DD274052A5 - Process for the preparation of recombinant Hbv, Hiv or Plasmodium surface proteins or hybrid particles - Google Patents

Abstract

The invention relates to a process for the production of recombinant surface proteins or hybrid particles of HBV, HIV or Plasmodium, in which one of an HBV, HIV or Plasmodium gene coding for the corresponding surface protein, or a part of the gene in the reading phase to the 3-end of at least part of the Pre S2 region of the HBV genome ligated, which part is so large that it codes for an immunogenic protein, this fusion DNA molecule to an expression control sequence of an expression vector, the resulting recombinant DNA Molecule einschleust in a eukaryotic host organism, zuechtet the resulting transformed host organism in a culture medium and isolated from the cell lysate or culture medium, the protein or the hybrid particle. Furthermore, the invention relates to a method for the preparation of vaccines for the prophylaxis of HBV, HIV or Plasmodium infections, wherein one of the proteins obtained by the above methods is used.

Description

Title of the invention:

Process for the preparation of recombinant HBV, HIV or Plasmodium surface proteins or hybrid particles

Field of application of the invention:

The application of the present invention is in the field of medicine for the prophylaxis of human HBV, HIV or Plasmodium infections.

Characteristic of the known state of the art: 26

A. Hepatitis B vaccines

Infection with hepatitis B virus (HBV) is a serious, widespread health problem. The infection can be acute or chronic = In the United States, the number of acute hepatitis cases is estimated to be at least 100 000 per year with a death rate of 1 - 2 % . As chronic carriers of HBV, between 0.1 and 1 % are classified among healthy adults depending on their age and social status. In South America about 1 to 3 % are considered, in the USSR and Southern Europe about 3 to 6 % and in Asia and Africa more than 10 % as chronic HBV carriers.

-2-

In developed countries, a vaccine is needed for people who are at increased risk of infection. Such are patients and personnel in medical facilities where blood comes into contact, military personnel, spouses of chronic HBV transmitters, travelers in HBV endemic areas, neonates of chronic HBV transmitters, homosexuals, prostitutes and drug addicts. Third world countries need a cheap vaccine to immunize a great many people. Finally, such immunization can not only reduce the number of acute hepatitis cases and chronic HBV transmitters, but also reduce the morbidity and mortality rate of chronic active hepatitis and hepatocellular carcinoma.

Dane particles that are thought to be virions for hepatitis B and the

Each particle consists of a shell containing the hepatitis B surface antigen (HBsAg), a capsid (HBcAg), an endogenous polymerase and a DNA genome. The genome is circular and double-stranded with a single-stranded region of about 200 bases. The single-stranded region can be made a double strand in vitro by the endogenous polymerase. The DNA genome contains about 3200 bases.

The production of HBV vaccines has long been difficult since the virus is difficult to replicate in tissue culture and only humans are known as hosts. In the laboratory, however, it is also possible to infect chimpanzees with the virus.

From Valenzuela et al. , Nature _2_98 (1982), 347-350., The expression of HBsAg in yeast is known. The coding sequence of HBsAg, an 8H5 base pair Taq1 -Hpa'i fragment, is placed under the control of the yeast alcohol dehydrogenase I promoter.

-3-

provided. This work was preceded by several short reports on research activities in this area. This includes the work of Valenzuela et al. , Arch. Biol. Med. Exp. (Chile), J_4 (1) (1981), 21-22, which discloses the expression of a DNA fragment in yeast encoding a protein similar to HBsAg. This DNA fragment is placed under the control of the yeast alcohol dehydrogenase I promoter. Further, it is known from a work in Scrip No. 616, p. 14 (Aug. 12, 1981), that a team of US scientists, including P. Valenzuela and WJ Rutter, make the production of the envelope protein of hepatitis B virus in yeast have announced. Zuckerman, Nature, 295 , (1982), 98-99, discloses that WJ Rutter has reported the expression of glycosylated HBsAg in yeast cells.

Antigenic components of HBV, such as HBsAg, have been reported to be produced in bacteria into which a recombinant DNA molecule containing a gene coding for the antigen has been introduced. Burrell et al., Nature, 2 79 , No. 5708 (1979), 43-47, discloses the expression of HBV DNA sequences in E. coli, strain HB101. These DNA sequences were cloned in the plasmid pBR322.

European Patent Application No. 13,282 discloses the production of a recombinant vector encoding HBV antigens such as HBsAg. The vector is prepared from the DNA of Dane particles and the plasmid pBR322 and is suitable for the transformation of E. coli strain HB101. The authors indicate that other bacterial cells, yeast and fungi, animal and plant cells and other hosts are to be understood as suitable hosts, although in this application only E. coli is used as the host system.

From Charnay et al. _t Nature, 286 (1980), 893-895, the construction of a bacteriophage is known that a fusion

gene from the β-galactosidase gene and the structural gene HBsAg contains. The bacteriophage results in the expression of a fusion protein containing the antigenic determinants of HBsAg and β-galactosidase.

British Patent Application No. 2 034 323 discloses the production of a phage containing HBV DNA. The E. coli strain C600 is transformed by this recombinant phage.

From GB Patent Application No. 2 070 621 a plasmid is known which has a part of the HBsAg gene, the promoter and the Z gene of the lactose operon and which has been cloned in E. coli.

European Patent Application No. 20,251 discloses recombinant vectors from the plasmid pBR322 and BamHI fragments of HBV DNA which can be used to transform E. coli. Other vectors containing a BamHI fragment of HBV DNA and part of the tryptophan operon were used to obtain expression in E. coli, strain HB101.

From Edman et al. , Nature, 291 , No. 5815. (1981), 503-506, the construction of plasmids is known which lead to the expression of HBcAg and a fusion protein from ß-lactamase HBsAg in E. coli. Expression occurs under control of the regulatory region of the tryptophan operon.

It is known from Pumpen et al., Gene (1984), 202-210, that low levels of HBsAg monomer and fusion proteins are synthesized in E. coli. Expression is detected by antibodies that react with the denatured HBsAg monomer.

Other literature citations in which the insertion of HBV DNA

Ι in bacteria are the following: Charnay et al., Progr. Med. Virol., 11 (1981), 88-92; MacKay et al. Proc Natl. Acad. Be. US 7Ό. ^No. 7 (1981), 4510-4514; Fritsch et al. , CR. Acad. Sci., 287, No. 16 (1978), 1453; U.K. Patent Application 2,034,323 (Derwent No., 46874C) and Pasek et al., Nature, 2, _2f . 6 (1979), 575.

HBV DNA has also been cloned in mammalian cells, namely human, mouse and human cells.

IQ liver tumor. From Dubois et al., Proc. Natl. Acad. Be. US, 21, No. 8 (1980), 4549-4553, is known, for example, the transformation of mouse cells with a plasmid containing the HBV genome. The expression of HBsAg is revealed; from Hirschman et al., Proc. Natl. Acad, Sei. US, 77 , No. 9 (1980), 5507-5511, discloses the production of HBV-like particles by HeLa cells transformed with HBV DNA.

From Funakoshi et al., Progr. Med. Virol., 27 (1981), 163-167, and Maupas et al., Progr. Med. Virol., 22 (1981), 185-201., Methods are known for using HBV HBsAg from human blood. Produce vaccines. The vaccine of Funakoshi et al. contains 40 μg of purified, formalin-treated HBsAg, phosphate, sodium chloride, 20 mg of mannitol and 0.1 % of aluminum hydroxide as adjuvant. From the work of Maupas et al. It is known that one dose of the vaccine was 1 ml containing 2 to 10 μg of purified formalin-treated HBsAg (determined by the method of Lowry) and 0.1 % of aluminum hydroxide. The Maupas et al. protocol used required three injections at intervals of one month with a booster vaccination after one year; the authors suggest two injections of concentrated HBsAg at intervals of three months.

_g5 Supplementary literature citations for the production of HBV vaccines are Maupas et al., Adamowicz et al. and Funakoshi et al.

or on pages 3, 37 and 57 of Hepatitis B Vaccine INSERM Symposium no. 18, edited by Maupas and Guesry, 1981, Elsevier / North Holland Biomedical Press.

Yeasts have been used as host organisms for the expression of certain DNA sequences. However, these sequences are not HBV DNA sequences. British Patent Application No. 2 068 969 discloses the production of chicken ovalbumin in yeast; From a work in Scrip Nr, 640, p. 11 (Nov. 4, 1981), it is known that an interferon type is produced in yeast. From the European godfather; No. 11,562 (Derwent No. 38762C) discloses hybrid yeast plasmids containing the ura * yeast gene in the 2 μ plasmid.

The natural hepatitis B virus surface antigen (HBsAg) can be isolated from plasma from infected individuals as a 22 nm particle. This particle consists of the two proteins, P24 and its glycosylated derivative GP28. Both proteins have 226 amino acids and are ^encoded by the ^{s gene of} the HBV genome. A 163 amino acid coding DNA sequence lying immediately before the coding sequence of the S protein on the HBV genome becomes pre-S coding Sequer.z denotes. A 55 amino acid coding DNA region of the pre S coding sequence, which lies immediately before the S protein coding sequence, is referred to as Pre S2 coding sequence. The coding for the remaining 108 amino acids DNA region of the Pre S coding sequence is referred to as Pre S1 coding sequence. The Pre S coding sequence, or any small

Part of it is also referred to as the DNA sequence coding for the HBsAg precursor protein.

The Pre S coding sequence of some HBV subtypes (e.g., ayw) comprises 163 codons, while it has 174 codons in other HBV subtypes (e.g., adw_). In any case, the Pre S2 region has 55 codons and lies just before the codec

-7-send sequence of the S-protein.

In the Pre S2 coding sequence is the binding or receptor site for polyalbumin found on the surface of Dane particles and on the surface of some HBsAg particles: i which are isolated from the serum of HBV-infected patients. Although the Pre S2 region lies just before the coding region of the S protein on the HBV genome, the Pro. S2 region not \ at the q together mensetzung of HBsAg particles involved; see. eg Persing et al. , Proc. Natl. Acad. Be. USA, 82: (1985), 3440-3444.

From Valenzuela et al., Nature, 298 (1982), 347-350, HBsAg-like particles are known that were found after digestion of yeast cells transformed with a vector containing the coding sequence of the protein. It was concluded that HBsAg particles are synthesized in yeast.

^From Harford et al., Developments in Biological Standardization, 1985, 125-13 (1983), HBsAg-like particles are known; which were found after digestion of transformed yeast cells. These cells were transformed with a vector containing a DNA sequence encoding 18 amino acids of ornithine carbamoyltransferase. This sequence was followed immediately at the 3 'end by a DNA region of the Pre S2 coding sequence which codes for 42 N-terminal amino acids and subsequently the coding region of the S protein.

