432
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(429)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(93)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (94)...(429)
    <400> SEQUENCE: 43
    atg aaa aaa ttt ttt tct caa tct tta tta gct ttg att gtg tct atg 48
    Met Lys Lys Phe Phe Ser Gln Ser Leu Leu Ala Leu Ile Val Ser Met
    -30 -25 -20
    aac gcg cta ctg gcc atg gat ggc aat ggc gtt ttt tta ggg gcg ggt 96
    Asn Ala Leu Leu Ala Met Asp Gly Asn Gly Val Phe Leu Gly Ala Gly
    -15 -10 -5 1
    tat ttg caa ggg caa gcc caa atg cat gcg gat att aat tct caa aaa 144
    Tyr Leu Gln Gly Gln Ala Gln Met His Ala Asp Ile Asn Ser Gln Lys
    5 10 15
    caa gcc act aac gct act atc aaa ggc ttt gat gcg ctt tta ggg tat 192
    Gln Ala Thr Asn Ala Thr Ile Lys Gly Phe Asp Ala Leu Leu Gly Tyr
    20 25 30
    caa ttt ttc ttt ggg aaa tac ttt ggc ttg cgt gct tat ggg ttt ttt 240
    Gln Phe Phe Phe Gly Lys Tyr Phe Gly Leu Arg Ala Tyr Gly Phe Phe
    35 40 45
    gac tac gct cat gcc aat tct att agg ctt aaa aac cct aac tat aac 288
    Asp Tyr Ala His Ala Asn Ser Ile Arg Leu Lys Asn Pro Asn Tyr Asn
    50 55 60 65
    agc gaa gtg gcg caa ttg gcg ggt caa att ctt ggg aaa caa gaa atc 336
    Ser Glu Val Ala Gln Leu Ala Gly Gln Ile Leu Gly Lys Gln Glu Ile
    70 75 80
    aat cgc tta acg agc ctt gct gat cct aaa acc ttt gag cca aac atg 384
    Asn Arg Leu Thr Ser Leu Ala Asp Pro Lys Thr Phe Glu Pro Asn Met
    85 90 95
    ctc act tat ggg ggg gct atg gat tta atg gtt aat gtt cat caa 429
    Leu Thr Tyr Gly Gly Ala Met Asp Leu Met Val Asn Val His Gln
    100 105 110
    taa 432
    <210> SEQ ID NO 44
    <211> LENGTH: 143
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 44
    Met Lys Lys Phe Phe Ser Gln Ser Leu Leu Ala Leu Ile Val Ser Met
    1 5 10 15
    Asn Ala Leu Leu Ala Met Asp Gly Asn Gly Val Phe Leu Gly Ala Gly
    20 25 30
    Tyr Leu Gln Gly Gln Ala Gln Met His Ala Asp Ile Asn Ser Gln Lys
    35 40 45
    Gln Ala Thr Asn Ala Thr Ile Lys Gly Phe Asp Ala Leu Leu Gly Tyr
    50 55 60
    Gln Phe Phe Phe Gly Lys Tyr Phe Gly Leu Arg Ala Tyr Gly Phe Phe
    65 70 75 80
    Asp Tyr Ala His Ala Asn Ser Ile Arg Leu Lys Asn Pro Asn Tyr Asn
    85 90 95
    Ser Glu Val Ala Gln Leu Ala Gly Gln Ile Leu Gly Lys Gln Glu Ile
    100 105 110
    Asn Arg Leu Thr Ser Leu Ala Asp Pro Lys Thr Phe Glu Pro Asn Met
    115 120 125
    Leu Thr Tyr Gly Gly Ala Met Asp Leu Met Val Asn Val His Gln
    130 135 140
    <210> SEQ ID NO 45
    <211> LENGTH: 336
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(333)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (1)...(60)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (61)...(333)
    <400> SEQUENCE: 45
    atg aaa acc ttt aaa aac ctg ctc tgt ttt agc ctg atc gct atg agt 48
    Met Lys Thr Phe Lys Asn Leu Leu Cys Phe Ser Leu Ile Ala Met Ser
    -20 -15 -10 -5
    tgg ctc caa gcg gac atg ttg gat aat ttc act agg gcc att aac agc 96
    Trp Leu Gln Ala Asp Met Leu Asp Asn Phe Thr Arg Ala Ile Asn Ser
    1 5 10
    tac acc act aaa aag ctt aat gaa atc aag gat caa gtc aat agc gct 144
    Tyr Thr Thr Lys Lys Leu Asn Glu Ile Lys Asp Gln Val Asn Ser Ala
    15 20 25
    aac cct act aaa aat cac aat acc act tat aac gct aat ggc atg ctc 192
    Asn Pro Thr Lys Asn His Asn Thr Thr Tyr Asn Ala Asn Gly Met Leu
    30 35 40
    att aac att gat tgt aaa gtc tta aaa aat aac ttc tat tcg gtg tgt 240
    Ile Asn Ile Asp Cys Lys Val Leu Lys Asn Asn Phe Tyr Ser Val Cys
    45 50 55 60
    tat tct agc gag tta aaa aac cct att tat ggc gtg agc gtg ttg ttt 288
    Tyr Ser Ser Glu Leu Lys Asn Pro Ile Tyr Gly Val Ser Val Leu Phe
    65 70 75
    ggg gat tta gtg gat aaa aat aat att gaa aaa cgc tat gag ttt 333
    Gly Asp Leu Val Asp Lys Asn Asn Ile Glu Lys Arg Tyr Glu Phe
    80 85 90
    taa 336
    <210> SEQ ID NO 46
    <211> LENGTH: 111
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 46
    Met Lys Thr Phe Lys Asn Leu Leu Cys Phe Ser Leu Ile Ala Met Ser
    1 5 10 15
    Trp Leu Gln Ala Asp Met Leu Asp Asn Phe Thr Arg Ala Ile Asn Ser
    20 25 30
    Tyr Thr Thr Lys Lys Leu Asn Glu Ile Lys Asp Gln Val Asn Ser Ala
    35 40 45
    Asn Pro Thr Lys Asn His Asn Thr Thr Tyr Asn Ala Asn Gly Met Leu
    50 55 60
    Ile Asn Ile Asp Cys Lys Val Leu Lys Asn Asn Phe Tyr Ser Val Cys
    65 70 75 80
    Tyr Ser Ser Glu Leu Lys Asn Pro Ile Tyr Gly Val Ser Val Leu Phe
    85 90 95
    Gly Asp Leu Val Asp Lys Asn Asn Ile Glu Lys Arg Tyr Glu Phe
    100 105 110
    <210> SEQ ID NO 47
    <211> LENGTH: 755
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (223)...(672)
    <221> NAME/KEY: sig_peptide
    <222> LOCATION: (223)...(285)
    <221> NAME/KEY: mat_peptide
    <222> LOCATION: (286)...(672)
    <400> SEQUENCE: 47
    gattttaagc gcttgaaata gcccatttta atcaacaatt aagcgactaa ccattaaact 60
    taagcgataa ataagataaa atttaggata gctcaaatct ttataaaaag aaaaggataa 120
    ccccttacaa actttatttt taataaaaaa tggcttatct cttctagcct actcccctta 180
    ttttttctta accctttagc ggcagaagat gatggatttt tt atg ggg gtg agt 234
    Met Gly Val Ser
    -20
    tat caa act tct cta gcc gtt caa agg gtg gat aac tca ggg ctt aac 282
    Tyr Gln Thr Ser Leu Ala Val Gln Arg Val Asp Asn Ser Gly Leu Asn
    -15 -10 -5
    gcc agt caa gac gca tcc act tac atc cgc caa aac gct atc gct cta 330
    Ala Ser Gln Asp Ala Ser Thr Tyr Ile Arg Gln Asn Ala Ile Ala Leu
    1 5 10 15
    gaa tct gcg gca gtg cct tta gcc tat tat tta gaa gcg atg ggc caa 378
    Glu Ser Ala Ala Val Pro Leu Ala Tyr Tyr Leu Glu Ala Met Gly Gln
    20 25 30
    caa acc aga gtt tta atg caa atg ctc tgc cct gat ccg tct aaa aga 426
    Gln Thr Arg Val Leu Met Gln Met Leu Cys Pro Asp Pro Ser Lys Arg
    35 40 45
    tgt ttg ctc tat gcg ggg ggt tat aaa aac gga tca agt aat act aac 474
    Cys Leu Leu Tyr Ala Gly Gly Tyr Lys Asn Gly Ser Ser Asn Thr Asn
    50 55 60
    ggc gat aca ggc aac aac ccc cca aga ggc aat gtc aat gcc acc ttt 522
    Gly Asp Thr Gly Asn Asn Pro Pro Arg Gly Asn Val Asn Ala Thr Phe
    65 70 75
    gat atg caa tct tta gtc aat aat cta aac aaa ctc acc caa ctc atc 570
    Asp Met Gln Ser Leu Val Asn Asn Leu Asn Lys Leu Thr Gln Leu Ile
    80 85 90 95
    ggc gag act tta atc cgt aac cct gaa aat ctt tct aac gcc aaa gtc 618
    Gly Glu Thr Leu Ile Arg Asn Pro Glu Asn Leu Ser Asn Ala Lys Val
    100 105 110
    ttt aac gtc aaa ttt gga aat caa agc act gtt att gct ttt acc aga 666
    Phe Asn Val Lys Phe Gly Asn Gln Ser Thr Val Ile Ala Phe Thr Arg
    115 120 125
    ggg tct tagacaaata ccatgggacg cttttacaaa tgacaatcaa ccaacgcttt 722
    Gly Ser
    taaccacgct ctgggtattt accaaaaccc taa 755
    <210> SEQ ID NO 48
    <211> LENGTH: 150
    <212> TYPE: PRT
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 48
    Met Gly Val Ser Tyr Gln Thr Ser Leu Ala Val Gln Arg Val Asp Asn
    1 5 10 15
    Ser Gly Leu Asn Ala Ser Gln Asp Ala Ser Thr Tyr Ile Arg Gln Asn
    20 25 30
    Ala Ile Ala Leu Glu Ser Ala Ala Val Pro Leu Ala Tyr Tyr Leu Glu
    35 40 45
    Ala Met Gly Gln Gln Thr Arg Val Leu Met Gln Met Leu Cys Pro Asp
    50 55 60
    Pro Ser Lys Arg Cys Leu Leu Tyr Ala Gly Gly Tyr Lys Asn Gly Ser
    65 70 75 80
    Ser Asn Thr Asn Gly Asp Thr Gly Asn Asn Pro Pro Arg Gly Asn Val
    85 90 95
    Asn Ala Thr Phe Asp Met Gln Ser Leu Val Asn Asn Leu Asn Lys Leu
    100 105 110
    Thr Gln Leu Ile Gly Glu Thr Leu Ile Arg Asn Pro Glu Asn Leu Ser
    115 120 125
    Asn Ala Lys Val Phe Asn Val Lys Phe Gly Asn Gln Ser Thr Val Ile
    130 135 140
    Ala Phe Thr Arg Gly Ser
    145 150
    <210> SEQ ID NO 49
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 49
    gccngaagga tttattatga ttaaaagaa 29
    <210> SEQ ID NO 50
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 50
    gccnaaggaa taaattagaa agtgaagaa 29
    <210> SEQ ID NO 51
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 51
    gccnaaaggg cgaaaatgag caaga 25
    <210> SEQ ID NO 52
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 52
    gccntttttt aagaatcact ttcttcgg 28
    <210> SEQ ID NO 53
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 53
    gccncgcatt gatttgatga ataaacc 27
    <210> SEQ ID NO 54
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 54
    gccnctcact aaaaagcaat ttttgag 27
    <210> SEQ ID NO 55
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 55
    gccntcacaa tggataaaaa caacaaca 28
    <210> SEQ ID NO 56
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 56
    gccnctgtcc aaatcagcca ccc 23
    <210> SEQ ID NO 57
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 57
    gccnggaaga ataatgctcg cttcc 25
    <210> SEQ ID NO 58
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 58
    gccnctattc tccagggata tggcc 25
    <210> SEQ ID NO 59
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 59
    gccngaaggg tgtatggtat taggaagc 28
    <210> SEQ ID NO 60
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 60
    gccncgttaa aactaaagtt ctattttta 29
    <210> SEQ ID NO 61
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 61
    gccnaatata tgggaactta atgagaat 28
    <210> SEQ ID NO 62
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 62
    gccnatgtca tgtcaaacta tgaagc 26
    <210> SEQ ID NO 63
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 63
    gccnaaaagg gttttaaata atggctg 27
    <210> SEQ ID NO 64
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 64
    gccnaagatt ctaaaagggc ttcaaat 27
    <210> SEQ ID NO 65
    <211> LENGTH: 38
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 65
    gccngagagt agtggcagag tttatgctga ttccgtta 38
    <210> SEQ ID NO 66
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 66
    gccnggctta aactggaacg gatttc 26
    <210> SEQ ID NO 67
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 67
    gccnatgaaa agatttgatt tgtttttatc 30
    <210> SEQ ID NO 68
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 68
    gccnttaaat atcccaatcc tgccac 26
    <210> SEQ ID NO 69
    <211> LENGTH: 35
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 69
    gccntaaagt ttgctaaaaa gatggtttta atttc 35
    <210> SEQ ID NO 70
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 70
    gccncccatc tttagaaatc aaccccca 28
    <210> SEQ ID NO 71
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 71
    gccncaataa aacaccaaaa tgaatgagtt ac 32
    <210> SEQ ID NO 72
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 72
    gccngcattt accccctaaa aactataaac 30
    <210> SEQ ID NO 73
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 73
    gccngtaagg aatgagatga taaagagttg g 31
    <210> SEQ ID NO 74
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 74
    gccnctaaac tctggcttat tgcgtatc 28
    <210> SEQ ID NO 75
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 75
    gccnatagga acaagcatgt tttttaaaac 30
    <210> SEQ ID NO 76
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 76
    gccnctggct tattgcgtat catc 24
    <210> SEQ ID NO 77
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 77
    gccngaaatc aaggagtttg tatgcaacag cg 32
    <210> SEQ ID NO 78
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 78
    gccncccaat acttttattg attcaccatt tc 32
    <210> SEQ ID NO 79
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 79
    gccnatggta tttgacagaa caatcag 27
    <210> SEQ ID NO 80
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 80
    gccnttagga atagcataac aaacaaacg 29
    <210> SEQ ID NO 81
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 81
    gccnatgttg aaatttaaat atggtttga 29
    <210> SEQ ID NO 82
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 82
    gccngagcct acaggttgct tgc 23
    <210> SEQ ID NO 83
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 83
    gccncaagca aaaaaatgtt caataaaagg g 31
    <210> SEQ ID NO 84
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 84
    gccngtctaa attagaataa gtgttgtt 28
    <210> SEQ ID NO 85
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 85
    gccntaagga atgaagttga taaaatttgt 30
    <210> SEQ ID NO 86
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 86
    gccnggattt attgagcttt cccctt 26
    <210> SEQ ID NO 87
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 87
    gccnatgtta gaaaaattga ttgaaagag 29
    <210> SEQ ID NO 88
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 88
    gccnttatgc gatagggggc gtatc 25
    <210> SEQ ID NO 89
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 89
    gccnatgcgt ttattattgt ggtggg 26
    <210> SEQ ID NO 90
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 90
    gccnttaaat ttttagggaa agggta 26
    <210> SEQ ID NO 91
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 91
    gccnatgaaa aaattttttt ctcaatcttt 30
    <210> SEQ ID NO 92
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 92
    gccnttattg atgaacatta accattaaa 29
    <210> SEQ ID NO 93
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 93
    gccnatgaaa acctttaaaa acctgc 26
    <210> SEQ ID NO 94
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 94
    gccnttaaaa ctcatagcgt ttttcaat 28
    <210> SEQ ID NO 95
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 95
    gccngatgga ttttttatgg gggtgag 27
    <210> SEQ ID NO 96
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: 4
    <223> OTHER INFORMATION: n = A,T,C or G
    <400> SEQUENCE: 96
    gccnatggta tttgtctaag accctc 26
    <210> SEQ ID NO 97
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 97
    aacctaattt gaaattcaaa ccat 24
    <210> SEQ ID NO 98
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 98
    aaattaggtt ttgtaggctt tgccaataaa tg 32
    <210> SEQ ID NO 99
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 99
    taaaataacc aacagagtga tca 23
    <210> SEQ ID NO 100
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 100
    ggttatttta gtggatattt gggtttatag cga 33
    <210> SEQ ID NO 101
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 101
    cgcctataac cgctccatt 19
    <210> SEQ ID NO 102
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 102
    gttataggcg ataaaggttt aacgcagcta ag 32
    <210> SEQ ID NO 103
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 103
    gcccttttgt ttaggggtta g 21
    <210> SEQ ID NO 104
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 104
    acaaaagggc tttttagagc atgtgagcca tc 32
    <210> SEQ ID NO 105
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 105
    actggagtgt ggataaaact at 22
    <210> SEQ ID NO 106
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 106
    acactccagt agatgctttc ccggatattt c 31
    <210> SEQ ID NO 107
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 107
    caccatacat gtatcctgca ttaatg 26
    <210> SEQ ID NO 108
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 108
    catgtatggt gtagcaaaga attttaagga ggc 33
    <210> SEQ ID NO 109
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 109
    tgcgagattt aacctgtttt ca 22
    <210> SEQ ID NO 110
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 110
    aaatctcgca gaaatctttc acaagcgagc aa 32
    <210> SEQ ID NO 111
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 111
    acaaggataa aaaacgcgct aa 22
    <210> SEQ ID NO 112
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 112
    ttatccttgt tgctggcttg gtttttttta att 33
    <210> SEQ ID NO 113
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 113
    aacttttctc tatcccaatt cgttacgctc 30
    <210> SEQ ID NO 114
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 114
    ggatagagaa aagtttggcg tcaaaagttg g 31
    <210> SEQ ID NO 115
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 115
    aagccgtatt gtttgttttg gc 22
    <210> SEQ ID NO 116
    <211> LENGTH: 34
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 116
    aatacggctt taaagctata gaaaatttaa acgc 34
    <210> SEQ ID NO 117
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 117
    gacttctaaa gcgtcctttt tttcttta 28
    <210> SEQ ID NO 118
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 118
    ctttagaagt cattaaacaa agaggggt 28
    <210> SEQ ID NO 119
    <211> LENGTH: 26
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 119
    agattttgtt ttgagcgtta gaaatg 26
    <210> SEQ ID NO 120
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 120
    caaaatctat aaactcaatc aagtcaaaaa tg 32
    <210> SEQ ID NO 121
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 121
    tggaatattg tgatccacgc catc 24
    <210> SEQ ID NO 122
    <211> LENGTH: 37
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 122
    gaatattcca aaagccgttt tttattacag aagaggg 37
    <210> SEQ ID NO 123
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 123
    tgaagtcttg cgatttttgc tt 22
    <210> SEQ ID NO 124
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 124
    caagacttca aaaaagaagg agcggttgcc 30
    <210> SEQ ID NO 125
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 125
    aagcttttca ttatcttccc cataagc 27
    <210> SEQ ID NO 126
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 126
    tgaaaagctt ttagcgaagc gatcaagcc 29
    <210> SEQ ID NO 127
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 127
    gaaaagccac cccgcttatt 20
    <210> SEQ ID NO 128
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 128
    gtggcttttc aaaaagagtg ggtgcaacaa tt 32
    <210> SEQ ID NO 129
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 129
    aaaccccact cttatcatcg g 21
    <210> SEQ ID NO 130
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 130
    agtggggttt ttttaggggg tgggtatgct 30
    <210> SEQ ID NO 131
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 131
    taagtccata cgatagccta tg 22
    <210> SEQ ID NO 132
    <211> LENGTH: 34
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 132
    tatggaactt agaacatttt aacacgctct atta 34
    <210> SEQ ID NO 133
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 133
    gcattttcat tcattctttg gac 23
    <210> SEQ ID NO 134
    <211> LENGTH: 32
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 134
    atgaaaatgc acgcccaaat aataaggaag ta 32
    <210> SEQ ID NO 135
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 135
    tgaacacata gcctaaaacc ac 22
    <210> SEQ ID NO 136
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 136
    tatgtgttca tgaaagagtt gtggcacatg c 31
    <210> SEQ ID NO 137
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 137
    caatacccac cacaataata aacgcat 27
    <210> SEQ ID NO 138
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 138
    gtgggtattg gtattatcgc tctttttaaa tcc 33
    <210> SEQ ID NO 139
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 139
    tggccagtag cgcgttcat 19
    <210> SEQ ID NO 140
    <211> LENGTH: 34
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 140
    ctactggcca tggatggcaa tggcgttttt ttag 34
    <210> SEQ ID NO 141
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 141
    tagcgatcag gctaaaacag a 21
    <210> SEQ ID NO 142
    <211> LENGTH: 29
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 142
    ctgatcgcta tgagttggct ccaagcgga 29
    <210> SEQ ID NO 143
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 143
    ggcactgccg cagattcta 19
    <210> SEQ ID NO 144
    <211> LENGTH: 33
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 144
    cggcagtgcc tttagcctat tatttagaag cga 33
    <210> SEQ ID NO 145
    <211> LENGTH: 30
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 145
    gccgagctct atcgtatgga cttagaacat 30
    <210> SEQ ID NO 146
    <211> LENGTH: 34
    <212> TYPE: DNA
    <213> ORGANISM: Helicobacter pylori
    <400> SEQUENCE: 146
    gccctcgaga ttagaataag tgttgtttaa aatc 34

Claims (39)

What is claimed is:
1. An isolated polynucleotide that encodes (i) a polypeptide comprising an amino acid sequence that is homologous to the amino acid sequence of a Helicobacter membrane-associated polypeptide, wherein said amino acid sequence of said Helicobacter membrane-associated polypeptide is selected from the group consisting of:
(a) the amino acid sequences as shown:
in SEQ ID NO:2, beginning with an amino acid in any one of the positions from −27 to 5, and ending with an amino acid in position 160 (HPO101);
in SEQ ID NO:4, beginning with an amino acid in position 1 and ending with an amino acid in position 172 (HPO104);
in SEQ ID NO:6, beginning with an amino acid in any one of the positions from −17 to 5, and ending with an amino acid in position 169 (HPO116);
in SEQ ID NO:8, beginning with an amino acid in any one of the positions from −21 to 5, and ending with an amino acid in position 198 (HPO121);
in SEQ ID NO:10, beginning with an amino acid in any one of the positions from −20 to 5, and ending with an amino acid in position 132 (HPO132);
in SEQ ID NO:12, beginning with an amino acid in positions 1 and ending with an amino acid in position 114 (HPO15);
in SEQ ID NO:14, beginning with an amino acid in any one of the positions from −17 to 5, and ending with an amino acid in position 248 (HPO18);
in SEQ ID NO:16, beginning with an amino acid in any one of the positions from −40 to 5, and ending with an amino acid in position 74 (HPO38);
in SEQ ID NO:18, beginning with an amino acid in any one of the positions from −34 to 5, and ending with an amino acid in position 226 (HPO42);
in SEQ ID NO:20, beginning with an amino acid in any one of the positions from −21 to 5, and ending with an amino acid in position 179 (HPO45);
in SEQ ID NO:22, beginning with an amino acid in any one of the positions from −33 to 5, and ending with an amino acid in position 114 (HPO50);
in SEQ ID NO:24, beginning with an amino acid in any one of the positions from −60 to 5, and ending with an amino acid in position 349 (HPO54);
in SEQ ID NO:26, beginning with an amino acid in any one of the positions from −18 to 5, and ending with an amino acid in position 288 (HPO57);
in SEQ ID NO:28, beginning with an amino acid in any one of the positions from −21 to 5, and ending with an amino acid in position 150 (HPO58);
in SEQ ID NO:30, beginning with an amino acid in any one of the positions from −20 to 5, and ending with an amino acid in position 309 (HPO64);
in SEQ ID NO:32, beginning with an amino acid in any one of the positions from −35 to 5, and ending with an amino acid in position 129 (HPO70);
in SEQ ID NO:34, beginning with an amino acid in any one of the positions from −19 to 5, and ending with an amino acid in position 153 (HPO71);
in SEQ ID NO:36, beginning with an amino acid in any one of the positions from −25 to 5, and ending with an amino acid in position 176 (HPO76);
in SEQ ID NO:38, beginning with an amino acid in any one of the positions from −21 to 5, and ending with an amino acid in position 156 (HPO7);
in SEQ ID NO:40, beginning with an amino acid in position 1 and ending with an amino acid in position 144 (HPO80);
in SEQ ID NO:42, beginning with an amino acid in any one of the positions from −20 to 5, and ending with an amino acid in position 152 (HPO87);
in SEQ ID NO:44, beginning with an amino acid in any one of the positions from −31 to 5, and ending with an amino acid in position 112 (HPO95);
in SEQ ID NO:46, beginning with an amino acid in any one of the positions from −20 to 5, and ending with an amino acid in position 91 (HPO98);
in SEQ ID NO:48, beginning with an amino acid in any one of the positions from −21 to 5, and ending with an amino acid in position 129 (HPO9); and
(b) the precursor or mature amino acid sequences encoded by the Helicobacter DNA inserts found in American Type Culture Collection deposit numbers 98197 (HPO76), 98210 (HPO18), 98201 (HPO121), 98208 (HPO45), 98198 (HPO101), 98200 (HPO116), 98211 (HPO7), 98199 (HPO104), 98214 (HPO15), 98206 (HPO58), 98202 (HPO132), 98203 (HPO9), 98204 (HPO38), 98205 (HPO87), 98217 (HPO71), 98219 (HPO70), 98215 (HPO80), 98216 (HPO95), 98218 (HPO98), 98220 (HPO57), 98207 (HPO50), 98213 (HPO64), 98212 (HPO54), and 98209 (HPO42); or (ii) a derivative of said polypeptide encoded by said polynucleotide.
2. An isolated polynucleotide that encodes (i) a polypeptide comprising an amino acid sequence that is homologous to an amino acid sequence selected from the group consisting of:
(a) the amino acid sequences as shown:
in SEQ ID NO:2, beginning with an amino acid in position −27 and ending with an amino acid in position 160 (HPO101);
in SEQ ID NO:4, beginning with an amino acid in position 1 and ending with an amino acid in position 172 (HPO104);
in SEQ ID NO:6, beginning with an amino acid in position −17 and ending with an amino acid in position 169 (HPO116);
in SEQ ID NO:8, beginning with an amino acid in position −21 and ending with an amino acid in position 198 (HPO121);
in SEQ ID NO:10, beginning with an amino acid in position −20, and ending with an amino acid in position 132 (HPO132);
in SEQ ID NO:12, beginning with an amino acid in position 1 and ending with an amino acid in position 114 (HPO15);
in SEQ ID NO:14, beginning with an amino acid in position −17 and ending with an amino acid in position 248 (HPO18);
in SEQ ID NO:16, beginning with an amino acid in position −40 and ending with an amino acid in position 74 (HPO38);
in SEQ ID NO:18, beginning with an amino acid in position −34 and ending with an amino acid in position 226 (HPO42);
in SEQ ID NO:20, beginning with an amino acid in position −21 and ending with an amino acid in position 179 (HPO45);
in SEQ ID NO:22, beginning with an amino acid in position −33 and ending with an amino acid in position 114 (HPO50);
in SEQ ID NO:24, beginning with an amino acid in position −60 and ending with an amino acid in position 349 (HPO54);
in SEQ ID NO:26, beginning with an amino acid in position −18 and ending with an amino acid in position 288 (HPO57);
in SEQ ID NO:28, beginning with an amino acid in position −21 and ending with an amino acid in position 150 (HPO58);
in SEQ ID NO:30, beginning with an amino acid in position −20 and ending with an amino acid in position 309 (HPO64);
in SEQ ID NO:32, beginning with an amino acid in position −35 and ending with an amino acid in position 129 (HPO70);
in SEQ ID NO:34, beginning with an amino acid in position −19 and ending with an amino acid in position 153 (HPO71);
in SEQ ID NO:36, beginning with an amino acid in position −25 and ending with an amino acid in position 176 (HPO76);
in SEQ ID NO:38, beginning with an amino acid in position −21 and ending with an amino acid in position 156 (HPO7);
in SEQ ID NO:40, beginning with an amino acid in position 1 and ending with an amino acid in position 144 (HPO80);
in SEQ ID NO:42, beginning with an amino acid in position −20 and ending with an amino acid in position 152 (HPO87);
in SEQ ID NO:44, beginning with an amino acid in position −31 and ending with an amino acid in position 112 (HPO95);
in SEQ ID NO:46, beginning with an amino acid in position −20 and ending with an amino acid in position 91 (HPO98);
in SEQ ID NO:48, beginning with an amino acid in position −21 and ending with an amino acid in position 129 (HPO9); and
(b) the amino acid sequences encoded by the DNA inserts found in American Type Culture Collection deposit numbers 98197 (HPO76), 98210 (HPO18), 98201 (HPO121), 98208 (HPO45), 98198 (HPO101), 98200 (HPO116), 98211 (HPO7), 98199 (HPO104), 98214 (HPO15), 98206 (HPO58), 98202 (HPO132), 98203 (HPO9), 98204 (HPO38), 98205 (HPO87), 98217 (HPO71), 98219 (HPO70), 98215 (HPO80), 98216 (HPO95), 98218 (HPO98), 98220 (HPO57), 98207 (HPO50), 98213 (HPO64), 98212 (HPO54), and 98209 (HPO42); or (ii) a derivative of said polypeptide.
3. The isolated polynucleotide of claim 1, which encodes the mature form of (i) a polypeptide comprising an amino acid sequence that is homologous to an amino acid sequence selected from the group consisting of:
(a) the amino acid sequences as shown:
in SEQ ID NO:2, beginning with an amino acid in position −27 and ending with an amino acid in position 160 (HPO101);
in SEQ ID NO:4, beginning with an amino acid in position 1 and ending with an amino acid in position 172 (HPO104);
in SEQ ID NO:6, beginning with an amino acid in position −17 and ending with an amino acid in position 169 (HPO116);
in SEQ ID NO:8, beginning with an amino acid in position −21 and ending with an amino acid in position 198 (HPO121);
in SEQ ID NO:10, beginning with an amino acid in position −20, and ending with an amino acid in position 132 (HPO132);
in SEQ ID NO:12, beginning with an amino acid in position 1 and ending with an amino acid in position 114 (HPO15);
in SEQ ID NO:14, beginning with an amino acid in position −17 and ending with an amino acid in position 248 (HPO18);
in SEQ ID NO:16, beginning with an amino acid in position −40 and ending with an amino acid in position 74 (HPO38);
in SEQ ID NO:18, beginning with an amino acid in position −34 and ending with an amino acid in position 229 (HPO42);
in SEQ ID NO:20, beginning with an amino acid in position −21 and ending with an amino acid in position 179 (HPO45);
in SEQ ID NO:22, beginning with an amino acid in position −33 and ending with an amino acid in position 114 (HPO50);
in SEQ ID NO:24, beginning with an amino acid in position −60 and ending with an amino acid in position 349 (HPO54);
in SEQ ID NO:26, beginning with an amino acid in position −18 and ending with an amino acid in position 288 (HPO57);
in SEQ ID NO:28, beginning with an amino acid in position −21 and ending with an amino acid in position 150 (HPO58);
in SEQ ID NO:30, beginning with an amino acid in position −20 and ending with an amino acid in position 309 (HPO64);
in SEQ ID NO:32, beginning with an amino acid in position −35 and ending with an amino acid in position 129 (HPO70);
in SEQ ID NO:34, beginning with an amino acid in position −19 and ending with an amino acid in position 153 (HPO71);
in SEQ ID NO:36, beginning with an amino acid in position −25 and ending with an amino acid in position 176 (HPO76);
in SEQ ID NO:38, beginning with an amino acid in position −21 and ending with an amino acid in position 156 (HPO7);
in SEQ ID NO:40, beginning with an amino acid in position 1 and ending with an amino acid in position 144 (HPO 80);
in SEQ ID NO:42, beginning with an amino acid in position −20 and ending with an amino acid in position 152 (HPO 87);
in SEQ ID NO:44, beginning with an amino acid in position −31 and ending with an amino acid in position 112 (HPO 95);
in SEQ ID NO:46, beginning with an amino acid in position −20 and ending with an amino acid in position 91 (HPO 98);
in SEQ ID NO:48, beginning with an amino acid in position −21 and ending with an amino acid in position 129 (HPO 9); and
(b) the amino acid sequences encoded by the DNA inserts found in American Type Culture Collection deposit numbers 98197 (HPO76), 98210 (HPO18), 98201 (HPO121), 98208 (HPO45), 98198 (HPO101), 98200 (HPO116), 98211 (HPO7), 98199 (HPO104), 98214 (HPO15), 98206 (HPO58), 98202 (HPO132), 98203 (HPO9), 98204 (HPO38), 98205 (HPO87), 98217 (HPO71), 98219 (HPO70), 98215 (HPO80), 98216 (HPO95), 98218 (HPO98), 98220 (HPO57), 98207 (HPO50), 98213 (HPO64), 98212 (HPO54), and 98209 (HPO42); or (ii) a derivative of said polypeptide.
4. The isolated polynucleotide of claim 1, wherein the polynucleotide is a DNA molecule.
5. The isolated polynucleotide of claim 1, which is a DNA molecule that can be amplified and/or cloned by polymerase chain reaction from an Helicobacter genome, using either:
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:49 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:50 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:51 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:52 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:53 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:54 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:55 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:56 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:57 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:58 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:59 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:60 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:61 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:62 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:63 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:64 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:65 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:66 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:67 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:68 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:69 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:70 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:71 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:72 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:73 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:74 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:75 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:76 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:77 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:78 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:79 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:80 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:81 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:82 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:83 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:84 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:85 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:86 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:87 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:88 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:89 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:90 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:91 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:93 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:95 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:94 wherein N is a restriction site;
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:97 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:96 wherein N is a restriction site; or
A 5′ oligonucleotide primer having a sequence as shown in SEQ ID NO:99 wherein N is a restriction site, and a 3′ oligonucleotide primer having a sequence in SEQ ID NO:98 wherein N is a restriction site.
6. The isolated DNA molecule of claim 5, which can be amplified and/or cloned by the polymerase chain reaction from a Helicobacter pylori genome.
7. The isolated polynucleotide of claim 1, which is a DNA molecule that encodes the mature form or a derivative of a polypeptide encoded by the DNA molecule of claim 5.
8. The isolated polynucleotide of claim 1, which is a DNA molecule that encodes the mature form or a derivative of a polypeptide encoded by the DNA molecule of claim 6.
9. A compound, in a substantially purified form, that is the mature form or a derivative of a polypeptide comprising an amino acid sequence that is homologous to an amino acid sequence of a polypeptide associated with the Helicobacter membrane, which is selected from the group consisting of:
(a) the amino acid sequences as shown:
in SEQ ID NO:2, beginning with an amino acid in position −27 and ending with an amino acid in position 160 (HPO101);
in SEQ ID NO:4, beginning with an amino acid in position 1 and ending with an amino acid in position 172 (HPO104);
in SEQ ID NO:6, beginning with an amino acid in position −17 and ending with an amino acid in position 169 (HPO116);
in SEQ ID NO:8, beginning with an amino acid in position −21 and ending with an amino acid in position 198 (HPO121);
in SEQ ID NO:10, beginning with an amino acid in position −20, and ending with an amino acid in position 132 (HPO132);
in SEQ ID NO:12, beginning with an amino acid in position 1 and ending with an amino acid in position 114 (HPO15);
in SEQ ID NO:14, beginning with an amino acid in position −17 and ending with an amino acid in position 248 (HPO18);
in SEQ ID NO:16, beginning with an amino acid in position −40 and ending with an amino acid in position 74 (HPO38);
in SEQ ID NO:18, beginning with an amino acid in position −31 and ending with an amino acid in position 226 (HPO42);
in SEQ ID NO:20, beginning with an amino acid in position −21 and ending with an amino acid in position 179 (HPO45);
in SEQ ID NO:22, beginning with an amino acid in position −33 and ending with an amino acid in position 114 (HPO50);
in SEQ ID NO:24, beginning with an amino acid in position −60 and ending with an amino acid in position 349 (HPO54);
in SEQ ID NO:26, beginning with an amino acid in position −18 and ending with an amino acid in position 288 (HPO57);
in SEQ ID NO:28, beginning with an amino acid in position −21 and ending with an amino acid in position 150 (HPO58);
in SEQ ID NO:30, beginning with an amino acid in position −20 and ending with an amino acid in position 309 (HPO64);
in SEQ ID NO:32, beginning with an amino acid in position −35 and ending with an amino acid in position 129 (HPO70);
in SEQ ID NO:34, beginning with an amino acid in position −19 and ending with an amino acid in position 153 (HPO71);
in SEQ ID NO:36, beginning with an amino acid in position −25 and ending with an amino acid in position 176 (HPO76);
in SEQ ID NO:38, beginning with an amino acid in position −21 and ending with an amino acid in position 156 (HPO7);
in SEQ ID NO:40, beginning with an amino acid in position 1 and ending with an amino acid in position 144 (HPO80);
in SEQ ID NO:42, beginning with an amino acid in position −20 and ending with an amino acid in position 152 (HPO87);
in SEQ ID NO:44, beginning with an amino acid in position −31 and ending with an amino acid in position 112 (HPO95);
in SEQ ID NO:46, beginning with an amino acid in position −20 and ending with an amino acid in position 91 (HPO98);
in SEQ ID NO:48, beginning with an amino acid in position −21 and ending with an amino acid in position 129 (HPO9); and
(b) the amino acid sequences encoded by the Helicobacter DNA inserts found in American Type Culture Collection deposit numbers 98197 (HPO76), 98210 (HPO18), 98201 (HPO121), 98208 (HPO45), 98198 (HPO101), 98200 (HPO116), 98211 (HPO7), 98199 (HPO104), 98214 (HPO15), 98206 (HPO58), 98202 (HPO132), 98203 (HPO9), 98204 (HPO38), 98205 (HPO87), 98217 (HPO71), 98219 (HPO70), 98215 (HPO80), 98216 (HPO95), 98218 (HPO98), 98220 (HPO57), 98207 (HPO50), 98213 (HPO64), 98212 (HPO54), and 98209 (HPO42).
10. The compound of claim 9, which is the mature form or a derivative of a polypeptide encoded by a DNA molecule of claim 5.
11. The compound of claim 9, which is the mature form or a derivative of a polypeptide encoded by a DNA molecule of claim 6.
12. A method of preventing or treating Helicobacter infection in a mammal, said method comprising administering to said mammal a prophylactically or therapeutically effective amount of a compound of claim 9.
13. The method of claim 12, further comprising administering an antibiotic, an antisecretory agent, a bismuth salt, or a combination thereof.
14. The method of claim 13, wherein said antibiotic is selected from the group consisting of amoxicillin, clarithromycin, tetracycline, metronidizole, and erythromycin.
15. The method of claim 13, wherein said bismuth salt is selected from the group consisting of bismuth subcitrate and bismuth subsalicylate.
16. The method of claim 13, wherein said antisecretory agent is a proton pump inhibitor.
17. The method of claim 16, wherein said proton pump inhibitor is selected from the group consisting of omeprazole, lansoprazole, and pantoprazole.
18. The method of claim 13, wherein said antisecretory agent is an H2-receptor antagonist.
19. The method of claim 18, wherein said H2-receptor antagonist is selected from the group consisting of ranitidine, cimetidine, famotidine, nizatidine, and roxatidine.
20. The method of claim 13, wherein said antisecretory agent is a prostaglandin analog.
21. The method of claim 20, wherein said prostaglandin analog is misoprostil or enprostil.
22. The method of claim 12, which further comprises administering a prophylactically or therapeutically effective amount of a second Helicobacter polypeptide or a derivative thereof.
23. The method of claim 22, wherein the second Helicobacter polypeptide is a Helicobacter urease, a subunit, or a derivative thereof.
24. A composition comprising a compound of claim 9, together with a physiologically acceptable diluent or carrier.
25. The composition of claim 24, further comprising an adjuvant.
26. The composition of claim 24, further comprising a second Helicobacter polypeptide or a derivative thereof.
27. The composition of claim 26, wherein said second Helicobacter polypeptide is a Helicobacter urease, or a subunit or a derivative thereof.
28. A method of preventing or treating Helicobacter infection in a mammal, said method comprising administering to said mammal a prophylactically or therapeutically effective amount of a polynucleotide of claim 1.
29. A method of preventing or treating Helicobacter infection in a mammal, said method comprising administering to said mammal a prophylactically or therapeutically effective amount of a polynucleotide of claim 5.
30. A method of preventing or treating Helicobacter infection in a mammal, said method comprising administering to said mammal a prophylactically or therapeutically effective amount of a polynucleotide of claim 8.
31. A composition comprising a viral vector, in the genome of which is inserted a DNA molecule of claim 4, said DNA molecule being placed under conditions for expression in a mammalian cell and said viral vector being admixed with a physiologically acceptable diluent or carrier.
32. The composition of claim 31, wherein said viral vector is a pox virus.
33. A composition that comprises a bacterial vector comprising a DNA molecule of claim 4, said DNA molecule being placed under conditions for expression and said bacterial vector being admixed with a physiologically acceptable diluent or carrier.
34. The composition of claim 33, wherein said vector is selected from the group consisting of Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacille bilié de Calmette-Guérin, and Streptococcus.
35. A composition comprising a polynucleotide of claim 1, together with a physiologically acceptable diluent or carrier.
36. The composition of claim 35, wherein said polynucleotide is a DNA molecule that is inserted in a plasmid that is unable to replicate and to substantially integrate in a mammalian genome and is placed under conditions for expression in a mammalian cell.
37. An expression cassette comprising a DNA molecule of claim 4, said DNA molecule being placed under conditions for expression in a procaryotic or eucaryotic cell.
38. A process for producing a compound of claim 9, which comprises culturing a procaryotic or eucaryotic cell transformed or transfected with an expression cassette of claim 37, and recovering said compound from the cell culture.
39. A method of preventing or treating Helicobacter infection in a mammal, said method comprising administering to said mammal a prophylactically or therapeutically effective amount of an antibody that binds to the compound of claim 9.
US10/013,315 1996-11-14 2001-11-05 Helicobacter antigens and corresponding DNA fragments Abandoned US20030069404A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/013,315 US20030069404A1 (en) 1996-11-14 2001-11-05 Helicobacter antigens and corresponding DNA fragments

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US74905196A 1996-11-14 1996-11-14
US10/013,315 US20030069404A1 (en) 1996-11-14 2001-11-05 Helicobacter antigens and corresponding DNA fragments

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US74905196A Continuation 1996-11-14 1996-11-14

Publications (1)

Publication Number Publication Date
US20030069404A1 true US20030069404A1 (en) 2003-04-10

Family

ID=25012024

Family Applications (1)

Application Number Title Priority Date Filing Date
US10/013,315 Abandoned US20030069404A1 (en) 1996-11-14 2001-11-05 Helicobacter antigens and corresponding DNA fragments

Country Status (1)

Country Link
US (1) US20030069404A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030007980A1 (en) * 1992-11-03 2003-01-09 Pierre Michetti Urease-based vaccine and treatment for helicobacter infection
US20040033240A1 (en) * 2000-07-05 2004-02-19 Bruno Guy Immunological combinations for prophylaxis and therapy of helicobacter pylori infection
US20040058402A1 (en) * 2001-02-05 2004-03-25 Laurence Fourrichon Method for purifying the helicobacter adhesin-like protein a (alpa)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030007980A1 (en) * 1992-11-03 2003-01-09 Pierre Michetti Urease-based vaccine and treatment for helicobacter infection
US20040033240A1 (en) * 2000-07-05 2004-02-19 Bruno Guy Immunological combinations for prophylaxis and therapy of helicobacter pylori infection
US20040058402A1 (en) * 2001-02-05 2004-03-25 Laurence Fourrichon Method for purifying the helicobacter adhesin-like protein a (alpa)

Similar Documents

Publication Publication Date Title
AU784193B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
AU780444B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
WO2002018595A9 (en) Moraxella polypeptides and corresponding dna fragments and uses thereof
CA2385325C (en) Chlamydia antigens and corresponding dna fragments and uses thereof
KR20010005893A (en) Identification of polynucleotides encoding novel helicobacter polypeptides in the helicobacter genome
US7629327B2 (en) Chlamydia 60 Kda CRMP antigens and vaccine uses
US7081245B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
AU750792B2 (en) 76 kDa, 32 kDa, and 50 kDa helicobacter polypeptides and corresponding polynucleotide molecules
US20030158396A1 (en) Identification of polynucleotides encoding novel helicobacter polypeptides in the helicobacter genome
AU735391B2 (en) Helicobacter polypeptides and corresponding polynucleotide molecules
US20030069404A1 (en) Helicobacter antigens and corresponding DNA fragments
US6403101B1 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
US20030124141A1 (en) Helicobacter polypeptides and corresponding polynucleotide molecules
US20020115078A1 (en) Identification of polynucleotides encoding novel helicobacter polypeptides in the helicobacter genome
US20030023066A1 (en) Helicobacter polypeptides and corresponding polynucleotide molecules
AU771974B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
US6660275B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
US20020160456A1 (en) Identification of polynucleotides encoding novel helicobacter polypeptides in the helicobacter genome
US20020107368A1 (en) Helicobacter proteins, gene sequences and uses thereof
US20020026035A1 (en) Helicobacter ghpo 1360 and ghpo 750 polypeptides and corresponding polynucleotide molecules
US20020044949A1 (en) 76 kda helicobacter polypeptides and corresponding polynucleotide molecules
US7166289B2 (en) Nucleic acid molecules encoding inclusion membrane protein C of Chlamydia
AU770919B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
AU774902B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
JP2001503637A (en) Helicobacter polypeptides and corresponding polynucleotide molecules

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION