WO1988007546A1 - Immunogenic polypeptide and method for purifying it - Google Patents

Immunogenic polypeptide and method for purifying it Download PDF

Info

Publication number
WO1988007546A1
WO1988007546A1 PCT/US1988/001150 US8801150W WO8807546A1 WO 1988007546 A1 WO1988007546 A1 WO 1988007546A1 US 8801150 W US8801150 W US 8801150W WO 8807546 A1 WO8807546 A1 WO 8807546A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
vivax
amino acid
repetitive
Prior art date
Application number
PCT/US1988/001150
Other languages
English (en)
French (fr)
Inventor
Victor Nussenzweig
Original Assignee
New York University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New York University filed Critical New York University
Publication of WO1988007546A1 publication Critical patent/WO1988007546A1/en
Priority to DK665588A priority Critical patent/DK665588A/da

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/002—Protozoa antigens
    • A61K39/015—Hemosporidia antigens, e.g. Plasmodium antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to an immunogenic polypeptide expressed by a recombinant yeast and comprising an amino acid sequence incorporating a portion of the P.vivax circumsporozoite (CS) protein including the region of the repeat immunodominant epitope of said protein; and to a method for purifying this polypeptide.
  • CS P.vivax circumsporozoite
  • the entire P.vivax CS gene has been identified and its sequence described in the above-mentioned documents.
  • the P.vivax CS protein comprises a central region of 19 tandem repeats of the sequence:
  • A alanine
  • C cysteine
  • D aspartic acid
  • E glutamic acid
  • F phenylalanine
  • G glycine
  • H histidine
  • I isoleucine
  • K lysine
  • L leucine
  • M aethionine
  • N asparagine
  • P proline
  • Q glutamine
  • R arginine
  • S serine
  • T threonine
  • V valine
  • W tryptophan
  • Y tyrosine.
  • Synthetic peptides consisting essentially of 18 amino acid residues (i.e. two repeats of the above repeating sequence and cyclic permutations thereof -- such as Asp-Gly-Gln-Pro-Ala-Gly-Asp-Arg-Ala) are recognized by antibodies to the native P.vivax CS protein and in turn generate antibodies (when injected in mammals) which recognize, and bind to, the native CS protein. Hence, such peptides have utility in a vaccine against malaria.
  • the synthetic peptide (NANP) 3 which is a candidate for preparing a vaccine against P.falciparum is exceptional, since at least 70% of the antipeptide antibodies recognize the malaria sporozoites.
  • an alternative technique was sought for manufacturing an immunogenic peptide that could be used in a vaccine against P.vivax malaria.
  • the present inventors looked to recombinant DNA and genetic engineering techniques to express immunogenic polypeptides that would be used to confer immunity to mammals against P.vivax malaria.
  • the technology was readily available for constructing recombinant bacteria that would express a portion or all of the repeating amino acid sequence of the P.vivax protein, the present inventors searched for an alternative expression system for the following reasons: First, the expression system should be reliable and able to produce the polypeptide of interest consistently and with a high yield. Bacteria can be difficult to handle when produced in mass culture and overexpressing a foreign protein product.
  • expression products of bacteria are often difficult to purify from pyrogenic impurities and other inflammatory and toxic agents that either are co-expressed by the bacteria, or are necessary additives in a bacterial growth medium.
  • expression products of bacteria are most often fusion proteins, that is, they contain additional non-relevant sequences originating from the genes associated with the bac teria.
  • yeast expression systems which have been substantially improved by recent advances in the field of recombinant DNA technology.
  • Yeasts are hardier organisms than bacteria and much easier to grow in mass culture.
  • recent advances in yeast genetics and cloning have increased the yields of yeast expression systems.
  • Purification of expression products of recombinant yeast systems is not a priori more complicated than purification of products of bacterial recombinant systems and depends mostly on the characteristics of the particular protein sought to be purified. Nevertheless, such purification is generally more complicated than that of a peptide or protein produced by classical peptide synthetic techniques.
  • the present inventors chose a general yeast expression system that is the subject matter of United States Patent Application Serial No. 868,639 filed on May 29, 1986 in the name of R.L. Burke et al and assigned to Chiron Corporation. This application is incorporated by reference herein.
  • an object of the present invention to provide an immunogenic yeast-engineered polypeptide immunochemically reactive with monoclonal antibodies against P.vivax circumsporozoite (CS) protein, and useful in a vaccine preparation against malaria.
  • CS circumsporozoite
  • Another object is to provide an immunogenic polypeptide suitable for incorporation in an anti-malaria vaccine preparation.
  • Another object is to provide an immunogenic polypeptide suitable for use in an anti-malaria vaccine preparation without being coupled to a carrier.
  • Another object is to provide a method for purifying the foregoing yeast-engineered polypeptide from an impure preparation thereof comprising lysed yeast cell material and yeast culture media.
  • Figure 1 is a diagram of the construction of the yeast expression vector used in the present invention.
  • Figure 2 is a map of yeast plasmid pAB24.
  • Figure 3 is a polyacrylamide gel obtained using lysates from P. vivax/pAB24-transformed yeast and control yeast.
  • Figure 4 is a Western analysis of lysates from yeast transformed with the P. vivax/pAB24 vector.
  • Figure 5 is a plot of (a) the optical density profile of the material purified according to the invention (solid line); (b) the conductivity of the eluting buffer (solid lineblack points); and (c) the percent activity of eluted fractions in inhibiting the binding of antibody to native CS protein.
  • Figure 6 is a radioautograph of a SDS-PAGE gel demonstrating the purity of the engineered polypeptide when made and purified in accordance with the present invention.
  • Figure 7 is a radioautograph of an isoelectric focusing gel showing the engineered polypeptide of the present invention.
  • Figure 8 is a standard curve for a competitive radioimmunoassay and shows the inhibition of binding of labeled, en gineered CS polypeptide to anti-vivax CS protein antibodies by the presence of unlabeled engineered polypeptide of the present invention.
  • Figure 9 is a plot of the amount of radiolabeled goat anti-mouse IgG recognizing mouse antisera bound to engineered CS polypeptide, as a function of the mouse serum dilution.
  • Figure 10 is a plot of the binding of labeled mouse antisera (raised against the engineered peptide) to immobilized synthetic 18-amino acid (repeat) vivax CS peptide, as a function of the antibody concentration.
  • Figure 11 is a plot of the inhibition by synthetic vivax CS repeat peptide of the binding of mouse antisera to immobilized engineered CS polypeptide prepared and purified according to the present invention, as a function of the concentration of the synthetic (inhibiting) peptide.
  • Figure 12 is a plot of the binding of mouse antisera to immobilized synthetic non-repeat peptide, as a function of the antisera dilution.
  • This invention relates to a yeast-engineered polypeptide having an amino acid sequence consisting essentially of the amino acid sequence:
  • the P.vivax CS gene is set forth below (together with the amino acid sequence for which it codes) [N-terminus] ATGAAGAACTTCATTCTCTTGGCTGTTTCTTCCATCCTGTTGGTGGACTTG
  • the DNA fragment chosen for insertion in the yeast host was: GCAGAACCAAAAAATCCACGTGAAAATAAGCTGAAGCAACCAGGAGACAGAGCAGATGGACAGC
  • This fragment includes the entire tandem repeat se quence plus a region that is substantially parallel to Region I of Dame, et al Science 225:628 (1984), precedes the repeat re gion, and codes for the amino acid sequence AE P KN P RE N K L K Q P G.
  • This sequence includes the subsequence K L K Q P wh ich is conserved in all malarial species that have been investigated to date.
  • the foregoing DNA fragment was obtained from the entire gene by subcloning a 15kb BglII fragment isolated as described by Arnot et. al (U.S. Patent Application Serial No. 754,645, and Science 230:815-818. November 15, 1985) both incorporated by reference. It was then inserted in the DNA of modified yeast plasmid pAB24 as described in Example 1 below.
  • a hybrid promoter comprising the strong yeast glyceraldehyde-3-phosphate dehydrogenase and the glucose regulatable alcohol dehydrogenase-2 (ADH-2) promoter was used. Fusion of this promoter to heterologous genes allows the growth of yeast cultures to high density using glucose as a carbon source. Depletion of glucose in the media during fermentative growth leads to concomitant induction of expression of the heterologous protein. Incorporation of the plasmid into high copy number, autonomously replicating yeast plasmids, and transformation of yeast cells generated strains capable of expressing high levels of CS proteins on induction.
  • the yeast was grown in culture in YEP medium (1% w/v yeast extract, 2% peptone) with 1% glucose as described in Example 1 below. Two hundred liters of yeast material were thus obtained and stored at - 80 oC.
  • the thus obtained yeast material contained a complex mixture of different yeast proteins as well as culture medium additives. Gel electrophoresis of this material on 7.5% sodium dodecyl sulfate polyacrylamide gel gave an indication of its heterogeneity (see Figure 6, lane 1).
  • the expression procedure and plasmid construction are outlined in Figure 1 and described in Example 1, below.
  • polypeptide will refer to a relatively long protein fragment
  • protein will refer to the entire protein
  • peptide will refer to a relatively short peptide, e.g., one containing 30 amino acid residues or less.
  • sequence it will be understood that polypeptides and peptides in accordance with the present invention will be functionally equivalent if they have the same sequence whether the sequence is set forth from the N to the C terminus or from the C to the N terminus).
  • the mixture was then subjected to heating at 100oC, which resulted in massive precipitation of lysed yeast cell material.
  • the supernatant was separated, dried and lyophilized.
  • the lyophilized supernatant residue showed a substantial improvement in purity over the yeast extract (see Fig. 6, lane 4).
  • a solution of the lyophilized material was then further purified sequentially by (a) anion-exchange chromatography using an electrolyte gradient to elute the engineered CS polypeptide; and (b) molecular sieve chromatography.
  • the fractions containing CS polypeptide activity were identified with a radioimmunoassay.
  • a small amount of the highly purified yeast material was radiolabelled to a high specific activity with 125 I.
  • Each fraction was assayed by a classical radioimmunoassay for its capacity to inhibit the binding of the labelled material to immobilized anti-P.vivax monoclonal antibody, directed against the repetitive epitope of the P.vivax CS protein.
  • a major advantage of the purification process of the present invention is its simplicity and its ready adaptability to scale-up.
  • the thus purified engineered P.vivax CS polypeptide is homogeneous by SDS-PAGE and isoelectric focusing and is thus expected to be substantially free of pyrogenic, inflammatory and toxic impurities that may have been associated with the lysed yeast cell material and yeast culture media.
  • the yield of the combination of the yeast expression procedure and the purification process of the present invention proved to be 13 mg of pure CS polypeptide per liter of yeast culture. Given that 200 liters of this culture were produced in three days using pilot scale equipment (250 liter fermenter), it is apparent that large amounts of the engineered CS polypeptide can be made available in a short period of time.
  • a 200-liter stock of yeast extract contains sufficient engineered CS polypeptide to immunize about 25,000 humans against P.vivax. using 100 micrograms of polypeptide per person.
  • Major advantages of the CS polypeptide produced in accordance with the present invention include that the engineered peptide:
  • (a) can be produced in large scale free of impurities and of non-relevant antigens; (b) represents a large fragment of the native CS molecule;
  • Antibodies to the "repeats” have been shown to neutralize parasite injectivity very effectively. Antibodies to a peptide containing this conserved region also neutralized parasite injectivity, but the inhibitory activity could not be accurately quantitated (Vergara, et al, J. Immunol. 134: 3445-3448, 1985). Moreover, the fact that the sequence KLKQP, which is part of the peptide, is present in all CS proteins, suggests that this region has an important function.
  • EXAMPLE 1 Restriction of the P.vivax CS gene, Ligation into a Vector, Transformation of the Host Yeast Cells and Expression
  • Linker I provides for an Ncol site, while Linker II provides a SalI overhang.
  • the linker-containing fragment was digested with NcoI and Sail, isolated by gel electrophoresis and cloned onto NcoI/SalI digested pBS100 (construction described below).
  • the resulting plasmid is designated pAG/P.vivaxl.
  • pBS100 is a pBR322-derived plasmid containing the ADH-2 regulated GAPDH (glyceraldehyde-3-phosphate dehydrogenase) promoter (1200bp) and GAPDH terminator (900bp) (See Figure 1) and its construction is described below.
  • the ADH-2 portion of the promoter was constructed by cutting a plasmid containing the wild type ADH-2 gene (plasmid pADR2, see Beier and Young, Nature. 300:724 - 728 (1982) incorporated by reference with the restriction enzyme EcoR5, which cuts at a position +66 relative to the ATG start codon, as well as in two other sites in pADR2, outside of the ADH-2 region.
  • the resulting mixture of a vector fragment and two smaller fragments was digested with Bal31 exonuclease to remove about 300bp.
  • the resulting DNA linker vector fragment (about 5kb) was separated from the linkers by column chromatography (on
  • Xhol religated and used to transform E. colj to ampicillin resistance.
  • the positions of the Xhol linker additions were determined by DNA sequencing using standard techniques well known in the art.
  • the GAP portion of the promoter was constructed by cutting plasmid pPGAP (as disclosed in European Patent Application No. 164,556 of Chiron Corporation filed on May 3, 1985, incorporated by reference and accorded the filing date of a corresponding U.S. application Serial No. 609,540 filed on May 11, 1984) with the enzymes BamHI and EcoRI, followed by the isolation of the 0.4Kbp DNA fragment.
  • Plasmid pPGAP is a yeast plasmid containing a yeast GAPDH promoter and terminator sequences with flanking Ncol and SalI restriction endonuclease sites. The purified fragment was partially digested with the enzyme Alul to create a blunt end near the BamHI site and used to construct plasmid pJS104.
  • Plasmid pJS104 was constructed by the ligation of the AluI-EcoRI GAP promoter fragment to the ADH-2 fragment present on the linear vector described above.
  • the BamHI-Ncol ADH-GAP promoter fragment was obtained from plasmid pJS103, which is the same as pJS104 (supra) except that the GAP fragment of the ADH-GAP promoter is about 200 bp in pJS103 and 400 bp in pJS104.
  • Construction of pJS103 was the same as that for pJS104 except that the 0.4 kb BamHI-EcoRI fragment was completely digested with Alul (instead of partially digested for pJS104) and a 200 bp fragment was isolated.
  • pAB24 is a yeast expression vector (Fig. 2) which contains the complete 2 mu sequences necessary for an autonomous replication in yeast (Broach, in: Molecular Biology of the Yeast Saccharomvces. 1:445, Cold Spring Harbor Press, 1981) and pBR322 sequences.
  • yeast URA3 gene derived from plasmid YEp24 (Botstein, et al., Gene (1979) 8:17 incor porated by reference) and the yeast LEU2 d gene derived from plasmid pCl/1 (see European Patent Application Serial No. 116,201 filed on August 22, 1984 in the name of Chiron Corporation, incorporated by reference). Insertion of the expression cassette was in the BamHI site of pBR322, thus interrupting the gene for bacterial Resistance to tetracyclin. Expression of P. vivax CS proteins
  • Saccharomyces cerevisiae strain AB110 isolated by Chiron Corporation (Mat , leu2-04. or both leu2-3 and leu2-112, pep4-3, his4-580. cir ) was transformed with pAB24/P. viva according to Hinnen, et al., Proc. Natl. Acad. Sci. USA 75:1929 - 1933 (1978). Single-transformant colonies harboring GAP- regulated vectors were grown in 2ml of leu- (leucine-depleted) selective media to late log or stationary phase. Only yeast harboring the plasmid can grow in this medium.
  • vivax plasmid ( Figure 3). This band was detected in those cells transformed with the expression vector, while being absent from extracts of cells harboring control (pCl/1) plasmids.
  • the fusion protein accounts for over 10% of the total cell protein.
  • the reason for abnormal cell migration (38kD versus 23kD, predicted from DNA construction) may be attributable to anomalous SDS binding as previously reported for P. Knowlesi CS proteins (Ozaki, et al., Cell 34:185, 1983), probably due to the low proportion of hydrophobic residues.
  • proteins synthesized by yeast were also submitted to Western analysis. Cleared yeast lysates prepared as described above were electrophoresed on polyacrylamide gels (Laemmli, supra) and proteins were subsequently electroblotted onto nitrocellulose filters (Towbin, et. al., Proc. Natl. Acad. Sci. USA 76:3450, 1979). The filter was preincubated for 1h with 1% (BSA) in PBS and subsequently treated with a monoclonal antibody to P. vivax CS protein for 12h at 4oC.
  • BSA 1%
  • the filters were washed with 1% BSA/PBS and a second goat anti-mouse antibody conjugated with horseradish peroxidase (BioRad Laboratories, Richmond, California) added. Finally, the filters were incubated with horseradish peroxidase color development reagent (Bio-Rad, Richmond, CA) and washed. The western analysis showed that the fusion protein reacted with the monoclonal antibodies. (Fig. 4)
  • EXAMPLE 2 Purification of the circumsporozoite polypeptide of the Plasmodium vivax
  • the yeast cultures expressing a part of the circumsporozoite polypeptide were prepared as in Example 1.
  • the expressed polypeptide consisted of 234 amino acids including all of the repeat domain and a conserved region, namely Region I of Dame, J.B., et al, Science 225:628 (1984).
  • the N-terminal amino acid of the expressed polypeptide is alanine in the nucleotide positions No. 385-7 (GCA) and the C-terminal amino acid is proline at nucleotide positions No. 1084-1086 (CCA); Arnot, et al, Science 230:815-818, 1985.
  • the first step of purification of the peptide fragment expressed by yeast consisted of subjecting the extracts to temperatures of 100oC. The purification was performed as follows:
  • Extracts from pelleted yeast from 20 liters of yeast culture were prepared in a bead beater, diluting the yeast in an equal volume of 0.1 M sodium phosphate buffer, pH 7.3, 0.1% Triton-X, 1 mM EDTA, 1 mM PMSF (phenylmethylsulfonylfluoride) and 1 microgram per ml of pepstatin.
  • the extract (370 ml) was added to 200 ml of boiling water containing 1 mM of PMSF and 1 microgram/ml of leupeptin. The mixture was brought to a temperature of 100oC and kept for ten minutes with constant stirring at this temperature.
  • the mixture was cooled to 0oC and centrifuged at 18,000 rotations per minute in a Beckman Ultracentrifuge Rotor TI-19, (Beckman Instruments, Palo Alto, CA) for fifteen minutes. The supernatant was removed and then lyophilized.
  • the dry material was dissolved in 120 ml of water, centrifuged to remove a small residual amount of insoluble material, dialyzed extensively against distilled water for 48 hours and lyophilized again.
  • the powder was dissolved in 3 mM sodium potassium phosphate buffer, pH 7.5, and the conductivity adjusted with water to 0.58 mS.
  • the solution was centrifuged to remove insoluble materials and subjected to anion exchange chromatography in a DEAE-Sephacel (Pharmacia Fine Chem Co., Piscataway, N.J.) column (5cm x 24cm) equilibrated in the same buffer. The flow rate was adjusted to 100ml per hour and 21 ml per tube were collected.
  • the column was then washed with 500 ml of the same buffer, i.e., with about one column volume.
  • the elution continued with a buffer formed in a linear gradient in which 1,500 ml of the initial buffer were gradually mixed with 1,500 ml of the same buffer also containing 0.75 M NaCl.
  • the presence of the circumsporozoite polypeptide in the various fractions eluting from the column was detected using a competitive radioimmunoassay described below.
  • the positive fractions eluted between fraction Nos. 65- 90 in a symmetrical peak with conductivities between 2 and 10 mS (Fig. 5).
  • the full fractions 65-90 were lyophilized, redissolved in 60 ml of 0.3 M NaCl and dialyzed against 0.3 M NaCl at room temperature for several hours.
  • the dialyzate was centrifuged to remove a small amount of insoluble material and one third, i.e. 20 ml, was subjected to molecular sieve chromatography on Sephadex G-200 (Pharmacia) equilibrated with 0.3 M sodium chloride.
  • the Sephadex was superfine and the column was 5 cm in diameter and 100 cm long. Samples of 21 ml per tube were collected from the column.
  • the CS polypeptide eluted in a sharp symmetrical peak between tubes 51-57.
  • a solid state competitive radioimmunoassay was used to detect the engineered CS polypeptide during the purification procedure.
  • the standard curve relating the dose of antigen with the signal obtained in the radioimmunoassay was prepared as follows.
  • the purified, engineered CS polypeptide was radiolabelled with 125 I to a specific activity of about 2 x 10 6 counts per minute per microgram protein using the well-known iodogen method.
  • Mixtures containing a constant amount of radiolabelled engineered CS polypeptide and variable amounts of purified cold (i.e. unlabeled) engineered CS polypeptide (in a total volume of 100 microliters) were prepared.
  • the assay of the column fractions and of the extracts was performed exactly as described above and the degree of inhibition obtained was referred to the standard curve (Fig. 8) to calculate the concentration of the CS protein peptide. All dilutions and washing in this assay were performed in a phosphate buffer saline (PBS) containing 1.0% bovine serum albumin (BSA) and 0.1% sodium azide. On the basis of the results of these assays, we calculated that the yeast cultures contain about 60 mg of circumsporozoite protein per liter and that the recovery of the purified material was about 20% of the total. There were no losses in the initial step of purification, i.e., following the boiling of the extracts this step removed more than 90% of the non-relevant protein bands observed in the SDS-PAGE of the original extracts.
  • PBS phosphate buffer saline
  • BSA bovine serum albumin
  • the purified engineered CS polypeptide was then used as an antigen to immunize mice.
  • mice 8-12 week old mice were injected with 50 mi ⁇ rograms of the purified peptide adsorbed on aluminum hydroxide. Three and six weeks afterwards, the mice were boosted with the same dose of antigen again using aluminum hydroxide as adjuvant. Ten days later, the mice were bled and the sera were subjected to analysis by an immunoradiometric assay to detect antibodies to the CS polypeptide. In this assay, the wells of microtiter plates are coated with purified engineered CS polypeptide (10 micrograms/ml in PBS) and then incubated the wells with 30 microliters of various dilutions of the mouse serum in PBS-BSA.
  • the first two amino acids are extraneous to the CS protein and were added for purposes of coupling the peptide to a carrier protein and radiolabelling with 125 I.
  • This peptide was used to coat wells of microtiter plates and the antibody contents in the sera were detected as described above. After the second booster, all sera recognized this small peptide at dilutions of 1:2,000 or greater. The results of titrations of a pool of these sera is shown in Fig. 12.
  • the sera were also tested by indirect immunofluorescence using the sporozoite of P. vivax as the antigen. All sera were positive at dilutions of 1:1,000 or greater.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US1988/001150 1987-03-30 1988-03-30 Immunogenic polypeptide and method for purifying it WO1988007546A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DK665588A DK665588A (da) 1987-03-30 1988-11-29 Fremgangsmaade til rensning af et polypeptid og polypeptid

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US3232687A 1987-03-30 1987-03-30
US032,326 1987-03-30

Publications (1)

Publication Number Publication Date
WO1988007546A1 true WO1988007546A1 (en) 1988-10-06

Family

ID=21864341

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1988/001150 WO1988007546A1 (en) 1987-03-30 1988-03-30 Immunogenic polypeptide and method for purifying it

Country Status (9)

Country Link
EP (1) EP0309555A4 (ja)
JP (1) JPH01503514A (ja)
AU (1) AU617668B2 (ja)
ES (1) ES2009587A6 (ja)
IL (1) IL85905A0 (ja)
NZ (1) NZ224086A (ja)
PT (2) PT87137B (ja)
WO (1) WO1988007546A1 (ja)
ZA (1) ZA882272B (ja)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0392820A2 (en) * 1989-04-11 1990-10-17 Chiron Corporation Plasmodium circumsporozoite protein analogs lacking repeat sequences
WO1991008293A1 (en) * 1989-12-05 1991-06-13 Aktiebolaget Astra DNA PROBES SPECIFIC FOR $i(PLASMODIUM VIVAX)
EP0600884A4 (en) * 1990-11-06 1992-12-30 Us Gov Sec Navy PROTECTIVE EPITOPE WITH FOUR AMINO ACIDS DRESSES AGAINST MALARIA -i (PLASMODIUM VIVAX).

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4826957A (en) * 1985-07-12 1989-05-02 New York University Immunogenic recombinant yeast expression product and method for purifying it
AU625713B2 (en) * 1988-02-19 1992-07-16 Microgenesys, Inc. Method for producing recombinant protein derived from the circumsporozoite gene of plasmodium falciparum
WO1993011157A1 (en) * 1991-11-27 1993-06-10 The Council Of The Queensland Institute Of Medical Research MALARIAL VACCINE AND PEPTIDES COMPRISING HUMAN T-CELL EPITOPE OF CIRCUMSPOROZOITE PROTEIN OF $i(P.VIVAX)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4466917A (en) * 1981-02-12 1984-08-21 New York University Malaria vaccine
WO1987000533A1 (en) * 1985-07-12 1987-01-29 New York University Immunogenic peptide antigen corresponding to plasmodium vivax circumsporozoite protein
US4693994A (en) * 1985-11-19 1987-09-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Protective synthetic peptide against malaria and encoding gene
US4707357A (en) * 1984-06-26 1987-11-17 The United States Of America As Represented By The Secretary Of The Army Immunologically active peptides capable of inducing immunization against malaria and genes encoding therefor

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ZA856655B (en) * 1984-09-12 1986-04-30 Univ New York Cross-reactive and protective epitopes of circumsporozoite proteins
US4826957A (en) * 1985-07-12 1989-05-02 New York University Immunogenic recombinant yeast expression product and method for purifying it
EP0252588A3 (en) * 1986-05-12 1989-07-12 Smithkline Beecham Corporation Process for the isolation and purification of p. falciparum cs protein expressed in recombinant e. coli, and its use as a vaccine

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4466917A (en) * 1981-02-12 1984-08-21 New York University Malaria vaccine
US4707357A (en) * 1984-06-26 1987-11-17 The United States Of America As Represented By The Secretary Of The Army Immunologically active peptides capable of inducing immunization against malaria and genes encoding therefor
WO1987000533A1 (en) * 1985-07-12 1987-01-29 New York University Immunogenic peptide antigen corresponding to plasmodium vivax circumsporozoite protein
US4693994A (en) * 1985-11-19 1987-09-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Protective synthetic peptide against malaria and encoding gene

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHEMICAl ABSTRACTS, Volume 106, No. 23, issued 8 June 1987 (Columbus, Ohio, USA) (BARR et al.) "Expression in Yeast of a Plasmodium Vivax Antigen of Potential Use in a Human Malaria Vaccine. see page 203, column 1, the Abstract No. 190316k, J. Exp. Med. 1987 165(4), 1160-71 (Eng.). *
CHEMICAL ABSTRACTS, Volume 107, No. 1, issued 1 July 1987 (Columbus, Ohio, USA) DE LA CRUZ et al) "Evolution of the Immunodominant Domain of the Circumsporozoite Protein Gene from Plasmodium Vivax. Implications for Vaccines". see page 181, column 2, the Abstract No. 1902K, J. Biol. Chem. 1987, 262 (14), 6464-7 (Eng.). *
CHEMICAL ABSTRACTS, Volume 107, No. 25, issued 21 December 1987 (Columbus, Ohio USA) (ROMERO et al) "Antigenic Analysis of the Repeat Domain Circumsporozoite Protein of Plasmodium Vivax" see page 590, column 2, the Abstract No. 234362z, J. Immunol. 1987, 139(5), 1679-82 (Eng.). *
Journal of Experimental Medicine (New York, USA) Volume 156, issued July 1982 (NARDIN et al) "Circumsporozoite Proteins of Human Malaria Parasites Plasmodium Falciparum and Plasmodium Vivax", see pages 20-30. *
Journal of Experimental Medicine (New York, USA) Volume 157, issued June 1983 (ZAVALA et al) "Circumsporozoite Proteins of Malaria Parasites Contain a Single Immunodominant Region with two or More Identical Epitopes", see pages 1947-57. *
Journal of Immunology (Baltimore, Maryland, USA) Volume 135, issued October 1985 (ZAVALA et al) "Ubiquity of the Repetitive Epitope of the CS Protein in Different Isolates of Human Malaria Parasited", see pages 2790-93. *
Science (Washington, D.C., USA) Volume 230, issued 15 November 1985 (ARNOT et al) "Circumsporozoite Protein of Plasmodium Vivax: Gene Cloning and Characterization of the Immunodominant Epitope". see pages 815-18. *
Science (Washington, D.C., USA) Volume 230, issued 20 December 1985 (McCUTCHAN et al) "Sequence of the Immunodominant Epitope for the Surface Protein on Sporozoites of Plasmodium Vivax", see page 1381-83. *
See also references of EP0309555A4 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0392820A2 (en) * 1989-04-11 1990-10-17 Chiron Corporation Plasmodium circumsporozoite protein analogs lacking repeat sequences
EP0392820A3 (en) * 1989-04-11 1990-12-27 Chiron Corporation Plasmodium circumsporozoite protein analogs lacking repeat sequences
EP0467965A1 (en) * 1989-04-11 1992-01-29 Chiron Corporation Plasmodium circumsporozoite protein analogs lacking repeat sequences
EP0467965A4 (en) * 1989-04-11 1992-04-15 Chiron Corporation Plasmodium circumsporozoite protein analogs lacking repeat sequences
WO1991008293A1 (en) * 1989-12-05 1991-06-13 Aktiebolaget Astra DNA PROBES SPECIFIC FOR $i(PLASMODIUM VIVAX)
US5250411A (en) * 1989-12-05 1993-10-05 Aktiebolaget Astra Nucleic acid probes specific for Plasmodium vivax and methods of using the same
EP0600884A4 (en) * 1990-11-06 1992-12-30 Us Gov Sec Navy PROTECTIVE EPITOPE WITH FOUR AMINO ACIDS DRESSES AGAINST MALARIA -i (PLASMODIUM VIVAX).
EP0600884A1 (en) * 1990-11-06 1994-06-15 THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by THE SECRETARY OF THE NAVY PROTECTIVE FOUR AMINO ACID EPITOPE AGAINST $i(PLASMODIUM VIVAX) MALARIA

Also Published As

Publication number Publication date
EP0309555A4 (en) 1990-04-10
IL85905A0 (en) 1988-09-30
PT87332B (pt) 1992-07-31
NZ224086A (en) 1991-02-26
PT87137B (pt) 1992-07-31
ZA882272B (en) 1988-09-22
ES2009587A6 (es) 1989-10-01
PT87332A (pt) 1988-05-01
PT87137A (pt) 1988-04-01
AU1593688A (en) 1988-11-02
AU617668B2 (en) 1991-12-05
EP0309555A1 (en) 1989-04-05
JPH01503514A (ja) 1989-11-30

Similar Documents

Publication Publication Date Title
US4722840A (en) Hybrid particle immunogens
EP0123544A2 (en) Process for expressing heterologous protein in yeast, expression vehicles and yeast organisms therefor
EP0307472B1 (en) Immunogenic recombinant yeast expression product and method for purifying it
HUT50876A (en) Process for producing hepatitis b virus surface antigenes and hybrid antigenes containing same, as well as pharmaceutical compositions comprising same
US5098704A (en) Hepatitis surface antigen particle vaccine
EP0510018A1 (en) Lipoprotein signal peptide fused to antigenic polypeptides
AU617668B2 (en) Immunogenic polypeptide and method for purifying it
US6933130B1 (en) Recombinants process for preparing a complete malaria antigen, gp190/MSP1
US4997647A (en) Vaccine against the sporozoite stage of malaria
US4820642A (en) Amplified expression vector
US5171843A (en) Immunogenic polypeptide and method for purifying it
WO1988005817A1 (en) Expression of the p. falciparum circumsporozoite protein by yeast
US5061788A (en) Recombinant malarial polypeptides
WO1990000403A1 (en) Genetically engineered coccidiosis vaccine
EP0474891A1 (en) Vectors for expression of malarial antigens on the surface of Salmonella vaccine strains
EP0540719B1 (en) Dictyostelid expression vector and method for expressing a desired protein
Holder et al. A hybrid gene to express protein epitopes from both sporozoite and merozoite surface antigens of Plasmodium falciparum
US5225534A (en) Recombinant malarial polypeptides
Cook et al. Expression and Purification of Recombinant Tick Anticoagulant Peptide (Y1W/D10R) Double Mutant Secreted bySaccharomyces cerevisiae
JPH05508996A (ja) 熱帯熱マラリア原虫のロプトリー関連タンパク質のクローニングと発現
EP0297110A1 (en) Polypeptides providing protective immunity against malaria
Baba et al. Production of a soluble and secreted antigenic fragment of HBsAg in yeast
JPH11318475A (ja) マラリア特異性ｄｎａ配列物、それらの発現産物およびそれらの使用
NO884304L (no) Ekspresjon av plasmodium falciparum circumsporozoitt-protein hos gjaer.
JPS63283586A (ja) 酵母によるピー・ファルシパルム・サーカムスポロゾイトタンパク質の発現

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK JP LK

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1988903724

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1988903724

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1988903724

Country of ref document: EP