3Q, Laub et al., J. Virology, 4JH1) (1983), 271-280, discloses the construction of a simian virus 40 vector in which the early region is encoded by a large portion of the HBV genome that encodes the pre SS protein Sequence contains, is replaced. This HBV DNA was expressed in SV40 transformed CV-1 cells (COS cells).

It is known from Stibbe et al., J. Virology, 4j [(2) (1983), 626-628, that GP33 and GP36 are present in low abundance of HBsAg glycoproteins encoded by the Pre S2-S protein coding sequence. Dev. Biol. Stand., 5_4 (1983), 33-34, it is known that HBsAg particles containing high levels of GP33 and GP36 do not contain higher antibody titers against the anti S protein than those HBsAg particles almost free of GP33 and GP36.

From Heerman et al., J. Virol., 5_2 (2) (1984), 396 - 402, it is known that the coding sequence of protein S and the pre S coding sequence coding for 389 amino acids for encode the polypeptide P39. This polypeptide is found together with the glycosylated form GP42 and the other HBV surface antigen-associated polypeptides P24, GP27, GP33 and GP36 in HBV particles and viral antigenic filaments.

Neurath et al., Science, 224 (1984). 392-394, it is known that polypeptides are immunogenic with the 26 amino-terminal amino acids of the Pre S2 coding sequence. It should be noted that antibodies to these polypeptides can be used for diagnostic assays.

From Michel et al., Proc. Natl. Acad. Be. USA, 81 (1,984), 7708-7712, discloses the expression of HBsAg, which carries receptors for the human serum polyalbumin, in Chinese hamster ovary cells (CHO). These cells were transfected with a plasmid encoding the pre S2-S protein.

gO rende sequence contains.

Persing et al., Proc. Natl. Acad. Be. USA, B2 (1985), 3440-3444, it is known that mouse L cells transformed with a Pre S2-S protein coding sequence express three HBsAg-related polypeptides (24, 27 and 35 kd). These polypeptides can become complex

2 7 4 O

-9 immunoreactive HBsAg particles of diameter.

22 nm, which bind polymerized human serum albumin (HSA); In contrast, mouse L cells transformed with a Pre S2-S coding sequence having a frame mutation at the 3 'end of the Pre S2 region can express only 24 and 2 "kd polypeptides that are too immunoreactive HBsAg particles with a diameter of 22 nm can be formed and can no longer bind HSA. Persing et al conclude that

jQ encodes the Pre S2-S protein coding sequence for a 35 kd polypeptide and that the Pre S2 protein is responsible for the HSA binding activity of HBsAg, but is not required for the composition and secretion of HBsAg particles; it is further concluded that the

2g in large quantities, the 24 kd polypeptide of HBsAg is not primarily obtained by cleavage of larger precursor proteins (namely the 27 or 35 kd peptides).

Milich et al., Science, 28 (1985) 1195-1199, discloses that vaccines containing HBV particles with Pre S2 and HBsAg in certain mice can prevent insensitivity that occurs when the vaccine is administered contains only HBsAg; the HBV particles used with Pre S2 and HBsAg were obtained from Chinese hamster ovary cells (CHO) transfected with a plasmid containing the Pre S2-S protein coding sequence. It is also known that the 26 amino acids are located at the aniinoterminus of the 33 kd polypeptide expressed by the Pre S2-S

protein coding sequence, represent a dominant antibody binding site in the pre 'S2 region.

Michel et al., "Vaccines 86", Brown et al., Ed., Cold Spring Harbor Laboratory (1986), 359-363, discloses the production of hepatitis B surface antigen particles containing the expression product of the Pre S2 region. described.

-10-

Neurath et al., Nature, 315 (1985), 154-156, discloses that the Pre S region encodes proteins of the HBV envelope which have domains that are specifically recognized by liver cells; the Pre S2-S protein coding sequence encodes a protein present in HBV particles;

synthetic peptides corresponding to the gene coding for Pre S proteins are immunogenic. Neurath et al. conclude that HBV vaccines should contain pre S determinants

 10

Valenzuela et al., Biotechnology, 2 (1985), 317-320, discloses expression of the entire Pre S2-S protein coding sequence in yeast; it is also known that this yeast cell. synthesize a particle with HBsAg and Pre S that is very similar to those containing only HBsAg in the electron microscope and in the sedimentation properties, and that the Pre S2 region does not interfere with the ability to form particles very similar to the 22 nm HBsAg particles Similarly, From Valenzuela et al.

Further, it is hypothesized that HBV enters the liver by binding the HBV polyalbumin receptor to hepatocytes by polyalbumin and thus ingesting the virus, and that the polyalbumin receptor of HBV is encoded by the Pre S2 region. Valenzuela concludes that a vaccine containing Pre S2 leads to the formation of antibodies that not only inactivate HBV via a normal mechanism, but may also interfere with liver uptake of the virus.

European Patent Application No. 171 008-A claims the production of non-glycosylated hepatitis B virus surface antigen P31 protein in yeast.

European Patent Application No. 174 444-A2 claims a method of preparation in yeast of HBsAg particles containing the P31 protein.

-11-

The following Table I compares the known amino acid sequences of the Pre S2 region with the HBV Pre S2 amino acid sequence of the present invention:

Table I

Comparison of the amino acid sequence of the Pre S2 region of different HBV serotypes

Pre S2 coding region

HBV sub-

Type -55 -50 -40 -30 -20 -10 Literature 0 quote 0 T L L T V TT P I AP I isoleucine 1 adw MQWNSTAFHQALQOPRVRGLYFPAGGSSSGTVNPAPNIASHISSSSARTGOPVTN Subject Pre S2 Co-ordinating Region T L L L T V TT P I AP leucine 2 adw S Abbreviations VLTT PL I AL tyrosine · 3 adw e K aspartate V TTT P I AL phenylalanine 4 adw P threonine IFS Histidine. 5 adw G serine He I S lysine 6 adr T A Glutamic acid Leu IFS I arginine 7 adr T C proline · Tyr IFS I tryptophan 8th ayw T V glycine Phe glutamine adyw H T M alanine · His I asparagine Amino acid- cysteine Lys L Asp Valin · bad Y Thr methionine Trp F Ser Gin H Glu Asn K. Per R Gly W Ala Q Cys N Val mead

-12- Quoted literature

1. Valenzuela ec al., In Animal. Virus Genetics (FieLd. Jaenisch and Fox eds), 57-70, Academic Press,

New York (1980).

2. Chow et al. Fourth Annual Congress for Recombinant DNA Research, San Diego, USA, 1984.

3. Fujisawa et al . Nucl. Acids Res. , VL (1983), 4601-4610.

4. Lo et al., Biochem Biophys. Res. Com. 2, (1986), 382-388.

5. Fujisawa et al. , a.O.

6. Ono et al., Nucl. Acid Res. , IJ, (1983), 1747-1757.

7. Galibert et al. Nature . 28JL. (1979), 646-650. 8. Pasek et al., Nature . 2_8_2 (1979), 575-579.

Malaria vaccines

Numerous recent works suggested that a more sensitive

Host can obtain sufficient immunity to the sporozoite of a single species of Plasmodium by producing its own antibodies against the circumsporozoide protein (CS protein) of the single sporozoite. 25

The DNA of sporozoite proteins from some types of Plp.s. , Modes have been cloned and some expressed using recombinant DNA techniques.

^ao From US patent 4,466,917 is described a as p-44? Sporozoite polypeptide known. Furthermore, the kionation and expression of its DNA in E. coli is known.

Sharma et al., Science, 228 (1985), 879-882, discloses expression of a portion of the CS protein of Plasmodium knowlesi in yeast. The expression vector used

-13-

contains the 5 'regulatory region of the yeast alcohol dehydrogenase I gene in place of the 5 ¹ "upstream" region of Plasmodium knowlesi CS gene.

WO84-02922-A discloses the cloning of a DNA region of a repeating protein subunit of the CS protein of P. knowlesi. Furthermore, the expression of this DNA fragment is known as a fusion protein with β-lactamase or β-galactosidase in E. coli

 10

WO84-02917-A discloses the cloning and expression in E. coli of a coding sequence of CS protein from the blood stage of P. falciparum.

From Dame et al., Science, 225 (1984), 593, the cloning and expression of the CS protein of P. falciparum in E. coli is known. The protein has about 412 amino acids and a molecular weight of about 44,000. It has 41 repeating units of a tetrapeptide. Synthetic peptides having 7, 11 or 15 amino acid residues of the repeating unit bind to monoclonal antibodies directed against the CS protein.

Ellis et al., Nature, 301 (1983), 536-538, discloses the expression of a fusion protein in E. coli from β-lactamase and P. knowlesi CS protein.

From Enea et al. Proc. Natl. Acad. Sci., USA, 81 (1984), 7520 7524,. For example, an analogous repeating structure is known in the CS protein of P. cynomolgi. Furthermore, the cloning and expression of the DNA of the CS protein in E. coli and its coding sequence is known.

From Ballou et al. , Science, 228 (1985), 996-999, it is known that synthetic peptides of the repeating structure of the CS protein of Plasmodium falciparum, which with

-14-

Bovine serum albumin (BSA) or thyroglobulin, leading to an antibody response in mice and rabbits. It was concluded that a vaccine against the sporozoite stage of the malaria parasite can be developed by binding synthetic peptides of the repeating structure of the CS protein with a carrier protein.

From Weber et al. , Molecular and Bacterial Parasitologi, 15 (1985), 305-316, it is known that a cloned gene of the CS protein of a Brazilian strain of P. falciparum can be used as a probe to study the structure of 17 other P. falciparum strains Analyze nucleic acid hybridization. It was concluded that the gene of the CS protein is highly conserved and that the development of a malaria vaccine with the CS protein is not likely to be complicated by stem variations. * becomes one.

From Arnot et al., Science, 230 (1985), 815-818, the cloning of the CS protein gene of P. vivaex and its coding sequence is known. As a result, the coding DNA sequence of the CS protein of P. vivax is homologous to that of the P. CS gene of P.knowlesi, but not homologous to that of P. f.ilc parum.

From Dharma et al., Science, 229 (1985), 779-782, the complete nucleotide sequence of the coding region of the CS gene is known from the Nuri strain of P. knowlesi.

Young et al., Science, 228 (1985), 958-962, discloses the 3Q expression of the P. falciparum CS protein in E. coli and its potential application in a human malaria vaccine.

WO84 / 02917 discloses the artificial production of poly-3g nucleotide sequences which comprise substantially all or part of the P. mRNA or genomic DNA.

-15-

falciparum, known. Further, the peptide corresponding to such a sequence and a method for its production is known, as well as an agent for immunoreacting against P. in a mammal containing such a peptide.

falciparum to stimulate antigens.

Mazier et al., Science, 2J31 (1986), 156-159, discloses that antibodies formed after immunization of mice with several recombinant and synthetic peptides of the P. falciparum CS protein are threefold protected in human liver cell culture before the parasite, namely, protection against adherence of the sporozoite to the liver cell surface before entry and subsequent intracellular development of the sporozoite.

C. Polyvalent vaccines

From Valenzuela et al., Biotechnology, 2 (1985), 323-327, it is known that the HBsAg polyalbumin receptor encoded by the Pre S2 coding sequence can be used for the production of polyvalent vaccines. From Valenzuela et al. It is also known that expression of the hybrid HSV-1gD-Pre S2-S protein coding sequence in yeast enables the production of a hybrid HBsAg herpes simplex 1 virus glycoprotein D (HSV-IgD) particle.

From Valenzuela, "Hepatitis B subunit vaccines using recombinant DNA Techniques", May 15, 1985, Bio-Expo-5 meeting, Boston Massachussetts, it is known that in a hybrid such as the HBsAg HSV-1gD particle described above, the immunological dominance of HBsAg against the foreign immunogenic polypeptide presented on the surface of the particle is compromised.

European Patent Application 0 175 261 discloses a novel hybrid polypeptide comprising at least a large part

-16-

hepatitis B surface antigen fused to one or more oligopeptides. The hybrid polypeptide is capable of forming in a cellular host a particle that presents at least one epitope of at least one oligopeptide.

Proteins can undergo post-translational modifications and some of these can fundamentally affect the conformation and function of the protein. Oligosaccharide chains on the human-derived Pre S1-Pre S2-S and Pre S2-S protein (Heerman et al., J. Virol., 5_2_. (1984), 396 - 402; Stibbe and Gerlich, Virology, 123 (1982), 436-442; Stibbe and Gerlich, J. Virol., 46 (1983), 626-628, and presumably the myristic acid on the Pre S1-Pre S2-S protein (Persing et al., Abstracts of papers presented at the 1986 meeting on Molecular Biology of Hepatitis B Viruses, 28/31/1886, Cold Spring Harbor Laboratory) could influence particle formation, the conformation of the proteins in the particles, and the antigenicity and immunogenicity of these particles.

Yeast (Saccharomyces cerevisiae) has the necessary enzymes to glycosylate proteins (Ballou "The Molecular Biology of the Yeast Saccharomyces, Metabolism and Gene Expression"; Strathern, Jones and Broach Ed., Cold Spring Harbor Laboratory (1982), 335). 360) and fatty acids (Towler and Glasler, Proc Natl Acad., Sei, 1986, 28, 282828, similar to higher eukaryotic cells.

Viral surface glycoproteins expressed in yeast are glycosylated. From Jabbar et al. Proc. Natl. Acad. Sci., 2 (1985), 2019-2023, it is known that expression of the hemagglutinin gene of Influenz.a in yeast resulted in a glycosylated hemagglutinin protein. From Wen and Schlesinger, Proc. Natl. Acad. See, £ 3_ (1986),

-17-

3639-3643, it is known that the expression of glycoproteins of Sindbis and vesicular stomatitis virus in yeast resulted in glycosylated viral proteins. From Fujisawa et al. (Abstracts of papers presented at the 1986 meeting on Molecular Biology of Hepatitis B Viruses, Aug. 28-31, 1986, Cold Spring Harbor Laboratory, p.62) it is known that the expression of the pre S2-S gene in yeast Synthesis of two glycosylated forms of the pre S2-S protein resulted. From Kniskern et al. (Abstracts of papers presented at the 1986

IQ Meeting on Modern Approaches to New Vaccines, Including Prevention of AIDS, 9-14. Sept. 1986, Cold Spring Harbor Laboratory, page 89), it is known that the expression of the Pre S1-Pre S2-S gene in yeast for the synthesis of two pre S1-Pre S2-S proteins with a size of 45 kd and 39 kd led. From Persing et al. (Abstracts of papers presented at the 1986 meeting on Molecular Biology of Hepatitis B Viruses, Aug. 28-31, 1986, Cold Spring Harbor Laboratory, page 19) it is known that the addition of ³ Η-labeled myristic acid to COS7- Cells expressing Pre S1-Pre S2-S, Pre S2-S ^{and <} 3 S-proteins resulted in radiolabelled Pre S1-5? Re S2-S protein.

Fusion proteins expressed in yeast and packaged in a particle are purified according to the general scheme: aerosilic adsorption and desorption (1) -> calcium chloride precipitation (2) -> phenylagarose or phenyl boron agarose adsorption and desorption (3) -> cesium chloride Gradient centrifugation or DEAE ion exchange chromatography.

Step 1 is known from EP-A 0 204 680 and step 3 from EP-A 0 199 698, as far as phenylagarosa is concerned. The specific combination of step 1 and step 3 makes it possible to separate contaminating material severely (elimination of 90 % protein, carbohydrates and 50 % lipids). This new combination enables a good functionality.

-18-kidney the next chromatographic steps.

In the case of fusion proteins that are glycosylated, phenylboronate (PI3A) is used as the affinity adsorbent. At pH 9, the boronate group forms covalent complexes with possible cis-diol groups on the glycosylated side chains. PBA gels have been used, if desired, to purify soluble glycoproteins but not to purify particles that have embedded glycoproteins in the lipid bilayer (see Cook et al., Analyticyl Biochemistry, 149 (1985), 349-535; et al., Biochemical Journal, 20 ° (1983), 771-779; Cook et al., Biochimica et Biophysica Acta, 828 (1985), 205-212; Maestasane et al., Journal of Chromatography, 189 (1980); 225-231 Since the particle contains many ligand binding sites, PBA gels with a very low PB ligand density must be used, eg PBA gels with a boronate content of <10 μg / ml gel, preferably 5 μg boronate per ml gel Use of very low borane content phenyl boronate gels allows affinity chromatography of particles containing glycoproteins embedded.

Aim and presentation of the essence of the invention

25

This invention relates to a recombinant DNA molecule containing a functional coding DNA sequence fused in readout phase to a portion of the Pre S2 region from a hepatitis B virus (HBV) Pre S2-S protein coding sequence. The term "coding, sequence" or "coding region" as used herein also includes any functional derivative thereof. By the term "functional derivative" is meant a coding sequence having amino acid modifications which, where appropriate, does not interfere with particle formation and / or maintain immunogenicity, if desired. Such a funccional derivative

-19-

can be prepared by the usual site-directed mutagenesis as described by Botstein et al., Science, 229 (1985), 1193-1201. In general, such a DNA molecule contains a regulatory region, preferably derived from the yeast arg ³ gene.

The invention also relates to a recombinant vector containing a recombinant DNA molecule operably linked to a regulatory region. The DNA molecule contains a

JO functional DNA coding sequence fused in read-out phase to a portion of the pre S2 region from an HBV Pre S2-S protein coding sequence. By the term "regulatory region" as used herein is meant a DNA sequence that has a promoter region and other necessary sequences.

^ g sequences for transcription and translation of a coding sequence.

The invention also relates to a eukaryotic host cell transformed by a recombinant vector containing a DNA molecule operably linked to a regulatory region. The DNA molecule contains a functional coding DNA sequence fused in read-out phase to a portion of the Pre S2 region from an HBV Pre S2-S protein coding sequence.

The invention also relates to a method of producing such a transformed host cell comprising transforming a eukaryotic host cell with such a recombinant vector.

The invention also relates to a process for the preparation

a hybrid HBsAg containing particle containing or presenting a peptide encoded by a functional coding DNA sequence. The method utilizes the j-culture of a eukaryotic host cell transformed by a recombinant vector in a suitable manner

-20-

Culture medium and the isolation of the particle from a lysate or extract of this host cell. The vector used contains a DNA molecule operatively linked to a regulatory region in which the functional coding DNA sequence is fused in read-out phase to part of the Pre S2 region from an HBV Pre S2-S protein coding sequence.

The invention also relates to a hybrid immunogenic particle containing hepatitis B virus surface antigen (HBsAg) which contains or presents a peptide encoded by a functional coding DNA sequence.

The invention also relates to a vaccine which contains an amount of such hybrid particles necessary for immune protection.

The invention also relates to a micelle containing such a hybrid particle and polysorbate and a vaccine containing an amount of such micelles necessary for immune protection.

By "functional DNA coding sequence" is meant a DNA coding sequence which does not participate in the composition of the HBsAg particle upon fusion in the reading phase with part of the Pre S2 region from an HBV Pre S2-S protein coding sequence and does not bother.

Preferred functional coding DNA sequences include, but are not limited to, (a) the entire HBV Pre S protein coding sequence or an immunogenic derivative thereof, such as the Pre SZ, Pre S1 or Pre S1 Pre S2 protein coding sequence and ( b) other immunogenic coding sequences, such as the coding sequence of the Plasmodium CS protein, or any immunogenic derivative thereof, the gene for the coat protein of HIV, or any one of them

-21-immunogenic derivative thereof, especially the coding sequence of the C ₇ peptide, the peptide 121 or the Dreesman peptide, or an immunogenic derivative thereof.

The invention also relates to an HBV Pre S1 protein coding region coding for the following amino acid sequence:

-163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met GIy Thr Asn Leu Ser VaI Pro Asn Pro Leu

GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pro Asp His Gin Leu Asp Pro

GCA TTC GGA GCC AAC TCA AAC AAT CCA GAT Ala Phe Gly Ala Asn Sec Asn Asn Pro Asp

TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp Asp Phe Asn Pro Lys Asp His Trp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro Ala Ala Asn Gin VaI GIy VaI GIy AIa

TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gli Leu Thr Pro Pro His GIy

GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly He Leu Gly Trp Ser Pro Gin Ala GIn

GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT

GIy He Leu Thr Thr VaI Sec The He Pro

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro AIa Ser Thr Asn Arg Gin Ser GIy

AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg GIn Pro Thr Pro He Ser Pro Pro Leu

AGA GAC AGT CAT CCT CAC GCC Arg Asp Ser His Pro Gin AIa

-22-

1 or an HBV Pre S2 protein coding region or an HBV Pre S2-S protein coding region in which the Pre S2 moiety codes for the following amino acid sequence:

-55 -50

Met-Gln-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp

-40 -30

Pro-Arg-Val-Arg-Gly-Leu-Tyr-Phe-Pro-Ala-Gly-Gly-Ser-Ser

Ser

-20 Gly-Thr-Val-Asn-Pro-Ala-Pro-Asn-Ile-Ala-Ser-His-Ile-Ser

-10 See-See-Ser-Ala-Arg-Thr-Gly-Asp-Pro-Val-Thr-Asn;

The invention also relates to a recombinant DNA vector in which such a Pre S1, Pre S2 or Pre S2-S protein coding region is operably linked to a regulatory region; a transformed host cell containing such a vector; a method of producing such a transformed cell which comprises transforming a host cell with such a vector; the protein encoded by such a coding region; a method for producing such a protein; a vaccine containing an amount of such protein necessary for immune protection, the particle encoded by a pre S2-S protein coding region; a method for producing such a particle, a vaccine containing an amount of such a particle necessary for immune protection, and a micelle containing such a particle and polysorbate, and a vaccine containing an amount of such micelles necessary for immune protection.

The invention also relates to a recombinant DNA vector in which a complete pre S1-Pre S2-S protein coding sequence or Pre S1-functional DNA coding sequence Pre S2-S protein coding sequence or an immunogenic derivative thereof with a regulatory region functionally

-23-

is bound; a yeast host cell transformed with such a vector; a method of producing such a transformed host which comprises transforming a yeast host cell with such a vector; a method of producing a protein encoded by the Pre S1-Pre S2-S proieincoding sequence or Pre S1-functional DNA coding sequence-Pre S2-S protein coding sequence, or an immunogenic derivative thereof; the protein produced by such a method; a vaccine containing an amount of such protein necessary for immune protection; a particle containing a polypeptide encoded by the Pre S1-Pre S2-S protein coding sequence or Pre S1-functional DNA coding sequence-Pre S2-S protein coding sequence, or an immunogenic derivative thereof; a process for its preparation, a vaccine containing an amount of such particles necessary for immune protection, a micelle containing such a particle and polysorbate, and a vaccine containing an amount of such micelles necessary for immune protection

The invention also relates to a Pre S1-Pre S2 protein coding sequence or Pre S1-Pre S2-S protein coding sequence, of which the Pre S1 Pre 32 region has the following amino acid sequence:

PRE- SL REGION -163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG OQ Met GIy Thr Asn Leu Ser VaI Pro Asn Pro Leu

GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pro Asp His Gin Leu Asp Pro

_Qc - GCA TTC GGA GCC! AAC TCA AAC AAT CCA GAT ob

AIa Phe GIy AIa Asn Ser Asn Asn Pro Asp

-24-

TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp Asp Phe Asn Pro Lys Asp His Trp

CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro Ala Ala Asn Gin VaI GIy VaI GIy Ala

TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gli Leu Thr Pro Pro His GIy

GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG GIy He Leu GIv Trp Ser Pro Gin Ala Gin

GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT

GIY He Leu Thr Thr VaI Ser Thr He Pro 15

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro Ala Ser Thr Asn Arg Gin Ser GIy

AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro He Ser Pro Pro Leu

AGA GAC AGT CAT CCT CAG GCC Arg Asp Ser His Pro Gin Ala

PRE-S2 REGION -55

ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA Met Gin Trp Asn Ser Thr Ala Phe His Gin

GCT CTG CAG GAT CCC AGA GTC AGG GGT CTG Ala Leu Gin Asp Pro Arg VaI Arg GIy Leu

TAT TTT CCT GCT GGT GGC TCC AGT TCA GGA Tyr Phe Pro Ala GIy GIy Ser Ser Ser GIy

ACA GTA AAC CCT GCT CCG AAT ATT GCC TCT Thr VaI Asn Pro AIa Pro Asn lie Ala Ser

-25-

CAC ATA TCG TCA AGC TCC GCG AGG ACT GGG His He Ser Sec Sen Ser Ala Arg Thr GIy

GAC CCT GTG ACG AAC

Asp Pro VaI Thr Asn

The invention also relates to a recombinant vector in which such a novel Pre S1-Pre S2 or Pre S1-Pre S2-S .protein coding sequence is operably linked to an expression control sequence; a host cell transformed with such a vector; a method of producing such a transformed host comprising transforming a host cell with such a vector; a procedure

g for the production of a protein encoded by such a Pre S1-Pre S2 or Pre S1-Pre S2-S protein coding sequence or an immunogenic derivative thereof; the protein produced by such a method; a vaccine containing an amount necessary for immune protection

2Q contains such protein; a particle which comprises a polypeptide encoded by such a Pre S1-Pre S2-S protein coding sequence, or an immunogenic derivative thereof; a process for its preparation, a vaccine containing an amount of such

Contains 2g particles and a micelle containing such a particle and polysorbate.

The following amino acid abbreviations are used:

Asp aspartate Ue isoleucine Thr threonine Leu leucine · Ser Secin Ty c Tycosin · Glu glutamic acid Phe phenylalanine Pco proline His histidine Gly glycine Lys lysine Ala alanine bad arginine Cys cysteine Trp tryptophan Va i valine Gin glutamine mead methionine Asn asparagine

FIG. 1 FIG. 2 FIG. 3 FIG. 4

FIG. 5 FIG. 6 FIG. 7 FIG. 8th

-26- Brief description of the figures:

is a restriction map of pRIT10601. is a restriction map of pRIT10616. is a restriction map of pMC200. is the nucleotide sequence of a region of the 3300 base pair yeast HindIII fragment integrated into pMC200 and having the Hindi, BglII and EcoRI restriction sites.

shows the preparation of pRIT10671 and pRIT10673. zei-yt the preparation of pRIT10749. shows the preparation of pRIT10761 and pRIT10764 shows the preparation of pRIT10167 (Example 1), PRIT10158 and pRit10162 (Example 3); pRIT10158, PRIT10677 and pRIT10909 (Example 4); pRIT10911 (Example 5); pRIT10679, pRITi0903, pRIT10914 (Example 6), PRIT12211, pRIT12209 and pRIT12230 (Example 7); and pRIT12288 and pRIT12322 (Example 8). Figure 9 shows a restriction map of pRIT10172.

Fig. 10 shows a restriction map of pRIT12290.

Figure 11 shows a restriction map of pRIT12322 showing the DNA regions derived from pRIT12230 and pRIT12288.

Fig. 12 shows the preparation of pRIf12571; pRIT12573; PRIT12572 and pRIT12574.

Fig. 13 is a restriction map of pRIT12309.

Fig. 14 shows the preparation of pRIT12314 and pRIT12544.

Fig. 15 shows the preparation of pRIT12658. Fig. 16 is a restriction map of pRIT12662.

Fig. 17 shows the preparation of pRITi2660.

Fig. 18 shows the preparation of pRIT12845 (a, b, c, d, e, f).

Fig. 1A shows the preparation of pRIT12662.

Fig. 2A shows a schematic restriction map of the clone / {. MPf 1 and a strategy for its sequencing.

-27-

Fig. 3A shows the nucleotide sequence of the CS protein gene of

P. falciparum

 Fig. 4A shows the Pre S1-Pre S2 included in pRIT12792

DNA coding sequence.

Fig. 1B shows a schematic restriction map of the coding sequence of the HIV envelope protein. Fig. 2B shows the construction of pRIT12893. Fig. 3B shows the construction of pRIT12897. Fig. 4B shows the construction of pRIT12899. Fig. SB shows the construction of pRITX.

D detailed description of the invention

Expression of HBsAg in yeast

By the term "regulatory region" as used herein is meant a DNA sequence containing necessary or desirable sequences for transcription and translation of a coding sequence. Such regulatory regions are typically seeded adjacent to the 5 'end of the coding sequence to be expressed. Preferably, another region of the yeast DNA containing a termination signal for transcription is placed immediately at the 3 'end of the coding region to be expressed to effect transcription initiation.

By the term "HBsAg" as used herein is meant an antigen comprising proteins expressed by the S-protein co-

QO dating sequence of the HBV genome are encoded. Such HBsAg is structurally similar to natural HBsAg or has substantially the same antigenic determinants as the natural HBsAg encoded by the S-protein coding sequence. Such HBsAg can stimulate an immune response that specifically recognizes and reacts with natural HBsAg. Such HBsAg is also specifically

-28 HBsAg antibodies detected.

The HBsAg coding sequence can be isolated from the DNA of Dane particles from the serum of infected human by reacting the single-stranded region of the DNA with a DNA polymerase, preferably the endogenous polymerase; is made to Doppelstrana and this is then cut with a restriction endonuclease. The choice of endonuclease depends, in part, on the individual Dane particles 3b. For example, the HBsAg coding sequence of the HBV DNA of certain adw serotype Dane particles can be isolated by a single BamHI fragment; the. HBsAg coding sequence of the HBV DNA of certain Dane particles of the ayw serotype kai.η be isolated by a Hhal fragment. HBV DNA from Dane particles of the same serotype may also have different restriction patterns.

The cleavage of DNA

The preparation of DNA fragments used in the method according to the invention, the ligation of such fragments into recombinant DNA molecules and the insertion of such recombinant DNA molecules into microorganisms is carried out in a manner known per se; see. the above or following references. Conditions are chosen to prevent denaturation of the DNA and enzymes. For example, the pH is adjusted to a range of 7 to 11 and the temperature is kept below 60 ⁰ C. Preferably, the restriction of the DNA at a temperature of 30 to 40 ⁰ C and the ligation at 0 to 10 ⁰ C is performed. Restriction enzymes and ligases used are commercially available and are used according to instructions. T4 DNA ligase is the preferred ligase.

The various fragments and the final constructions can be connected together in the usual way.

-29-

In many cases genes have been isolated, mapped by restriction enzymes and also sequenced. For this purpose, one may select the sequence of interest, such as the HBsAg sequence, by restriction of the gene and further manipulate, if necessary, such as Bal31 digestion, in vitro mutagenesis, primer-mediated repair or the like, to produce a fragment of desired size containing the desired sequence and having suitable ends. Linker and attachment fragments can be used to join sequences together and also replace lost sequences if a restriction site has been used within the region of interest. The various fragments that are isolated can be purified by electrophoresis, electroeluted, ligated with other sequences, cloned, reisolated, and further manipulated.

The use of regulatory regions to control the transcription of the structural gene of interest, such as the HBsAg sequence, allows, after the host cells have grown to a high density during which the structural gene has not or only little expression, by altering the surrounding Conditions eg of nutrient, temperature, etc., to induce the expression of the structural gene.

For example, with the GAL4 regulatory region, one can grow the yeast cells in a full medium with a combination of glycerol and lactic acid to a high density, namely the mid or late log phase, and then change the carbon source and offer galactose. With

r ·

The PHO5 regulatory region allows one to grow the cells in a medium with a high phosphate concentration of about 7 mM KH ₂ PO. grow, then harvest and resuspend in a phosphate-free medium to cause derepression and expression. With temperature sensitivity, the cells could be grown at 25 to 37 ° C and then

-30-

the temperature fits around. 5 to 2O ° C change. The host cells then have the regulatory system associated with the regulatory region.

The fusion of the HBsAg sequence with the regulatory region can be achieved using an intermediate vector. Alternatively, however, the HBsAg sequence can also be integrated directly into a vector containing the regulatory region. A vector is a DNA that can carry and maintain the DNA fragment of the invention, for example, a phage or a plasinide. Techniques for cloning DNA fragments into phage are known, for example, from Charnay et al., Nature , Vol. 286 (1980), 893-895, and British Patent Application 2,034,323. The HBsAg sequence is preferably linked to the regulatory region such that after expression of the HBsAg sequence, an HBsAg free from foreign amino acid residues results.

In one embodiment of the invention, the HBsAg coding sequence, together with 42 codons of DNA encoding the HBsAg precursor (PreS-S) protein, was ligated in read-out phase to the 18th codon of the yeast OCT protein coding sequence, which was under the control of arg ³ promoter stands. This construct yields a hybrid particle containing an HBsAg protein which in addition to the 226 amino acids of the S protein has an additional 60 N-terminal amino acids.

An example of a regulatory region is derived from the yeast arq ³ gene encoding ornithine carbamoyl transferase (OCT). The arg ³ regulatory region is responsible for specific and general control mechanisms. From Crabeel et al., Proc. Natl. Acad. Be. USA, 78 (1981), 6026, the cloning of this regulatory region in the plasmid pYeura ³ arg ³ in E. coli is known. Preferred hosts are strains of S. cerivisiae in which arginine biosynthesis is pre-premixed, for example strain 1c1697d.

-31-

The use of such strains leads to an increased expression by the arg ³ promoter compared to the strain DC5. Other useful regulatory regions are derived from yeast genes whose products are involved in glycolysis, for example, genes encoding enolase, aldolase, phosphoglycerate kinase, and glyeraldehyde-3-phosphate dehydrogenase; from the yeast alcohol dehydrogenase gene; and, in general, genes involved in catabolic metabolism, such as the arginase gene.

A preferred vector for cloning the fused DNA tag in yeast is plasmid YEp13, which is replicated and stable in E. coli and S. cerevisiae and therefore referred to as a shuttle vector. Several other yeast vectors are known and available. The HBsAg sequence and the regulatory region can be inserted in a yeast vector sequentially or simultaneously. Transformation of yeasts with plasmid vectors containing yeast-specific autonomously replicating sequences usually results in the extracellular replication of the DNA molecule of the invention like a plasmid. Such replicons are known in the art. Transformation with plasmid vectors containing no functional yeast replicons results in integration of the DNA molecule into the yeast genome.

Human vaccines for protection against HBV infection containing HBsAg produced in yeast according to the invention and having a suitable carrier can be prepared by known methods. The use of an adjuvant such as aluminum hydroxide or aluminum phosphate is desirable. The HsssAg so produced can also be combined with other immunogenic substances to make combination vaccines. The HBV vaccine or the combination vaccine can be administered, for example, subcutaneously, intravenously or intramuscularly. The DNA fragment of the invention and the HBsAg produced therefrom can also be used as a probe molecule or sample to detect HBV in biological

-32-

To detect samples by DNA hybridization techniques or in various immunoassays.

Expression of a DNA molecule containing a functional DNA sequence that is in read-out phase with part of the Pre S2 region from an HBV Pre S2-S protein coding sequence

f is used

This invention also relates to a recombinant DNA molecule containing a functional DNA sequence fused in read-out phase to a portion of the Pre S2 region from an HBV Pre S2-S protein coding sequence. The term "coding sequence" or "coding region" as used herein also includes any functional derivative thereof.

By the term "functional derivative" is meant a coding sequence having amino acid modifications that does not interfere with particle formation and / or maintain immunogenicity. Such functional derivatives can be prepared by the usual site-directed mutagenesis. Botstein et al., Science, 229 (1985), 1193-1201, discloses site-specific mutagenesis techniques. Such a fusion may occur at the N-terminus of the Pre S2 region or at some point within the Pre S2 region. There are four

<pc types of fusions, namely at the 5 'terminus of the entire Pre S2 region, at any point within the Pre' S2 region, so that the Pre S2 DNA flanks the functional DNA sequence on both sides, at the 5 ''terminal end of a truncated Pre S2 region or at the 5' terminus of the S protein

QQ coding region, so that the fusion contains no Pre S2 DNA. Several pre S2-S protein coding sequences are known and can be prepared and isolated by known methods (See the literature cited above.) In one embodiment of the invention, the ARG3 regulatory

g ₅ region together with 1 8 codons of the DNA coding for the yeast OCT protein in the reading phase with a shortened Pre S2-S pro-

-33-

teincodierenden sequence, which then contains 42 codons of Pre S2-S protein coding sequence together with the complete S-protein coding sequence. Preferred functional DNA sequences are the coding sequence of the circumsporozoic (CS) protein of Plasmodium or any immunogenic derivative thereof, the gene of the envelope protein of HIV or any immunogenic derivative thereof, especially the coding sequence of the C_ peptide, of peptide 121 or Dreesman peptide or any immunogenic derivative thereof and the Pre S2, Pre S1 or entire Pre SI-Pre S2-S protein coding sequence or any immunogenic derivative thereof. A preferred functional DNA sequence is the first 13 N-terminal codons of the Pre S2 coding sequence, which are then fused to the 42 C-terminal codons of a truncated Pre S2 region from a Pre S2-S protein coding sequence. By the term "immunogenic derivative" is meant a sequence which is a derivative or modified version of a naturally occurring sequence and which retains or enhances the protective immunogenic activity of the natural sequence. Such immunogenic derivatives can be prepared by conventional methods. The term "Pre S2, Pre S1 or the entire Pre S1-Pre S2-S protein coding sequence" as used herein includes any immunogenic derivative thereof.

By the term "circumsporozoides (CS) protein of plasmodium" is meant the immunologically dominant surface antigen of the sporozoite of Plasmodium or any immunogenic derivative thereof. Useful circumsporozoide

(CS) Proteins include, in particular, those derived from Plasmodium falciparum, P. vivax, P. ovale and P. malaria *. P. falciparum, P. vivax, P. ovale and P. malariae infect humans.

From Dame et al., Science, 225 (1984), 593-599, the CS is

-34-

protein coding sequence of Plasmodium falciparum known. From Arnot et al., Science, 230 (1985), 815-818, the CS protein coding sequence of P. vivax is known. From Sharma et al., Science, 229 (1985), 779-782, the CS protein coding sequence of P. knowlesi is known. From Enea et al., Proc. Natl. Acad. Be. USA, 8j (1984), 7520-7524, the CS protein coding sequence of P. cynomolgi is known. The CS protein coding sequences of other species of Plasmodium are known (see the literature cited above) and / or can be obtained by conventional methods.

The terms "CSP" or "CS protein" include Plasmodium's natural, normal sized circumsporozoide protein and also any immunogenic derivative thereof. By the term "immunogenic derivative" of the circumsporozoic protein of Plasmodium is meant (a) any derivative of the circumsporozoic protein of Plasmodium which retains the protective immunogenic activity, or (b) any protein derived from a modified coding sequence of the circumsporozoic protein derived from Plasmodium, which retains protective immunogenic activity. Such immunogenic derivatives can be prepared by conventional methods. From Ballou et al., Science, 228 (1985), 996-999, some immunogenic synthetic derivatives of the CS protein coding sequence of P. falciparum are known; see. also Mazier et al., Science, 231 (1986), 156-159.

The CS coding sequence of various Plasmodium species is known and can be prepared or isolated by known methods [cf. for example, WO84-02922-A (P. knowlesi CS protein) and Dame et al., Science, 225 (1984), 593 (P. falciparum CS protein)]. A DNA molecule in which the CS coding sequence or any functional DNA sequence is fused in read-out phase to a part of the Pre S2 region from an HBV Pre S2-S protein coding sequence can be prepared by known methods.

-35-

such as by ligation of the CS coding sequence or any other functional DNA sequence in read-out phase with any codon of the 55 amino acid coding Pre 32 coding region from a Pre S2-S protein coding sequence.

Preferably, after ligation with the CS coding sequence or other functional DNA sequence, a sufficient portion of the Pre S2 coding sequence remains to optimally present the CS protein or any other functional protein on the HBsAg particle surface. Namely, a sufficient portion of the Pre S2 region should remain so that the polypeptide encoded by the Pre S2 region can act as a bridge between the product encoded by the functional DNA sequence and the HBsAg particle surface. For example, Milich et al., Science, 228 (1985), 1195-1199, discloses that the 26 amino-terminal amino acids of the Pre S2 coding sequence represent a dominant antibody binding site on the Pre S2 region.

When it is desired to produce a hybrid particle containing or presenting the epitopes of Pre S2 and CS, or another functional DNA sequence, one should preferably at one point within the CS coding sequence or any other functional DNA sequence insert the Pre S2 coding region that allows production of a hybrid particle containing or presenting the epitopes of Pre S2 and CS or other functional DNA sequence.

The recombinant vector used in the method of the invention contains the recombinant DNA molecule (namely, a functional DNA sequence fused in readout phase to a portion of the Pre S2 region from an HBV Pre S2-S protein coding sequence) operably linked to a regulatory region. Such a vector may additionally have a functional yeast replicon. With the expression "replicon"

-36-

is meant the smallest DNA region that contributes to the extra-chromosomal stability of such a recombinant vector in a yeast host organism. Such replicons are known. By the term "regulatory region" is meant any DNA region that regulates the transcription and translation of the DNA sequence to be expressed. Such regulatory regions are also known.

Such a vector may be prepared by conventional methods, such as by inserting the DNA molecule of the invention into a reading phase into a vector already containing a replicon of a regulatory region. The insertion occurs in such a way that the DNA molecule is operably linked to such a regulatory region. The DNA molecule is preferably ligated into a vector capable of expression in the yeast genus Saccharomyces.

The invention also relates to a yeast host cell transformed by such a recombinant vector and a method for producing such a transformed host which comprises transforming a yeast host cell with the recombinant vector. Such a transformation is carried out in a manner known per se. Suitable yeast cells are those of the genus Saccharomyces, the cells of the species Sö-.Ccharomyces cereviöiae and Saccharomyces carlsbergensis are particularly suitable.

The invention also relates to a method for producing a hybrid HBsAg protein-containing particle containing or presenting the product of the functional DNA sequence. Such a method comprises culturing the transformed yeast host cells in a suitable culture medium and isolating the particle from a cell lysate or extract of these host cells. With the

-37-

By "presented or containing" is meant that the protein encoded by the functional DNA sequence is contained in the hybrid HBsAg protein-containing particle so that it can stimulate an immune response. If desired, presentation of the protein encoded by the functional DNA sequence will not interfere with the immunogenic activity of the HBsAg epitopes, thereby yielding a divalent vaccine. Most preferably, the protein encoded by the functional DNA sequence is presented on an HBsAg particle in such a way that either the maximum number of epitopes of the protein encoded by the functional DNA sequence or the maximum number of epitopes of the protein represented by the functional DNA sequence Sequence coded protein and the HBsAg protein is exposed as appropriate. By the term "suitable culture medium" is meant a drug that allows growth of the transformed host and allows such a host to express the product of the hybrid DNA fragment contained in the vector used for transformation in a repeatable amount. This hybrid DNA fragment is a fusion product of the functional DNA sequence and the Pre S2-S protein coding sequence. One skilled in the art will appreciate that the appropriate culture medium is dependent on the host cell used. The isolation of the hybrid particle of the invention from a cell lysate or extract of such a host cell can be accomplished by conventional protein isolation techniques.

The invention also relates to a vaccine containing the hybrid particles of this invention. Such a vaccine will contain an amount of hybrid particles of the invention necessary for immune protection and can be prepared by conventional methods. By the term "immunoprotective" is meant that the hybrid particles of this invention are administered in sufficient quantity so as to achieve a sufficient antibody response to the agent

-38-

which contributes to the protection and has no serious side effects. Preferably, the vaccine of the invention contains the micelles of the invention, namely micelles containing the particle of the invention and polysorbate. The preferred amount of polysorbate in such a micelle is 5 to 50 μg of polysorbate per 100 μg of protein. The micelle can be prepared by the process described in EP-A 0 199 698.

In the vaccine of the invention, an aqueous solution of the hybrid particles of the invention may preferably be used directly at a physiological pH. Alternatively, the particle can be taken up with any of the known adjuvants. Such adjuvants include, but are not limited to, aluminum hydroxide.

From Vaccines New Trends and Developments, edited by Voller et al., University Park Press, Baltimore, Maryland, USA, 1978, the production of vaccines is generally known.

The amount of hybrid particle of the invention is limited in each dose of vaccine to an amount that induces a response necessary for immune protection in typical vaccines without causing serious side effects. Such an amount depends on which specific immunogen is used and whether an adjuvant is added. In general, it is expected that each dose will contain from 1 to 1000 μg of protein, preferably from 1 to 200 μg of protein. An optimal

₃ Q amount for a particular vaccine can be determined by standard assays including monitoring of antibody titer and other responses in the patient. After a first vaccination, patients will preferably receive another vaccine after four weeks.

"P. Administration / one more every six months, as long as there is a risk of infection.

-39-

The immune response to the hybrid particle of the invention can be increased by the use of an adjuvant, such as aluminum hydroxide.

δ To illustrate the hybrid particle of the invention, a DNA sequence containing -64 codon coding for the repeating epitope of the circumsporozoic (CS) protein of Plasmodium falciparum and an 8 codon-containing CS coding sequence [cf. Dame et al., Science, 225 (1984). 593-599 Π in each reading phase with a portion of the Pre S2 coding sequence present in a yeast expression vector fused. This yeast expression vector also contains a replicon and a suitable regulatory region. Both expression vectors, one containing the 64 codons CS sequence and the other containing the eight codons sequence, were each introduced into yeast host cells and the extracts of such transformed cells for the presence of HBsAg and CS epitopes on the same molecule studied.

The results were obtained by immunoblot analysis using a mixture of five monoclonal antibodies to CS and a monoclonal antibody to HBsAg from yeast. The results showed a 37 kd hybrid protein from the lysate of yeasts transformed with a vector containing the 64 codon-containing CS coding probe sequence in the Ableie phase fused to the Pre S2-S protein coding sequence. The results showed a 30 kd hybrid yeast lysate protein transformed with a vector containing the eight-codon containing CS coding sequence fused to the pre S2-S protein coding sequence. The assembly of these proteins into HBsAg-like particle structures was assessed by analysis of cesium chloride and sucrose gradients, high performance liquid chromatography

-40-

(HPLiC) and electron microscopy. The presentation of CS epitopes on the outside of such particles has been demonstrated in ELISA tests by the accessibility of CS epitopes for CS-specific antibodies. The presentation of HBsAg epitopes on the outside of such particles was demonstrated by radioimmunoassay (AUSRIA II, Abbott) or ELISA assay (Enzygnost-HBsAg, Behringwerke).

New Pre S2 and Pre S2-S protein coding sequences

The novel HBV Pre S2 and Pre S2-S protein coding sequences of the invention are derived from the HBV adw subtype and were isolated from the plasmid pRIT10616. The term "coding sequence" or "coding region" as used herein also includes any functional derivative thereof. By "functional derivative" is meant a coding sequence having amino acid modifications which, if desired, do not interfere with particle formation and / or maintain immunogenicity, if desired. Such functional derivatives can be obtained by site-directed mutagenesis, as described, for example, by Botstein et al., Science, 229 (1985), 1193-1201. Such Pre S2 and Pre S2-S protein coding sequences can be obtained by conventional recombinant DNA methods from the plasmid pRIT10616. This plasmid was deposited (in E. coli K12 strain C600) according to the Budapest Treaty at the American Type Culture Collection, Rockville, Maryland, on June 2, 1982 under ATCC 38131. The Pre S2 region of such a novel protein coding sequence contains the following amino acids:

-55 ~ -50 Met-Gln-Trp-Asn-Ser-Thr-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp

-40 - ³⁰

Pro-Arg-Val-Arg ^ Gly-Leu-Tyr-Phe-Pro-Ala-Gly-Gly-Ser-Ser

-20 Ser-Gly-Thr-Val-Asn-Pro-Ala-Pro-Asn-Al-Ala-Ser-His-Ile-

-10 Ser-Ser-Ser-Ser-Ala-Arg-Thr-Gly-Asp-Ptro-Val-Thr-Asn.

-41-

Such a region can also be prepared by synthetic oligonucleotides in a conventional manner. A preferred functional derivative of the Pre S2-S coding sequence of the invention is one in which the amino acid Α] anin (GCT) at position -45 has been replaced by the site-directed mutagenesis by the amino acid threonine (ACT). Such a functional derivative is expressed twice more strongly in Saccharomyces cerevisiae than the unmodified coding sequence of the invention.

In a recombinant vector of the invention, the Pre S2 or Pre S2-S protein coding sequence of the invention is operably linked to a regulatory region. Such a vector may additionally contain a replicon,

I ^ dependent on the host in which it is used.

By the term "replicon" is meant the smallest DNA region that will maintain such a recombinant vector extrachromosomally stable in a eukaryotic or prokaryotic organism. Such replicons are known. By the term "regulatory region" is meant any DNA sequence containing a promoter region and other sequences necessary for the transcription of a coding sequence. ! Such regulatory regions are known. Such a vector can be prepared in a manner known per se, such as insertion of the Pre S2 or Pre S2-S protein coding sequence of the invention in the reading phase into a vector which already contains a replicon and a regulatory region. This listing is done in such

Preferably, the DNA molecule is inserted into a vector that is operably linked to such a regulatory region. Preferably, the DNA molecule is inserted into a vector that can be expressed in yeast, such as Sacch-iromyces.

The invention also relates to a host cell which is transformed by this recombinant vector and a

-42-

Process for the preparation of such a transformed host. Such a transformation is carried out in a manner known per se. The host cells may be prokaryotic or eukaryotic cells. Preferred host cells are eukaryotic cells, mainly yeast cells of the genus Saccharomyces, especially those belonging to the species Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

The invention also relates to a process for the preparation

IQ of a protein encoded by the Pre S2 and Pre S2-S DNA sequence. Such a method comprises culturing the transformed host cells in a suitable culture medium and isolating the protein from the culture supernatant or the cell lysate or extract of such host cell.

2g len. The type of isolation depends on the ability of the cells to secrete such proteins. By the term "appropriate culture media" is meant media in which the transformed host to grow and the Pre S2 or Pre S2-S protein coding sequence may in repeatable amounts exprimie ^ren. It is known to the person skilled in the art that the culture media depend on the host cell used. The pre S2-S protein is isolated by conventional protein isolation techniques from a culture lysate or culture supernatant of such a host. The protein produced by the method of this invention may be glycosylated, as long as the host cell is capable of doing so. If an unglycosylated protein is desired, then the protein is produced in a host cell that is not capable of glycosylation. Alternatively, the protein coding sequence could also be

eg by the usual site-directed mutagenesis, as known from Botstein et al., Science, 229 (1985), 1193-1201, before the method of the invention is carried out.

The invention also relates to a vaccine containing a

-43-

The amount of Pre S2 or Pre S2-S proteins of the invention contains as necessary. Such a vaccine may be prepared by conventional techniques.

The invention also relates to a method for producing a hybrid HBsAg protein-containing particle containing a protein encoded by the Pre S2-S sequence. Such a method comprises culturing the transformed eukaryotic host cells in suitable culture media and isolating the particle from the culture supernatant or the cell lysate or extract of such host cells. The type of isolation depends on whether the transformed host cells can secrete such particles. By "suitable culture media" is meant media in which the transformed host can grow and express the Pre S2-S protein coding sequence in particulate form and in a repeatable amount. The skilled person is aware that suitable culture media of the host cell depend <3 ^{e i 1} · The hybrid particles by conventional isolation techniques from the culture lysate or the culture supernatant of such a We do "isolated.

The invention also relates to a vaccine containing the hybrid particles. Such a vaccine will contain an amount of the hybrid particles necessary for immune protection and will be prepared in a manner known per se. The vaccine preferably contains the micelle of the invention, namely a micelle containing the particle and polysorbate. The preferred amount of polysorbate of such a micelle is 5 to 50 μg of polysorbate per 100 μg of protein. The micelle can be prepared by the process of EP-A 0 199 698.

In the vaccine, an aqueous solution of Pre S2-S

-44-

Protein or the hybrid particle, which preferably has a physiological pH can be used directly. Alternatively, any adjuvant can be added to the protein or particle. Such adjuvants include, but are not limited to, aluminum hydroxide.

From NW Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, USA, 1978, the production of vaccines is generally known. For example, U.S. Patent 4,235,877 discloses encapsulation in liposomes. U.S. Patent Nos. 4,372,945 and 4,474,757 disclose the combination of proteins into macromolecules.

The Pre S2-S protein or hybrid particle is present in each dose of vaccine in an amount that results in typical vaccine responses to immune protection without significant side effects. Such an amount will depend on the specific immunogenic agent and also on whether an adjuvant is included in the vaccine. In general, it is expected that each dose will contain 1 to 1000 parts protein, preferably 1 to 200 times protein. An optimal amount for a particular vaccine can be determined by standard studies involving observation of antibody titers and other responses in the patient. After a first vaccination, the patient will preferably receive a re-administration of the vaccine after about four weeks, followed by another every six months, as long as there is a risk of infection.

The immune response to the Pre S2-S protein and the hybrid particle is enhanced by the use of an adjuvant, such as aluminum hydroxide

 35

-45- New Pre S1 protein coding sequence

The new HBV Pre S1 protein coding sequence is from an HBV adw subtype and can be isolated from the plasmid pRIT10616. The term "coding sequence" or "coding region" as used herein also includes any functional derivative thereof. By the term "functional derivative" is meant a coding sequence having amino acid modifications which, if desired, does not interfere with particle formation and / or immunomodulatory activity.

"Il

maintains authenticity. Such functional derivatives can be prepared by conventional site-specific mutagenesis as known from Botstein et al., Science, 229 (1985), 1193-1201. Frequency can Such Pre S1 protein coding Se ⁴ are obtained from the plasmid pRIT10616 by conventional recombinant DNA techniques. This plasmid was (in E. coli K12 strain C600) according to the Budapest Treaty with the American Type Culture Collection. Rockville, Maryland, filed June 2, 1982 under ATCC 38131. The Pre Sei region codes for the following amino acid sequence:

-163

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met GIy Thr Asn Leu Ser VaI Pco Asn Pro Leu 25

GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pco Asp His Gin Leu Asp Pro

GCA TTC GGA GCC AAC TCA AAC AAT CCA GAT Ala Phe GIy Ala Asn Ser Asn Asn Pro Asp

TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Trp Asp Phe Asn Pro He Lys Asp His Tcp

CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pro Ala Ala Asn Gin VaI GIy VaI GIy AIa

-46-

TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC PUe GIy Pro Gli Leu The Pro Pro His GIy

GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG GIy l \ 3 Leu Gly Trp Ser Pro Gin Ala GIn

GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT GIy He Leu Thr Thr VaI Ser Thr He Pro

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro AIa Ser Thr Asn Arg Gin Ser GIy

AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pico Thr Pro He Ser Pro Pro Leu

AGA GAC AGT CAT CCT CAG GCC Arg Aap Ser His Pro Gin AIa

Such a region can also be obtained by the usual synthesis of oligonucleotides.

In a recombinant vector, the pre S1 protein coding sequence is operably linked to a regulatory region. Such a vector may also additionally contain a replicon which depends on the host in which it is used. By the term "replicon" is meant the smallest DNA region that will maintain such a recombinant vector extrachromosomally stable in a eukaryotic or prokaryotic host organism. Such replicons are known. By the term "regulatory region" is meant a DNA sequence containing a promoter region and other sequences necessary for the transcription of a coding sequence. Such regulatory regions are known. Such a vector

-47-

can be prepared in a manner known per se, such as by inserting the pre S1 protein coding sequence in the reading phase into a vector which already contains a replicon and a regulatory region, in such a way that the DNA molecule has this regulatory region The DNA molecule is preferably inserted into a vector which can be expressed in yeast such as Saccharomyces.

The invention also relates to a host cell transformed with such a recombinant vector and to a method for producing such a transformed host cell. Such a transformation is carried out in a manner known per se. Host cells may be prokaryotic or eukaryotic cells. Preferred host cells are eukaryotic cells, mainly yeast cells and those of the genus Saccharomyces, especially those of the species Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

The invention relates to a method of producing a protein encoded by the pre S1 protein coding sequence. Such method comprises culturing the transformed host cell in suitable culture media and isolating the protein from the culture supernatant or the cell lysate or extract thereof host cultures. The isolation type depends on whether the transformed. Host can secrete such proteins. By "suitable culture media" is meant media in which the transformed host can grow and express the Pre S1 protein coding sequence in a repeatable amount. It is known to those skilled in the art that the appropriate culture media will depend on the host cell used. The isolation of the pre S1 protein from a culture lysate or the culture supernatant of such a host is carried out by conventional methods. The protein produced by the method of this invention

-48-

can be glycosylated, provided that the host cell is capable of glycosylation. If a non-glycosylated protein is desired, the protein should be prepared by using a host cell that is not capable of glycosylation. Alternatively, the protein coding sequence can be altered by standard site-directed mutagenesis before performing the method of this invention. Site-specific mutagenesis is carried out, for example, as known from Botstein et al., Science, 2, 9 (1985), 1193-1201.

The invention also relates to a vaccine containing the Pre S1 protein of the invention. Such a vaccine will contain an amount of Pre S1 protein of the invention necessary for immune protection and prepared by conventional techniques.

For the vaccine, an aqueous solution of the Pre S1 protein, which preferably has a physiological pH, can be used directly. Alternatively, any adjuvant can be added to the Pre S1 protein. Such adjuvants include, but are not limited to, aluminum hydroxide.

From New Trends and Developments in Vaccines, edited

The production of vaccines is generally known by Voller et al., University Park Press, Baltimore, Maryland, USA, 1978. Capsule encapsulation in liposomes is known from U.S. Patent 4,235,877. 945 and 4 474 757 is the composition of pro-

* "known to macromolecules.

The Pre S1 protein is present in each dose of vaccine in an amount that, in typical vaccines, provides a response necessary for vaccination protection without significant

tende side effects. Such a quantity is from

-49-

the specific immunogenic agent used and also whether the substance contains an adjuvant. In general, each dose is expected to contain 1 to 1000 μg of protein, preferably 1 to 200 μα. An optimal amount for a particular vaccine can be determined by standard assays involving observation of antibody titer and other responses in the patient. After a first vaccination, the patient is preferably given a new dose of vaccine after about four weeks, followed by another every six months as long as there is a risk of infection. The immune response to the Pre S1 protein is increased by the use of an adjuvant, such as aluminum hydroxide.

15

New Pre S1-Pre S2-S protein coding sequence

The invention also relates to an HBV Pre S1-Pre S2-S protein coding sequence of which the Pre S1-Pre S2 part contains the following amino acid sequence:

PRE- SL REGION -163

25

ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Giy Thi Asn Leu S-ir VaI Pro Aen Pro Leu

GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pro Asp His Gin Leu Asp Pro

GCA TTC GGA GCC AAC TCA AAC AAT CCA GAT ο Ό

Ala Phe GIv Ala Asn Ser Asn Asn Pro Asp

TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG

Ti \ j Asp ^ü he Asn Pro lie Lys Asp His Trp

35

CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA

Pro Ala Ala Asn Gin VaI Giy Vai GIy Ala

-50-

TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe Gly Pro Gli Leu Thr Pro Pro His GIy

GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG GIy lie Leu GIy Trp Ser Pro Gin Ala GIn

GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT GIy He Leu Thr Thr VaI Ser Thr lie Pro

CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro AIa Ser Thr Asn Arg Gin Set GIy

AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg GIn Pro Thr Pro He Ser Pro Pro Leu 15

AGA GAC AGT CAT CCT CAG GCC Arg Asp Ser His Pro Gin AIa P RE-S2 REGION

- ⁵⁵

ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA Met GIn Trp Asn Ser Thr Ala Phe His Gin

GCT CTG CAG GAT CCC AGA GTC AGG GGT CTG AIa Leu Gin Asp Pro Arg VaI Arg GIy Leu

TAT TTT CCT GCT GGT GGC TCC AGT TCA GGA Tyr Phe Pro Ala GIy GIy Ser Ser Ser GIy

ACA GTA AAC CCT GCT CCG AAT ATT GCC TCT Thr VaI Asn Pro AIa Pro Asn I ¹ C AIa Ser

CAC ATA TCG TCA AGC TCC GCG AGG ACT GGG His He Ser Ser Ser Ser AIa Arg Thr Gly 35

GAC CCT GTG ACG AAC Aep Pro VaI Thr Asn

-51-

The novel HBV Pre S1-Pres S2-S protein coding sequence of the invention is derived from an HBV adw subtype and was isolated from the plasmid pRIT10616. This plasmid is deposited at the American Type Culture Collection, Rockville, Maryland, ATCC 38131 as noted above. The term "coding sequence" or "coding region" as used herein also includes any functional derivative thereof. By the term "functional derivative" is meant a coding sequence having amino acid modifications which, if desired, does not interfere with particle formation and / or maintain immunogenicity. Such functional derivatives can be prepared by the usual site-directed mutagenesis, as known, for example, from Botstein et al., Science, 229 (1985), 1193-1201.

In a recombinant vector is the

Pre S1-Pre S2-S protein coding sequence operably linked to a regulatory region. Such a vector may also additionally contain a replicon which depends on the host in which it is used. By the term "replicon" is meant the smallest DNA region that will maintain such a recombinant vector extrachromosomally stable in a eukaryotic or prokaryotic host organism. Such replicons are known. By the term "regulatory region" is meant any DNA sequence containing a promoter region and other sequences necessary for the regulation of transcription of a coding sequence. Such regulatory regions are known. Such a vector can be prepared in a manner known per se, such as by inserting the Pre S1-Pre S2-S protein coding sequence in the reading phase into a vector which already contains a replicon and a regulatory region. The insertion occurs in such a manner that the DNA molecule is operably linked to such a recurulatory region. The DNA molecule is preferably inserted into a vector which is expressed in yeast, such as

-52 Saccharomyces, can be expressed.

The invention also relates to a host cell transformed with such a recombinant vector and to a method for producing such a transformed host.

Such a transformation is carried out in a manner known per se. Host cells may be prokaryotic or eukaryotic cells. Preferred host cells are eukaryotic cells, mainly yeast cells and of which the cells of the genus Saccharomyces, especially those of the species Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

The invention also relates to a method for the production of a protein encoded by the Pre S1-Pre S2-S sequence. Such a method involves culturing the transformed host cells in appropriate culture media and isolating the protein from the host cell supernatant or cell lysate or extract of such host cells. The ^{nature of} the isolation depends on the ability of the host cells to secrete such proteins. By "suitable culture media" is meant media in which the transformed host can grow and express the product of the Pre S1-Pre S2-S protein coding sequence in a repeatable amount. It is known to those skilled in the art that the appropriate culture media will depend on the host cell used. The isolation of the Pre S1-Pre S2-S protein from a culture lysate or the culture supernatant of such a host is carried out by conventional methods. The protein produced by the method of the invention may be glycosylated as long as the host cell is capable of glycosylation. If an unglycosylated protein is desired, the protein of this invention should be prepared by using a host cell that is not capable of glycosylation. Alternatively, the

- 53 -

protein coding sequence by the usual site-directed mutagenesis, as known, for example, from Botstein et al., Science, 229 (1985), 1193-1201, before the method of this invention is carried out. The Pre S1-Pre S2-S coding sequence is expressed in yeast or mammalian cells as a glycosylated protein. The Pre S1-Pre S2-S coding sequence is expressed in yeast as a protein having a myristic acid as a substituent at the N-terminus.

The invention also relates to a vaccine containing the Pre S1-Pre S2-S protein in an amount necessary for immune protection. Such a vaccine can be prepared by conventional techniques.

The invention relates to a method for producing a hybrid HBsAg protein-containing particle containing a protein which is encoded by the Pre S1-Pre S2-S protein coding sequence. Such a method comprises

* ^ the cultivation of the transformed eukaryotic host cells in appropriate culture media and the isolation of the particle from the host cell supernatant or a cell lysate or extract of such host cells. The nature of the isolation depends on the ability of the transformed host cells to assemble such proteins. By the term _"r ge suitable culture media" is meant media in which the transformed host to grow and the Pre S1- Pre S2-S protein coding sequence capable of expressing in particle form and in repeatable quantities. It is known to the person skilled in the art

^ow that suitable culture media depend on the host cell used. The isolation of the particle from culture lysate or culture supernatant of such a host is carried out by conventional methods.

-54-

The invention also relates to a vaccine containing the hybrid particles. Such a vaccine contains the hybrid particles in an amount necessary for immune protection and is prepared by conventional methods. The vaccine preferably contains the micelle, namely a micelle which contains the particle and polysorbate. The preferred amount of polysorbate in such a micelle is 5 to 50 μg of polysorbate per 100 μg of protein. The Miz.elle can be prepared by the method described in EP-A 0199 698.

An aqueous solution of the Pre S1-Pre S2-S protein or the hybrid particle, which preferably has a physiological pH, can be used directly for the vaccine. Alternatively, any adjuvant may be added to the protein or particle. Such adjuvants include, but are not limited to, aluminum hydroxide.

From Vaccines New Trends and Developments, edited by Voller et al., University Park Press, Baltimore, Maryland, USA, 1978, the production of vaccines is generally known. U.S. Patent 4,235,877 discloses encapsulation in liposomes. US Pat. Nos. 4,372,945 and 4,474,757 disclose the composition of proteins to macromolecules.

The Pre S1-Pre S2-S protein or hybrid particle is present in each dose of vaccine in an amount that results in typical vaccines for a non-immunocompetitive response with no significant side effects. Such an amount will depend on the specific immunogenic agent used and also on whether the vaccine contains an adjuvant. In general, each dose is expected to be from 1 to 1000 μg of protein, preferably 1 to

-55-

Contains 200 μg of protein. An optimal amount for a given vaccine can be determined by standard studies involving the observation of antibody titers and other reactions in the patient. After a first

Vaccination is preferred to the patient after about four

Weeks another vaccine dose administered, all six

Months another follows as long as there is a risk of infection.

The immune response to the Pre S1-Pre S2-S protein or to the hybrid particle is enhanced by the use of an adjuvant, such as aluminum hydroxide.

Expression of Pre S1-Pre S2-S Protein in Yeast

The invention also relates to a recombinant DNA vector in which the entire Pre S1-Pre S2-S protein coding sequence is operably linked to an expression control sequence. The term "coding sequence" or "coding region" as used herein also includes any functional derivative thereof. By the term "functional derivative" is meant a coding sequence having amino acid modification which, if desired, does not interfere with particle formation and / or maintain immunogenicity. Such functional derivatives can be prepared by the usual site-directed mutagenesis as disclosed, for example, in Botstein et al., Science, 229 (1985), 1193-1201. On

gO such vector may additionally contain a replicon which depends on the host in which it is used. Preferably, the Pre S1-Pre S2-S protein coding sequence is used.

By the term "replicon" is meant the smallest DNA region which contains such a recombinant vector in a yeast.

-56-

Host organism keeps extrachromosomal stable. Such replicons are known. By the term "regulatory region" is meant any DNA sequence containing a promoter region and other sequences that are important

for the regulation of transcription of a coding sequence.

• Such regulatory regions are known. Such a vector can be prepared in a manner known per se, such as by inserting a Pre S1-Pre S2-S protein coding sequence in the reading phase into a vector which already contains a replicon and a regulatory region. The insertion occurs in such a way that the DNA molecule is operably linked to the regulatory region. The DNA molecule is preferably ligated into a vector which is expressed in yeasts of the genus Saccharomyces.

Preferably, the Pre S1-Pre S2-S protein coding sequence contained in the vector is the Pre S1-Pre S2-S protein coding sequence. Such vectors are also useful for the insertion of functional DNA sequences to express the resulting Pre S1-functional DNA sequence Pre S2-S protein coding sequence. Therefore, this invention also relates to a recombinant DNA molecule in which a functional DNA sequence in reading phase is fused to the Pre S1 region from the Pre S1-Pre S2-S protein coding sequence and a vector containing such a recombinant DNA molecule. The fusion can be done so that the functional DNA sequence either forms an insertion in the Pre S1 region or replaces part of the Pre S2 region; see. below, item 21A.

By "functional DNA sequence" is meant a DNA sequence which, when fused in read-out phase to the Pre SI region from the Pre S1-Pre S2-S protein coding sequence, does not participate in the composition of the HBsAg particle involved is still the particle formation bothers. Preferred functional DNA sequences include the circumsporozoide (CS) coding sequence of Plasmodium or any immunogenic derivative thereof, the coding sequence

-57-

the HIV envelope protein or any immunogenic derivative thereof, especially the coding sequence of the C_ peptide, the peptide 121 or the Dreesman peptide or coding sequences of peptides of interest of other viruses, especially those of coat proteins or surface proteins of other parasites.

The invention also relates to a yeast host cell transformed with such a recombinant vector and to an IQ method for producing such a transformed host. Such a transformation is carried out in a manner known per se. Preferred yeast cells belong to the genus Saccharomyces and particularly preferred cells of the species Saccharomyces cerevisiae.

The invention also relates to a method for producing a protein encoded by a Pre S1-Pre S2-S protein coding sequence or a Pre S1-functional DNA sequence Pre S2 protein coding sequence. Such a method comprises culturing the transformed host cells in suitable culture media and isolating the protein from the culture supernatant or from a cell lysate or extract of such host cells. The nature of the isolation depends on the ability of the host cell to secrete such proteins. By the term "suitable culture media" is meant media in which the transformed host grows and encodes the product of a pre S1-Pre S2-S protein coding sequence or a Pre S1-functional DNA sequence-Pre S2-S protein.

gO can express the sequence in a repeatable amount. The isolation of the Pre S1-Pre S2 ^ -S protein or the Pre S1-functional DNA Sequei.z- Pre S2-S protein from a cell lysate or the culture supernatant of such a host is carried out by conventional methods. The protein isolated by the method of this invention may be glycosylated provided that the host cell has the ability

-58-

possesses for glycosylation. If an unglycosylated protein is desired, the protein of this invention should be prepared by using a host cell that is not capable of glycosylation. Alternatively, the protein coding sequence could be altered by standard site-directed mutagenesis, as known, for example, from Botstein et al., Science, 229 (1985), 1193-1201, before carrying out the method of the invention.

The invention also relates to a vaccine which contains an amount of Pre S1-Pre S2-S protein or Pre S1-functional DNA sequence Pre S2-S protein necessary for immune protection, both of which were prepared by the method of the invention , Such a vaccine can be prepared in a manner known per se.

The invention also relates to a method for producing a hybrid particle containing a protein encoded by a Pre S1-Pre S2-S protein coding sequence or a Pre S1-functional DNA sequence Pre S2-S protein coding sequence. Such a method involves culturing the transformed yeast host cells in appropriate culture media and isolating the particle from the culture supernatant or from a cell lysate or extract of such host cells. The nature of the isolation depends on the ability of the cells to read such particles. By "suitable culture media" is meant media in which the transformed host grows and the Pre S1-Pre S2-S protein coding sequence or the Pre 51-functional DNA Sequence Pre S2-S protein coding sequence in particulate form and in can express repeatable amount. It is known to a person skilled in the art that the suitable culture media depend on the host cell used. The isolation of the particle from a culture lysate or the culture supernatant of such host cells is becoming more common. Methods executed.

-59-

The invention also relates to a vaccine containing the particles of the invention. Such a vaccine contains an amount of particles necessary for immune protection and is produced in a manner known per se. The seed preferably contains the micelle of the invention, namely a micelle containing the particle of the invention and polysorbate. The preferred amount of polysorbate in an _(such micelle is 5 to 50 \ xg polysorbate per 100 ug protein. The micelle may be prepared by the process described in EP-A 0,199,698 procedure.

For the vaccine of the invention, an aqueous solution of the Pre S1-Pre S2-S protein or the Pre S1-functional DNA sequence-Pre S2-S protein or the particle, which preferably has a physiological pH, may be directly used become. Alternatively, the protein particle may be incorporated with any adjuvant. Such adjuvants include, but are not limited to, aluminum hydroxide.

- -.

New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, USA, 1978, disclose the production of vaccines. U.S. Patent 4,235,877 discloses encapsulation in liposomes. U.S. Patents 4,372,945 and 4,474,757 disclose macromolecules.

4,372,945 and 4,474,757 is the composition of proteins

The Pre S1-Pre S2-S protein or Pre S1-Pre S2 nutraceuticals DNA sequence-S protein or the particle is present in each vaccine dose in an amount which, without in typical vaccines for a answer necessary _Immunsch% utz leads to significant side effects. Such an amount depends on the specific immunogenic agent used and also on whether the vaccine contains an adjuvant. Generally, it is expected that each vaccine dose will be 1 to

-60-

1000 μg protein, preferably 1 to 200 μg. An optimal amount for a particular vaccine can be determined by standard assays involving observation of antibody titers and other responses in patients. After a first vaccination, the patient is preferably given a further dose of vaccine after four weeks, followed by another every six months as long as there is a risk of infection.

The immune response against the Pre S1-Pre S2-S protein or Pre S1-functional DNA sequence-Pre S2-S protein or particle is enhanced by the use of an adjuvant, such as aluminum hydroxide.

Embodiments 20

- All percentages are by weight and all temperatures are given in ