HUT50876A - Process for producing hepatitis b virus surface antigenes and hybrid antigenes containing same, as well as pharmaceutical compositions comprising same - Google Patents

Abstract

The invention relates to hepatitis B virus anti­gens and hybrid antigens containing them and to the cloning of genes which code for said antigens in yeast by use of recombinant DNA techniques. Said antigens are valuable for the preparation of vaccines, e.g. hepatitis B virus vaccines or malaria vaccines.

Description

The present invention relates to hepatitis B virus antigens and hybrid antigens containing them, and to the cloning of genes which clone said antigens in yeast using recombinant DNA technology.

The background of the present invention will be explained below.

A. Hepatitis B vaccines

Hepatitis B virus (HBV) infection is a serious, widespread health problem. The infection manifests itself in an acute or chronic phase. In the United States, the rate of acute hepatitis is estimated at 100,000 per year with a 1-2% mortality rate, and the prevalence of chronic carriers of HBV among healthy adults is between 0j1-1%, depending on age and social class. The incidence of chronic carriers in South America is about 1-3%, in the Soviet Union and Southern Europe about 3-6%, and in Asia and Africa more than 10%.

Thus, there is a need for vaccines in developed countries for people at risk of infection, such as patients and employees in medical units that treat blood, military personnel, spouses of chronic carriers, travelers to high-HBV areas, neonates of chronic carriers, homosexuals, prostitutes, and drug users. There is a demand in the Third World countries for a cheap vaccine for mass immunization. The mass immunization program ultimately not only affects the incidence of acute hepatitis and the mass of chronic carriers, it can also reduce the number of serious morbidity and mortality due to chronic active hepatitis and hepatocellular cancer.

Dane particles believed to be hepatitis • · · ·

- 3 a

Virions B, which can be isolated from infected patients, have a diameter of about 42 nm. They each contain a coat containing hepatitis B surface antigen (HBsAg), a capsid (HBcAg), an endogenous polymerase, and a DNA genome. The genome is circular and double-stranded with a single-stranded region containing about 200 bases. The single-stranded area can be filled in vitro by the action of endogenous polymerase. The longer strand contains about 3,200 bases.

It has long been difficult to produce HBV vaccines because of the difficulty of propagating the virus in tissue culture and because the only known host is man. However, chimpanzees can also be infected in the laboratory with the virus.

Valenzuela et al., Natura, 298, 347-350 (1982), report on the synthesis of HBsAg in yeast using an expression vector in which the HBsAg coding sequence is a 835 bp Taql-Hpal fragment and the promoter is the yeast alcohol dehydrogenase I promoter. A number of previous short papers also mention research that precedes this paper. For example, Valenzuela et al., PArch. Biol. Med. Exp (Chile), 14 (1), 21-22 (1981) J, which reports the expression of a DNA fragment in yeast, which DNA sequence contains a sequence ligated to a yeast alcohol dehydrogenase promoter region encoding a protein similar to HBsAg; the

Scrip 616 on page 14, August 12, 1981, which states that a group of US researchers, Valenzuela P. and Rutter W.J. also reported the production of yeast protein-envelope surrounding hepatitis B virus; and Natur Zucskerman

295, 98-99 (192) J, reporting that Rutter

W. J. described the expression of glycosylated HBsAg in yeast cells.

HBV antigen components, e.g. HBsAg has been reported to be produced in bacteria after the insertion of a recombinant DNA molecule containing a gene that encodes the antigen. Burrell et al. Report the expression of HBV DNA sequences cloned in pBR322 in E. coli strain HB101, Natl. 279, 5708 (1979), 43-47.

Murray et al. Describe the preparation of a recombinant vector capable of encoding HBV antigens (European Patent Publication No. 13,828, 1980). The vector was constructed from Dane particle DNA and plasmid pBR322. The authors declare that useful carriers include other bacterial hosts, yeasts and other fungi, animal and plant cells and other hosts, although the only host for which the application is exemplified is E1. coli.

Charnay et al., Natura, 286, 893-895 (1980) J report the construction of a bacteriophage carrying a fusion product of the β-galactosidase gene and the HBsAg structural gene. The bacteriophage directs the synthesis of a fusion protein containing the determinants of both HBsAg and β-galactosidase antigen.

Thiolis et al. Describe the preparation of coli phages containing HBV DNA (British Patent Application 2,034,323). The fused phage HBV DNA is transformed into E. coli strain C600.

British Patent Application 2,070,621 discloses a plasmid containing a portion of the HBsAg gene, as well as the promoter and Z gene of the lactose operon, which can be cloned into E. coli.

Rutter et al. Describe recombinant vectors, including recombinant vectors containing plasmid pBR322 and BamHI fragments of HBV DNA that can be used to transform E. coli (European Patent Publication No. 20,251 (1980)). Another plasmid containing the BamHI fragment of HBV DNA and a portion of the tryptophan operon was used to achieve expression in E. poly HB101.

Edman et al. Describe the construction of plasmids that direct the synthesis of HBcAg and synthesis of a? -Lactamase-HBsAg fusion protein under the control of the tryptophan operon regulatory region in E. coli, 291, 5815, No. 503-506 (1981). ].

Pumpen et al. Describe the synthesis of small amounts of HBsAg monomeric proteins and fusion proteins in E. coli using antibodies against denatured HBsAg monomer for detection. Gene 30: 201-210 (1984).

Other publications report the incorporation of HBV DNA into bacteria. Charnay et al., Prog. Med. Virol. 27: 88-92 (1981); MacKay et al., Proc. Natl. Acad. Sci. 78 (7): 4510-4514 (1981); Fritsch et al., C.R.Acad.Sci. 287, (16), 1453 (1978); United Kingdom Patent 2,034,323 (Derwent 46874C); and Pasek et al., 1979, Natur. 282 (6), 575.

HBV DNA has already been cloned in mammalian cells. These cells include human, mouse, and human hepatoma cells.

lines. so e.g. Dubois et al. Report the transformation of mouse cells with a plasmid containing the HBV genome and the expression of HBsAg in £ proc. Natl. Acad. Sci.

US. 77 (8): 4549-4553 (1980)]; Hirschman et al., Report the production of HBV-like particles by HBV DNA-transformed Hela cells. Natl. Acad. Sci. 77 (9), 5507-5511 (1980)].

A method for producing an HBV vaccine using human blood derived HBsAg is described by Funakoshi et al., Prog. Med. Virol. 27: 163-167 (1981)], et al., Prog. Med. Virol. 27: 185-201 (1981)].

Maupas et al. The vaccine prepared by Funakoshi et al. Contains jKg purified, formalin-treated HBsAg, phosphate, sodium chloride, 20 mg mannitol, and 0.1% aluminum hydroxide as adjuvant. In a recent report, Maupas et al. Report that the dose of vaccine is 1 ml of purified, formalin-treated HBsAg containing 2-10 µg / ml protein (as measured by the Lowry method) and 0.1% aluminum hydroxide. The study used in the study by Maupas et al., Prescribes three injections at monthly intervals, with a reminder injection after one year; the authors also recommend a session consisting of two injections of concentrated HBsAg at three-month intervals.

Further references relating to the production of HBV vaccines, e.g. 18th Hepatitis B Vaccine INSERM Symposium, pages 3, 37, and 57 (Maupas et al., Adamowicz et al. and Funakoshi et al.), edited by Maupas and Guesry, Elsevier / North-Holland Biomedical Press (1981).

• · ·

Yeasts have also been used as hosts to express certain other non-HBV DNA sequences. so e.g. Fraser et al. Describe the preparation of chicken ovalbumin in yeast (British Patent Application 2,068,969; Scrip, N- 640, page 11, November 4, 1981), reporting that one type of interferon is prepared in yeast. European Patent Publication (Derwent 38762C) discloses hybrid yeast plasmids containing the urea ⁺ yeast gene in plasmid 2.

Authentic hepatitis B virus surface antigen (HBsAg) can be recovered from the plasma of infected individuals at about 2 µm, composed of two proteins known as P24 and its glycosylated derivative, GP28, each of which is encoded by the S protein. coding sequence for the 226 amino acids on the known HBV genome. The entire 163 amino acid coding sequence immediately preceding the S protein coding sequence on the HBV genome is hereinafter referred to as the Pre S coding sequence. The 55 amino acids of the Pre S coding sequence immediately preceding the S protein coding sequence are hereinafter referred to as the Pre S2 coding sequence, and the other 108 amino acids of the Pre S coding sequence are hereinafter referred to as the Pre S1 coding sequence. The Pre S coding sequence, or any minor portion thereof, may also be referred to as an HBsAg precursor protein encoder.

For the sake of completeness, it should be noted that the entire Pre S coding sequence consists of 163 codons for certain HBV subtypes (e.g., ayw), while the entire Pre S coding sequence consists of 174 codons for other HBV subtypes (e.g., adv ^). The Pre S2 area

• · · always consists of 55 codons immediately preceding the S protein coding sequence.

The Pre S2 coding sequence encodes the β-alpha-albumin coding or receptor site on the surface of Dane particles isolated from serum of HBV infected patients and on the surface of certain HBsAg particles. Although the Pre S2 region directly precedes the S protein coding region on the HBV genome, the Pre S2 region does not participate in the assembly of the HBsAg particles, see e.g. Persing et al., Proc. Natl. Acad. Sci. USA 82: 34403444 (1985).

Valenzuela et al. Disclose that HBsAg-like particles are found after disruption of yeast cells transformed with a vector containing the S protein coding sequence, and conclude that HBsAg particles are synthesized in yeast, Natura, 1982, 298, 347-350.

Harford et al. Disclose that HBsAg-like particles are found after the disruption of a yeast cell transformed with a vector that contains 18 amino acids of the ornithine carbamoyltransferase enzyme coding for the ornithine carbamoyl transferase, which precedes the S2 terminal amino acid coding sequence. Logical Standardization, 54, 125-139 (1983) J.

Laub et al. Describe the construction of 40 early replacement vectors of the Simian Virus containing a large portion of the HBV genomic DNA, including the Pre SS protein coding sequence, and the expression of such a fragment in SV40-transformed CV-1 cells transformed with such vector (COS). cells). Virology, 48 (1), 271-280 (1983) J.

···· ··

- 9 Stibbe et al. Disclose that smaller HBsAg glycoproteins, namely the GP33 and GP36 glycoproteins are encoded by the Pre S2-S protein coding sequences. Virology 46 (2): 626-628 (1983)]. Stibbe et al. Also disclose that HBsAg particles containing high levels of GP33 and GP36 do not induce higher anti-S protein antibody titers than HBsAg particles that are almost free of GP33 and GP36 [i.e. Biol. Stand. 54, 33-43 (1983) J.

Heerman et al. Disclose that the entire 389 amino acid sequence encoding both the S protein coding sequence and the Pre S coding sequence encodes a polypeptide, P39, which is glycosylated in HBV particles and in viral surface antigen strands. , together with GP42, and other polypeptides associated with HBV surface antigen such as P24, GP27, GP33 and GP36 [J. Virol. 52 (2): 396-402 (1984)].

Neurath et al disclose that polypeptides having 26 amino-terminal residues of the polypeptide sequence formed by the Pre-S2 coding sequence act as immunogens and suggest that immunogen-induced antibodies can be used in diagnostic assays. (1984) 224: 392-394. ].

Michel et al. Disclose the synthesis of BHsAg carrying human serum polyalbumin receptors in Chinese hamster ovary (CHO) cells transfected with a plasmid carrying the Pre S2-S protein coding sequence. Proc. Natl. Acad. Sci. USA 81: 7708-7712 (1984)].

···· «· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·›

999 999 * · 9 99

- 10 Persing et al. Disclose that mouse L cells transformed with the Pre S2-S protein coding sequence produce three HBsAg-related polypeptides (24000, 27000 and 35000 dalion), each of which can be complexed into an immunoreactive complex with HBsAg particles 22 nm in diameter, however, bind to human serum albumin (HSA) with the Pre S2-S protein coding sequence, which carries a frame-shift mutation near the 3 'end of the Pre S2 region, transformed mouse L cells produce only 24000 and 27000 Dalton polypeptides. nm diameter HBsAg particles are assembled into an immunoreactive complex which is unable to bind to HSA by proc proc. Natl. Sci. USA 82: 3440-34444 (1985). Persing et al. Conclude that the Pre S2-S protein coding sequence encodes the 35,000 Dalton species and that the Pre S2 protein explains the HSA-binding activity of HBsAg but is not required for assembly and selection of HBsAg particles; and that the major polypeptide of HBsAg (i.e. the 24000 dalton species) is primarily not derived from cleavage of larger precursors encoded by the Pre S2-S protein coding sequence (i.e. the 27000 and 35000 dalton species).

Milich et al. Show that vaccines containing HBV particles with both Pre S2 and HBsAg, wherein the HBV particles are made from Chinese Hamster Ovary (CHO) cells infected with a plasmid containing the Pre S2-S protein coding sequence. , may suspend the insensitivity of certain mice to vaccines containing only HBsAg; and that the 26 amino acid residues at the NHg terminus of the 33,000 dalton polypeptide encoded by the Pre S2-S protein coding sequence represent a dominant antibody binding site

X • * · · »················································································································································· *

- 11 Pre S2 areas. Michel et al., 1986, Vaccines 86, eds. Brown et al., Cold Spring Harbor Laboratory, pp. 359-363 discuss the synthesis of hepatitis B surface antigen particles containing a product expressed as a Pre S2 region in CHO cells.

Neurath et al. Describe that the Pre S region encodes proteins on the HBV envelope that contain domains specifically recognized by liver cells; the sequence encoding the Pre S2-S protein encodes a protein present in the HBV particles; synthetic peptides corresponding to the gene encoding Pre-S proteins are immunogenic and finally conclude that HBV vaccines contain Pre S determinants (Naturre, 315: 154-156 (1985)).

Valenzuela et al. Describe the expression of the entire Pre S2-S protein coding sequence in yeast transformed with such coding sequence; and also disclose that such yeast cells actually synthesize a particle containing both HBsAg and Pre S2 and which / ^ brain like 1 ^<ana k electron microscopy and by the sedimentation properties of the particles, which only HBsAg and that the Pre S2 region does not affect the ability to form particles similar to the 22nm HBsAg particles. Biotechnology 3: 317-320 (1985). Valenzuela et al. Also disclose their theory that HBV penetrates the liver such that poly-albumin binds to the HBV polyalbumin receptor, which in turn binds to the polyalbumin receptor on liver cells, thereby transferring the virus to the liver; the HBV polyalbumin receptor is the Pre S2 region

- 12 encodes it. Valenzuela concludes that a Pre

The S2-containing vaccine can produce antibodies that, in addition to HBV inactivation through the normal mechanism, can prevent the virus from entering the liver cell.

Takeda Chemical Ind. KK, in European Patent Publication No. 171,908-A, claims protection for the production of surface antigen P31, non-glycosylated hepatitis B virus, in yeast.

Chicon Corporation, in European Patent Publication No. 0,174,444A2, claims protection for a method of making HBsAg particles containing P31 protein in yeast.

Table I below compares the known Pre S2 region amino acid sequences with the HBV Pre S2 amino acid sequences of the present invention.

TABLE I. Comparison of pre-S2 region amino acid sequences from different HBV serotypes

HBV subtype Pre S2 coding region

-55 -50 -40 -30 -20 -10 0 Reference

OJ cd -p <D <D P Γ — I

Dm: fi

P

Ό <U bû-Pv- c \ j cn in uo i> co P

Ο Ό

Pm <-t o fi nd «3 Ό 3 44 Ό N CO <

E-I> {X, Q Cd Eh K

CD

Dm Dm μπ t-4 <5 <;

CD-1

CD CD l-l 3 CD n 3 Dm «aj Dm 3> Eh cfi CD CD CD CÜ Cd -ü Dm Dm> h Pl Cd 3> ed Dm q a? i-4

Cf 3 Dm

Eh CD 3 3 <y s

I — I l-l l-l c

I — I Μ -rl fi fi fi

CD CD CD CD • rl lake • rl dm tx. dm SHE fiction i-1 L-L L-L 1-1 1-1 fiction fiction • rl (U • H d> • rl N f-1 -P fiction I-1 Ο SHE • rl N • rl i-4 SHE fiction P Xil N dm dm dm 3 N <D • rl Φ • H • rl 1-1 i-4 Eh E.g Eh E < Eh Eh Eh Eh Eh Eh Eh i-4 > > > > 1-1 E.g > h K

d> fiction P <ü to to r-l <D >> X • rl E.g E.g Eh 3 »q

k4 i-4

E.g

i-4 i-4

E-t E-t

H Eh to and i-1 EH Eh £

> «3 cn fi • rl bû

5 5 5 TJ nd nd nd nd CO «3 «3 CO «3

PP ndnd «3 {Ö • rl

OT XD -P W £ nd • rl>: o

P> »>

>> t <β {Ö <Öto o fi • rí

E

<ö fiction P • rl fiction «3 fiction • rl P < She P N Φ <D cn P Isi < Eh CD

> Π3 CO fi • H

E fiction £ n3 rí • rl -P i-1 Q fiction SHE • H r-1 P | --i CD dm She

Q Eh CD D4 Dm Cd

P. P P 3 She >> co 3 <U r ^- 1 P j, l < Η CD SHE PU SHE

r needle -p £

X r-lco

Φa • rdQ tx.

ra £ 44XÖ

£ X

TABLE (continued)

-P • rl • N x to E CO φ She cn X X V * £ φ Φ K - N V z x to She x E She kJ £ £ r-1 > kJ kJ 1-1 X φ t » to £ φ -P xo « ι-1 • > : £ z-x X • <4 ca • Ό kJ Z-X the Φ z-x co • rl She Q > » CO cn X CO sorrow 00 X the cn -P M σ> x ' £ • rH χ- £ χ- • xo £ sorrow E She kJ • rl · X- co Z ~ X £ cn • rl «J 'rl £ kJ co CO • rl She ε £ SHE X • rl X SHE m CO £ -P the the £ X • rH X 1 cn Ή Pd -P the - SHE Ξ £ Kű OJ x ~ • loyal • rH N to > H She Φ <F · co z * x £ £ ι-1 to She She E 1 m cn < Eh CU c • rl Φ X Γ- She- • -P Φ CTI She - tendon cn Z ^ Φ the Ό oj | Ο- X cn £ £ She <b Χ- X ^ · She· Φ - She sorrow • KJ Ι OX X m «ΙΗ Φ - E 44 She- She X 04 13 c? the to • rl She £ -4 m X-Z to φ to Q v- | She £ SHE- Ό £ to E x- 1 cn £ CU φ £ • • Ό She- • rl £ kJ to to -P - -4 n > She sorrow CQ φ φ -P X-I SHE 1 sorrow P < c £ • rl £ CHwCH CU Φ X-1 n £ £ rh to ι-1 E SHE - to She- Eh CU kJ φ SHE ta • XD • χ- m E X kJ X ta x to 00 • rl kJ rh ca rd > » xH φ OJ c She kJ £ She x OJ <4 "4 £ to <4 P. X - CO - £ ta She X • Φ OJ - £ ca • • H φ £ N <-1 -4 φ 1-1 m -P • rl £ - kJ kJ £ She £ SHE -P φ X x sorrow £ • Φ "4 the £ ·· ι-1 -P £ the E «Μ the £ • rl She £ She Φ • -P kJ £ M ·· X ·· r-l ·· the to She SHE • rl She rd SHE • rd the £ SHE- | X < • rl "the She the £ the xo 1 -P to • H m the to ·· £ £ -P 0 ·· £ £ CQ £ £ • rl • rl • rH you m • rl XD xo XTJ . · xo the £ Φ c X kJ X -P ·· -P • rl -P to • rl +> £ She £ - to £ you • H the the the £ £ N • H • rH 5 s \ £ Φ 44 the 44 to 44 xo CO 10 rh -P E X xo > £ to £ £ £ -P rh • rl cC Φ She -P Ή £ £ £ xe £ the < She > s to fcd kJ E xo E -P E 44 to XD X X -P the £ She to £ Ή to KJ cl 44 to £ 1-1 kJ XD £ X XD X XD £ XD E 3 i-1 E Φ £ £ X Φ x > » <e £ the E -P to u > s 1 3 She to sorrow s E 5 £ XD "5 to to XD Φ kJ the to Φ • rl £ • rl the to » CQ XD X 44 SHE φ £ * • r! XD Rh • rH Φ £ ι-1 Φ She to • to * T3 She rh to Φ kJ SHE x XTJ SHE £ the £ > X She -P X ίχ » SHE CU f £ Φ lake ca «-Η -P z-x Z < z 's Z x zs z s Z-X ι-1 > » the φ Φ • • • • • • • • < SHE > s CTI V ^- OJ cn tendon Ό SHE CO

• · * ····· · · · ······· · · «

- 15 Β. Malaria vaccines

Numerous recent studies suggest that protective immunity against sporozoite-grade infections of certain species of Plasmodium in susceptible hosts may be mediated by antibodies raised by the host sporozoite protein (CS protein).

Sporozoite proteins of certain types of Plasmodium have already been cloned, and some of them have been expressed by recombinant DNA techniques.

Nussenzweig et al. Disclose a sporozoite polypeptide identified as a P-44 protein and demonstrate its cloning and expression in E. coli (U.S. Patent No. 4,466,917).

Sharma et al. Describe the expression of a portion of the Plasmodium knowlesi circumsporozoite (CS) protein in yeast using an expression vector containing the 5 'regulatory region of the yeast alcohol dehydrogenase I gene instead of the 5' upstream region of the P. knowlesi CS gene sequence, pScience, 879-882 (1985) J.

New York University discloses the cloning of part of the coding region for the P. knowlesi circumsporozoite (CS) protein repeat unit and its fusion products with beta-lactamase and beta-galactosidase in E. coli (PCT Publication No. WO 8402922-A) .

Kemp et al. Describe the cloning and expression of a blood protein-coding sequence from P. falei-parum CS in E. coli (PCT Patent Publication No. WO 84-02917-A ·····

- 16 disclosure documents).

Dame et al. Report the cloning and expression of the P. falciparum CS protein in E. coli (Science, 225, 593 (1984), 1984), it is reported to contain about 412 amino acids with about 44,000 molecular weights. It contains 41 tandem (consecutive) repetitions of a tetrapeptide. Synthetic from a repeating region bound to monoclonal antibodies

7-, 11- and 15-radical peptides are formed against the CS protein.

Ellis et al. Report beta-lactamase P. knowlesi CS protein fusion product in E. coli (Natura, 302, 536-538 (1983)).

Enea et al. Describe an analog repeat unit structure within the P. cynomolgi CS protein, as well as the cloning and expression of the CS protein in E. coli and the disclosure of its coding sequence. Natl. Acad. Sci. USA 81: 7520-7524 (1984)].

Ballou. et al., describe that synthetic peptides of the recombinant region of Plasmodium falciparum CS proteins conjugate bovine serum albumin (BSA) or thyroglobulin to elicit antibody responses in mice and rabbits and conclude that the malaria parasite may be a by the use of synthetic peptides of the recombinant regions of the CS protein conjugated to protein (Science 228: 996-999 (1985)).

Weber et al. Describe the use of a Brazilian strain of P. falciparum as a probe for the cloned CS protein gene to analyze the structure of 17 other P. falciparum strains by nucleic acid hybridization, and conclude that

that the CS protein gene is highly conserved and that the development of a malaria vaccine with the CS protein is unlikely to be complicated by strain variants. Molecular and Bacterial Parasitology 15: 305-316 (1985).

Arnot et al. Disclose the cloning of the P. vivax CS protein and the complete cloning sequence thereof; conclude that the coding sequence for the P. vivax CS protein is homologous to the P. knowlesi CS gene but not homologous to P. falciparum ^ Science, 230, 815-818 (1985) J.

Sharma et al. Disclose the complete nucleotide sequence of the coding region of the P. gene of CS knowlesi Nuri (Science, 229: 779-782 (1985)).

Young et al. Disclose the expression of the P. falciparum CS protein in E. coli for possible use in a human malaria vaccine (Science 228: 958-962 (1985)).

The Walter and Eliza Hall Institute of Medical Research discloses an engineered polynucleotide sequence that corresponds to all or part of the P. falciparum mRNA or genomic DNA, the peptide corresponding to such a sequence, a process for its preparation, and a composition of such a sequence. peptide and stimulates the immune response against P. falciparum antigens in mammals (PCT Publication No. WO 84/02917, 1984).

Mazier et al. Describe that antibodies raised in mice immunized with numerous recombinant and synthetic peptides of the P. falciparum circumsporozoite protein have been evaluated for protective activity in the human hepatocyte culture system and

• · ·

these have been found to exhibit protection against the parasite at three points: sporozoite binding to the hepatocyte surface, entry, and subsequent intracellular development, fscience, 231: 156-159 (1986).

C. Polyvalent vaccines

Valenzuela et al. Describe the use of the HBsAg polyalbumin receptor encoded by the Pre S2 coding sequence as a means for producing polyvalent vaccines (Biotechnology 3: 323-327 (1985)). Valenzuela et al. Describe the preparation of an HBsAg-Herpes simplex 1 virus glycoprotein D hybrid (HSV-IgD) by expression of a hybrid HSV-IgD-Pre S2-S protein coding sequence in yeast.

Valenzuela also describes that a hybrid, e.g. with the HBsAG-HSV-IgD particle described above, there is a problem of HBsAg immunomodulation over foreign immunogens on its surface [/ 'Hepatitis B subunit vaccines using recombinant DNA techniques', Bio-Expo 5. Meeting, May 15, 1985, Boston, Massachussets].

Chiron Corporation claims new hybrid particles comprising at least a major portion of the hepatitis B surface antigen fused to one or more oligopeptides, wherein the hybrid polypeptide is capable of forming a particle in a host that contains at least one epitope of at least one oligopeptide (0.175.261). European Patent Publication Document).

Proteins can be subjected to post-translational modifications, and some of them profoundly affect the conformation and function of the protein. Presence of oligosaccharide chains in the human pre-S1-pre-S2-S and pre S2-S proteins J. Virerman et al., J. Virology 52: 396-402 (1984); Stibbe and Gerlich, Virology, 123, 436-442 (1982), * Stibbe and Gerlich, J. Virol. 46, 626-628 (1983)], and possibly the presence of myristic acid in the preS1-preS2-S protein (Persing et al., Abstracts of a Scientific Meeting, August 28, 2831, Molecular Biology of Hepatitis B Viruses, Cold Spring Harbor Laboratory ) may influence the formation of particles, the conformation of proteins within the particles, and the antigenicity and immunogenicity of these particles.

Yeast (Saccharomyces cerevisiae) has the enzymatic ability to glycosylate the protein. Metabolism and Gene Expression (Molecular Biology of Saccharomyces Yeast; Metabolism and Gene Expression), edited by Strathern, Jones and Broach; Cold Spring Harbor Laboratory (1982), pages 335-360, and the enzymatic ability of fatty acid acylation. Towler and Glasler, Proc. Natl. Acad. Sci., 83, 2812-2816 (1986)], similar to that of higher eukaryotic cells.

Surface glycoproteins expressed in yeast have been found to be in glycosylated form. Jabbar et al. Describe that expression of the influenza virus hemagglutinin gene in yeast resulted in glycosylated hemagglutinin protein. Natl. Acad. Sci. 82, 2019-2023 (1985) J. Wen and Schlesinger describe that the expression of glycoproteins of Sindbis and vesicular stomatitis virus in yeast gave glycosylated forms of these viral proteins [_Proc. Natl. Acad. Sci.

• «• · · ·

20, 83, 3649-3643 (1986)]. Fujisawa et al. Describe that expression of the preS2-S gene in yeast results in the synthesis of two glycosylated forms of the preS2-S protein (Abstracts of a Scientific Meeting, Molecular Biology of Hepatitis B Viruses, August 28-31, 1986, Cold Spring Laboratory 62). Kniskern et al., Describe that expression of the preS1-preS2-S gene in yeast results in the synthesis of two preS1-preS2-S proteins with molecular weights of 45 kD and 39 kD, according to Modern Approaches to New Vaccines. for vaccines, including AIDS prevention), excerpts from a scientific meeting held September 9-14, 1986, Cold Spring Harbor Laboratory, page 89]. Persing et al. Describe that labeling of C0S7 cells expressing preS1-preS2S, preS2-S and S with myristic acid H results in the presence of the label in the preS1-preS2-S protein (Molecular Biology of Hepatitis B viruses, August 28-31, 1986). excerpts from lectures held at the Cold Spring Harbor Laboratory, page 19).

The yeast expressed in particulate form fusion proteins are purified as outlined below.

Aerosil adsorption and desorption (1) -CaClg precipitation (2) phenyl-agarose or phenyl carbonate-agarose adsorption and desorption (3) - ^ - CsCl gradient centrifugation or DEAE ion exchange chromatography.

Step (1) is described in European Patent Publication No. 0 204 680 and Step (3) is described in European Patent Publication No. 0 199 698 for Phenylapose. The special combination of steps (1) and (3) allows you to use »··· • ·. · · · ·· • ·· «··· · · ······················································· _(ι

- drastic removal of 21 impurities (removal of 90% protein and carbohydrates and 50% lipids). This new combination allows the subsequent chromatographic steps to work well.

In the case where the fusion proteins are glycosylated, phenylboronate (PBA) is used as the affinity adsorbent. At pH 9.0, the boronate group forms covalent complexes with possible cis-diol groups on the glycosylated side chains. PBA signals have occasionally been used to purify soluble glycoproteins but have not been used to purify particles containing glycoproteins embedded in lipid bilayers. See Cook et al., 1985, Anal. Biochemistry, 14-9, 349-353; Middle et al., Biochemical Journal, 209, 771-779 (1983); Cook et al., 1985, Biochimica et Biophisica Acta 828: 205212; Maestasane et al., 1980, Journal of Chromatography 189: 225-231. Due to multiple ligand binding, PBA signals with very low PB-ligand density, e.g. PBA gels with 10 µg / ml gel boronate, preferably 5 µg / ml gel oronate. The use of phenylboronate gels with very low boronate content allows for affinity chromatography of embedded glycoprotein particles.

The following is a brief description of the process of the invention.

The present invention relates to recombinant DNA molecules comprising a functional DNA coding sequence fused in phase to a portion of the Pre S2 region of a Hepatitis B virus (HBV) Pre S2-S protein coding sequence. A * · · ··························································•

The term "coding sequence" or "coding region" as used herein encompasses any functional derivative thereof. The term functional derivative refers to a coding sequence with amino acid changes that, where appropriate, do not interfere with particle formation and / or retain their immunogenicity, where such preservation is desired. Such functional derivatives may be prepared by conventional site-specific mutagenesis, e.g. by the methods described by Botstein et al., Science, 229: 1193-1201 (1985) J. Preferably, such a DNA molecule also contains a regulatory region, preferably derived from the yeast arg gene.

The present invention also provides a recombinant vector comprising a recombinant DNA molecule operably linked to a regulatory region, wherein the DNA molecule comprises a functional DNA coding sequence fused to a portion of the Pre S2 region of the HBV Pre S2-S protein. The term regulatory region as used herein refers to a DNA sequence comprising a promoter region as well as other sequences necessary for transcription and translation of a coding sequence.

The present invention also relates to a eukaryotic host transformed with a recombinant vector, said vector comprising a DNA molecule operably linked to a regulatory region, wherein said DNA molecule comprises a functional relay DNA coding sequence fused to a HBV Pre S2-S protein coding sequence Pre S2. part of your territory. The present invention also relates to a method of producing such transformed host cells, which is a eukaryote. · ♦ ♦ ·· · ···

It consists of transforming 23 host cells with such a recombinant vector.

The present invention also relates to a method of making hybrid particles comprising an HBsAg protein, which comprises and / or transmits a peptide encoded by a functional DNA coding sequence; the method comprising culturing four eukaryotic host cells transformed with a recombinant vector in a suitable medium and isolating particles from a cell lysate or extract of such a host cell culture, wherein said vector comprises a DNA molecule operably linked to a regulatory molecule, wherein said DNA is comprises a functional DNA coding sequence fused in phase to a portion of the Pre S2 region of the HBV Pre S2-S protein coding sequence.

The present invention also relates to a hybrid immunogenic portion comprising a hepatitis B virus surface antigen (HBsAg) particle which contains and / or transmits a peptide encoded by a functional DNA coding sequence.

The present invention also relates to a vaccine comprising an immunoprotective amount of such hybrid particles.

The present invention also relates to micelles containing such hybrid particles and polysorbate, and vaccines containing an immunoprotective amount of such micelles.

Functional DNA coding sequence refers to a DNA coding sequence which, when fused in phase to a portion of the Pre S2 region of the HBV Pre S2-S protein coding region, does not interfere with or interfere with the assembly of the HBsAg particles. Preferred functional DNA coding sequences include, but are not limited to, e.g. ···· ································································································································· · an immunogenic derivative, e.g. (without limitation) coding sequences for Pre S2, Pre S1 or PreS1-PreS2; and (b) other immunogenic coding sequences, such as, e.g. the coding sequence for Plasmodium circumsporozoite protein or any immunogenic derivative thereof, the coding sequence for the HBV envelope gene or any immunogenic derivative thereof, particularly C? peptide, peptide 121, or Dreesman peptide coding sequence, or an immunogenic derivative thereof.

The present invention also provides an HBV Pre S1 protein coding region encoding the following amino acid sequence: -163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser With Pro Asn Pro Leu GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro Ile Lys asp His Trp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro below below Asn Gin With Gly With Gly below

i

TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TTG ACC ACA GTG TCA ACA ATT CCT Gly Ile Leu Thr Thr With Ser Thr Ile Pro CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCT ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin below, 1

or deals with an HBV Pre S2 protein coding region or an HBV Pre S2-S protein coding region, wherein the Pre S2 portion thereof encodes the following amino acid sequence:

-55 -50 Met-Gln-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp-40

Pro-Arg-Val-Arg-Gly-Leu-Tyr-Phe-Pro-Ala-Gly-Gly-Ser-SerSer-

• · ···· ·· ♦ · ··· · ·

Gly-Thr-Val-Asn-Pro-Asn-Pro-Ala'a-Ile-Ala-Ser-His-Ile-Ser-10

Ser-Ser-Ser-Ala-Arg-Thr-Gly-Asp-Pro-Val-Thr-Asn;

a recombinant DNA vector operably linked to a regulatory region of such a Pre S1, Pre S2 or Pre S2-S protein coding region; a transformed host cell comprising such a vector; the step of producing a transformed cell comprising transforming a host cell with such a vector; a protein encoded by such coding region; a method for producing such a protein; a vaccine comprising an immunoprotective amount of such a protein; particles encoded by such a Pre S2-S protein coding region; a method for producing such particles; a vaccine comprising an immunoprotective amount of such a particle; a micelle containing such particles and polysorbate; and a vaccine containing an immunoprotective amount of such micelles.

The present invention relates to a recombinant DNA vector operably linked to a regulatory region comprising a complete Pre S1-Pre S2-S protein coding sequence or a Pre S1-functional DNA coding sequence-Pre S2-S protein coding sequence or an immunogenic derivative thereof; a yeast host cell transformed with such a vector; a method of producing such transformed host cells comprising transforming a yeast host cell with such a vector; the Pre S1-Pre S2-S protein coding sequence, or the Pre-S1-functional DNA coding sequence-Pre

A protein encoded by the S2-S protein coding sequence or any immunogenic derivative thereof; a protein produced by such a method; a vaccine comprising an immunoprotective amount of such a protein; a particle comprising a polypeptide encoded by a Pre S1-Pre S2-S protein coding sequence or a Pre S1 functional DNA coding sequence, or an immunogenic derivative thereof; a process for the preparation thereof; a vaccine comprising an immunoprotective amount of such particles; . a micelle containing such particles and polysorbate; and a vaccine containing an immunoprotective amount of such a micelle.

The present invention relates to a Pre S1-Pre S2 protein coding sequence or a Pre S1-Pre S2-S protein coding sequence, the Pre S1-Pre S2 portion of which contains the following amino acid sequence.

PRE-S1 AREA

-163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser With Pro Asn Pro Leu GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro He Lys asp His Trp

· ♦ · <· ··

CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro below below Asn Gin With Gly With Gly below TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TTG ACC ACA GTG TCA ACA ATT CCT Gly Ile Leu Thr Thr With Ser Thr Ile Pro CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin below

PRE-S2 AREA

ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA

Met Gin Trp Asn Ser Thr Alá Phe His Gin · * · ··

- 29 GCT CTG CAG GAT CCC

Alá Leu Gin Asp Pro

TAT TTT CCT GCT GGT

Tyr Phe Pro Alá Gly

ACA GTA AAC CCT GCT

Thr Val Asn Pro Alá

CAC ATA TCG TCA AGC

His Ile Ser Ser Ser

AGA GCT AGG GGT CTG

Arg Val Arg Gly Leu

GGC TCC AGT TCA GGA

Gly Ser Ser Ser Gly

CCG AAT ATT GCC TCT

Pro Asn Ile Alá Ser

TCC GCG AGG ACT GGG

Ser Alá Arg Thr Gly

GAC CCT GTG ACG AAC

Asp Pro Val Thr Asn

The present invention also relates to a recombinant vector comprising such a novel Pre S1-Pre S2 or Pre S1-Pre S2-S protein coding sequence operably linked to an expression control sequence; and a host cell transformed with such a vector; a method of producing a transformed host comprising transforming a host cell with such a vector; a method encoding a protein encoded by such Pre S1-Pre S2 or Pre S1-Pre S2-S protein, or an immunogenic derivative thereof; a protein produced by such a method; a vaccine comprising an immunoprotective amount of such a protein; a particle comprising a protein or immunogenic derivative thereof encoded by such a Pre S1-Pre S2-S protein coding sequence; the method for its preparation; a vaccine containing an immunoprotective amount of such particles, and a micelle containing such particles and polysorbate.

Below is the key to the abbreviation of the amino acids as used in this application.

asp aspartic acid Ile isoleucine Thr threonine Leu leucine Ser serine Tyr tyrosine Glu glutamic acid Phe phenylalanine Pro proline His histidine Gly glycine Lys lysine below alanine Arg arginine Cys cysteine Trp tryptophan With Valin Gin glutamine Met methionine Asn asparagine

The contents of the figures are briefly described below.

Figure 1 is a restriction Qndonuclease map of pRIT10601.

Figure 2 is a restriction endonuclease cleavage map of pRIT10616.

Figure 3 is a restriction endonuclease cleavage map of pMC200.

Figure 4 is the nucleotide sequence of a portion of the 3300 bp HindIII yeast insert in pMC200, which contains the HincII, BglII and EcoRI sites.

Figure 5 is a flow chart illustrating the production of pRIT10671 and pRIT10673.

Figure 6 is a flowchart illustrating the production of pRIT10749.

Figure 7 illustrates the production of pRIT10761 and pRIT10764

- 31 flow charts.

Figure 8 is _P RIT10167 (Example 1); pRIT10158 and _P RIT10616 (Example 3); pRIT10158, pRIT10677 and pRIT10909 (Example 4); pRIT 10911 (Example 5); pRIT10679, pRIT10903, pRIT10914 (Example 6); pRIT12211, pRIT12209 and pRIT12230 (Example 7); and a flowchart illustrating the preparation of pRIT12288 and pRIT12322 (Example 8).

Figure 9 is a restriction endonuclease cleavage map of pRIT10172.

Figure 10 is a restriction endonuclease cleavage map of pRIT12290.

Figure 11 is a restriction endonuclease cleavage map of pRIT12322 showing portions of pRIT12230 and pRIT12288.

Figure 12 is a representation of pRIT12571; pRIT12573; Flowchart illustrating the production of pRIT12572 and pRIT12574.

Figure 13 is a restriction endonuclease cleavage map of pRIT12309.

Figure 14 is a flowchart illustrating the production of pRIT12314 and pRLT12544.

Figure 15 is a flowchart illustrating the production of pRIT12658.

Figure 16 is a restriction endonuclease cleavage map of pRIT12662.

Figure 17 is a flowchart illustrating the production of pRIT12660.

Figure 18 is a flowchart illustrating the production of pRIT12845 (a, b, c, d, e, f).

1A. FIG.

2A. Fig. 4A is a schematic restriction map and sequence analysis strategy of the ^ MPfl clone.

32A 3A. Figure 5A shows the nucleotide sequence of the circumsporozoite protein gene from P. falciparum.

4A. Fig. 6A shows the coding sequence of PreS1-PreS2 DNA in pRIT12792.

1B. Fig. 3A is a schematic restriction map of the HV B virus envelope.

2B. Figure 1B shows the construction of plasmid pRIT12893.

3B. Figure 1B shows the construction of plasmid pRIT12897.

4B. Figure 1B shows the construction of plasmid pRIT12899.

5B. Fig. 4A shows the construction of plasmid pRITX.

The present invention is described in detail below.

The term regulatory region, as used herein, refers to a DNA sequence that contains sequences necessary or desirable for transcribing and translating a coding sequence. Such regulatory regions are generally located 5 'and adjacent to the coding sequence to be expressed. Preferably, an additional region of the yeast DNA containing the signal required for transcription expression is located directly 3 'to the coding region to be expressed so as to effect completion of transcription.

As used herein, HBsAg means an antigen comprising proteins encoded by the S protein coding sequence of the HBV genome, wherein such HBsAg is structurally similar to authentic HBsAg or has substantially the same S protein coding sequence encoded by antigenic determinants, like authentic HBsAg, that is, it can stimulate an immune response that specifically recognizes and responds to authentic HBsAg, or is specifically recognized by anti-HBsAg antibodies.

The HBsAg coding sequence can be isolated from DNA extracted from D1 particles in infected human serum by loading into the single strand region by DNA polymerase, preferably endogenous polymerase, followed by restriction endonuclease digestion. The choice of endonuclease depends in part on the Dane particles in question. so e.g. the HBsAg coding sequence for HBV DNA of certain Dane serotype Dane particles can be isolated on a single BamHI fragment; the HBsAg coding sequence of the HBV DNA of certain Dane particles of the wt serotype can be isolated on the Hhal fragment. HBV DNA from Dane particles of the same serotype may also show different arrangement of restriction sites.

Cleavage of DNA to produce the DNA fragments used in the present invention, ligation of such fragments to produce the recombinant DNA molecules used in the present invention, and insertion into microorganisms are accomplished by known techniques, e.g. with techniques described in the references cited above and thereafter. The conditions should be chosen to avoid denaturation of DNA and enzymes. so e.g. the pH is buffered to maintain a value of between 7.0 and 11.0 and the temperature is maintained below 60 ° C. The restriction is preferably carried out at a temperature of 30-40 ° C and the ligation is carried out at a temperature of 0-10 ° C. The restriction enzymes used in carrying out the process of the present invention are commercially available and must be used in accordance with the accompanying guidelines. T4 DNA ligase is the preferred ligase.

I • ί · ^: · '···:. ··.

·.:. · Ί. * ': · · ** ·

- 34 The various fragments and final constructs can be soldered by conventional methods. In many cases, the genes are isolated and subjected to restriction mapping and sequence analysis. The sequence of interest can be appropriately selected, e.g. the HBsAg sequence by further cleavage of the gene, e.g. By truncation with Bal31, in vitro mutagenesis, primer recovery, or the like, a fragment of the desired size, including the desired sequence and having the appropriate ends, is obtained. Switches (linkers) and adapters can be used to combine the sequences and to replace the lost sequences, where a restriction site used is within the region of interest. The various fragments that are isolated can be purified by electrophoresis, electroelution, ligated to other sequences, cloned, re-isolated and subjected to further operations.

The application of the regulatory domain to the structural genes in question, such as those described herein. to regulate HBsAg sequence transcription, allows host cells to grow to high densities in the structure gene, e.g. with or without expression of the HBsAg sequence, and induction of expression under environmental conditions, e.g. the medium, temperature, etc. changing.

so e.g. with the GAL4 regulatory region, yeast cells can be grown on a rich medium of glycerol-lactic acid combination to high density, e.g. to the middle or late hanging phase, followed by conversion of the carbon source to galactose. Another example of PH05 regulation is that cells at high phosphate concentrations, e.g. can be increased at about 7 mM KH ^ PO ^ and recovered.

And resuspended in medium lacking phosphate, thus affecting depression and expression. An example of temperature sensitivity is that the cells are grown at a temperature in the range of 25-37 ° C and then the temperature is appropriately changed by 5-20 ° C. The host cell must have a regulatory system that is associated with the regulatory domain used.

Fusion of the HBsAg sequence to the regulatory region can be accomplished using an intermediate vector. Alternatively, the HBsAg sequence may be inserted directly into a vector containing the regulatory region. A vector is a DNA that can carry and maintain a DNA fragment of the invention, such as a DNA fragment. phages and plasmids. Techniques for cloning DNA fragments in phages are described, e.g. Charnay et al., Natura, 286, 893-895 (1980), J and Tiollais (British Patent Application 2,034,323). The HBsAg sequence is preferably located relative to the regulatory region such that HBsAg synthesized by expression of the HBsAg sequence is free of excess amino acid sequences.

In one embodiment of the present invention, the HBsAg coding sequence, together with the 42 codons of the HBsAg precursor (preS-S) protein, is fused in phase to a coding sequence for the 18 yeast OCT protein transcribed from the arg promoter. This construct provides a hybrid particle containing HBsAg protein containing 60 N-terminal amino acids in addition to the 226 amino acids of the corresponding S protein.

An exemplary regulatory region is derived from yeast

ο arg ^J gene encoding ornithine carbamoyl transferase (OCT). The arg regulatory domain is subject to both specific and general regulatory mechanisms. This has already been cloned

3

E. coli on plasmid pYeura arg as described by Crabeel et al., Proc. Natl. Acad. Sci. USA, 78, 6026 (1981)]. Preferred hosts are S. cerevisiae strains in which the arginine biosynthetic pathway is derepressed, e.g. strain 1c1697 d. The use of such strains results in increased expression from the arg promoter compared to the DC5 strain. Examples of other useful regulatory domains include those derived from the yeast genes of the glycolytic pathway, e.g. genes encoding enolase, aldalase, phosphoglycerate kinase and glyceraldehyde-3-phosphate dehydrogenase; the yeast alcohol dehydrogenase gene; and in general those genes that are interested in catabolism, e.g. the arginase gene.

For the cloning of the fused DNA fragments in yeast, plasmid YEp13, which is capable of replication and survival in both E. coli and S. cerevisiae, is known as a shuttle vector. Many other yeast vectors are known and available. The HBsAg and regulatory regions can be inserted into the yeast vector sequentially or simultaneously. Transformation with plasmids containing autonomous replication sequences (replicons) operable in yeast normally results in the extrachromosomal survival of the DNA molecule of the invention as a plasmid. Such replicons are well known in the art. Transformation with plasmids containing no functional replicons in yeast can result in the incorporation of the DNA molecule into the chromosomal DNA,

Vaccines of the present invention containing yeast-produced HBsAg and a suitable carrier can be prepared by known techniques to stimulate protection against HBV infection in humans. An adjuvant, e.g. aluminum hydroxide or aluminum phosphate is desirable. The HBsAg so produced can be combined to produce vaccines combined with other immunogens. HBV or combination vaccines may be administered e.g. subcutaneously, intravenously or intramuscularly. The DNA fragment of the present invention and the HBsAg produced by it can also be used as a probe for the detection of HBV in biological samples using DNA hybridization techniques and various immunoassays.

HBV PRE S2 WHITE CODING SEQUENCE EXPRESSION OF A DNA MOLEKULA CONTAINING A FUNCTIONAL DNA CODING SEQUENCE IN A PHASE OF A PRE S2 AREA

The present invention also relates to a recombinant DNA molecule comprising a functional DNA coding sequence fused to a portion of the Pre S2 region of the HBV Pre S2-S protein coding sequence. The term coding sequence, or coding region as used herein, encompasses any functional derivative thereof. The term functional derivative refers to a coding sequence that includes amino acid changes that do not, if desired, prevent particle formation and / or preserve immunogenicity. Such functional derivatives may be prepared by conventional site-specific mutagenesis. The technique of site-specific mutagenesis is taught by Botstein et al., 1985, Science, 229, 1193-1201 J.

- 38 at the N-terminal or at certain points within the Pre S2 area. There are four types of fusion, ie at the 5'terminal of the entire Pre S2 region; at certain points within the Pre S2 region such that the Pre S2 DNA flanks both sides of the functional DNA coding sequence; at the 5 'terminal of the truncated portion of the Pre S2 region; or at the 5 'terminus of the S protein coding region such that the fusion product does not contain Pre S2 DNA. Various Pre S2-S protein coding sequences are known and can be prepared or isolated by known techniques (see, e.g., the references cited above). In one embodiment of the present invention, the ARG3 regulatory region is fused in phase with the 18 amino acid region of the yeast OCT protein to a truncated Pre S2-S protein coding sequence, such that the fused sequence comprises 42 codons of the Pre S2-S protein coding sequence. protein coding sequence. Preferred functional DNA sequences include the Plasmodium circumsporozoite protein coding sequence or any immunogenic derivative thereof, the HIV envelope gene coding sequence or any immunogenic derivative thereof, and in particular C? peptide, peptide 121, or Dreesman peptide coding sequences or any immunogenic derivative thereof; so e.g. a preferred functional DNA sequence is the first 13 N-terminal codons of the Pre S2 coding sequence, which is then ligated to the 42 C-terminal codons of the truncated Pre S2 region of the Pre S2-S protein coding sequence. The term immunogenic derivative refers to a sequence that is a derivative or modifier of a naturally occurring sequence.

which maintains or enhances the protective immunogenic activity of the natural sequence. Such immunogenic derivatives may be prepared by conventional techniques. The term Pre S2, Pre S1, or the entire Pre S1-Pre S2-S protein coding sequence, as used herein, includes any immunogenic derivative thereof.

The term circulating sporozoite protein of Plasmodium refers to an immuno-dominant surface antigen on the sporozoite of Plasmodium or any immunogenic derivative thereof. Useful circumsporozoite proteins (CSs) include, but are not limited to, those derived from Plasmodium falciparum, P. vivax, P. ovale, and P. malariae. P. falciparum, P. vivax, P. ovale and P. malariae infect humans.

The coding sequence for Plasmodium falciparum CS protein is described by Dame et al., Ence 225, 593-599 (vivax.

CS coding sequence described by Arnot et al., 1985, Science 230: 815-818] Sharma et al., Science 229: 779-782 (1985)] Enea et al. describe the coding sequence for the P. cynomolgi CS protein in J. Proc. Natl. Acad. Sci. USA 81: 7520-7524 (1984)]. CS protein coding sequences of other species of plasmodia are also known (see the literature cited above) and / or can be deduced by conventional techniques.

As used herein, the terms CSP or CS protein encompass both the native full-length circumsporozoite protein of Plasmodium and their immunogenic derivatives. The term immunogenic derivative of Plasmodium circumsporozoite protein ···

(a) any derivative of Plasmodium circumsporozoite protein that retains protective immunogenic activity; or (b) any protein derived from the modified coding sequence of Plasmodium circumsporozoite protein having protective immunogenic activity. Such immunogenic derivatives may be prepared by conventional techniques. Certain synthetic immunogenic derivatives of the P. falciparum CS protein coding sequence are described in BalloU et al., Science 228: 996-999 (1985). See also Mazier et al., Science 231: 156-159 (1986).

The coding sequences of various species of Plasmodium are known and can be prepared or isolated by known techniques, e.g. Colman et al., WO84-02922A PCT Publication (P. knowlesi CS protein); and Dame et al., Science, 225, 593 (1984) (P. falciparum CS protein). A DNA molecule comprising the CS coding sequence, or any other functional DNA coding sequence, fused in phase to a portion of the Pre S2 region of the HBV Pre S2-S protein coding sequence may be prepared by conventional techniques, e.g. By ligating a CS coding sequence or any other functional DNA coding sequence, the Pre S2-S protein coding sequence for any codon within the 55 amino acids of the Pre S2 coding region.

Preferably, the Pre S2 coding sequence will remain sufficient after ligation of the CS coding sequence, or any other functional DNA coding sequence, to ensure optimal expression of the CS protein or any other protein corresponding to the functional DNA coding sequence for the HBsAg particle ♦ ··· ··

- 41 joints, i.e. sufficient Pre S2 region to function as a bridge between the product of the functional DNA protein coding sequence and the surface of the HBsAg particle, encoding the Pre S2 region polypeptide. It has been reported that the 26 amino-terminal amino acids of the Pre S2 coding sequence represent a .beta.dominant antibody binding site in the Pre S2 region. Milich et al., Science 228: 1195-1199 (1985). Thus, if it is desired to produce a hybrid particle that contains and / or transmits both the Pre S2 epitopes and the CS or any other functional sequence epitopes, it is preferable to insert the CS coding sequence or any other functional DNA coding sequence at that point. Within the Pre S2 coding region, which allows for the generation of a hybrid particle that contains and / or transmits both the Pre S2 epitopes and the CS or any other functional DNA coding sequence epitopes.

The recombinant vector of the present invention comprises a recombinant DNA molecule of the present invention (i.e., a functional DNA coding sequence fused to a portion of the Pre S2 region of the HBV Pre S2-S protein coding sequence) operably linked to a regulatory region. Such a vector may further comprise a yeast-functional replicon. The term 'replicon' refers to the minimal region of DNA that functions to maintain such a recombinant vector stably and extrachromosomally in a yeast host transformed with such a vector. Such replicons are well known in the art. The term regulatory region refers to any DNA region that regulates transcription and translation of the desired coding sequence to be expressed. Such regulatory areas are well known in the art. Such a vector can be produced by conventional techniques, e.g. inserting a DNA molecule of the present invention in phase into a vector that already contains a replicon and regulatory region such that the DNA molecule is operatively linked to such a regulatory domain. Preferably, the DNA molecule is ligated into a vector capable of expression in yeasts of the genus Saccharomyces.

The present invention also relates to a yeast host cell transformed with such a recombinant vector, and to a method for producing such a transformed host, which method comprises transforming the yeast host cell with the recombinant vector of the present invention. Such transformation can be accomplished by conventional techniques, e.g. with the ones already described here. Preferred yeast cells include yeasts of the genus Saccharomyces, and in particular those of the species Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

The present invention also relates to a process for making hybrid particles comprising the HBsAg protein, which particles contain and / or deliver a functional DNA coding sequence product; such a method involves culturing the transformed yeast host cell of the present invention in a suitable medium and isolating the particles from the cell lysate or extract of the culture of such host organism. The terms transferred or containing and / or transfer means that the protein corresponding to the functional DNA coding sequence is contained in a hybrid particle containing the HBsAg protein with a ··· ♦ ··

43 ways to allow an immune response to the protein corresponding to the functional DNA coding sequence to be produced. If desired (although not critical), the transfer of a protein corresponding to the functional DNA coding sequence will not interfere with the immunogenic activity of the HBsAg epitopes, thus providing bivalent vaccines. Most preferably, the protein corresponding to the functional DNA coding sequence is transferred to the HBsAg particle so that either the maximum number of epitopes of the protein corresponding to the functional DNA coding sequence or both the protein corresponding to the functional DNA coding sequence and the HBsAg epitopes are adequately surface exposed. The term "appropriate culture medium" refers to a medium that allows the transformed host to survive, and which also allows such a host to express a hybrid product of the vector's functional DNA coding sequence-Pre S2-S protein coding sequence, vector is transformed with the host. Those skilled in the art will appreciate that the appropriate culture medium to be used will depend on the host used. Isolation of the hybrid particles of the present invention from a cell lysate or extract of a culture of the host organism is accomplished by conventional protein isolation techniques.

The present invention also relates to vaccines containing the hybrid particles of the present invention. Such vaccines contain an immunoprotective amount of the hybrid particles of the present invention and are prepared by conventional techniques. The term immunoprotective means that a sufficient amount of the hybrid particles of the present invention is conducted.

44 to induce an appropriate protective antibody response against the agent to be protected without serious adverse reactions. Preferably, the vaccine of the present invention comprises a micelle of the present invention, i.e. a micelle comprising a particle of the present invention and a polysorbate. The preferred amount of polysorbate contained in such a micelle is 5 to 50 µg of polysorbate per 100 µg of protein. The micelle may be prepared by the method described in European Patent Application 0 199 698.

An aqueous solution of the hybrid particles of the present invention, preferably buffered at physiological pH η, can be used directly in the vaccine of the present invention. Alternatively, the particles may be mixed with or adsorbed with various known adjuvants. Examples of such adjuvants include aluminum hydroxide.

Vaccine preparation is generally described in New Trends in Vaccines, edited by Voller et al., University Park ^ Press, Baltimore, Maryland, United States of America. , 1978.

The amount of hybrid particles of the present invention in each dose of vaccine is selected as the amount that elicits an immunoprotective response without significant adverse side effects. This amount will vary depending upon the specific immunogen used and whether or not an adjuvant is used in the vaccine.

Generally, it is expected that each dose will contain from 1 to 1000 µg of protein, preferably from 1 to 200 µg of protein. The optimum amount of a given blind 45 cin can be determined by standard studies, which include observation of antibody titers and other responses in the study subjects. Patients usually receive a booster dose after 4 weeks of vaccination, followed by a booster every six months for as long as there is a risk of infection.

The immune response of the hybrid particles of the present invention may be enhanced by the use of an adjuvant such as aluminum hydroxide, but the process of the present invention is not limited thereto.

To exemplify the hybrid particles of the present invention, the 64 codon DNA sequence encoding the recurring epitope of the circulatingporozoite protein (CS) of Plasmodium falciparum and an eight codon CS coding sequence are described in Dame et al., Science, 225, 593-599 (1984). inserting, in phase, a portion of the Pre S2 coding sequence in a yeast expression vector comprising a replicon, a Pre S2-S protein coding sequence, and an appropriate regulatory region. Both expression vectors, one containing the 64 codon CS sequence and the other containing the 8 codon CS sequence, are introduced into yeast host cells and analyzed for the presence of HBsAg epitopes and CS epitopes in the same molecule.

Results from immunoassay analyzes using a collection of five CS-specific monoclonal antibodies and a purified yeast-derived HBsAg antibody revealed that a 37,000 kilodalton (Kd) hybrid protein was obtained from the Pre S2-S protein. with coding sequence · * · ♦ ··

- Yeast lysates transformed with a 46-phase fused 64 codon CS coding sequence vector and a 30,000 Kd hybrid protein was obtained from yeast lysates transformed with a vector containing the 8 codon CS coding sequence pre-fused with the Pre S2-S protein coding sequence. The assembly of these proteins into HBsAg particle-like structures is detected by CsCl and sucrose gradient analysis, high pressure liquid chromatography, and electron microscopy. The transfer of CS epitopes on the exterior of such particles is detected by the availability of CS epitopes for CS specific antibodies using ELISA. The transfer of HBsAg epitopes on the outside of such particles is detected by radioimmunoassay (AUSRIA II, Abbot) or by ELISA (Enzygnost-HBsAg, Behringwerke).

NEW PRE S2 AND PRE S2 WHITE CODING SEQUENCES

The novel HBV Pre S2 and Pre S2-S protein coding sequences of the present invention are derived from the HBV adw subtype isolated from pRIT10616. The term '' coding sequence or coding region, as used herein by j, encompasses their functional derivatives. The term functional derivative refers to a coding sequence containing amino acid changes, where such change, where necessary, does not affect particle formation and / or preserves immunogenicity if desired. Such functional derivatives may be prepared by conventional site-specific mutagenesis, e.g. Botstein et al., FScience, 229, 1193-1201 (1985). Such Pre S2 and Pre S2-S protein coding sequences can be obtained by conventional recombinant DNA techniques from plasmid pRIT10616, which has been deposited in E. coli strain K12 C600. From Budapest

• w · ♦ · #

In agreement with the American Type Breeding Collection (ATCC), Rockville, Maryland, June 2, 1982, under accession number ATCC 38131. The Pre S2 region of such novel protein coding sequences encodes the following amino acid sequence:

Met-Gln-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp-40

Pro-Arg-Val-Arg-Gly-Leu-Tyr-Phe-Pro-Ala-Gly-Gly-Ser-Ser-20

Ser-Gly-Thr-Val-Asn-Pro-Ala-Pro-Asn-Ile-Ala-Ser-His-Ile-10 Ser-Ser-Ser-Ser-Ala-Arg-Thr-Gly-Asp-Pro-Val Thr-Asn

Such regions can also be obtained by conventional synthetic oligonucleotide synthesis. A preferred functional derivative of the Pre S2-S coding sequence of the present invention is that the alanine coding triplet (GCT) at -45 is modified to a threonine coding triplet (ACT). Such a functional derivative results in a twice higher expression level in the Saccharomyces cerevisiae transformed with it compared to the unmodified coding sequence of the present invention.

A recombinant vector of the present invention comprises a coding sequence for the Pre S2 or Pre S2-S protein of the present invention operably linked to a regulatory region.

• · · «· # ·· * 4 · ·· lettel. Such a vector may further comprise a replicon if preferred and / or depending on the host to be used. The term replicon refers to the minimal region of the DNA sequence that functions to stably and extrachromosomally maintain such a recombinant vector in a eukaryotic or prokaryotic host transformed with such a vector. Such replicons are well known in the art. The term regulatory region refers to any DNA sequence containing a promoter region and other sequences required for transcription of a coding sequence. Such regulatory areas are well known in the art. Such a vector can be produced by conventional techniques, e.g. inserting the Pre S2 or Pre S2-S protein coding sequence of the present invention into a vector already comprising a replicon and a regulatory region such that the DNA molecule is operably linked to such a regulatory region. Preferably, the DNA molecule is ligated to a vector that is capable of expression in yeast, e.g. in a Saccharomyces.

The present invention also relates to host cells transformed with such a recombinant vector as well as to a method of producing such transformed host organisms. Such transformation can be accomplished by conventional techniques. The host cell may be prokaryotic or eukaryotic. Preferred host cells are eukaryotes, especially yeast cells, including those belonging to the genus Saccharomyces, and especially those belonging to the species Saccharomyces cerevisiae and Saccharomyces carlsbergiensis.

The present invention relates to the present invention.

- a method for producing proteins encoded by a Pre S2 or Pre S2-S protein coding sequence, said method comprising culturing a transformed host cell of the present invention in an appropriate culture medium and isolating the protein from a host cell culture broth or cell lysate of such a host organism. extract, depending on the ability of the host cells to secrete such a protein. The term "appropriate culture medium" refers to a medium that enables the transformed host organism of the present invention to survive and enables these hosts to express in a recoverable amount the Pre S2 or Pre S2S protein coding sequence of the present invention. Those skilled in the art will know that the appropriate culture medium to be used will depend on the host cell employed. Isolation of the Pre S2-S protein of the present invention from a culture lysate or culture broth of such a host is accomplished by conventional protein isolation techniques. The protein produced by the method of the present invention may be glycosylated, depending on whether or not the host cells are capable of doing so. If a deglycosylated protein is to be produced, the protein of the present invention is produced using a host cell that is unable to undergo such glycosylation or conventional site-specific mutagenesis on the protein coding sequence prior to carrying out the method of the present invention, e.g. Botstein et al., 1985, Science, 229, 1193 ~ 1201]

The present invention is directed to the present invention

You also provided an immunoprotective amount of Pre S2 or Pre S2-S protein with 50 staining vaccines. Such a vaccine may be prepared by conventional techniques.

The present invention also relates to a method for producing hybrid particles containing HBsAg protein, which method comprises culturing the transformed eukaryotic hosts of the present invention in an appropriate culture medium and isolating the particles from the culture broth of the host organism or from lysates of such host cells. , depending on whether or not the transformed host cells are capable of secreting such particles. A suitable culture medium is a medium that enables the transformed host organism of the present invention to survive, and which also enables the host organism to express the coding sequence of the Pre S2-S protein of the present invention, in particulate form and quantities. Those skilled in the art will know that the appropriate culture medium to be used will depend on the host cell used. Isolation of the hybrid particles of the present invention from a culture lysate or culture broth of such a host is accomplished by conventional isolation techniques.

The present invention also relates to vaccines containing the hybrid particles of the present invention. Such vaccines contain an immunoprotective amount of the hybrid particles of the present invention and are prepared by conventional techniques. Preferably, the vaccine of the present invention comprises the micelles of the present invention, i.e. those containing the particles and polysorbate of the present invention. The preferred amount of polysorbate contained in such micelles is 5-50 µg / g polysorbate / 100 µg protein. The micelles may be prepared by the method described in European Patent Publication No. 0 199 698.

In the vaccines of the present invention, an aqueous solution of the Pre S2-S protein or the hybrid particle of the invention can be used directly, preferably buffered at physiological pH η. Alternatively, the protein or particles may be mixed with or adsorbed on various known adjuvants. Examples of such adjuvants include aluminum hydroxide.

Vaccine preparation is generally described in the following book: New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, United States, 1978. describe closure eg. Fullerton (U.S. Patent No. 4,235,877). Conjugation of proteins to macromolecules is described e.g. Likhite (U.S. Patent No. 4,372,945) and Armor et al. (U.S. Patent No. 4,474,757).

The amount of Pre S2-S protein or hybrid particle of the present invention contained in each vaccine substance is selected to be an amount that induces an immunoprotective response without significant adverse side effects in typical vaccines. Such amounts may vary depending upon the particular immunogen used and whether or not the vaccine contains an adjuvant. Generally, it is expected that each dose will contain from 1 to 1000 µg, preferably from 1 to 200 µg, of white52. The optimal amount of a particular vaccine can be determined by standard studies, including test titers of antibody and other responses. monitoring. After the initial vaccination, patients will preferably receive a booster dose after approximately 4 weeks, followed by booster injections every six months for as long as there is a risk of infection.

The immune response of the Pre S2-S protein or hybrid particle of the present invention may be enhanced by the use of an adjuvant, e.g. using aluminum hydroxide, but the process is not limited to this.

NEW PRE S1 WHITE CODING SEQUENCE

The novel HBV Pre S1 protein coding sequence of the present invention is derived from the HBV adw subtype isolated from plasmid pRIT10616. The term "coding sequence" or "coding region" as used herein also encompasses functional derivatives thereof. The term functional derivative refers to a coding sequence comprising changes corresponding to amino acid changes, which, if desired, do not affect particle formation and / or retain immunogenicity. Such functional derivatives may be prepared by conventional site-specific mutagenesis, e.g. Fccience 229: 1193-1201 (1985). Such Pre S1 protein coding sequences can be obtained by conventional recombinant DNA techniques from plasmid pRIT10616, which (deposited in E. coli strain K12 0600) has been deposited with the American Type Strain Collection (ATCC), Rockville, Maryland, June 2, 1982 in accordance with the Budapest Treaty. ATCC Accession No. 38131. A • 9 /

Pre S1 region encodes the following amino acid sequence:

-163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser With Pro Asn Pro Leu GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro Ile Lys asp His Trp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro below below Asn Gin With Gly With Gly below TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TTG ACC ACA GTG TCA ACA ATT CCT

Gly Ile Leu Thr Thr Val Ser Thr Ile Pro

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin Below.

Such regions can also be obtained by conventional synthetic oligonucleotide synthesis.

A recombinant vector of the present invention comprises the Pre S1 protein coding sequence of the present invention operatively linked to a regulatory region, and may also contain a replicon, depending on whether it is preferred and / or depending on the host used. The term replicon refers to the minimal region of the DNA sequence that functions to stably and extrachromosomally maintain such a recombinant vector in a eukaryotic or prokaryotic host transformed with such a vector. Such replicons are well known in the art. The term regulatory region refers to a DNA sequence comprising a promoter region and other sequences required for transcription of a coding sequence. Such regulatory areas are well known in the art. Such a vector can be produced by conventional techniques, e.g. inserting the Pre S1 protein coding sequence of the present invention in phase into a vector that already contains a replicon and a regulatory region,

- 55 for the DNA molecule to be operatively linked to such a regulatory region. Preferably, the DNA molecule is ligated to a vector that is capable of expression in yeast, e.g. in a Saccharomyces.

The present invention also relates to host cells transformed with such a recombinant vector as well as to a method of producing such transformed host organisms. Such transformation can be accomplished by conventional techniques. The host cell may be prokaryotic or eukaryotic. Preferred host cells are eukaryotes, especially yeast cells, including those belonging to the genus Saccharomyces, and especially those belonging to the species Saccharomyces cerevisiae and Saccharomyces carlsbergiensis.

The present invention also relates to a method of producing proteins encoded by the Pre S1 protein coding sequence of the present invention, which method comprises culturing the transformed host cell of the present invention in a suitable culture medium and isolating the protein from the host cell culture broth or cell lysate of such host organism. or an extract thereof, depending on the ability of the host cells to secrete such a protein. The term "appropriate culture medium" refers to a medium that enables the transformed host organism of the present invention to survive, and which enables these host organisms to express in a recoverable amount the Pre S1 protein coding sequence of the present invention. Those skilled in the art will appreciate that the appropriate culture medium to be used will depend on the host cell employed.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

The isolation of the Pre S1 protein of the present invention from a culture lysate or culture broth of such a host is accomplished by conventional protein isolation techniques. The protein produced by the method of the present invention may be glycosylated, depending on whether or not the host cells are capable of doing so. If a deglycosylated protein is to be produced, the protein of the present invention is prepared using a host cell that is unable to undergo such glycosylation or conventional site-specific mutagenesis on the protein coding sequence before carrying out the method of the present invention. Such site-specific mutagenesis, e.g. Botstein slot, et al., Science 229: 11931201 (1985).

The present invention also relates to a vaccine comprising the Pre S1 protein of the present invention. Such vaccines contain an immunoprotective amount of Pre S1 protein and may be prepared by conventional techniques.

The vaccine of the present invention can be used directly in the solution of the virus of the Pre S1 protein of the invention, preferably buffered at physiological pH η. Alternatively, the Pre S1 protein may be mixed with or adsorbed on various known adjuvants. Examples of such adjuvants include aluminum hydroxide.

Vaccine preparation is generally described in the following book: New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, United States, 1978. describe closure eg. FullerΛ

- 57 tons (U.S. Patent No. 4,235,877). Conjugation of proteins to macromolecules is described e.g. Likhite (U.S. Patent No. 4,372,945) and Armor et al. (U.S. Patent No. 4,474,757).

The amount of the Pre S1 protein of the present invention contained in each dose of vaccine is selected to be an amount that induces an immune-protective response without significant adverse side effects in typical vaccines. Such amounts may vary depending upon the particular immunogen used and whether or not the vaccine contains an adjuvant. Generally, it is expected that each dose will contain from 1 to 100 µg of protein, preferably from 1 to 200 µg of protein. The optimal amount of a particular vaccine can be determined by standard studies, including monitoring antibody titers and other responses. After the initial vaccination, patients will preferably receive a booster dose after approximately 4 weeks, followed by booster injections every six months for as long as there is a risk of infection.

The immune response of the Pre S1 protein of the present invention may be enhanced by the use of an adjuvant, e.g. using aluminum hydroxide, but the process is not limited to this.

NEW PRE S1-PRE S2 WHITE CODING SEQUENCE

The present invention also relates to a coding sequence for the HBV Pre S1-Pre S2-S protein having a fragment of Pre S1-Pre S2 having the following amino acid sequence.

···· ··· · ··· · ···· · • t

- 58 PRE S1 AREA

-163

ATG GGG ACG AAT CCT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser With Pro Asn Pro Leu GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro Ile Lys asp His Trp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro below below Asn Gin With Gly With Gly below TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TTG ACC ACA GTG TCA ACA ATT CCT

Gly Ile Leu Thr Thr Val Ser Thr Ile Pro • ··· ··

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT 'CCA . CCT 'CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin below

PRE-S2 AREA

-55 ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA Met Gin Trp Asn Ser Thr below Phe His Gin GCT CTG CAG DAM CCC AGA GTC AGG GGT CTG below Leu Gin asp Pro Arg With Arg Gly Leu TAT TTT CCT GCT GGT GGC TCC AGT TCA GGA Tyr Phe Pro below Gly Gly Ser Ser Ser Gly ACA GTA AAC CCT GCT CCG AAT ATT GCC TCT Thr With Asn Pro below Pro Asn Ile below Ser CAC OVER THE TCG TCA AGC TCC GCG AGG ACT GGG His Ile Ser Ser Ser Ser below Arg Thr Gly

• · • · ν ·

- 60 GAC CCT GTG ACG AAC

Asp Pro Val Thr Asn

The novel HBV Pre S1-Pre S2-S protein coding sequence of the present invention is derived from the HBV adw subtype isolated from plasmid pRIT10616, which, as stated above, is available from the American Type Strain Collection, Rockville, Maryland, under accession number ATCC 38131. The term "coding sequence" or "coding region" as used herein also encompasses functional derivatives thereof. The term functional derivative refers to a coding sequence comprising changes corresponding to amino acid changes, which, if desired, do not affect particle formation and / or retain immunogenicity if desired. Such functional derivatives may be prepared by conventional site-specific mutagenesis, e.g. Botstein et al., 1985, Science 229: 1193-1201.

A recombinant vector of the present invention comprises a coding sequence for the Pre S1-PreS2-S protein of the present invention operably linked to a regulatory region. Such a vector may further comprise a replicon, depending on whether it is beneficial and / or depending on the host used. The term replicon refers to the minimal region of the DNA sequence that functions to stably and extrachromosomally maintain such a recombinant vector in a eukaryotic or prokaryotic host transformed with such a vector. Such replicons are well known in the art. The term regulatory region refers to a DNA sequence that is a promoter. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · b ···

- contains 61 regions and other sequences required for transcription of a coding sequence. Such regulatory areas are well known in the art. Such a vector can be produced by conventional techniques, e.g. inserting the Pre S1-Pre S2-S protein coding region of the present invention into a vector already comprising a replicon and a regulatory region such that the DNA molecule is operatively linked to such a regulatory region. Preferably, the DNA molecule is ligated to a vector that is capable of expression in yeast, e.g. in a Saccharomyces.

The present invention also relates to host cells transformed with such a recombinant vector as well as to a method of producing such transformed host organisms. Such transformation can be accomplished by conventional techniques. The host may be prokaryotic or eukaryotic. Preferred host cells are eukaryotes, especially yeast cells, including those belonging to the genus Saccharomyces, and especially those belonging to the species Saccharomyces cerevisiae and Saccharomyces carlsbergiensis.

The present invention also provides a method of producing proteins encoded by the Pre S1-Pre S2-S protein coding sequence of the present invention, which method comprises culturing the transformed host cell of the present invention in a suitable culture medium and isolating the protein from the host cell culture broth or cell lysate or extract of a culture of such a host, depending on the ability of the host cells to secrete such a protein. The term "appropriate culture medium" refers to a medium that enables the transformed host organism of the present invention to survive and enables these hosts to express in a recoverable amount the Pre S1-Pre S2-S protein coding sequence of the present invention. your product of the present invention. Those skilled in the art will appreciate that the appropriate culture medium to be used will depend on the host cell employed. The Pre. Isolation of S1-Pre S2-S protein from a culture lysate or culture broth of such a host is accomplished by conventional protein isolation techniques. The protein produced by the method of the present invention may be glycosylated, depending on whether or not the host cells are capable of doing so. If a deglycosylated protein is to be produced, the protein of the present invention is prepared using a host cell that is unable to undergo such glycosylation or conventional site-specific mutagenesis on the protein coding sequence prior to carrying out the method of the present invention, e.g. Botstein et al., 1985, Science 229, 1193-1201 J. According to the present invention

The Pre S1-Pre S2-S coding sequence is expressed as a glycosylated protein in yeast or mammalian host cells transformed with it. The Pre S1-Pre S2-S coding sequence of the present invention is expressed as an N-myristylated protein in the yeast host cells transformed with it.

The present invention also relates to vaccines comprising an immunoprotective amount of the Pre S1-Pre S2-S proteins of the present invention. These vaccines can be prepared by conventional techniques.

The present invention also relates to a method of making hybrid particles comprising an HBsAg protein comprising a protein encoded by a Pre S1Pre S2-S protein coding sequence; the method comprising culturing the transformed eukaryotic host cells of the present invention in a suitable culture medium and isolating the particles from the host cell culture broth or cell lysate or extract of the host culture, depending on whether the transformed host cell is capable of secreting either such protein. The term "appropriate culture medium" refers to a medium that enables the transformed host organism of the present invention to survive and enables these host organisms to express in particulate form and recoverable amounts the Pre S1-Pre S2-S of the present invention. protein coding sequence. Those skilled in the art will appreciate that the appropriate culture medium to be used will depend on the host cell employed. The isolation of the particles of the present invention from a culture lysate or culture broth of such a host is accomplished by conventional protein isolation techniques.

The present invention also relates to vaccines containing the hybrid particles of the present invention. Such vaccines contain an immunoprotective amount of the hybrid particles of the present invention and are prepared by conventional techniques. Preferably, the vaccines of the present invention comprise micelles of the present invention, i.e., micelles containing particles and polysorbate of the present invention. The preferred amount of polysorbate in such micelles is 5 ~ 50 µg of polysorbate per 100 µg of protein. The micelle is • 9 9 ··· ·· · · ···

- 64 Ο 199 698.

An aqueous solution of the Pre S1-Pre S2-S protein or hybrid particle of the present invention can be used directly in the vaccines of the present invention, preferably buffered at physiological pH η. Alternatively, the protein or particle may be mixed with or adsorbed on various known adjuvants. Examples of such adjuvants include aluminum hydroxide.

Vaccine preparation is generally described in the following book: New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, USA, 1378. The Liposomes closure is described e.g. Fullerton (U.S. Patent No. 4,235,877). Conjugation of proteins to macromolecules is described e.g. Likhite (U.S. Patent 4,372,945) and Armor et al. (U.S. Patent 4,474,757).

The amount of Pre S1-Pre S2-S protein or hybrid particle of the present invention contained in each dose of vaccine is selected to be an amount that induces an immunoprotective response in a typical vaccine without significant adverse side effects. Such amounts may vary depending upon the particular immunogen used and whether or not the vaccine contains an adjuvant. Generally, it is expected that each dose will be 1-IOOO ^ g, preferably · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· • - 65

1-200 µg, containing protein. The optimal amount of a particular vaccine can be determined by standard studies, including monitoring antibody titers and other responses. After the initial vaccination, patients will preferably receive a booster dose after approximately 4 weeks, followed by booster injections every six months for as long as there is a risk of infection.

The immune response of the Pre S1-Pre S2-S protein or hybrid particle of the present invention may be enhanced by the use of an adjuvant, e.g. using aluminum hydroxide, but the process is not limited to this.

EXPRESSION OF PRE S1-PRE S2-S PROTEIN IN YARN

The present invention also relates to a recombinant DNA vector comprising a complete Pre S1-Pre S2-S protein coding sequence operably linked to an expression control sequence. The term "coding sequence" or "coding region" as used herein also encompasses functional derivatives thereof. The term functional derivative refers to a coding sequence comprising changes corresponding to amino acid changes, which, if desired, do not affect particle formation and / or preserve immunogenicity if desired. Such functional derivatives may be prepared by conventional site-specific mutagenesis, e.g. Botstein et al., 1985, Science, 229, 1193-1201 J. Such a vector may further comprise a replicon, depending on whether it is beneficial and / or depending on the host used. The Pre S1-Pre S2-S protein coding sequence used is a preferred embodiment of the present invention.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ···

The term "replicon" refers to the minimal region of the DNA sequence that functions to stably and extrachromosomally maintain such a recombinant vector in a yeast host transformed with such a vector of the invention. Such replicons are well known in the art. The term regulatory region refers to a DNA sequence comprising a promoter region and other sequences required for transcription of a coding sequence, and which regulates transcription of the coding sequence of a structural gene. Such regulatory areas are well known in the art. Such a vector can be produced by conventional techniques, e.g. inserting the Pre S1Pre S2-S protein coding region of the present invention into a vector which already contains a replicon and a regulatory region, such that the DNA sequence is operably linked to such a regulatory region. Preferably, the DNA molecule is ligated to a vector that is capable of expression in yeast, e.g. in a Saccharomyces. The Pre S1-Pre S2-S protein coding sequence contained in the vector of the present invention is preferably the Pre S1-Pre S2-S protein coding sequence described above. Such vectors are useful for inserting functional DNA coding sequences to allow expression of the Pre S1 - functional DNA coding sequence - Pre S2-S protein coding sequence included in such vectors. Accordingly, the present invention also relates to a recombinant DNA molecule fused in phase to the Pre S1 region of a Pre S1-Pre S2-S protein coding sequence such that the functional DNA sequence is either inserted into the Pre S1 region or replaces the Pre S1 region. · · · · A portion of the region and possibly a portion of the Pre S2 region, and deals with a vector containing such a recombinant DNA molecule (see, e.g., Example 21A below). Functional DNA coding sequence refers to a DNA coding sequence which, when fused in phase to the Pre S1 region of the HBV Pre S1-Pre S2-S coding region, does not interfere with or interfere with the assembly of the HBsAg particles. Preferred functional DNA coding sequences include, but are not limited to, e.g. the coding sequence for Plasmodium circumsporozoite protein or any immunogenic derivative thereof, the coding sequence for the HBV envelope gene or any immunogenic derivative thereof, particularly C? peptide, peptide 121, or Dreesman peptide coding sequence, or an immunogenic derivative thereof, as exemplified below, or sequences encoding specific peptides from other viruses, and in particular sequences encoding the envelope proteins of other parasites.

The present invention relates to a yeast host cell transformed with such a recombinant vector and to methods for producing the transformed host organism. Such transformation is accomplished by conventional techniques. Yeast cells belonging to the genus Saccharomyces, especially those belonging to the species Saccharomyces cerevisiae, are preferred.

The present invention also relates to a method of producing a protein encoded by the Pre S1-Pre S2-S protein coding sequence or the Pre S1-functional DNA coding sequence, comprising culturing the transformed host cells of the present invention in a suitable culture. medium, and isolating the protein from the host cell culture broth or cell lysate or extract from such a host organism, depending on whether or not the host cell is able to secrete such protein. The term "appropriate culture medium" refers to a medium that enables the host of the present invention to survive, and that also enables such host to express in a recoverable amount the Pre S1-Pre S2-S protein coding sequence or Pre S1. -functional DNA coding sequence-Pre S2-S protein coding sequence product. Those skilled in the art will know that the appropriate medium to be used will depend on the host cell employed. Isolation of Pre S1Pre S2-S protein or Pre S1 functional DNA coding sequencePre S2-S protein from cell lysate or culture broth of such a host cell culture is accomplished by conventional protein isolation techniques. The protein produced by the method of the present invention may be glycosylated depending on whether or not the host cell is capable of this glycosylation. If a deglycosylated protein is desired, the protein of the present invention must be prepared using a host cell that is unable to undergo such glycosylation, or conventional site-specific mutagenesis, e.g. Botstein et al., 1985, Tscience 229: 1193-1201.

The present invention also relates to a vaccine comprising an immunoprotective amount of Pre S1-Pre S2-S protein or Pre S1-functional DNA coding sequence-Pre S2-S protein produced by the method of the present invention. Such a vaccine has been traditionally

- We can produce it with 69-inch techniques.

The present invention also relates to a method for producing hybrid particles comprising a protein encoded by a Pre S1-Pre S2-S protein coding sequence or a Pre S1-functional DNA coding sequence-Pre S2-S protein coding sequence, wherein the present method comprising culturing the transformed yeast host cells of the invention in a suitable culture medium and isolating the particles from the host cell culture broth or cell lysate or extract of such a host organism, depending on whether or not the host cell is capable of secreting such particles. The term "appropriate culture medium" refers to a medium that enables the host of the present invention to survive, and which also enables such host to express, in particulate and recoverable amounts, the Pre S1-Pre S2-S protein coding sequence or the Pre S1-functional DNA coding sequence-Pre S2-S protein coding sequence. Those skilled in the art will know that the appropriate medium to be used will depend on the host cell employed. Isolation of the particles of the present invention from cell lysate or culture broth of such a host is conventionally carried out. techniques.

The present invention also relates to vaccines containing particles of the present invention. Such vaccines contain an immunoprotective amount of the particles of the present invention and are prepared by conventional techniques. The vaccines of the present invention preferably comprise the micelles of the present invention, i.e., the micelles that are present in the present invention.

Containing 70 particles of the invention and polysorbate. The preferred amount of polysorbate in such micelles is 5-50 µg of polysorbate per 10 µg of protein. The micelle may be prepared by the method described in European Patent Publication No. 0 199 698.

In the vaccines of the present invention, the Pre S1-Pre S2-S protein or Pre S1-functional DNA coding sequence-Pre S2-S protein of the present invention, or an aqueous solution of the particles of the present invention, preferably at physiological pH apply. Alternatively, the protein or particle may be admixed or adsorbed with various known adjuvants. Examples of such adjuvants include aluminum hydroxide.

Vaccine preparation is generally described in the following book: New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, United States, 1978. The Liposomes closure is described e.g. Fullerton (U.S. Patent No. 4,235,877). Conjugation of proteins to macromolecules is described e.g. Likhite (U.S. Patent 4,372,945) and Armor et al. (U.S. Patent 4,474,757).

The amount of Pre S1-Pre S2-S protein or Pre S1 functional DNA coding sequence Pre S2-S protein or particle of the present invention that is contained in each vaccine dose is selected from: ···· ·· • · ····

And 71 to provide an amount that induces an immunoprotective response without significant adverse side effects in typical vaccines. Such amounts may vary depending upon the particular immunogen used and whether or not the vaccine contains an adjuvant. Generally, it is expected that each dose will contain from 1 to 100 µg of protein, preferably from 1 to 200 µg of protein. An optimal amount for a particular vaccine can be set standard studies, including subjects of the test antibody titers _O THER responses in surveillance of them. After the initial vaccination, patients will preferably receive booster vaccinations after approximately 4 weeks, followed by booster injections every six months for as long as there is a risk of infection.

The immune response of the Pre S1-Pre S2-S protein or Pre S1-functional DNA coding sequence-Pre S2-S protein or particle of the present invention may be enhanced by the use of adjuvant, e.g. using aluminum hydroxide, but the process is not limited to this.

EXAMPLES

The following examples of the invention, which are provided for purposes of illustration and not limitation, are set forth in the following explanations.

- All percentages are by weight and temperatures are in degrees Celsius.

- The enzymes used for DNA manipulation were obtained from Bethesda Research Laboratories, New England Biolabs and / or Boehringer and are supplied by the supplier. as directed.

- Yeast Growth Medium: Selective Medium: YNB ····· · · · · · · · · · · · · · · · · · · · · · ·

- 72 Yeast nitrogenous base without amino acids (Difco Labs) J 0.675% (w / v) containing 2% (w / v) glucose.

YEPD Medium: 1% (w / v) yeast extract, 2% (w / v) peptone and 2% (w / v) glucose.

- DNA recombinant methods: Molecular Cloning c. (Maniatis T. et al., Cold Spring Harbor Laboratory, 1982).

- PMSF: phenylmethylsulfonyl fluoride.

- The following abbreviations may be used:

PBS: phosphate buffered saline (pH 7.4), per liter:

8.0 g of NaCl

0.2 g KCl

1.15 g Na ₂ HP0 ₄

0.2 g KH ₂ P0 ₄

0.1 g CaCl

0.1 g MgCl ₂ .6H ₂ 0

BSA: Bovine Serum Albumin (Α ^ γθ * Sigma)

X-gal: 5-Bromo-4-chloro-indoyl-3-D-galactopyranoside, commercially available from Sigma Chemical Co., St. Louis, Missouri.

L-medium (per liter):

g tripton g NaCl g yeast extract ml 0.1 M MgSO 4

An ml of aseptic thiamine solution (1 mg / ml) was added after autoclaving. For solid, add 15 g of agar to medium ···· · β ···· · 4 · 4 4 4 44 ·

4 * 4 4444 4 44 • 44 · 4Φ 4 4 ··

- 73 per liter.

Example 1 Construction of plasmid pRIT10107

The starting material is plasmid p6y containing a 2.1 kb HindIII fragment of yeast DNA containing TDH3 cloned in pBR322. PBR322 is described by Bolivar et al., 1977, Gene, 2: 95-113. Plasmid p6y was designed and characterized by Musti et al., Gene, 25, 133 (1983) J and deposited with Dr. Rosenberg M. at the National Institute of Health. The HindIII fragment was re-cloned in a pBR322 derivative in which the EcoRI site had been previously cleaved to give plasmid pRIT101064 (not necessarily a maneuver). The following manipulations are performed to create a BamHI site located at the G terminus of the ATG codon of the TDH3 coding sequence and to obtain a HindIII-BamHI DNA fragment with TDH3 promoter activity in which the TDH3 sequences remain intact and unaffected during manipulation. The DNA of pRIT10164 prepared as described above is purified by two cycles of CsCl-ethidium bromide density gradient centrifugation, essentially as described by Kahn et al., Methods in Enzymology, 68, 268 (1979), J150-150 g of pRIT10164. digested with 75 units of XbaI endonuclease, phenol and ether, precipitated with ethanol and resuspended in 0.01 M tromethamine-HCl buffer at 1 _v Mg / (41 _%). / g is digested with Bal31 nuclease to cut 61 base pairs of DNA between the ATG codon and the Xba I site. Bal31 digestion is carried out at 30 ° C for 1-3 minutes in a buffer containing 600 mM NaCl. t, 12 mM CaCl ₂ , 12 mM MgCl ₂ , 1 mM EDTA, 20 mM ·····················································································• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

- 74 tromethamine HCl (pH 3.1) using one unit of Bal31 nuclease per 20 µg of DNA for a final reaction volume of 200 L.

The enzyme reaction is stopped by adding enough ethylene bis (oxyethylene emtrilo) tetraacetic acid (EGTA) to a final concentration of 20 mM and the samples are extracted with an equal volume of phenol and then with ether and precipitated with ethanol. Each DNA sample was resuspended in 20 ml of 10 mM tromethamine-HCl buffer, pH 7.5. The level of Bal31 digestion was measured by digesting about 2.5 µg of each DNA sample with Hpal endonuclease and comparing the size of the Hpal-Xba I fragments with the 335 bp Hpal-Xba I fragment obtained from pRIT10164. The Bal31 digest for 2 minutes was found to remove about 41-88 nucleotides from the XbaI-Hpal fragment of pRIT10164.

These results indicate that a similar number of base pairs were removed at the other Xba I end toward the ATG codon. For 5 µl, 2 min of Bal31 digested DNA was digested with BamHI endonuclease, extracted with phenol and recovered by ethanol precipitation. This DNA was treated with 5 units of T4 polymerase in the presence of deoxynucleotide triphosphates to load and homogenize BamHI and any Bal31 single-stranded ends, extracted with phenol and recovered by ethanol precipitation. 2.3 µg of this DNA is treated with 5 units of T4 DNA ligase and half of the ligation mixture is used to transform competent cells of E. coli K12 strain MM294 prepared by the method of Cohen et al., Proc. Natl.

·· *:. ·· «· · · · · · · · · · · · · · · · · · · · · ···

- 75 Acad. Sci., 69, 2110 (1972). One ml of the transformed E. coli population is diluted in 350 ml of L-medium supplemented with 200 µg / ml ampicillin and the whole plasmid DNA is purified from the resulting culture.

This plasmid DNA, which contains a population of 40-80 base pairs of plasmid molecules lost by digestion with Bal31, is sequentially digested with 75 units of HindIII endonuclease and 96 units of BamHI endonuclease to release DNA fragments from the plasmids in which the BamHI site is located. again as a result of the treatments described above, i.e. where the Bal31 digestion was completed at G. This DNA digestion mixture was run on a 1% preparative agarose gel and the desired HindIII-Bam HI fragments, corresponding to a size range of 1100-1000 bp, were cut out of the gel in two slices; one corresponds to about 1070 bp of DNA and the other corresponds to about 1030 bp of DNA. DNA was recovered from the two agarose gel slices by subjecting the slices to two cycles of freezing and thawing followed by high speed centrifugation to transfer the agarose to the pellet. The supernatant liquid was filtered through a Millipore GV Millex filter and the DNA was recovered by performing two cycles of ethanol precipitation and resuspension in 20 µl of 0.01 M tromethamine in HCl pH 7.5.

Digestion by agarose gel electrophoresis and comparison with HindIII and XbaI digested pRIT10164 DNA and HindIII and EcoRI digested with phage DNA indicates that the HindIII-BamHI fragment has a <RTIgt;

• 9 here · ··

- · " · • ·· the · · • ··

Two separate populations of 76 mocks were obtained, one with an estimated size of about 1070 bp and another with an estimated size of about 1030 bp compared to the parent HindIIIIIbal fragment from pRIT10164. About 100 ng of the 1030 bp Hind III- Bam HI fragment population was ligated to 200 ng of plasmid pUC9 which had been © HindIII and BamHI endonucleases restenosis / - _a ^ _ treated alcali phosphatase (see Shine: 4264731 Patent No. US S. and the ligation mixture is used to transform competent cells of E. coli strain JM103, where selection can be accomplished with ampicillin resistance. Transformation of E. coli strain JM103 was performed according to the method of Cohen et al., Supra.

Both the plasmid pUC9 and the host strain E. coli JM103 were described by Vieira and Messing Qlene, 1-9, 259 (1982) J and obtained from Messing J. (University of Minnesota), the vector pUC9 is commercially available. Amersham (Buckinghamshire, UK) and Pharmacia (Uppsala, Sweden). E. coli strain JM103 is available from Messing J., University of Minnesota. Other strains with the characteristics of E. coli JM103 are available from the American Type Strain Collection (ATCC, Rockville, Maryland), e.g. strain JM101, which is also available as a host, under accession number ATCC 33876. About 400 colonies of ampicillin resistant per ml are obtained and 98 colonies are assayed in medium containing X-gal. Among these, 95 white colonies indicate the successful insertion of the foreign DNA fragment between the HindIII and BamHI sites on the vector.

The plasmids of each transformant colony were prepared by a small-scale procedure [Bimbóim and Dolyf Nucl. Acid. Sl., 1513 (1979), after addition of plasmid amplification of plasmids with ISO / µg / ml spectinomycin to increasing cultures.

Recombinant plasmids were analyzed on 7.5% acrylamide gels after double digestion with Avall and BamHI endonucleases and compared to the 450 bp Aval-XbaI fragment containing the pRIT10164 promoter-N-terminal coding regions and the Hpall digestion product of pBR322 DNA. A AvalI-BamHI fragment corresponding to 20-90 bp deletions is present in 35 of the 36 plasmids tested when compared to pRIT10164. Three plasmids were selected for further assays: the equivalent of about 80 base pair bypass (pRIT10166), the equivalent of 50 base pairs (pRIT10167 - Figure 8), and the 45 base pair bypass (pRIT101-5). Plasmid DNA was recovered by density centrifugation with CsCl-ethidium bromide, and PS4 g of each was digested with EcoRI. The EcoRI ends are labeled with γ-P-ATP by kinase exchange and the nucleotide sequence of the HindIII-EcoRI fragments obtained from each plasmid is determined by the method of Maxam and Gilbert (1980, Methods Enzymology 65: 499). Labeling and sequence analysis of the EcoRI site in the pUC9 vector portion of each recombinant plasmid is a convenient way of sequencing around the adjacent BamHI site by marking the end of the deletion on the TDH3 DNA fragment. This sequence analysis shows that the BamHI site in plasmid PRIT10166 is restored to the G residue located at the 5 'untranslated region, 25 bases ··· ♦ ··

- 78 pairs upstream of the ATG codon; in pRIT10165, the BamHI site is located at the second base of the third codon; and in pRIT 10167 the BamHI site is located at the G terminus of the ATG codon.

The HindIII-BamHI fragments of the TDH3 DNA thus generated in pRIT10167 contain, in unaltered form, all of the sequences required for exemplary TDH3 promoter activity. Creating vector pRIT1 01 72

The 1050 bp HindIII-BamHI TDH3 DNA insert from pRIT10172 prepared as described in Example 1 was re-cloned into the HindIII site in the 2 micron DNA portion of the vector as described in Broach et al., Gene 8, 121 (1979) J YEp13. and the BamHI site to obtain the recombinant plasmid pRIT12159. The DNA of pRIT12159 is then XbaI and XbaI

It is digested with BamHI endonucleases and the resulting 1650 bp fragment is ligated into a similar XbaI-BamHI fragment containing the arg promoter on pRIT10774. Plasmid pRIT10774 is described in Cabezon et al., Proc. Natl. Acad. Sci. USA, 81, 6594-6598 (1986) J, which contains the Yep13 replicon from which the BamHI and XbaI sites of the native vector have been removed by in vitro manipulation with the 1470 bp HindIII-BamHI insert containing the arg promoter and arg transcript has a termination area of 1150 bp

With the BamHI-HindIII fragment. Replacement of the arg promoter insertion on pRIT10774 with the TDH3 promoter insertion provides plasmid pRIT10172, which therefore contains a unique BamHI site located at the ATG codon of the TDH3 promoter insertion and prevents the functional signal of the transcription termination in the 1150 bp BamHI-HindIII fragment. . Corresponding ·· * · ·

It is possible to clone foreign DNA at this site. In addition, the two DNA insertions are also bound by HindIII sites, which allow removal of the expression unit module (cassette) as a 2200 bp HindIII fragment for insertion into other vectors. Figure 9 shows a restriction endonuclease cleavage map of pRIT10172.

Example 3 Construction of pRIT12290

The 1050 bp HindIII-EcoRI fragment produced from pRIT10167 by the method described in Example 1 (Figure 8) containing the HindIII-BamHI TDH3 promoter fragment together with the BamHI-SmaI-EcoRI portion of the pUC9 polylinker. was cloned between the HindIII and EcoRI sites of a derivative of plasmid pBR322, which had previously been removed from the BamHI site by loading and religating by T4 DNA polymerization. The resulting recombinant plasmid was identified as pRIT12176.

The DNA of plasmid pRIT1O158 (Figure 8) prepared as described in Example 4 (b) below was treated with EcoRI endonuclease and treated with T4 DNA polymerase to fill EcoRI single-stranded ends. The composition thus obtained is further digested with Clal endonuclease. A further sample of pRIT10158 was treated with Clal and HaelII endonucleases and an 1150 bp Clal-HaelII frag3 fragment carrying the arg gene transcription termination region was recovered by preparative agarose gel electrophoresis and electroelution. This fragment was ligated with pRIT10158 DNA treated with EcoRI, T4 DNA polymerase and ClaI, and the ligation mixture was used to transform competent cells of E. coli strain MM294, whereby the preparation of the cells was carried out using the ····· s ·· '!

• · - * ....;

This is done by the method described by Cohen et al. (See above), with the possibility of testing for ampicillin resistance. From the transformed colonies, a plasmid identified as pRIT10162, in which the Clal-HaelII arg transcription termination fragment was inserted into pRIT10158 between the Clal and the loaded EcoRI sites, and in which the EcoRI site was restored, was isolated. Figure 8 is a flowchart illustrating the preparation of pRIT10162. Plasmid pRIT10162 DNA was digested with EcoRI and PstI endonucleases, mixed with plasmid pRIT12176 DNA (also digested with EcoRI and PstI endonucleases) as described above, and the mixture was ligated and used to transform E. coli K12 MM294 cells. ampicillin resistance, according to Cohen et al., supra. Plasmid pRIT 12208 was recovered from colonies of this transformation in which the large 4630 bp EcoRIPstl fragment from pRIT12176 was ligated to the small 1930 bp EcoRIPst1 fragment from pRIT10162, and the arg transcription termination region was now close to was introduced into the TDH3 promoter. The arg 1 and TDH 3 DNA regions can be excised from pRIT12208 by digestion with HindIII endonuclease as a unique 2200 bp fragment. To obtain a different orientation of this fragment in terms of vector sequences, the 2200 bp HindIII fragment from pRIT12208 was re-cloned into the HindIII site of a pBR322 plasmid derivative in which the natural EcoRI and BamHI sites were separately removed by loading with T4 DNA polymerase. and re-ligation. The resulting plasmid was introduced in the opposite orientation to the vector sequences as compared to pRIT12208. with a 2200 bp HindIII fragment identified as pRIT12290. Figure 10 is a restriction endonuclease cleavage map of pRIT12290. In both pRIT12208 vector and pRIT12290 vector, the TDH3 promoter and transcription termination fragments are separated by unique BamHI, SmaI and EcoRI restriction sites which can be used to clone DNA fragments containing coding sequences, and the promoter and transcription termination regions can be excised in a 2200 bp HindIII fragment as a module or cassette for transferring other vectors.

The BamHI site is particularly useful because it is located at the ATG codon of the TDH3 gene and can be used to fuse other genes to the TDH3 promoter with the aim of expressing them in yeast, as further exemplified below. Such fusion products may be recovered from pRIT12208 or pRIT1229 derivatives in the form of cassettes or modules for insertion into yeast shuttle vectors by digestion with HindIII endonuclease or other restriction endonucleases that cleave at the flanking restriction sites.

Example 4 Construction of plasmids pRIT10677, pRITI-0909 and pRIT10158

a.) pRIT10677

A 1372 bp BamHI fragment of cloned HBV DNA was excised from pRIT10616 [Harford et al., Dev. Biol. Standard, 54, 125-130 (1983)] and mixing and ligating BamHI endo82 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· with pBR327 DNA digested with nuclease. This BamHI fragment contains a portion of the HBsAg precursor region, the HBsAg coding sequence, and the 3'-non-coding sequences. Plasmid pRIT10677, which has the BamHI fragment of HBV inserted at the BamHI site of the vector, is selected from the ligation mixture in such an orientation that the Xba I site in HBV DNA is proximal to the SalI site in the pBR327 vector. Figure 8 is a flowchart illustrating the production of pRIT10677.

b.) pRIT10909

Plasmid pMC200 (available from the American Type Strain Collection, Rockville, Maryland, United States of America, unpaired, ATCC 39131), described by Crabeel, M. et al., 1983, EMBO J. 2: 205-212. The 3300 bp HindIII fragment of J was re-cloned in a derivative of plasmid pBR332 from which the native Eco RI site had previously been removed by loading and re-ligating with T4 DNA polymerase. The resulting recombinant plasmid pRIT10158 was selected (Figure 8), in which the HindIII arg ^J gene insert had a 3 'region of the arg gene proximal to the ClaI site on the modified pBR322 vector. An 1150 bp Clal-HaelII fragment was obtained from pRIT10158 which carries the transcription termination region of the arg gene. This 1150 bp fragment was ligated with the Clal and Hpal endonuclease-digested DNA of plasmid pRIT10677 (produced by the method described in part a) above), thereby fusing the arg termination site downstream of the HBsAg coding region. The resulting plasmid is pRIT10909. Figure 8 is a flow chart illustrating the construction of pRIT10909. Figure 3 is a restriction endonuclease cleavage map of pMC200.

Example 5 Construction of pRIT10911 and pRIT10912

The BamHI site is the native BamHI site in pRIT10167 (Example 1) and the precursor region of the HBsAg gene cloned in pRIT10616 from an HBV virus of the adw serotype ^ Harford et al., Dev. Biol. Standard, 54, 125-130 (1983)], thus allowing the fusion of the TDH3 promoter fragment to provide an ATG codon for codon 42 of the HBsAg precursor sequence, followed by codon 226 of the corresponding HBsAg coding sequence. The source of the HBV DNA fragment for this fusion is plasmid pRIT 10909 (see Example 4 (b) above), which contains the coding portion of the HBsAg precursor region, the entire HBsAg coding sequence, and the 3'-untranslated DNA. the bp to which the fusion occurred, downstream of the Hpal site, and an 1150 bp HaelII-ClalII DNA fragment from pRIT10158, which contains the arg transcription termination region. PRIT10158 was prepared as described in Example 4 b. section. From pRIT10909, the 2085 bp EcoRI-BamHI fragment was excised and inserted between the EcoRI and BamHI sites of pRIT10167 prepared in Example A to form plasmid pRIT10911. The 3135 bp HindIII fragment from pRIT10911, which contains the yeast DNA transcription signals and the HBsAg coding sequences, is then inserted into the YEp13 shuttle vector to give plasmid pRIT10912. Figure 8 is a flowchart illustrating the production of pRIT10911.

»

Example 6 Construction of plasmids pRIT10903 and pRIT10914.

• ·

The constructs described below are intended to remove excess nucleotides at the end of the DNA fragment encoding at least the N-terminal portion of the mature HBsAg coding sequence by constructing a 6 base pair restriction site at the first base of the second codon. . The resulting fragment can then be fused to promoter fragments with a 6 base pair restriction site at the initiation codon using Mung bean or S1 nucleases to cut single-stranded overhangs and blunt ends for ligation as described by Rosenberg et al. Enzymology, 101C, 123 (1983)].

HBV DNA from pRIT10616 ^ Harford et al., Devel. Biol. Standard, 54, 125-130 (1983)], a 1225 bp FnuDII fragment containing the HBsAg gene is excised from this plasmid and ligated with synthetic EcoRI octameric linkers and cloned into the EcoRI site of pACYCl84 to give pRIT10679 (Figure 8). The pACYCl84 vector was obtained from Cohen S. Chang A.C.Y. and Cohen, S., p. Bacteriology. 134: 1141-1156 (1978)]. PACYC184 is also available from the American Type Strain Collection, Rockville, Maryland, USA, under accession number ATCC 37033. From this EcoRI (FnuDII) fragment, a 125 bp EcoRI-XbaI fragment is obtained which contains the C-terminal region of the HBsAg precursor, the HBsAg ATG codon and 90 bp of the HBsAg coding sequence. This 125 bp EcoRI-XbaI fragment was introduced between the EcoRI and XbaI sites of pRIT10158 (see example 4 (b) above). The resulting plasmid, pRIT10903, is accordingly tarI

- 85 3 has a unique EcoRI site at the site of the arg DNA and HBV DNA meeting, and has a unique XhoI site located in the arg promoter region. Figure 8 is a flowchart illustrating the production of pRIT10903.

150 µg of pRIT10903 plasmid DNA, prepared by CsCl-ethidium bromide density gradient centrifugation, was digested with 80 units of EcoRI endonuclease, extracted with phenol, precipitated with ethanol and resuspended in 1 µM Mg / t <1 mM 10 mM buffer (pH 7.5). The DNA was split into 3 samples of 50 µl and incubated with Bal31 nuclease at 30 ° C for 50, 75 and 90 seconds. Each reaction mixture contained the same reaction buffer, quoted in Example 1, containing 50 µg EcoRI-digested pRIT10903 DNA and 2.5 units Bal31 nuclease in a final volume of 500 µl. Reactions were quenched by addition of EGTA to a final concentration of 20 mM, cooled on ice, extracted with an equal volume of phenol, and precipitated with ethanol. The DNA samples were treated with Bal31 digested individually taken up in 50 ^ 1, 10 mmol / l tromethamine-HCl buffer and 2.5 _(/ (g endonuclease BstEII and a 7.5% acrylamide gel comparing pRIT10903 digested with endonucleases EcoRI and BstEII product, which is a 285 bp fragment. Treatment with Bal31 nuclease for 75 seconds at 30 ° C resulted in a reduction of the size of this Eco RI-BstEII fragment by 10-60 bp, yielding a series of discrete bands of 10, 30 bp. , 45 and 60 bp DNA, 29 bp cut the original FnuDII site to remove all HBsAg precursor DNA and the HBsAg ATG codon.

5 µg of pRIT10903 DNA, previously 75 seconds in length.

It was treated with Bal31, digested with 8 units of Xhol nuclease, extracted with phenol and precipitated with ethanol. This DNA was incubated with 5 units of T4 DNA polymerase in the presence of deoxynucleotide triphosphates to fill in and flank the XhoI and Bal31 ends, phenol and ethanol precipitate. The DNA was then incubated with 5 units of T4 DNA ligase for 16 hours at 16 ° C, and the mixture was used to transform competent cells of E. coli K1 strain MM294 with the ability to use ampicillin resistance according to Cohen et al., Supra. . About 2000 ampicillin-resistant colonies per milliliter are obtained after plating. Plasmids were prepared from 47 individual colonies by a small-scale procedure (see Bimbóim et al., Cited above), and found in 23 of the 47 colonies to retain the Xhol loading site, which means that the original Xho and ligation were Successfully completed at the 3 'end ending in G. This plasmid was further digested with XhoI and XbaI endonucleases to determine the size of the small restriction fragment compared to the original EcoRI-XbaI fragment from pRIT10903.

Numerous plasmids with deletions (deletions) have been identified with estimated deletions in the range of 25-40 bp. One plasmid, pRIT10914, estimated to contain a 95-100 base pair XhoI-XbaI fragment, was selected for further studies. Figure 8 illustrates a flow chart for generating pRIT10914. The DNA of this plasmid was purified by CsCl-ethidium bromide density gradient centrifugation and 25mg of this DNA was digested • · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

140 units with Xbal endonuclease.

The XbaI ends are exchanged for the y-P-ATP labeled ends and the labeled DNA is 15 units of HindIII endonuclease and?

zal /. The small HindIII-XbaI fragment of 765 bp was isolated by acrylamide gel electrophoresis and electroelution and precipitated with ethanol. The nucleotide sequence is altered at and around the Xho I site by sequence analysis of this fragment from the indicated Xba I end using the chemical modification method quoted by Maxam and Gilbert. Sequence data show that the XhoI site is located at the first base of the second codon of the HBsAg coding sequence.

XhoI

CTCGAGAAC

HBsAg nucleotides

Accordingly, this fragment is suitable for fusion to the BamHI end of the TDH3 promoter fragment on pRIT10167 (Example 1) after removal of the single-stranded ends.

Example 7 Construction of plasmids pRIT12211, pRIT12209, pRIT12230 and pRIT12265

Plasmid pRIT10911, described in Example 5, is used as a base for further operations. To introduce the desired restriction sites, the plasmid was digested with BamHI and XbaI endonucleases and the excised fragment was replaced with the 2275 bp Bam HI-XbaI fragment from pRIT 10158 (Example 4). This manipulation results in plasmid pRIT12211, in which the HindIII-BamHI TDH3 promoter fragment is close to an XhoI-containing BamHI-XbaI fragment, followed by the C-termini of the HBsAg coding sequence.

An XbaI-HindIII fragment containing 88 region and 128 bp of the 3 'non-coding DNA fused to the 1150 bp arg ^ transcription termination region. Figure 8 is a flowchart illustrating the construction of pRIT12211. PRIT12211 is digested with XhoI and XbaI endonucleases, thereby removing a 1600 bp fragment that is replaced by a 94 bp XhoI-Xba I fragment of modified HBsAg DNA from pRIT10914 prepared as described in Example 5. This 94 bp fragment was obtained by purification of the XR1 and Xba I digestion product of pRIT10914 DNA by purification by acrylamide gel electrophoresis followed by electroelution of the appropriate gel slice followed by ethanol precipitation of the DNA.

Plasmid pRIT12209 resulting from the introduction of the 94 bp fragment (see Figure 8) was purified by CsCl-ethidium bromide density gradient centrifugation and digested with 30 µl of ^ {pRIT 12209 DNA with 90 units of BamHI endonuclease and 60 units of Xhol endonuclease, to remove 990 bp of excess DNA between the TDH3 promoter and the HBsAg coding region, the mixture was extracted with phenol and precipitated with ethanol. 10 µg of this DNA is incubated for 30 minutes at 30 ° C with 20 units of mungbab nuclease (PL Biochemicals) in a volume of 150 _v a1. The incubation buffer contained 30 mM sodium acetate (pH 4.6), 250 mM NaCl, 1 mM ZnCl and 5% glycerol. The reaction was quenched by addition of sodium dodecyl sulfate to a final concentration of 0.2% and extracted with an equal volume of phenol followed by ethanol precipitation. An aliquot of 0.5 Jkgos of this mung bean nuclease-treated sample was incubated with 2 units of T4 DNA ligase for 16 hrs · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

• φ ···· · «· ······· · ···

At 8916 ° C, and then digested with 2 units of BamHI endonuclease to destroy any vector molecules that escaped this treatment. This mixture was used in E. coli K1 2MM

294 strains, with the possibility of selection with ampicillin resistance, as described by Cohen et al., Supra. Per milliliter of the transformation mixture, about

2000 ampicillin-resistant colonies were recovered and plasmids were amplified from amplified cultures of these transformants by the small-scale procedure (as described by Bimbóim et al., Supra).

16 plasmids give two DNA bands after digestion with HindIII endonuclease, 2700 bp (pUC9 vector) and 3000 bp. The 3000 bp band size is the size you would expect from a

HBsAg coding sequence and the arg termination site of the TDH3 promoter fragment from the fusion product.

Four designated plasmids are introduced for further studies. The DNA of each plasmid was digested with XbaI endonuclease and labeled by kinase exchange using P-ATP, followed by digestion with HindIII endonuclease, followed by isolation of the labeled 1190 bp HindIIIIIba fragment by electrophoresis following acrylamide gel electrophoresis and ethanol elution. . The sequence of each fragment is determined by the chemical modification methods of Maxam and Gilbert, cited above. Two plasmids are found to have the correct ATGGAGAAC sequence for the perfect fusion of the TDH3 promoter region and the HBsAg gene. Figure 8 is a flowchart illustrating the production of pRIT 12230. The DNA of this plasmid (pRIT12230)

- 90 • · · · · · · · · · · · · · · · · · · · · · · · · ···

Hin dIII was treated with the endonuclease and the 3000 bp fragment containing the HBsAG coding sequence fused to the TDH3 promoter was ligated into the YEp13 commuter vector. The resulting plasmid, pRIT12265, was transformed into yeast strain DC5 (MATa, leu2-4, leu2-112, his3, can1-11). This strain was obtained from Broach J., State University of New York, Stany Brook. is also available without limitation in the American Type Strain Collection (ATCC), using the transformation procedure of ATCC '20630, Ito et al. Bact. 153, 163 (1983)] -

Example 8 Construction of plasmids pRIT12288 and pRIT12322.

Contains the construction of plasmid pRIT12230 (Example 7)

128 bp of non-coding HBV DNA, located 3 'downstream of the stop codon of the HBsAg structural gene.

To remove 128 bp of DNA, approximately 25 _v / g of pRIT12230 prepared as described in Example 7 above was digested with AccI and EcoRI endonucleases. PRIT 12230 contains a unique AccI site located 7 nucleotides upstream of the TAA stop codon in the S gene coding sequence. The digested DNA was subjected to electrophoresis on a 1% agarose gel, and larger 4200 bp vector fragments were recovered from the gel by electroelution and ethanol precipitation.

Artificial DNA linker molecules composed of a 12-mer strand and a 14-mer strand are synthesized with the following sequences for insertion into the AccI and EcoRI sites of pRIT12330:

5 'ATACATTTAACG 3'

- Mer

3 'TGTAAATTGCTTAA 5'

- Mer

This restores the correct C-terminal HBsAg codons and the TAA stop codon and provides an EcoRI site for the insertion of the transcription termination fragments that is not present elsewhere in the TDH3 promoter or HBsAg coding sequences.

100 µmoles of synthetic 12-mer and 100 µmoles of synthetic 14-mer single fibers are mixed in a final volume of 10-20 µl, heated at 70 ° C for 15 minutes and allowed to cool slowly to room temperature over 3 hours, allowing the two fibers to fusion along its complementary sequences. To this brazed mixture was added about 0.15 picomoles (400 ng) of the 4200 bp AccI-Eco RI fragment of pRIT12230, as well as 10x concentrated ligation buffer and 2 units T4 DNA ligase.

This mixture was incubated for 4 hours at 16 ° C, then an additional 2 units of T4 DNA ligase was added and incubated overnight on ice. The ligation mixture was used to transform competent cells of strain MM 294, ampicillin resistance selection! with the method of Cohen et al., Proc. Natl. Acad. Sci. USA, 69, 2110 (1972). Plasmid was prepared from 12 or more individual colonies according to the rapid method of Bimbomim and Doly jjTucl. Acids Slit. 7, 1513 (1979) J and analyzed by restriction endonuclease analysis. Plasmids with AccI-EcoRI linker insertion show 4200 bp of single-stranded DNA by either AccI or EcoRI digestion

• · · · · · · · · · · · · · · · · · · · · · · · · ··· · The correctness of the insertion of the switch can be confirmed by DNA sequence analysis either from the EcoRI site or the AccI site by Maxam and Gilbert (1980), 65: 499.

To obtain a transcription termination fragment, the AccI-EcoRI linker insert plasmid obtained as described above was digested with EcoRI endonuclease and treated with alkaline phosphatase (Shine J., U.S. Patent No. 4,264,731). The 2650 bp HindIII fragment of pRIT1CH62, obtained as described in Example 3, was re-cloned into the HindIII site of plasmid pBR327 to construct plasmid pRIT12288. PBR327 is described by Soberon et al., 1980, Gene, 287-305, and may be prepared as described in Example 10 (b) below from plasmid pRIT12309, which, in turn, is American Type Strain Collection can be obtained from strain ATCC 67187. Figure 8 is a flowchart illustrating the construction of pRIT 12288.

The HindIII fragment on pRIT12288 is oriented such that the arg transcription termination site is flanked by the EcoRI and ClaI restriction sites of pBR327. It carries an 1180 transcription termination region from pRIT12288. This fragment was ligated with the Eco RI-digested alkaline phosphatase derivative pRIT12230 described above and the plasmids derived from this ligation mixture were tested for insertion and orientation of the 1180 bp EcoRI fragment. The orientation of the insertion can be obtained by digestion with HindIII endonuclease, which releases 2880 and 2720 bp fragments when the insertion is in the proper orientation.

A plasmid, pRIT12322 ₍ constructed in which the AccI-EcoRI linker replaces 128 bp of the unwanted DNA and in which the 1180 bp EcoRI fragment from pRIT12288 is present in the desired orientation downstream of the HBsAg coding sequence) A 2900 bp HindIII fragment can be excised from pRIT12322 carrying the expression module required for HBsAg synthesis, including the TDH3 promoter, the HBsAg coding sequence, and the arg transcription termination region. See also Figure 11, which is a restriction endonuclease map of pRIT12232, showing which portions of it are derived from pRIT12288 and which are from pRIT12230.

Example 9 Construction of plasmid pRIT12329

As described in Example 8 above, pRIT12322 contains a 2900 bp HindIII fragment with all the necessary signals from the TDH3 promoter required for HBsAg expression. This module is ligated into a shuttle vector for introduction into yeast cells. The YEp13 commuting vector DNA was digested with HindIII endonuclease and alkaline phosphatase and used as a host to introduce the HindIII fragment of pRIT12322 prepared as described in Example 8 above. Plasmid pRIT 12329 was isolated containing the YEp13 replicon together with the 2900 bp HindIII module fragment described in Example 8.

Example 10 Construction of plasmid vectors for expression of HBsAg-CS hybrid antigen in yeast.

the. Construction of plasmids pRIT12573 and pRIT12574

Plasmid WR201 is available from the Walter Reed Army Institute of Research ···· ···

94, and is generated as a result of the insertion of a 2.3 kb Eco RI fragment encoding the whole circumsporozoite protein gene of Plasmodium falciparum A mPf1 j Dame et al., Science, 225, 593-599 (1984)]. Figure 2A shows a schematic restriction map and chair analysis strategy for the AmPfl clone. The positions of the restriction enzyme cleavage sites shown in the figure are determined from the sequence and confirmed by digestion, the abbreviations being as follows: A: Avall; Ac: AccI; B: BstnI; D: Dral; Dd: Ddl; F: Foki; N: Ndel; R: Rsal; S: Stul; T: TthII; Tq: Taql; X: Xhol. The arrows indicate the origin, direction, and extent of the specified sequences. The coding region of the CS protein is shown as a thick line. 3A. Fig. 5A shows the nucleotide sequence of the P. falciparum CS protein gene. The nucleotide sequence of the CS protein gene in mPlF is shown. The pUC8 vector is described by Vieira et al., Gene, 1-9, 259 (1982). PUC8 is commercially available from Amersham and Pharmacia. Plasmid WR201 1215 base pair (bp) Stu I-Rsa I fragment containing the coding sequence for the CS protein without the first 52 bp was purified by electroelution _f (Figure 12) 7.5% polyacrylamide electrophoresis géljéről. This fragment is digested with Sau3A to form smaller fragments, e.g. a 192 bp Sau3A fragment that encodes a repetitive portion of the CS protein 16 tetrapeptides; and three identical 24 bp Sau3A fragments encoding a two tetrapeptide portion of the CS protein.

PRIT10911 (prepared as described in Example 5) is a pUC9 derivative carrying a 3136 bp HindIIIII cassette, which is a 1050bp HindllII-BamHI yeast glyceraldehyde 3β-dehydrogenase (TDH3). carries a promoter fragment (which provides ATG) at the BamHI site fused to the 42 bp C-terminal amino acids of the pre-S 2 region, the 226 amino acids of the S gene (adw serotype), and 128 bp of the 3 'non-coding DNA. containing HBV DNA to a 935 bp BamHI-Hpal fragment. The S gene is flanked by a 1150 bp yeast DNA fragment carrying the arg transcription terminator. PUC9 is described by Vieira et al., 1982, Gene 19: 259-268. The BamHI site of pRIT10911, located at the ATG initiation codon, is in phase with the Sau3A sites of the repetitive epitope of Plasmodium falciparum CS. Plasmid pRIT60911 DNA was digested with BamHI endonuclease, treated with alkaline phosphatase, extracted with phenol and recovered by ethanol precipitation. 0.5 g of this DNA is mixed with 0.2 µg of the Sau3A digestion product of the Stul-Rsal CS gene fragment prepared as described above, treated with T4 DNA ligase, and the ligation mixture is used in E. coli strain K12 MM294. competent cells transformed by the method of Cohen et al., Proc. Natl. Acad. Sci. USA, 69, 2110 (1972)]. 32 plasmids were prepared from each transformant colony by small-scale procedure. After replication of plasmid amplification by Bimbóim et al., Nucleic Acids Research 7, 1513 (1979), spectinomycin (300 g / ml) was added to growing cultures. . Recombinant plasmids were analyzed on 7.5% acrylamide electrophoresis gel after double digestion with BamHI and Xbal endonucleases and compared to the 219 bp BamHI-Xbal fragment of pRIT10911 (containing the first 42 amino acids of the Pre S2 precursor). ·· _Λ • «· *» ·· · · · · · · * ·· ·· this coding sequence and the start of the area HBsAg) and ψχ174 DNA Hae III digest of fragments.

Of the 32 plasmids, one recombinant shows a 411 bp BamHIXbaI fragment, which corresponds to the insertion of the 192 bp Sau3A fragment in the correct orientation, termed pRIT12572. Another recombinant 243 bp BamHI-XbaI fragment, which corresponds to the insertion of the 24 bp Sau3A fragment in the correct orientation, is called pRIT12571. Figure 12 is a flowchart for the production of pRIT12571 and pRIT12572.

The HindIII fragments of pRIT12572 and pRIT12571, which contain the TDH3 promoter, the CS-HBsAg hybrid coding sequence, and the arg termination site, were re-cloned into YEp13 to give plasmids pRIT12574 and pRIT12573 (Figure 12). YEp13 is described by Broach et al., 1979, Jlene 8: 121-133. Figure 12 is a flowchart illustrating the production of pRIT12573 and pRIT12574.

Plasmids pRIT10912, pRIT12574 and pRIT12573 were introduced into S. cerevisiae strain DC-5 (a, leu2-3, leu2-112, his3, can1-11) and S. cerevisiae 10S44C (pep4-3, leu2-3, leu12-112). from Czabeel M., of Ceria Institute, Anderlecht, Belgium; see also strain Cabezon T. et al., Proc. Natl. Acad. Sci. USA 81; 6594-6598 (1984)] by transforming strains treated with lithium acetate (lto et al., J. Bacteriol. 153: 163-168 (1983)] and leucine selection. The DC5 yeast strain was deposited with the American Type Strain Collection (ATCC), Rockville, Maryland, United States, prior to the Budapest Treaty.

- According to the writings of '97, '1982. June 2, ATCC 20630. THE

Yeast strain 10S44C has been deposited with the American Type Strain

Collection (ATCC), Rockville, Maryland, USA

States, August 1986 under deposit number. The expected hybrid protein at pRIT12573 is predicted to contain 277 amino acids, whereas pRIT12574 contains 333 amino acids.

It is possible to add or enlarge the CS epitope region to the vector of the invention. so e.g. further Sau3A fragments of the CS protein DNA, e. g., plasmid pRIT12572 and pRIT12571, a 192 bp or 24 bp Sau3A fragment can be ligated to the BamHI site as follows.

Plasmid pRIT12572 or pRIT12571 DNA was digested with BamHI endonuclease and treated with alkaline phosphatase. The 1215 bp Stul-Rsal fragment of plasmid WR201, obtained as described above, was digested with Sau3A endonuclease to release the 192 bp and 24 bp fragments carrying the repeat tetrapeptides. These fragments were mixed with BamHI and alkaline phosphatase treated pRIT12572 or pRIT12571 vectors, treated with T4 DNA ligase, and transformed into E. coli K12 strains by conventional methods with ampicillin resistance selection. The plasmids obtained from the transformant colonies were screened for size of BamHI-Xbal fragments by endonuclease digestion and compared with similarly digested pRIT12572 or pRIT12571 DNA, in particular the 243 bp BamHI-Xbal fragments derived from pRIT12572 and pRIT12571, a fusion region between a portion of the Pre S2-S coding sequence. The fragments of these • · ·

An increase in size of their -98 tours of 192 bp or 24 bp indicates that a repeat tetrapeptide fragment was inserted at the BamHI site of pRIT12572 and pRIT12571. The presence of the BamHI site on such plasmids indicates that the 192 bp or 24 bp Sau3A fragments were inserted in the correct orientation for fusion at the ATG codon. This process, as described above, may be repeated if it is desired to introduce additional 192 bp or 24 bp Sau3A fragments encoding the repeating CS tetrapeptides and extend the CS tetrapeptide region on the hybrid particle. As noted above, HindIII fragments derived from such derivatives of pRIT12572 or pRIT12571, carrying the expression module or cassettes, can be excised and inserted into YEp13 or other suitable yeast cloning vector for delivery to yeast cells by conventional techniques.

(B) Construction of pRIT12309, pRIT12314 and pRIT12377 expressing vectors containing the complete 2 micron DNA sequence from yeast

Plasmid pRIT12309 contains the complete yeast-derived 6318 bp complete 2 micron DNA sequence cloned into the EcoRI site of plasmid pBR327. The 6318 bp 2 micron DNA sequence was obtained from plasmid pCV19, obtained from Broach J. (Princeton University, New Jersey). Plasmid pRIT12309 was deposited on August 18, 1986, in the E. coli strain K12 MM924 of the American Type Strain Collection (ATCC), Rockville, Maryland, United States, under the accession number ATCC 67187. Figure 13 is a restriction endonuclease map of pRIT 12309. The 2 micron DNA chair • · · · · ··· · · · · · · · · · · · · · ·

The insertion of 99 vectors into pBR327 at one of the two EcoR1 sites present on this molecule interrupts the 2 micron A coding region and renders the resulting pRIT12309 hybrid molecule ineffective for the A 'gene function, also called the FLP function. For a description of the structure and function of the 2 micron region, see Broach J. The Molecular Biology of the Yeast Saccharomyces: Molecular Biology of the Saccharomyces Yeast: Life Cycle and Inheritance, 445-470; editors: Strathern J.N., Jones E.W. and Broach J.R .; Cold Spring Harbor Laboratory, New York (1981).

PBR327 is described in Soberon et al., 9, 287-305 (198O) J and was obtained from F. Bolivar (Department of Molecular Biology, National University of Mexico, 20DF). Those skilled in the art will recognize that pBR327 can be recovered from the above plasmid pRIT 12309 by generating plasmid pRIT12309 from the E. coli strain deposited in the American Type Species Collection under accession number ATCC 67187 by any of a number of conventional methods. digestion with Eco RI endonuclease, ligation of the digested product and transformation of E. coli K12 competent cells with the ligation mixture to create resistance to ampicillin or tetracycline.

A significant number of transformant colonies contain plasmids in which only the pBR327 portion of pRIT12309 is present without any of the two 2 micron DNA fragments.

The 2850 bp Clal-SalI fragment containing the TDH3 arg expression cassettes and flanking the pBR322 sequences derived from pRIT12290 of Example 3 described above was re-cloned into the pRIT12309 vector between the Clal and SalI sites. It is created in this way

Plasmid pRIT12314 was digested with SalI endonuclease and ligated with the 2218 bp SalI-XhoI fragment from YEp13 containing the yeast LEU2 gene. Figure 14 is a flowchart illustrating the construction of pRIT12314. YEp13 is available from the American Type Stock Collection under accession number ATCC 37115. The ligation mixture was used to transform competent cells of strain JA221, prepared by the method of Cohen et al., Cited above, with both leucine dependence and ampicillin resistance selection.

JA221 is publicly available and was obtained from Rosenberg, M. (Smith Kline and French Laboratories, Inc., Philadelphia), but is also available from the American Type Species Collection under accession number ATCC 33875.

Plasmid pRIT12544 is obtained from a colony of this transformation in which the 2218 bp SalI-XhoI LEU2 gene fragment is inserted at the SalI site of pRIT12314. The orientation of the insertion is such that the Scarlet space is re-formed on the side closest to the TDH3arg express cassette. The E. coli yeast shuttle vector pRIT12544 has unique BamHI and SmaI sites inserted between the TDH3 promoter and the arg transcription termination sites, which are capable of inserting DNA coding sequences to effect expression from the TDH3 promoter. Figure 14 is a flowchart illustrating the construction of pRIT12544.

(C) Construction of plasmid pRIT12658

The 3328 bp HindIII fragment of pRIT12574, which is shown in Figure 10.

YEp13 derivative prepared as described in Example 1A, Part A, was recloned in plasmid pBR322 BamHI (where the BamHI site is located

101 digested by loading with T4 DNA polymerase) to give pRIT 12608, where the BamHI site located at the ATG initiation codon of the CS-HBsAg coding sequence is unique (Figure 15). The 2550 bp BamHI-SalI fragment from pRIT12608, which contains the CS-HBsAg coding sequence, the arg transcription termination region, and the flanking pBR322 sequence, was re-cloned into the BamHI and SalI sites of pRIT12544 described above (Figure 15). to obtain plasmid pRIT12658 (Figure 15). This exchange places the CS-HBsAg coding sequence under the control of the TDH3 promoter in a complete 2 micron yeast shuttle vector. Figure 15 is a flowchart illustrating the production of pRIT12658.

Example 11 Synthesis of hybrid protein in yeast

Yeast strains of Saccharomyces cerevisiae DC5 or 10S44C were transformed according to the method of Ito et al., J. Bacteriol.

153: 163-168 (1983)] with each of the plasmids pRIT10912 (Example 5), pRIT12573 (Example 10), pRIT12574 (Example 10), or pRIT12329 (Example 9) or pRIT10172 (Example 9). Example 2) and separately grown in liquid medium lacking leucine (YNB or YNB + 80 _U g / ml histidine) and cells are harvested in the mid-log phase. Cells from 1 or 2 ml cultures were harvested by centrifugation and resuspended in 50 µl 0.125 M Tris-HCl, pH 6.8 containing 20% glycerol, 4% SDS, 6 M / 1 urea and 10%

Contains 2-mercaptoethanol. After incubation for 5 minutes at 100 ° C, the sample was halved and both halves were electrophoresed on a 12.5% separating gel and a 5% layered gel according to Laemmli (1971, 227, 680).

X t ··· • · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · pit ·

- 102 The HBsAg and CS protein sequences are identified by the protein immunostaining technique. See Burnette, Anal. Biochem. 112: 195-203 (1981); Gershoni and Palade, Anal. Biochem. 131: 1-15 (1983); Towbin and Gordon, J. Immunol. Methods 72, 313-340 (1984) J. After electropolishing the proteins on a nitrocellulose filter (Schleicher and Schull, 0.45 / 0owbin et al., Proc. Natl. Acad. Sci. USA, 76, 4350-4354 (1979)), the filter is preincubated for one hour at 37 ° C. The filter was then washed five times for five minutes, always with PBS containing 0.1% Tween20 (polyoxyethylene sorbitan monolaurate), and treated for one hour at room temperature with five anti-CS proteins. (Dame et al., Science, 225, 593-599 (1984)) in PBS containing 1% gelatin, The remainder of the plate was treated with HBsAg and HepYTAS12 monoclonal antibodies in PBS containing 1% gelatin.

HepYTAS12 is a purified yeast-derived HBsAg antibody directed against an epitope resistant to reduction and denaturation. The filter plates were washed five times for 5 minutes, in each case with PBS-0.1% Tween20, and a second biotinylated sheep anti-mouse antibody (Amersham) in 1% gelatin in PBS for one hour at room temperature. Plates were again washed with PBS-0.1% Tween20, incubated 5 times for 5 minutes and then incubated with streptavidinbiotinylated horseradish peroxidase (HRP) complex (Amersham) for 30 minutes at room temperature. Plates were washed three times with PBS-0.1% Tween20 and finally incubated with 30/41 Η ₂ 0 ₂ -νβ1 and HRP Color Development Reagent (HRP Color) in 30 ml of methanol. dissolved in 50 ml PBS. The · · »» · ·

The molecular weight of the 103 antigens is estimated using pre-stained protein markers, e.g. ovalbumin, alpha-chymotrypsinogen, beta-lactoglobin, lysozyme or cytochrome C (BRL).

Both DC5 and 10S44C yeast strains transformed with pRIT12573 show the production of an antigen that reacts with both anti-CS and anti-HBsAg antibodies and has an estimated molecular weight of 30,000 kilodaltons (kd). Both DC5 and 10S44C yeast strains transformed with either pRIT12574 or pRIT12658 show the production of an antigen that reacts with both anti-CS and anti-HBsAg antibodies and has an estimated molecular weight of 37000 kd. Some lower molecular weight antigens can also be detected, indicating some degradation of the hybrid protein. Control samples of cells containing plasmids without CS or HBsAg sequences (pRIT10172) show no reaction. Control samples of cells containing only plasmids with HBsAg sequences (pRIT12329 or pRIT10912) only react with anti-HBsAg antibodies.

These results indicate that the expected molecular weight hybrid protein containing both CS and HBsAg sequences is synthesized in plasmid-transformed yeast, which contains a CS coding sequence / fused to the Pre S2-HBsAg coding sequence.

In addition, while the binding intensity in the anti-HBsAg reaction is nearly the same for pRIT12573 and pRIT12574, the intensity of the antiCS reaction is significantly higher for pRIT12574 than for pRIT12573. This indicates that with the same amount of HBsAg sequence, the repetitive epitope of the CS protein is larger

104 is present in pRIT12574 as in pRIT12573.

Example 12 Synthesis of hybrid particles providing the CSP epitope

Yeast strains of Saccharomyces cerevisiae DC5 or 10S44C containing pRIT10172 (Example 2), pRIT12329 (Example 9), pRIT 12573 (Example 10), or pRIT12574 (Example 10) were grown in selective medium. (200 ml of YNB or YNB + 80 µg / ml histidine) until the end of the log phase. Cells were harvested by centrifugation and resuspended in 10 mL of 50 mM sodium phosphate buffer, pH 7.4, containing 0.5% Tween20 (polyoxyethylene sorbitan monooleate), 1 mM PMSF (phenylmethylsulfonyl). fluoride) and 2.5% isopropanol. Cells were crushed by passing twice through a French Press at 20,000 psi. The suspension is centrifuged at 30,000 g for 30 minutes. The total protein concentration of the supernatant fluid (crude cell extract) was determined according to Lowry et al. Biol. Chem. 193, 265-275 (1951)] using bovine serum albumin as a standard. Presence of HBsAg using radioimmunoassay kit (AUSRIA II), available from Abbot Laboratories, North Chicago, Illinois, or using ELISA kit (Enzygnost-HBsAg micro)

- which is a commercial product of Behringwerke, Marburg, Federal Republic of Germany.

the/

The availability of the CS sequences in the HBsAg particles / immune reaction is tested by the ELISA mentioned above.

Appropriate dilutions of test samples (containing 0.2% BSA).

In PBS) was allowed to bind (overnight at room temperature) to solid-phase anti-HBsAg (Enzygnost kit). The knit f

The HBsAg particles were incubated for one hour at 37 ° C

105

Five Monoclonal Antibodies Against CS Protein JDame et al., Science, 225, 593-599 (1984), diluted 1/10000 (in PBS containing 0.1% BSA) as first antibody followed by biotinylated sheep with 1/500 dilution of anti-mouse Ig (Amersham) (in PBS containing 0.1% BSA) as the second antibody for one hour at 37 ° C. Detection is by incubation of streptavidin-biotinylated horseradish peroxidase complex (Amersham) at 1/1000 (in PBS containing 0.1% BSA) and chromogen from the Enzygnost kit for 30 minutes at 37 ° C. Between incubations, plates are washed four times with wash solution from the Enzygnost kit. Color development was measured at 510 nm in a Titertek Multiskan (Dynatech).

Measurement of protein concentration and AUSRIA activity (Table II) in crude cell extracts shows that pRIT12573 controls HBsAg expression at the same level as pRIT 12329. However, pRIT12574 exhibits ten times less AUSRIA activity. Immunoblot analysis of these extracts shows approximately the same amount of synthesized HBsAg-related protein in these three cases.

II. SPREADSHEET - AUSRIA activity is raw nor in jute extracts plasmid Gene Protein (mg / ml) HBsAg (RIA) (ng / ml) HBsAg ng / ml protein pRIT10172 - 5.6 0 0 pRIT12329 S 3.3 5700 1730 pRIT12573 CS (24bp) PreS2-S 3.6 4000. 1130 pRIT12574 CS (192bp) PreS2-S 2.8 450 160

• · · ···· ·· "·· · · · · · · · • · *« • · · · · · · · · · · · ···· · · · ··

- 106 The ELISA shows that there is a construct present in the extracts of pRIT12573 and pRIT12574 that expresses both HBsAg and CS epitopes (Table III) and that there are more reactive CS epitopes per epitope of HBsAg in the extracts of PRIT12574. in pRIT12573 extracts.

To test the nature of these RIA and ELISA positive constructs, 1 ml of crude cell extract was mixed with 1.5 M CsCl ₂ (50 mM Na phosphate, pH 7.4) and centrifuged at 40,000 g for 40 hours, Beckman SW50.1 rotor. The collected fractions were assayed for HBsAg and CS antibody binding activity by the RIA and ELISA methods described above. For HBsAg and CS antigenic activities, we find. to balance both the pRIT12573 and pRIT 12574 gradients. Their supernatant density is slightly higher (^ 1.20 g / cm ^) than the pRIT12329 supernatant density (= 1.18 g / cm ^) ·

Immunoblot analysis of gradient fractions confirms RIA / ELISA results. The HBsAg and / or CS sequences are only found in the fractions that react in the RIA / ELISA assays.

II. TABLE - HBsAg and CS epitopes present in immobilized anti-HBsAg antibody-bound antigen

Crude cell extract of the following: Dilution ELISA (HBsAg) 0D ₅₁₀ nm ELISA (CS) 0D ₅₁₀ nm 10S44C (pRIT10172) 100x 0,000 0,065

10S44C (pRIT12329) 100x 0.580 0,054 200x 0.341 0.041

• ♦ ··· ·· • · · «· · · · · · · · · · ·

107

400x 0.188 0,056 10S44C (PRIT12573) 100x 1,298 1,596 200x 1, 080 1,299 400x 0.702 0.898 800x 0.336 0.560 1600x 0.155 0.323 3200x 0,075 0.189 10S44C (PRIT12574) 1 OOx 0.662 1.678 200x 0.370 1, 506 400x 0.183 1,130 800x 0.079 .798 1600x 0,044 0.449 3200x 0.061 0,205

These results indicate that the hybrid protein produced by expression of pRIT12573 and pRIT12574 is assembled into particles similar to HBsAg particles during yeast synthesis. Particles produced by the expression of pRIT12573 and pRIT12574 carry the CS sequences on their outer portions, as demonstrated by their ability to react with CS antibodies. For pRIT12574, these CS sequences partially block the determinant availability of HBsAg in the RIA assay (this determinant being mainly responsible for AUSRIA activity).

Example 13

A, Purification of hybrid particles

Yeast strain 10S44C containing pRIT12574 prepared as described in Example 10 was purified by polyethylene glycol (PEG) 400 precipitation and ultra ···· ··· in AMICON DC.

- Concentrate on 108 filters, where the apparatus is equipped with a candle having an exclusion of 100,000 Daltons.

Further purification of the hybrid particles is carried out by methods known in the art, e.g. CsCl by centrifugation, hydroxyapatite chromatography and gel filtration.

The final purified preparation from cell extract of strain 10S44C containing pRIT12574 shows a major peak in the exclusion volume of an HPLC TSK-3000 column (LKB), which contains both HBsAg and CS antigenicity. SDS-polyacrylamide gel electrophoresis was described by Laemmli, Naturre, 227, 680 (1971), followed by silver staining by Wray et al., Anal. Biochem. 118, 197-203 (1981) shows a single major band with an estimated molecular weight of 37000 kd. Negative staining with uranyl acetate after electron microscopy shows particles of the same size and shape as the yeast-derived HBsAg.

B. Purification of Hybrid Particles

Crumbling yeast extracts were prepared on Dyno Mill equipment from washed yeast cells in the same weight with 50 mM sodium phosphate extraction buffer (pH 8.1) with 4 mM Titriplex III, 1% Tween20, 4 mM / 1 is supplemented with PMSF and 10% isopropanol.

Cell debris was removed by centrifugation at 11000 g for 90 minutes, 500 ml of centrifuged crude extract was adjusted to pH 7.2 with 1N acetic acid and stirred overnight at 4 ° C in the presence of 10 g colloidal silica (Aerosil 380 , Degussa). The suspension is then centrifuged at 3500 g for 1 hour and the pellet is washed three times for 15 minutes with 150 ml of 0.15 M NaCl, 2 mM.

·· · ·· * · · ·

109

PMSF and 5 mM EDTA. Finally, the Aerosil pellet was eluted with 250 ml of 10 mM pyrophosphate buffer (pH 9.5) containing 2% Tween20 at 37 ° C for 3 hours. To the desorption product, 1M CaCl2 solution was added dropwise to a final concentration of 30 mM CaCl2 and the pH was adjusted to 7. The solution was allowed to stand overnight at 4 ° C and centrifuged at 6500 g for 15 minutes. The supernatant was dialyzed against 2 x 5 l of 10 mM Tris-HCl (pH 7.1) at 4 ° C and then diluted four times with dialysis buffer.

After addition of 30 mM CaClg and 1 M NaCl, the diluted antigen solution adjusted to pH 7.1 was passed through a 150 mL Phenyl Sepharose FF column, which contained the same CaClg / NaCl Tris. balanced by a buffer with a flow rate of 30 cm / h. Subsequently, the column was washed until the equilibration buffer until the 0 ^ 280nm ^z é ^{r <reduced} 5R? And eluted with the same flow rate of 6 mol / l, 10 mmol / 1 Tris-HCl (pH 9) urea in.

Alternatively, the dialyzed and 4-fold diluted antigen solution is supplemented with 20% (NH 4 SO 2, pH 7) and passed through a 150 mL Phenyl Sepharose FF column containing 10 mM Tris-HCl ( pH 7.1) and equilibrated with a solution containing 20% (NH 2 SO 2) at a flow rate of 30 cm / h. After washing the column with equilibration buffer, the column was flushed with 10 mM Tris-HCl at the same flow rate. (pH 7.1).

Antigen-positive fractions were collected and finally centrifuged with one or two successive CsCl density gradients »

• · • • I »

At 4 ° C at 245,000 g for 65 hours. The Purified Hybrid • · ν · ·· · ··· · ·

110

The supernatant density of CS-HBsAg particles was 1.23

Example 14 Immunogenicity of hybrid particles

Contains pRIT12574 produced by the method of Example 13 ·

Hybrid particles purified from S. cerevisiae strain 10S44C are inoculated into laboratory animals, alone or with aluminum hydroxide as adjuvant, and co-workers:

Science, 228: 958-962 (1985)].

C57B1 / 6 mice (6-8 weeks old), guinea pigs and rabbits were immunized subcutaneously and intraperitoneally on days 0-21 and 49. Animals were bled on days 7, 28, 56, and 84. Blood was allowed to coagulate at 4 ° C overnight and sera were collected and stored at -70 ° C until use.

The rabbits, in 2 groups of 2 animals, receive 10 µg (g of hybrid CSHBsAg protein in 1.0 mL doses, with or without aluminum hydroxide) at each immunization. As a control, 2 rabbits are immunized with 10 µg of Heptavax B (Merek Sharpé & Dohme) using the same inoculation procedure Mice and guinea pigs receive groups of 5 animals and receive 1 or 5 µg of hybrid protein in 0.5 ml doses for each immunization.

To determine antibody responses, sera from mice are pooled per group, while guinea pig and rabbit sera are individually examined. Anti-CS antibody titers were determined by ELISA using R32tet32 recombinant CS protein as an antigen (see Young et al., Science, 228: 958-962 (1985)) · Anti-HBsAg titers

- 111 determined using the AUSAB kit (Abbot Laboratories) and WHO references.

Neither guinea pigs nor mice are developed. who responded to HBsAg despite repeated booster vaccination. In contrast, both animal species develop. and anti-CS antibodies, and these responses are enhanced by booster vaccinations. 1.0 absorbance was obtained by ELISA at 1600-fold (mice) and 9000-fold (guinea pigs) dilutions. The immunogenicity of the hybrid particles is not enhanced by adsorption to aluminum hydroxide.

In contrast, rabbits develop antibodies to both CS and HBsAg. Reciprocal titers at absorbance of 1.0 are between 800 and 3200 in the anti-CS ELISA. The anti-HBsAg titers obtained with the aluminum hydroxide adsorbed hybrid particles are between 4000 and 20000 ml / ml, while

6

Rabbits immunized with Heptavax give titers of 10-10 ml / ml.

Adsorption of hybrid particles on aluminum hydroxide increases the immune response.

All serum from mice, guinea pigs, and rabbits is highly responsive to the circumsporozoite precipitin reaction and all inhibit the sporozoite invasion of hepatoma cells in vitro (Joung et al., Science, 228, 958-962 (1985), J Table IV). . Both reactions indicate a protective immune response.

• ·> - 112 IV. TABLE CIRCULAR SPOROZOITOUS precipitin (CSP) reactivity and percentage inhibition of HepG2-A 16 hepatoma cell sporozoite invasion (% ISI)

Animal (s) CSP reactivity% ISI week after booster 2 (4+ 2+ 0) vaccination

Collected Mouse-

rums 14 9 2 91% Rabbit, N- 36 22 3 0 96% Guinea pig N - 1107 24 1 0 100%

CSP reactivity, shown in parentheses:

= no detectable reactivity

2+ = granular precipitation on the sporozoite surface

4+ = yarn-like fabric at the end of the sporozoite

Example 15 Preparation of a vaccine

An exemplary vaccine of the present invention is prepared as follows: For a 3% buffered aqueous solution of aluminum hydroxide (10 mM sodium phosphate, 150 mM NaCl, pH 6.8, sterilization by filtration), the present invention particles are added in a similar buffer to a final concentration of 100 µg / ml polypeptide and 0.5 mg / ml aluminum (A1 ⁺ ).

The pH was maintained at 6.8. The mixture was allowed to stand overnight at about 0 ° C. Thimerosal is added to a final concentration of 0.005%. The pH is checked and adjusted to 6.8 if necessary.

While the foregoing fully describes the invention and all preferred embodiments thereof, it should be understood that the present invention may be incorporated by reference herein. ·

The present invention is not limited to the embodiments described herein, but includes all modifications which are within the scope of the following claims.

EXAMPLES OF PRE S2 AND PRE S1-PRE S2 WHITE WITH YARN

It has now been discovered that the insertion of the Pre S2-S protein coding region of the present invention into a yeast expression vector results in the synthesis of particles resembling authentic 22nm HBsAg particles bearing a glycosylated Pre S2 protein on their surface. Previously, it has not been correctly reported that a yeast glycosylated product transformed with any portion of the HBV genome.

The following examples relate to the expression in yeast of glycosylated forms of proteins which contain, in addition to the S protein of hepatitis B surface antigen, the Pre S2 region. Proteins can be extracted and purified from yeast cells in the form of particles for use in human vaccines. The yeast Pre S1-Pre S2-S protein is also glycosylated and can also be extracted and purified from particles for use in vaccines against hepatitis B virus.

In view of the presence of glycosylation, the following should be noted:

1.) Examples 25 ·, 26, and 27 deal with concavalin A binding, tunicamycin activity, and sensitivity to Endo H. All of them demonstrate that the 33 Kd Pre S2-S protein species are glycosylated. thus, glycosylation has three independent

- 114 flax is proven by methods.

2.) The specificity of these reagents is generally as follows:

the. ) concanavalin A preferably binds to mannose residues;

b. ) tunicamycin inhibits all types of glycosylation that bind to asparagine via N-glycoside;

c. ) endoglycosidase H cleaves asparagine-bound multi-mannose / oligosaccharides, leaving a N-acetylglucosamine residue bound to asparagine.

3.) From the results of Examples 25, 26 and 27 and from the above (tunicamycin inhibition, sensitivity to Endo-H), it can be concluded that an N-linked oligosaccharide chain is present in the

Pre S2-S protein 33 Kd. which is a multi-mannose-containing type (based on its sensitivity to Endo-H). The observed change in molecular weight (about 3,000) after treatment with tunicamycin and digestion with Endo H indicates that the oligosaccharide structure is composed of about 10 sugar moieties. This corresponds to the size of an internal glycosylation in yeast. Thus, it is likely that only one site is glycosylated around the potential glycosylation sites of the Pre S2-S protein.

4.) The purification procedures described in Examples 28 and 29 all involve an affinity chromatography step based on the sugar moiety of the glycoprotein.

5.) The phenyl boronate is specific for the 1,2-cis-diol groups (2 adjacent OH groups are located sterically in the same direction).

6.) Lentil-derived Lentil Sepharose is glucose / mannose specific.

Example 16 Construction of pRIT12662 - Construction of an E. coli vector containing the Pre S2-S expression cassette (Figure 16).

PRIT12290 obtained as described in previous 3 · «

Plasmid 115 was modified by inserting a synthetic BamHI-EcoRI adapter fragment encoding the N-terminal amino acids of the Pre S2 region between the TDH3 promoter and the ARG3 terminator fragments. This installation is done as follows.

Plasmid pRIT12290 was digested with BamHI and EcoRI and dephosphorylated with alkaline phosphatase. 200 picomoles of the following phosphorylated synthetic adapter

Gin Trp Bam 5 ' GATC CAG TGG 3 ' Eco 3 ' GTC ACCTTAA 5 '

ligated with 0.1 picomoles of BamHI-EcoRI treated and dephosphorylated pRIT12290 using 1 unit of T4 ligase; the ligated product is used to transform E. coli strain MM294 with the ability to test for ampicillin resistance. A transformant that has incorporated the synthetic adapter between the BamHI and EcoRI sites was identified and maintained. The plasmid is called pRIT12621. Starting with plasmid pRIT12621, the next steps are to remove the four additional base pairs (the inner part of the BamHI site) in order to phase the ATG codon with the second codon of the Pre S2 region and insert an EcoRI fragment into the EcoRI site of pRIT12621 to complete the entire Pre S2-S coding region, wherein said Eco RI fragment contains the remainder of the Pre S2 coding region and the entire S coding region.

In this phase, DNA manipulations, including the sequential linearization, deletion and re-rounding of plasmid pRIT12621, are performed without amplification by transformation of intermediate plasmids.

picomol (120 µg) pRIT12621 DNA was linearized with 120 one116 BamHI. After removal of the restriction enzyme by phenol extraction, the plasmid is precipitated with ethanol and resuspended in appropriate buffer to digest the BamHI single strand ends with 280 units of mung bean nuclease. The nuclease was removed by phenolic extraction followed by ethanol precipitation. The plasmid so treated was resuspended in ligation buffer and reconstituted with 10 units of T4 ligase.

The preparation containing the ligated plasmid was extracted with phenol, precipitated with ethanol and resuspended in appropriate buffer and digested with Eco RI. After removal of the EcoR1 endonuclease, 0.05 picol (0.2 µg) of DNA was resuspended in phenol treatment and ethanol precipitation to 0.4 µg (0.2 µg) isolated from pRIT12581, 838 µg. ligated with a base pair EcoR1 fragment that contains the entire C-terminal coding region of the Pre-S2-S protein. A plasmid substantially similar to pRIT 12581 can be constructed as follows. The vector pUC9 (commercially available from Amersham and Pharmacia) was digested with EcoR1 endonuclease and treated with alkaline phosphatase (Shine, U.S. Patent No. 4,264,731). Plasmid pRIT10616 (ATCC 39131) is treated with EcoR1 and AccI restriction endonucleases and the 826 bp EcoRI-AccI fragment containing part of the Pre S2-S coding region is recovered by preparative acrylamide gel electrophoresis and electroelution. About 0.4 picomoles (0.2 µg) of this fragment is mixed with about 10 picomoles of synthetic adapter, which is the following 12 bp pre-assembled synthetic adapter described in Example 8 above:

• · · ·

Ile

Tyr Stop

ATACATTTAACG

117

3 '

Acc

Eco

3 '

TGTAAATTGCTTAA 5 'and the mixture were treated with T4 DNA ligase and digested with EcoRI restriction endonuclease. To the mixture so treated, about 0.2 Mg Eco RI digested and alkaline phosphatase treated pUC9 vector prepared as above was treated with T4 DNA ligase and then conventionally transformed into competent E. coli K1 2 cells. used with ampicillin resistance selection. Colonies from the transformants were assayed for the presence of a plasmid containing the 2650 bp pUC9 vector together with an 838 bp Eco RI fragment; this fragment consists of the 826 bp EcoRI-AccI Pre S2-S fragment and a 12 bp AccI-EcoRI synthetic linker. The correctness of the construct thus identified is confirmed by DNA sequence analysis using the Maxam and Gilbert chemical modification method (Methods in Enzymology 65: 499 (1980)), preferably from the unique flanking restriction site in the pUC9 polylinker.

A ligation mixture containing the pRIT12621 plasmid DNA treated as described above and the 838 bp EcoRI fragment of pRIT12581 was used to transform E. coli strain MM294 according to the method of Cohen et al., Supra. One of the transformants having a plasmid with the EcoRI fragment in the correct orientation is recovered, this plasmid.

- 118 dots identified as pRIT12662 (see Figures 1A and 16). Figure 1A is a flowchart illustrating the production of pRIT12662. Figure 16 is a restriction endonuclease map of pRIT12662. Sequence analysis of the Pre S2 region from pRIT12662 was performed by Maxam and Gilbert chemical modification (jTMethods in Enzymology 65: 499 (1980)) to verify that the coding reading frame at the N-terminal is as follows:

Met Gin Trp Asn Ser

AAAC AAAC AAA ATG CAG TGG AAT TCC pTDH3 Pre S2-S Encoding Area

Those skilled in the art will recognize that the vector pRIT12662 can also be used to introduce additional functional DNA sequences into the Pre S2 region by appropriate manipulation of vector DNA in vitro. The Pre S2 coding sequence contains restriction sites for EcoRI, PstI and BamHI endonucleases. Any of these sites can be used to introduce functional DNA sequences encoding the peptides of interest to generate an in-phase fusion with the Pre S2 region. Such fusions are of the Pre S2-introduced sequence-Pre S2-S type. These restriction sites can also be manipulated in vitro to generate additional vectors and provide additional sites or reading frames for insertion of functional DNA sequences, e.g. Botstein et al., 1985, Science 229: 1193-1201.

Example 17 Construction of the yeast plasmid pRIT12377 and pRIT12660 expressing the Pre S2-S protein

Plasmid pRIT12309 DNA obtained as described in Example 10 (B) was obtained as described in Example 10 (B). Φ φφ φ ♦ φφ φφ φ φ • * * φ φ φ φ φ ·

119 digested with SalI endonuclease and ligated with a 2218 bp Xhol-SalI DNA fragment containing the yeast LEU2 gene, the latter fragment obtained by digestion with YEp13 and purification of the fragment on an acrylamide gel. The ligated mixture was used to transform E. coli strain K12 JA1221, prepared according to the method of Cohen et al., Supra; the possibility of selection gave both ampicillin resistance and leucine independence. The strain JA221 was obtained from Rosenberg M. (Smith Kline and French Laboratories, Philadelphia, Pennsylvania, United States of America) and is also available from the American Type Strain Collection (ATCC) under accession number ATCC 33875. From one transformed colony, plasmid pRIT12377 was identified, which contains the 2218 bp LEU2 XhoI-SalI fragment inserted into the SalI site of pRIT12309.

The orientation of the fragment on the vector is such that the SalI site is restored to the Aval side of the pBR327 portion of the vector. Plasmid pRIT12377 is an E. coli yeast commuting vector that has the necessary functions for selection, replication and maintenance in both organisms.

The 3050 base pair HindIII fragment from pRIT12662 (Example 16) containing the Pre S2-S expressing cassette was purified by acrylamide gel electrophoresis, treated with T4 polymerase and ligated with pRIT12377, which had been previously opened with BamHI and T4. This composition is used to transform E. coli strain MM294 with the ability to select for ampicillin resistance according to Cohen et al., Supra. An E. coli transformant containing plasmid pRIT12660 was obtained. Figure 17 is a flowchart ···· ··· · · ····

- 120, showing how to make pRIT12660.

Plasmid pRIT12660 was used to transform two strains of S. cerevisiae, DC5 cir ° and 10S44C cir °, according to the method described by Hinnen et al., Proc. Natl. Acad. Sci. USA, 79, 2157-2161 (1978).

Both DC5 cir ° and 10S44C cir ° strains were deposited with the American Type Culture Collection (ATCC, Rockville, Maryland, United States) in accordance with the Budapest Treaty, August 18, 1986, ATCC 20820 and ATCC 20818 deposit numbers.

Example 18 Pre S2 region in plasmid pRIT12662

The Pre S2 region in plasmid pRIT12662 was subjected to sequence analysis by Maxam and Gilbert by chemical modification. Natl. Acad. Sci. 74, 560-564 (1977), and found that there are four base pair changes leading to three amino acid changes compared to another virus of the adw2 serotype (Valenzuela et al., 1980, Table I, line 11). .

Changes: Alanine residue at position -45 · instead of threonine residue; phenylalanine instead of leucine. site; and the serine residue instead of the isoleucine residue is represented by -11. site. The latter change affects a radical that has been found to be alternating in all known serotypes / Lo et al., Biochem. Biophys. Gap. Com.

2, 382-388 (1986) J.

EXAMPLE 19 Synthesis of Particle Carrier Receptors for Polymerized Human Serum Albumin (pHSA)

DC5 cir ° or 10S44C cir ° yeast strains (S. cerevisiae) containing either pRIT12660 or pRIT12363 (Example 16) were grown in selective medium ^ 200 ml YNB + 80 µl / ml ··· ♦ 99 ··· · Histidine (DC5 cir °) or YNB (10S44C cir °) J to the log phase. (PRIT12363 is identical to pRIT12660 except for the hepatitis gene: pRIT12363 contains only the S gene). Cells were harvested by centrifugation and resuspended in 50 mM sodium phosphate (pH 8.0) containing 0.5% Tween20 (polyethylene sorbitan monooleate), 1 mM PMSF (phenylmethylsulfonyl fluoride) and It also contains 2.5% isopropanol. Cells were crushed by passing twice through a French Press at 20,000 psi. The suspension is centrifuged at 30,000 g for 30 minutes. The total protein concentration of the supernatant fluid (crude cell extract) was measured according to Lowry et al. Biol. Chem. 193, 265-275 (1951)] using bovine serum albumin as a standard. The presence of HBsAg-related material was measured using a radioimmunoassay kit (AUSRIA II), a kit commercially available from Abbott Laboratories. The results (Table V) indicate that pRIT 12660 directs the synthesis of antigenicity-related material to HBsAg particles. The expression level based on the measurement of AUSRIA activity is approximately the same in both yeast strains DC5 cir ° and 10S44C cir °.

In a radioimmunoassay for the detection of a receptor for polymerized human serum albumin (pHSA). Pontisso et al., J. Virol. Methods, 6, 151-159 (1983)], crude cell extracts from cells containing pRIT12660 give a positive reaction, whereas crude cell extracts from cells containing pRIT12363 do not. Beyond the background, no reaction with the polymerized bovine serum albumin was observed.

···· ··· · · ·

·· · · · ·

-122 ··

CsClp equilibrium centrifugation of crude cell extract from cells containing pRIT12660 AUSRIA shows positive or yeast HBsAg particles. The material obtained from this portion of the gradient gives a positive result in the pHSA assay.

The above-mentioned results show that yeast cells containing pRIT 12660 express an HBsAg-related protein, assembled in a structure such as serum-derived 22 nm particles, and exhibit a receptor for pHSA on its surface.

VA. SPREADSHEET. AUSRIA activity in crude cell extract

Tribe plasmid Protein mg / ml HBsAg-related antigenicity, ng / ml HBsAg is associated with anti-genicity, ng / mg protein CD5 cir ° pRIT12660 13.4 7 522 DC5 cir ° PRIT1266O 12.6 7 555 10S44C cir ° pRIT12660 10.8 6 556 10S44C cir ° PRIT12660 9.5 6 631

Example 20 Four S-related proteins were found to be expressed in yeast transformed with pRIT12660

In order to analyze HBsAg _% protein monomers expressed in pRIT12660, cells were grown in selective medium or in an Erlenmeyer flask or fermentor to a hanging phase and harvested by centrifugation.

The harvested cells (0.1 g) were first 20 µg / 41 µM

PMSF (in isopropanol) was added followed by 200 / 4.1, SDS-polyacrylamide *

• · ··· »··· ············································

-1 23 sample buffer for gel electrophoresis [θ, 125 M TrisHCl (pH 6.8) containing 20% glycerol, 4% SDS, 6 M urea and 10% 2-mercaptoethanol. Samples were vortexed and 2-20 µL aliquots were further diluted with the above sample buffer to a final volume of 40 µL, incubated for 5 minutes at 100 ° C, and subjected to electrophoresis.

12.5% on a separator and 5% on a gel according to Laemmli [Nature, 227, 680 (1971)]

Electrical Spotting of Proteins [Towbin et al.

Proc. Natl. Acad. Sci. USA, 76, 4350-4354 (1979)] to a nitrocel lulose filter. (0.45 µm, BioRad), the filter is preincubated with 3% gelatin in PBS for one hour at 37 ° C. The filter is incubated with a monoclonal antibody of human origin

HBsAg is directed against an epitope resistant to denaturation and reduction. monoclonal obtained from Thomas H. (Royal Free Hospital, London, England) and antibody binding was detected by sequential incubation with biotinylated sheep anti-mouse Ig (RPN 1021, Amersham, 1 /). 250 dilutions in PBS containing 1% gelatin); steptavidin-biotinylated horseradish peroxidase complex (RPN 1051, Amersham ₍ 1/400 dilution in PBS containing 1% gelatin); and finally 50 µl PBS in 30 µg HgOg and 30 mg / l HRP Color Development reagent, -chloro-1-naphthol (BioRad), dissolved in 10 ml of methanol.

Wash with PBS containing 0.1% Tween20.

Immunoblot analysis shows 4 bands similar to the S protein with bands of approximately 33 Kd, 30 Kd, 28 Kd and 25 Kd, which are detected in white by the monoclonal antibody (p23). Most of the S protein-related material is in the 33K protein band

424 and is found to move slightly faster than the gp33 protein Tvirology described by Stibbe and Gerlich, 123,

W

436-442 (1982). The smallest detected protein band moves more slowly than yeast-synthesized S protein (p23).

Example 21 Four types of S-like protein (33 Kd, 30;

Kd, 28 Kd and 25 Kd) are composed of:

Crude cell extracts of yeast cells containing pRIT12660 (Example 16) were prepared as described in Example 19 or by grinding the yeast cells in Dynomill in the presence of an equal weight of extraction buffer (200 mM Tris, 3 M NaCl). 10 mM EDTA, 10 mM ethylene glycol bis (beta-aminoethyl ether) -N, Ν, Ν ', N' tetraacetic acid (EGTA), 4 mM PMSF, 10 zopr s, Adjust by centrifugation at 30,000 g for 45 minutes

The pRIT12660-directed particles are partially purified from the crude cell extract by ultrafiltration, CsCl equilibrium centrifugation, and hydroxyapatite chromatography, and are well known in the art. The four protein bands of S. protein-related material detected by Western blot analysis are purified together during these purification steps. Immunostaining for AUSRIA positive CsCl fractions after equilibrium centrifugation (as described in Example 20) shows that the four S-protein related bands are present in the same relative portion of each fraction.

The material is thus homogeneously distributed over the peak fractions of the gradient.

Example 22 The 33 Kd and 30 Kd proteins carry a receptor for polymerized human serum albumin.

- 125 -

Human serum albumin (Sigma, A 8763) is polymerized by glutaraldehyde treatment (Merek, A-12179) and purified according to Pontisso et al. Virol. Methods, 6, 151-159 (1973) J. The reactivity of the four S-related proteins was tested for pHSA by Western blotting. Partially purified formulations of pRIT12660-directed particles (Example 21) were separated by SDS polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane as described in Example 20. The nitrocellulose filter was incubated sequentially with pHSA (15 µg / ml in PBS containing 1% gelatin), rabbit antiserum to human albumin (Behringwerke, ORCB 04/05, 1/125 dilution in PBS containing 1% gelatin) biotinylated donkey with anti-rabbit Ig (Amersham RPN 1004, 1/250 dilution in PBS containing 1% gelatin) followed by streptavidin-biotinylated horseradish peroxidase (Amersham RPN 1051, 1/400 dilution in PBS containing 1% gelatin), and finally with HgO 2 and 4-chloro-1-naphthol as described in Example 20.

The two largest S-related protein bands (33 Kd and 30 Kd) react with pHSA, while the two smallest bands (28 Kd and 25 Kd) do not react.

Example 23 33 Kd and 30 Kd proteins contain a sequence specific for the Pre S2 region of the Pre S2-S protein.

A peptide corresponding to the 26 N-terminal amino acids of the Pre S2-S protein, containing 23 of the 26 sites, was synthesized (NHg-Met-Glu-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu). -Gln-AspPro-Arg-Val-Arg-Gly-Leu-Tyr-Leu-Pro-Ala-Gly-Cys-COOH) and coupled via the C-terminus to keyhole clamshemocyanin (Keyhole Limpet Hemocyanin, Peninsula Laboratories). Rabbits are immunized subcutaneously with 100 Mg conjugate (which corresponds to · · * · · · 9 · 99 · 9 · 999 • 9,999 · 9 ·······

126 peptides) in complete Freund's adjuvant, on days 8 and 15, additional 100 µg of conjugate in complete Freund's adjuvant was added on days 28, 69 and 149, 100 µl conjugate in PBS as a booster vaccine. The development of antibody titer is monitored by collecting blood samples at regular intervals and by examining serum dilutions by incubation on a solid phase fixed synthetic peptide. Bound antibodies are detected with Protein A protein (New England Nuclear). Sera with an anti-peptide titer greater than or equal to 1/5120 are selected for use in the immune blot. Serum is used after 100-fold dilution or after partial purification of IgG. Partial purification of IgG is accomplished by precipitation with NagSO4 (100 mg / ml serum), resuspended in PBS and re-precipitation with 14% NagSO4. The resuspended IgG solution was desalted by passing through a PD10 column (Pharmacia).

Detection of the reactivity of these antibodies to S-related proteins in immunoblot assays was performed with biotinylated donkey Ig, streptavidin-biotinylated horseradish peroxidase, and HgOg and 4-chloro-1-naphthol as described in Example 22.

Proteins were isolated from partially purified preparations of pRIT12660-directed particles (Example 21) by SDS polyacrylamide gel electrophoresis and transferred to nitrocellulose as described in Example 20. The gel is also run on protein S (p23), prepared from yeast purified particles containing pRIT12363. Immunoassay showed that the two largest S-related protein bands (33 Kd and 30 Kd) react with anti-peptide antibodies, while the two smallest bands (28 Kd and f * · ·

-, 127 25 Kd) does not react. The S protein (p23) does not react with anti-peptide antibodies.

Example 24 Human anti-hepatitis B antibodies obtained from naturally infected individuals recognize the epitope (s) present in the 33 Kd and 30 Kd Pre S2-S proteins which are not present in the S protein.

The reactivity of gamma globulin (Belgian Red Cross, 100-150 International Units / ml, Lot 85108) from anti-hepatitis B positive human patients was assayed against the four S-related proteins using the immuno-blot procedure described in Example 20. A partially purified preparation of pRIT12660-directed particles (Example 21) was dissociated with SDS and the proteins were separated by SDS polyacrylamide gel electrophoresis. After transfer of the proteins to nitrocellulose, the membrane was incubated with ten-fold dilution of anti-hepatitis B gamma globulin in PBS containing 1% gelatin. Antibody binding is detected by sequential incubation with biotinylated sheep anti-human Ig (Amersham RPN1003.1 / 250 dilution in PBS containing 1% gelatin) followed by streptavidin-biotinylated horseradish peroxidase and finally HgOg and

4-chloro-1-naphthol as described in Example 20.

The two largest S-related protein bands (33 Kd and 30 Kd bands) react with human antibodies, while the two smallest bands (28 Kd and 25 Kd bands) do not react. Particle S protein (p23) derived from particles derived from yeast cells containing pRIT12363 does not react with these human antibodies. These results show that gamma globulin from infected individuals specifically recognizes epitopes present on denatured and reduced Pre S2-S proteins that are not present on denatured and .128 reduced S proteins. It is known that the epitopes present on S proteins derived from human serum and yeast are largely identical in structure.

10.A Example 33 33 Kd protein species have a mannosyl-containing oligosaccharide structure.

Pre S2-S protein from partially purified preparations of particles derived from 10S44C cir ° cells containing pRIT12660 was electrophoretically isolated and transferred to nitrocellulose as described in Example 20. The gel was also run on protein S derived from yeast-purified particles containing pRIT12363 and from infected human serum (obtained from Dr. Gerlich W.H., Department of Medical Microbiology, University of Göttingen, Federal Republic of Germany).

One half of the nitrocellulose filter was incubated with 50 µg / ml concavalin A (Calbiochem grade A), where the material was 10 mM Tris pH 7.5, 150 mM NaCl, 1 mM CaCl t, is dissolved in a solution containing 1 mmol / 1 MnClg and 0.05% Tween 20, and 30 _(/ fg / ml were incubated with horseradish peroxidase (Sigma type VIP 8375), wherein the substance is 10 mmol / L Tris (pH 7.5), dissolved in a solution containing 150 mM NaCl and 0.05% Tween20, and finally incubated with HgOg and 4-chloro-1-naphthol as described in Example 20.

Between incubations, the filter was washed with a solution containing 10 mM Tris pH 7.5, 150 mM NaCl, and 0.05% Tween20 [Hawkes, Anal. Biochem. 127: 389-394 (1984)]. The other half of the nitrocellulose filter was incubated with monoclonal antibody 6 as described in Example 20.

The 33K protein is responsive to the concanavalin A-peroxidase reagent, while the 30 Kd, 28 Kd, 25 Kd protein bands or /

• · ·

- S protein from cells containing -129 pRIT12363 does not react. In the presence of 0.1 M methyl alpha-D-mannopyranoside, the binding of concanavalin A to the 33K protein is abolished.

the>

Example 26 Pligosaccharide structure N-glycosylated binds to asparagine.

Strains containing pRIT12660 and pRIT12377 (Example 17) were grown on selective medium to ΝΒυΝΒ + 80 g / ml histidine (DC5 cir °) or YNB (10S44C ΐΐτθ ^ΟϋΟϋ θ _nm = 0.2). Tunicamycin (Calbiochem) Up to a final concentration of 10 ng / ml and cultures were incubated for 30 min at 30 ° C.

Ci ^J> -S-methionine (1000 Ci / mmol; New England Nuclear) was added per ml and the cultures were incubated for an additional 15 minutes. 2 ml of labeled cell cultures, whether treated with tunicamycin or not, were centrifuged in a microcentrifuge and the pelleted cells were resuspended in 40 µl of 41% SDS and crushed with 0.3 g of glass beads (0.45-0, 2 ml) with a Vortex mixer. 50 mm diameter).

Immunoprecipitation was performed essentially as described by Julius et al., PCell, 36, 309-318 (1984). The lysate was heated at 100 ° C for 3 minutes, followed by 0.5 ml of 1% Triton100, 0.5% sodium diluted with PBS containing cholate and 0.1% SDS and re-heated for 1 minute at 100 ° C.

25 µl of a 10% suspension of pre-washed Immunoprecipitin (formalin-fixed Staphylococcus A cells, Bethesda Research Laboratories) was added to the boiled extract and incubated at 0 ° C for 30 minutes. The mixture was clarified by centrifugation for 5 minutes in a microcentrifuge. The supernatant liquid is 2.5

A monoclonal antibody, which is specific for S protein, is added to JA1 6, · ············· · ···

-130 (see Example 20) and the mixture was incubated for 1 hour at 0 ° C. The other portion (25/41) of Immunoprecipitin was then added and incubated for 30 minutes at 0 ° C. Immune complexes were collected by centrifugation (5 min in a microcentrifuge) and washed with PBS containing 2M urea followed by PBS containing 1% 2-mercaptoethanol and finally PBS. The last washed pellet was resuspended in sample buffer for electrophoresis, as in Example 20.

Samples containing cpm were subjected to electrophoresis

12.5% SDS on polyacrylamide gel (see Example 20). After electrophoresis, the gels were fixed with 10% acetic acid in 40% methanol, treated with Amplify (Amersham) for fluorography, dried on filter paper under vacuum and subjected to fluorography using a Kodak X-Omat S film at -70 ° C.

This indicates that cells containing pRIT12660 are single

Kd protein is synthesized in the absence of tunicamycin and one

Kd protein in the presence of tunicamycin. Both bands are missing in appropriate samples of cells belonging to pRIT12377.

These antecedents indicate that the 33 Kd Pre S2-S protein expressed in DC5 cir ° yeast strains carries an oligosaccharide moiety that binds to asparagine by an N-glycoside bond. Here, most likely, only one oligosaccharide chain is attached to the 33 Kd form of the Pre S2-S protein, which is not much larger than the internal glycosylation.

Example 27 Crude cell extracts from cells containing pRIT12660 containing many mannose-type oligosaccharide structures or partially purified preparations containing Pre S2-S containing particles derived from these extracts were treated with Strep, 1.31 · · · · · · · · Endo-N-acetylglucosaminidase from Tomyces plicatusb (Endo H.; EC.3 · 2.1.96), obtained from New England Nuclear.

Partially purified particles (50 ml, 450 µg / Mg / ml protein) are heated at 100 ° C for 3 minutes in the presence of 0.1% sodium dodecyl sulfate, diluted ten-fold with 100 mM sodium citrate (pH 5) and 240 ml of this mixture. / Al is added 2.4 / 11 Endo H. Samples with and without Endo H were incubated for 4 hours at 37 ° C. Analysis of the Endo H-treated and untreated samples by SDS-polyacrylamide gel electrophoresis and immunoblot detection using monoclonal antibody 6 against S protein, as described in Example 20, shows the disappearance of the 33 Kd band. and the appearance of a 31 Kd band following Endo H treatment. The 31 Kd band still reacts with the concanavalin A-peroxidase reagents described above. The remaining bands (30 Kd, 28 Kd and 25 Kd) show no shift in response to Endo H treatment. Longer incubation times and higher Endo H concentrations give the same results. The results show that the oligosaccharide structure attached to the 33 Kd protein is of many mannose type and has a degree of internal glycosylation.

Example 28 Purification of particles containing Pre S2-S protein

Crude yeast extract containing Pre S2-S particles is prepared by grinding the washed yeast cells in Dynomill with an equal mass of extraction buffer, or 50 mM sodium phosphate pH 9.0, 4 mM EDTA, 1, 0% Tween20, 4 mM PMSF and 10% isopropanol, or 200 mM TrisHCl (pH 9.0), 3.0 M NaCl, 10 mM EDTA, 10 mM EGTA.

-132 £ ethylene glycol bis.z- (beta) aminoethyl ether-N, Ν, Ν ', tet'-tetraacetic acid, 1% Tween20, 4 mM PMSF and 10% isopropanol.

The homogenate was adjusted to pH 8.0 and 9.0 and centrifuged at 30,000 g for 45 minutes.

To 500 ml of crude yeast extract, adjusted to pH 7.2, is added 10 g of colloidal silica (Aerosil 380, Degussa). The colloidal suspension was stirred overnight and then centrifuged at low speed. The Aerosil pellet was then washed three times with 150 mL of 0.15 M NaCl for 114 hours and eluted in 250 mL of 10 mM pyrophosphate buffer, pH 9.3, containing 2% Tween20, At 37 ° C for 3 hours. The desorption product, a yellowish slightly opalescent solution, was passed through a 50 mL phenylboronate agarose column (Amicon) equilibrated with 10 mM pyrophosphate buffer, pH 9.0. The flow rate was 15 mL / hr. The column was further washed with 2 column volumes of equilibration buffer and reverse-eluted with 100 mM sorbitol / 50 mM Tris pH 7.2 at 15 mL / hr.

The eluted peak fractions were collected and passed through a DEAE-Fractogel TSK column equilibrated in 50 mM Tris-HCl (pH 8.1) after adjusting to pH 8.1. The particles were eluted with the same buffer containing 75 mM NaCl. After this step, the remaining nucleic acids are removed (i.e. 1 µg / 20 µg protein). The mass balance is set out in Annex VI. Presents table.

133 • · »

VI. TABLE pre Contains S2-S particles two-step cleaning mg S-relative protein mg mg mg poly faction ml (RIA) protein lipid saccharide Raw extract 500 11.3 14600 5286 7850 From Aerosil, de- sorb 270 5.96 385 554 249 passes at PBA column 315 2.83 * 365 360 267 Killing the PBA column 70 2.8 2.9 5 2.5 * not sufficiently glycosylated, to stay behind az'oszlopon

Purified material from cell extracts containing pRIT12660 was prepared as described in Example 28 and subjected to CsCl equilibrium centrifugation to obtain a material for electron microscopy, staining with uranyl acetate prior to assay. The assay shows the presence of a discrete particle structure, such particles having a diameter of 19 microns and containing such hybrid particles 5-20 Tween20 per 100 µg protein.

Example 29 Affinity chromatography on Sepharose lens

In this example, the phenyl boronate agarose chromatography step is replaced by affinity chromatography on lentil Sepharose (Lentil Sepharose, Pharmacia).

50 ml of the Aerosil desorption product obtained as described in Example 28 was passed through a 5 ml Lentil Agarose column equilibrated with a weighting buffer, e.g. as follows: 10 mM Tris pH 7.2, 0.14 M NaCl and 0.3% Tween. The column is equilibrated with 2 column volumes of equilibration buffer, e.g. Wash with 10 mM Tris pH 7.2 and then wash with a sugar additive having a specificity for the lens, e.g. with 0.5 M alpha-methyl-mannopyranoside in equilibration buffer. The mass balance is given in Annex VII. This is shown in the table.

VII. Use of L encse Sepharose affinity chromatography for purification of Pre S2-S containing particles

Volume ^ ug S-relative Complete faction (Ml) white (RXA) protein Crude 100 2170 3g Aerosilről desorption 50 1700 1 38 mg Flowing through the lens Sepharose 50 428 - Elated with lens- Sepharose 12.5 925 1.26 mg

The assay reveals that the hybrid particles purified as described above contain 5-50 µg Tween20 / 100 µg protein.

Example 30 Immunogenicity of Pre S2-S Particle

The immunogenicity of particles prepared from extracts of cells containing pRIT12660 (Example 16) was studied in 2 mouse strains: Balb / c (H2 ~ d) and NMRI (H2 ~ Q). The particles are absorbed on AliOH) prior to injection and the mice (5 groups of mice • · · ·

(-135)) is injected intraperitoneally (IP) with 0.3 RIA reactant. One month after immunization, the mice are bled and the sera from the same group of mice are pooled. Anti-S antibody titers were determined in the pooled samples using AUSA / kit (Abbott Laboratories) and WHO standards. The titers were converted to milli-units / ml (ml / ml) using the Hollinger formula, THollinger et al.

companions: Viral Hepatitis c. pages 451-466 of the technical book; editors: Szmuness et al; Publisher: Franklin Institute Press, Philadelphia (1982) ^. Anti-Pre S2 antibodies were determined using a solid phase assay (RIA) in which the synthetic Pre S2 peptide of Example 23 was absorbed onto plastic and bound antibodies were detected with I-labeled goat anti-mouse IgG. VIII. The results summarized in the Table show that particles obtained from cells containing pRIT12660 induce both anti-S and anti-Pre-S2 peptide antibodies in both mouse strains, but higher anti-Pre-S2 peptide antibody titers are induced in NMR1 mice than in Balb / c mice. mice. The anti-S titer obtained in Balb / c or NMR1 mice is 2-3 times higher than the titer obtained with higher doses of particles from cells containing pRIT12363, where these cells do not contain the Pre-S2 sequence. Pre S determinants increase the response to S determinants. This enhancement effect is not demonstrated when the synthetic Pre S2 peptide is injected with particles lacking Pre S2. In addition, the Pre S2 synthetic peptide alone is not capable of inducing anti-Pre S2 antibodies.

This indicates that the combination of Pre S2 determinants and S determinants on the same particle is required for anti-Pre S2 determinants.136 • ♦ · · · · · · · · · · · · · · · · · • ····· ♦ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · In addition, this merger results in an improved anti-S response.

The results of the immunogenicity studies on Pre S2-S particles are reported in Table VIII. It is summarized in a table.

VIII. TABLE The Pre Immunogenicity of S2-S particle The injected S.rokon T i t e r e k preparation 'ant yes dose- Anti-S antibodies Anti Pre S2 was given ja (jHg) (D (MIU / ml) (2) bodies (3) Balb / c NMR1 Balb / c NMR1 by pRIT12363 controlled, sharp stem-derived S re- chaff 1, 7 1404 719 0 2 by pRIT12363 controlled, sharp stem-derived S-ré- granule + color- Tic Pre Pre-S2 pulp tid: O.Oe ^ g. 1, 55 748 1163 0 4 Synthetic Pre S2 peptide: 0.08. _P Yeast Pre S2-S controlled by RIT12660 - 2 1 0 4 particle 0.3 3344 2418 8 120

(1) Determined using the AUSRIA Kit (Abbott Laboratories) / · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

444444 4 · ··· · 4 4 4 ·. ··, using the recommended Proposed International Reference Preparation, available from Dr. Schild, National Institute of Biological Standardization, London.

(2) Determined using the AUSAB kit (Abbott Laboratories) using the WHO (World Health Organization) standard.

(3) Determined using solid phase radioimmunoassay and synthetic Pre S2 peptide adsorbed to plastic.

The titer is the dilution that gives a significant binding of the antibody (2.5 times the value obtained with the negative control serum).

EXAMPLES OF EXPRESSION OF THE WHOLE PRE S1-PRE S2-SIZE CODING SEQUENCE

Example 31 Construction of plasmid pRIT12845, which expresses the Pre S1-Pre S2-S protein in yeast.

The first step is the fusion of the TDH3 promoter region with the N-terminal region of Pre S1 from the HBV genome. The starting material is plasmid pRIT12792, which contains the 495 bp NcoI-XbaI fragment containing the Pre S1-Pre S2 coding sequence except for the last asparagine. The Ncol site overlaps the ATG codon of the -163 amino acid residue of the HBV Pre S1 sequence. The sequence of the Ncol-Xbal fragment is shown in Figure 4A. is shown.

A plasmid substantially similar to pRIT12792, designated pRIT 12793 (5940 bp), was deposited with the American Type Strain Collection (ATCC, Rockville, Maryland, United States) under the terms of the Budapest Treaty under accession number ATCC 67193, September 5, 1986. -I. A 495 bp Ncol-Xba I fragment was obtained from plasmid pRIT12793, which contains the col · · ······································································································································································· • · Λ ··· · ···

-138 a complete Pre S1-Pre S2 coding sequence. This fragment is one nucleotide different from the fragment shown in Figure 4A and has the ACGAACTAATAATCTAGA sequence at the 3 'end of the fragment. The nucleotide difference is underlined. In the following examples, pRIT12792 can be replaced by pRIT12793. The NcoI-XbaI fragment on both pRIT12792 and pRIT12793 is derived from in vitro manipulation of DNA from the Pre S1-Pre S2 region of the hepatitis B virus strain (adw serotype) cloned in plasmid pRIT10616.

Plasmid pRIT10616 is available from the American Type Strain Collection under accession number ATCC 39131.

pRIT12792 was digested with restriction enzymes Ncol and XbaI and treated with Mung bean nuclease to eliminate the 5 'overhangs. 600 ng (2 picomoles) of the treated and purified 495 bp Ncol-Xba I fragment was ligated to 170 ng (0.02 picomoles) of pRIT12314 vector, previously opened with BamHI and SmaI and treated with mung bean nuclease. PRIT12314 contains the entire 2 micron fragment from S. cerevisiae and an expression cassette in which the TDH3 promoter is separated from the ARG3 terminator by a BamHI-SmaI-EcoRI linker as follows:

BamHI EcoRI

Smal

ATGGATCCCCGGGAATTC

A more detailed description of the construction of pRIT123l4 is provided in Example 10 (B) above. The ligation mixture described above was used to transform E. coli MM294 with ampicillin resistance selectivity, Cohen et al., Supra.

- -139 quoted method. Six transformants containing a plasmid in which the Pre S1-Pre S2 fragment is inserted in the correct orientation are conserved. These are plasmids pRIT1 2843 (a .... f) (Figure 18).

The second step involves inserting the S coding region into the plasmids pRIT12843 (a .... f) described above to restore the entire Pre S1-S2-S gene.

This is done as follows. Plasmids pRIT12843 (a .... f) were digested individually with BamHI and SalI. The BamHI site is located at the beginning of the Pre S2 region, the BamHI site is located behind the ARG3 terminator in pBR327. 80 ng (0.012 mol) of the largest BamHI-SalI fragment (10400 bp) purified from each plasmid of pRIT12843 (a .... f) was ligated with 30 ng of the small BamHI-SalI fragment from pRIT12660 (Example 16). (0.11 pmol). The small (4800 bp) BamHI-SalI fragment of pRIT12660 contains part of the Pre S2-S coding sequence, followed by the ARG terminator sequences and the LEU2 yeast sequence. After ligation and each pRIT12843 (a .... f) Transformation of plasmids into E. coli MM294 Cohen et al, supra Mode ³² According ere obtained containing a series of ampicillin resistant plasmids named pRIT12845 (a .... f) clones . Figure 18 is a flowchart illustrating the production of pRIT12845 (a .... f). These plasmids pRIT12845 (a .... f) were used individually to transform S. cerevisiae 10S44C cir ° according to the method of Ito et al., Supra. Cultures grown from certain clones from yeast transformations are screened for crude cell extracts using a commercially available AUSRIA assay kit (Abbott). Raw Cell Extract ···· ··

-140 ··································································································································································· (4020 (4040) ót40 40ót ót40 ót40 ót40 ót40 ót40 ót4040 by preparing yeast cells resuspended in PBS containing 0.5% Tween20, 2 mM PMSF and% isopropanol. One transformant from each of the six different transformations (pRIT12845 (a... F)) was tested. Five of the six transformants tested positive for AUSRIA.

To examine, whether it is a correct size protein detected specify whether the AUSRIA with antigenicity, samples of the crude extracts described above was immunoblot procedure described in Example 20. The five over- Ausra positive transformants showed about four stone _z zul

K's S-relative's whites. One of the trans formans / the extract /

K shows S-related protein. As pRIT12845, we retain the yeast transformant which expresses the 39K protein present in extract e_.

Example 32 The Pre S1-Pre S2-S protein is assembled into particles that carry a polymerized human serum receptor and a Pre S1 epitope on their surface.

Crude cell extracts were prepared from the yeast strain 10S44 cir ° containing the plasmids pR1T12845, pRIT12660 or pRIT12377 and the DC5 cir ° yeast strain containing pRIT12363 as described in Example 19. Total protein concentrate

HBsAg-related antigenicity assay and detection of polymerized human serum albumin receptor. The result shows strong binding activity to the polymerized human serum albumin in extracts of 10S44C cir ° containing pRIT12843 and pRIT12660 (see also Example 10), but this activity is not present in the 10S44cir containing pRIT12377. Or in extracts from strains containing pRIT12363.

Contains pRIT12845 (described in Example 12)

.141

CsCl equilibrium centrifugation of crude cell extracts from 10S44C cir ° cells and measurement of HBsAg-related antigenicity by AUSRIA assay in CsCl fractions show that the antigen binds at ζ = 1.2 g / cnr. This is confirmed by immunoblot analysis of the CsCl fractions. Pre S1 antibody binding activity in the CsCl fractions was assayed by the ELISA assay described in Example 12. After allowing the antigen to bind to solid-phase anti-HBsAg, the bound antigen is incubated with MA18 / 7 monoclonal antibody (Example 31), which is then detected with biotinylated anti-mouse Ig, streptavidin-biotinylated horseradish peroxidase complex, and chromogen. as described in Example 12.

Pre S1 specific antibody binding activity is found to be balanced with HBsAg-related antigenicity with the CsCl gradient. These results indicate that Pre S1Pre S2-S protein produced in 10S44C cir ° cells containing pRIT 12845 is assembled in particles similar to serum-derived 22 nm HBsAg particles. The particles exhibit Pre S1 specific sequences as well as a receptor for polymerized human serum albumin. From the activity level of these particles, the AUSRIA assay and the intensity of the reaction of the Pre S1-Pre S2-S protein in immunoblot analysis lead to the conclusion that the S-determinants of the particle are partially inhibited or deformed by the presence of Pre S sequences in the particle.

Example 33 Two proteins of about 38 and 45 Kd, each carrying Pre S1, Pre S2, and S epitopes, are expressed in yeast transformed with pRIT12845.

Cellular Protein Migration and Immunoreactivity in Autumn ···· ··· · · · ···

142 was compared with proteins derived from human serum purified HBsAg particles (ad serotype) (where the serum was obtained from Dr. Gerlich W.H., Department of Medical Microbiology, University of Göttingen, Federal Republic of Germany).

Three immune reagents are used for protein analysis:

- monoclonal antibody recognizing epitope S (obtained from Thomas H. - Example 20);

a polyvalent rabbit antiserum raised against synthetic Pre S2 peptide (described in Example 23);

- MA18 / 7 monoclonal antibody specific for the Pre S1 epitope, described by Heermann et al. Virol. 52: 396-402 (1984)].

Immunoblot analysis shows that two proteins that specifically react with each of the three immunoreactors described above are present among cellular proteins derived from 10S44C cells containing pRIT12845. These two proteins are estimated to have molecular weights of about 38,000 and 45,000 daltons, respectively. Molecular weight estimation is based on protein migration from serum from HBsAg, as determined by Heerman et al., J. Virol. 52: 396-402 (1984)]. Controlled by pRIT12845,

The 38,000 Dalton Pre S1-Pre S2-S protein migrates slightly faster than the p39 Pre S1-Pre S2-S protein derived from HBsAg particles. The p39 protein from human serum type ad serotype particles is likely to have a 119 amino acid Pre S1 region. Heermann et al., J. Virol. 52, 396-402 (19Q4) J.

PRIT12845 encodes a 108 amino acid Pre S1 region.

Example 34 The 45 Kd protein of Pre S1-Pre S2-S carries an N-glycosidic bonded multimannose oligosaccharide chain.

*> »··« · • ·

- cells containing -143 pRIT12845 were disrupted with an equal weight of glass beads (0.45-0.50 mm diameter) in an equal weight of 10 mM sodium phosphate buffer, pH 7.4, containing 2% SDS. and 1 mM EDTA by mixing with Vortex mixer.

After centrifugation, the supernatant was heated at 100 ° C for 4 minutes.

The heated supernatant fluid was diluted with 10 µl (1 µl) of 40 µl of 25 mM sodium citrate buffer, pH 5.0 and 2 µl of Endo H (74 µg / ml) was added ( see Example 27. Samples were incubated with or without Endo H for 2.5 hours at 37 ° C.

Samples treated with Endo H and untreated were analyzed by SDS polyacrylamide gel electrophoresis and subjected to immunoblot analysis as described in Example 20.

The stain was analyzed with monoclonal antibody 6 (S-specific) and MA18 / 7 (Pre-S1-specific, see Example 33).

Immuno-blot analysis with both monoclonal antibody 6 and

MA18 / 7 shows the disappearance of the 45 Kd band and the appearance of a 41 Kd band following Endo H treatment with monoclonal antibody. THE

The migration of the Kd band is not affected by Endo H treatment.

These results indicate that the 45 kD Pre S1-Pre

S2-S protein is an N-glycosidic linker carrying many mannose-type oligosaccharide chains.

EXAMPLE 35 The 38 Kd Pre S1-Pre S2-S protein contains covalently bound myristic acid present in an amide bond.

Cells of the yeast strain 10S44C containing pRIT12845, pRIT12660 or pRIT12377 were grown in YNB medium44, 40 D to _{520 nm} .

ml of culture cells were labeled with 1 mCi of H-labeled myristic acid (New England Nuclear) for 60 minutes and harvested by centrifugation. Cells were washed with cold HgO, resuspended in 100 mL 5 mM Tris-HCl pH 7.4 containing 3 mM DTT, 1% SDS and 1 mM PMSF containing 100 mg of glass beads and crushed in a Vortex mixer by vigorously stirring six times for 30 seconds, cooling the mixture between ice-agitators. The sediment was a 1 minute Eppendorf 5414 centrifuge in Towler and Glaser, Proc. Natl. Acad. Sci. 83: 2812-2816 (1986). 20 ^ 1 of the extract

For 3.5 hours, at room temperature, it is treated with 7 µl of freshly prepared solution containing 4 M hydroxylamine and 20 mM glycine (pH 10).

Samples, whether or not treated with hydroxylamine, were subjected to SDS polyacrylamide gel electrophoresis and fluorography as described in Example 26. Samples untreated with hydroxylamine are also subjected to immunoblot analysis with a monoclonal antibody that recognizes an S-epitope, as described in Example 20.

Immunoblot analysis showed the same results as described in Examples 20 and 33.

Fluorography shows a 38 Kd labeled band, which is present only in cell extracts from cells containing pRIT12845, which is hydroxylamine stable, indicating that the 3Hmyristate label is present in the amide bond. A specific labeled band for cell extracts containing pRIT12660 could not be detected.

These results indicate that the 38 kD Pre S1-S2-S

-145 • t · · · · · · · · · · · · · · · · · · · · · · · 99 · -bonded. In general, myristates are covalently linked via an amide group to amino-terminal glycine. This suggests that the initiating Met was removed from the Pre S1-Pre S2-S protein and that the Gly residue at position 2 was made available for acylation with myristic acid.

Example 36 Use of Pre S1 vectors for inserting functional DNA coding sequences.

The starting material is the DNA of plasmid pRIT12793 described in Example 31 above. PRIT12793 contains the Pre S1-Pre S2 coding sequence on a 495 bp Ncol-Xba I fragment. Plasmid pRIT12793 DNA was digested with NcoI restriction endonuclease and treated with T4 DNA polymerase to fill in the sticky ends and treated with XbaI endonuclease. The Ncol / T4 DNA polymerase / Xbal fragment was purified by polyacrylamide gel electrophoresis and electroelution and inserted into pUC12 vector digested with SmaI and XbaI endonucleases. The pUC12 cloning vector is commercially available from Amersham (Little Chalfont, Bucks, United Kingdom) and Pharmacia (Piscawatay, New Jersey). Plasmid pRITX was obtained as described in Figure 5B. 4a. In the Pre S1-Pre S2 region of the pRITX plasmid, a unique NcoI site overlaps the ATG start codon of the Pre S1 region and an Xba I site is present downstream of the TAA stop codon at the C-terminus of the Pre S2 coding sequences. A unique BstX restriction site is present on the plasmid near the N-terminal end of the Pre S1 coding region.

Those skilled in the art will recognize that similar vector derivatives containing the pRITX vector or the Pre S1-S2 sequences can be used to introduce additional fragile-146 cationic DNA coding sequences encoding a given peptide by generating in-phase fusions in the Pre S1 region. inside, installing at the BstX location.

In addition, functional DNA coding sequences can also be inserted by digesting pRITX and its derivatives with combinations of BstX and BamHI or EcoRI or PstI endonucleases and inserting the functional DNA coding sequences between these sites, thereby removing the Pre S1 coding sequence. and the N-terminal portion of the Pre S2 sequence. Such fusion products are of the Pre S1-introduced functional DNA coding sequence-Pre S2. If such fusions are made, they may be recombined with other plasmids containing the residues of the Pre S1-Pre S2 sequences, as well as the sequences necessary for maintenance and replication in E. coli and S. cerevisiae, for which the sequence shown in FIG. example.

Example 37 Fusion of peptide derived from HTLV-III virus proteins to the Pre S2 region of the Pre S2-S sequences to form new hybrid particles.

The Pre S2 region of the HBV Pre S2-S coding sequence may also be used to insert or fuse peptide sequences of other viral antigens, e.g. viral antigens that cause human AIDS symptoms, such as retroviruses known as HIV, HTLV-III, or LAV.

The cloned genome of an HIV virus is described in Ratner, L., et al., (1985, Nature 313: 277-284, and in Shaw, G., et al., 1984, 226: 1165-1171). From these genomic clones, various sub-fragments can be obtained as functional DNA coding sequences corresponding to a particular peptide.

These regions can be fused to the Pre S2-S sequence to form new hybrid particles that contain epitopes of HIV viral proteins. Such hybrid particles can serve as a base for a human vaccine to protect against HIV infectious material.

The peptide regions in question may include:

the. ) Peptide 07. This area corresponds to a spacer region of 45 amino acid residues directly adjacent to the casing precursor site, as described by Starcich B.R. et al., Cell. 45, 637-648 (1986) J.

b. ) 121. peptide This region corresponds to a relatively conserved amino acid sequence present in a number of retroviral transmembrane envelope proteins [see Cionciolo G.J. et al., Science, 230: 453-455 (1985). This sequence is believed to be involved in the pathogenesis of retrovirus-induced immunosuppression rman R. and Cionciolo G.J., Immunol. Today, 5, 240 (1984) J.

c.3 Dreesman peptides. A synthetic peptide that is a

Corresponds to the amino acid sequence of the envelope glycoprotein of HIV precursor 735-752, was used by Kennedy R.C. et al., Science, 231: 1556-1559 (1986)] to immunize rabbits and use rabbit antiserum to test for recognition of HIV envelope proteins by induced antibodies.

The results suggest that this area may induce an immune response against the native glycoprotein.

A. Fusion of the DNA sequence corresponding to C7 peptide from HTLV-III isolate to the Pre S2-S region on pRIT10911.

The starting material is the cloned genome of the HIV isolate BH10 · ······ · ···

- plasmid pBH10-R2 containing 148. This plasmid was obtained from Gallo R.C. (National Institutes of Health, Bethesda, Maryland). The 3108 bp SalI-XhoI fragment of the virus-derived DNA, excised from pBH10R2, was cloned between the SalI and XhoI sites of pUC18 to create plasmid pRIT12901. A restriction map of this Sall-Xhol fragment is shown in Figure 1B. Plasmid pUC18 is described by Norrander J. et al., Gene, 26, 101-106 (1983) J and is commercially available as a product of Pharmacia Inc. (Piscataway, New Jersey).

To generate the fusion product, pRIT12901 DNA was digested with BglII and MboHendonucleases and the 117 bp fragment was isolated by acrylamide gel electrophoresis and electroelution (see Figure IB). The DNA of this fragment was treated with &lt; RTI ID = 0.0 &gt; Uung &lt; / RTI &gt; bean nuclease to remove single-stranded ends and ligated with pRIT10911 DNA (see above Example 5) previously digested with BamHI endonuclease. From this ligation mixture, plasmid pRIT12893 was isolated into which the 118 bp BglII-MboII fragment from pRIT12901 was inserted into pRIT10911. The nucleotide sequence of the mung bean nuclease-treated fragment located in the pRIT12893 along the 117 bp HTLV-III BglII-MboII fusion junction was determined; this indicates that 10 excess nucleotides were removed from the BglII end of the fragment.

The sequence found is as follows:

5 'ATGGAGGAGGAGATATGAGGGA 3', where the first underlined ATG codon is the ATG codon of the TDH3 promoter region from pRIT10911 and the second underlined ATG codon • · · ·

- 149 inside the C7 peptide fragment. The second ATG codon overlaps a TGA termination codon. This termination codon is in the same reading frame as the first ATG codon. DNA sequence determination of the 3 'end of the fusion region on pRIT12893 shows the correct sequence for in-phase fusion of the HTLV-III fragment with MboII and mung bean nuclease to the Pre S2 sequence on pRIT10911, as shown in Figure 2B.

The DNA of pRIT12893 was then digested with HindIII endonuclease and the 3250 bp fragment was isolated and purified by agarose gel electrophoresis and electroelution. The 3250 bp HindIII fragment is then inserted at the HindIII site of plasmid YEp13 to generate pRIT12894. Plasmid DNA is then used to transform cells of yeast strains DC5 and 10S44C, with leucine independence selectivity, by the method of Ito et al., Cited above in Example 10.

Transcription and translation of the C7-Pre S2-S fusion DNA in pRIT12894 results in the synthesis of a small 5-stranded peptide that begins at the TDH3 ATG codon and ends at the TGA codon underlined above and the C7-Pre S2-S fusion peptide. resulting in a second ATG codon within the 07 sequence. This fusion product contains 38 amino acid residues from C7 peptide instead of 45 residues from the intact C7 fragment treated with BglII, MboII and mung bean nuclease. It will be clearly recognized that other plasmids can be tested and sequenced from the same ligation mixture from which pRIT12893 is obtained to determine whether they carry the fusion product corresponding to the complete fragment.

· · · ····················································· ·

-.150 -

B. Fusion of DNA sequence corresponding to peptide 121 to the Pre S2-S region on pRIT 10911.

To construct the fusion product, the DNA of pRIT12901 (described in Part A above) was digested with Hhal and HindIII endonucleases to release the 1B. The 230 bp fragment shown in FIG. This fragment was purified by acrylamide gel electrophoresis and electroelution and treated with T4 DNA polymerase to fill the single-stranded overhangs. The fragment thus treated was ligated with pRIT10911 DNA, which had been previously treated with BamHI and mung bean nuclease. From this ligation mixture, plasmid pRIT12897 is recovered and identified, in which a 230 bp fragment of HIV DNA is inserted into a correct reading frame for fusion to the Pre S2 sequence of pRIT10911, as shown in Figure 3B. . The DNA of plasmid pRIT12897 was then digested with HindIII endonuclease and the 3365 bp fragment containing the TDH3 promoter, HIV-Pre S2-S fusion product and ARG3 terminator was purified by agarose gel electrophoresis and electroelution. This 3365 bp fragment was ligated into HindIII endonuclease digested YEp13 to form plasmid pRIT12898. The DNA of this plasmid (pRIT12898) was then used to transform yeast strains DC5 and 10S44C with leucine independence isolation as described in Ito et al., Supra.

C. Fusion of the DNA sequence corresponding to the Dreesman peptide to the Pre S2 region on pRIT10911.

A 60 bp synthetic DNA is synthesized conventionally as two single strands which are then soldered together, having the sequence:

• · • · • ··

5 'GATCTCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGA 3'

3 'AGCTGTCCGGGCTTCCTTATCTTCTTCTTCCACCTCTCTCT 5'

5 'GACAGAGACAGATCCCCG 3'

3 'CTGTCTCTGTCTAGGGGCCTAC 5'

This fragment has 5 'BglII and 3' BamHI single strand overhangs. About 200 ng double stranded fragments and

300 ng of BamHI-digested plasmid pRIT10911 DNA was mixed and ligated. From this ligation mixture, a plasmid, pRIT

12899 is identified and recovered, the 60 bp fragment on this plasmid is inserted at the BamHI site of pRIT10911 so as to generate an in-frame fusion as shown in Figure 4B. is shown. The pRIT12899 DNA was digested with HindIII endonuclease and the 3200 bp HindIII fragment was purified by agar gel gel electrophoresis and electroelution. This HindIII fragment was inserted at the HindIII site of YEp13 to generate plasmid pRIT12900. Plasmid pRIT12900 DNA is then used to transform cells of DC5 and 10S44C strains with leucine independence selectivity, as described in Example 10 above, by Ito et al.

Example 38 Expression of fusion proteins from pRIT12894 and pRIT12898

YEp13, pRIT12363, pRIT10912, pRIT12894 or pRIT

Yeast strains of 12898 containing DC5 or 10S44C were grown individually in leucine-free liquid medium (YNB + 80 / g / ml histidine, or YNB) and cellular proteins were analyzed by immunoblotting as first antibody in human as described in Example 11. using a monoclonal antibody directed against the epitope of HBsAg-derived HBsAg for denaturation and reduction. monoclonal antibody obtained from Thomas H. (Royal Free Hospital, London, England)]. PRIT12894 and pRIT12898 are described in Example 37 above. PRIT12363 carries the HBV S gene fused to the TDH3 promoter as the 2900 bp HindIII fragment from pRIT12322 (Example 8), inserted into a yeast vector plasmid identical to pRIT12377 (Example 10, Part B), and pRIT 12363. It produces HBsAg under the control of the TDH3 promoter.

Immunoblot analysis has an estimated molecular weight of about 32 kD

S shows a protein-related protein band between whole cellular proteins derived from the yeast strain DC5 or 10S44C transformed with pRIT12894. An approximately 45 kD S-protein-related protein band is present between whole cellular proteins derived from yeast DC5 or 10S44C strains containing pRIT12898, while an approximately 29 kD S-protein-related protein band is present in pRIT10912. between total cellular proteins from the yeast strain DC5.

The crude cell extract from the yeast strain DC5 containing pRIT12363, pRIT10912 or pRIT12894 was prepared as described in Example 12. Immunoblot analysis of these extracts is performed as described above.

CsCl equilibrium centrifugation of the crude cell extracts (as described in Example 12) and measurement of HBsAg-related antigenicity by AUSRIA in the CsCl fractions shows that the antigen binds at about § = 1.2 g / rrr. This is also confirmed by immunoblot analysis of the CsCl fractions.

These results show that the 32 kD fusion protein, produced in cells of the yeast strain DC5 carrying pRIT12894 .153, is assembled into particles similar to the 22nm HBsAg particles from human serum. From the activity level of these particles in the AUSRIA assay and the intensity of the reaction of the 32 kD protein in the immunoblot analysis, it can be concluded that the S determinants of the particles are partially inhibited or deformed by the presence of C7 sequences.

From these results, it can be concluded that cells of the yeast strains DC5 and 10S44C transformed with either pRIT12894 or pRIT12898 synthesize 32 kD and 45 kD fusion proteins, each bearing an S epitope.

Those skilled in the art will recognize that hybrid particles carrying HIV virus peptide epitopes can be extracted and purified in conventional manner from cultures of yeast cells transformed with pRIT12894, pRIT12898 or pRIT12900. Such purified particles can then be formulated as a vaccine for human use in the presence of adjuvants, e.g. Al (OH) 2 or AlPO 4. The preferred dosage is in the range of 1-1000 _v 4 (g protein) and can be determined by conventional experiments. It is also to be understood that other peptide regions derived from HIV virus proteins may be contemplated in the present invention by the HBV coding sequences. It can be fused to the Pre S2-S region to form hybrid particles that deliver the HIV epitope in question.

Claims (20)

1.) A method of producing a transformed eukaryotic host cell comprising transforming a eukaryotic host cell with a vector operably linked to a regulatory region, wherein the recombinant DNA molecule comprises a functional DNA coding sequence fused to a protein of HBV Pre S2. a portion of the Pre S2 region of a coding sequence, and wherein the functional DNA coding sequence further encodes a Plasmodium circum sporozoite (CS) protein or encodes a HIV envelope gene sequence, e.g. HVV C7 protein coding sequence, HVV peptide 121 protein coding sequence, or HVV Dreesman peptide coding sequence. 2. The method of claim 1, wherein the host is a yeast cell. 3. The method of claim 2, wherein the host belongs to the genus Saccharomyces. 4.) The method of claim 3, wherein the host belongs to the species Saccharomyces cerevisiae or Saccharomyces carlsbergiensis. 5. The method of claim 4, wherein the host is strain DC5, DC5 cir °, 10S44C or 10S44C cir °. 6.) A method for containing or providing a peptide encoded by a live animal functional DNA coding sequence comprising hybrid HBsAg protein comprising culturing an eukaryotic host cell transformed with a vector in an appropriate medium and extracting the cell lysate from a culture of such host cell. said vector is a vector which is a recombinant DNA moiety. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · - comprising 155 nucleotides operably linked to a regulatory region, wherein the recombinant DNA molecule comprises a functional DNA coding sequence fused in phase to a portion of the Pre S2 region of a HBV Pre S2-S protein coding sequence, and wherein the functional DNA coding sequence further encodes Plasmodium circumsporozoite (CS) protein or encodes a HIV envelope gene sequence, e.g. The HIVC7 protein coding sequence, the HVV 121 peptide protein coding sequence, or the HVV Dreesman peptide coding sequence. 7.) A method of producing a transformed host cell comprising transforming a host cell with the HBV Pre S1 protein coding region encoding the following amino acid sequence: -163 ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser With Pro Asn Pro Leu GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn. Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro Ile Lys asp His Trp CCA GCA GCC AAC € AG GTA GGA GTG GGA GCA Pro Alá Alá Asn Gin Val Gly Val Gly Alá • · * ··· ···········································• - 156 TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly GOTHIC ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TGG ACC ACA GTG TCA ACA ATT CCT Gly Ile Leu Thr Thr With Ser Thr Ile Pro CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin Below. 8.) The method of claim 7, wherein said region is contained in a recombinant DNA vector. 9. The method of claim 7, wherein the host is a yeast cell. 10. The method of claim 9, wherein the host belongs to the genus Saccharomyces. 11.) A method of producing a protein encoded by the Pre S1 protein coding region of claim 7, wherein said host cell transformed with said region is cultured in an appropriate medium and said protein is cultured in said host organism. 157 genes were isolated from cell lysates or extracts. 12.) A method for producing a transformed host cell comprising transforming a host cell with an HBV Pre S2 protein coding region or an HBV Pre S2 protein coding region, wherein the Pre S2 portion encodes the amino acid sequence of -55 to 50 Thr or Met-Gln-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp Pro-Arg-Val-Arg-Gly-Leu-Tyr-Phe-Pro-Ala-Gly-Gly-Ser-SerSer-20 Gly-Thr-Val-Asn-Pro-Ala-Pro-Asn-Ile-Ala-Ser-His-Ile-Ser-10 Ser-Ser-Ser-Ala-Arg-Thr-Gly-Asp-Pro-Val-Thr-Asn. 13. The method of claim 12, wherein said region comprises a recombinant DNA vector. 14. A method for producing a protein encoded by the Pre S2 or Pre S2-S protein coding region of claim 12, wherein the host cell transformed with said region is cultured in a suitable medium and the protein is isolated from a cell lysate or extract of a culture of such host. 15.) A method of producing particles encoded by the Pre S2-S protein coding region of claim 12, wherein said host cell transformed with said region is cultured in a suitable medium and said particles are such cells. «·· -158 «··· ·· cultured cell lysate or extract. 16.) A method for producing a transformed yeast host cell comprising transforming a yeast host cell with a recombinant DNA vector operably linked to a regulatory region of a Pre S1-Pre S2-S protein. 17.) A method for producing a protein encoded by the Pre S1-Pre S2-S protein coding sequence comprising culturing a yeast host cell transformed with a recombinant DNA vector encoding a Pre S1-Pre S2-S protein coding sequence linked to a regulatory sequence and culturing the protein in an appropriate medium. isolated from a cell lysate or extract of a culture of such a host. 18.) A method for producing particles comprising a protein encoded by the Pre S1-Pre S2-S protein coding sequence comprising culturing a yeast host cell transformed with a recombinant DNA vector containing a Pre & 1Pre S2-S protein coding sequence linked to a regulatory sequence in a suitable medium. isolated from a cell lysate or extract of a culture of such a host. 19.) A method for producing a transformed yeast host cell comprising transforming a yeast host cell with a recombinant DNA vector operably linked to a regulatory region of the Pre S1-Pre S2 protein: Pre S1 area -163 ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Gly Thr Asn Leu Ser Val Pro Asn Pro Leu · »·· --159 - GGA TTC TTT CCC DAM CAT CAG TTG GAC CCT Gly Phe Phe Pro asp His Gin Leu asp Pro GCA TTC GGA GCC AAC TCA AAC AAT CCA DAM below Phe Gly below Asn Ser Asn Asn Pro asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp asp Phe Asn Pro Ile Lys asp His Trp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro below below Asn Gin With Gly With Gly below TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gly Leu Thr Pro Pro His Gly X GGT AAT TTG GGG TGG AGC CCT CAG GCT CAG Gly Ile Leu Gly Trp Ser Pro Gin below Gin GGC OVER THE TTG ACC ACA GTG TCA ACA ATT CCT Gly Ile Leu Thr Thr With Ser Thr Ile Pro CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro below Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro Ile Ser Pro Pro Leu * · · · · · · · · · · · · · · · · · · 4 · «« -160 AGA GAC AGT CAT CCT CAG GCC Arg asp Ser His Pro Gin below pre Area S2 -55 ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA Met Gin Trp Asn Ser Thr below Phe His Gin GCT CTG CAG DAM CCC AGA GTC AGG GGT CTG below Leu Gin asp Pro Arg With Arg Gly Leu TAT TTT CCT GCT GGT GGC TCC AGT TCA GGA Tyr Phe Pro below Gly Gly Ser Ser SER Gly ACA GTA AAC CCT GCT CCG AAT ATT GCC TCT Thr With Asn Pro below Pro Asn Ile below Ser CAC OVER THE TCG TCA AGC TCC GCG AGG ACT GGG His Ile Ser Ser Ser Ser below Arg Thr Gly GAC CCT GTG ACG AAC asp Pro With Thr Asn. 20.) A method of producing a protein, comprising producing a protein corresponding to the Pre S1 Pre S2 protein coding region of claim 19.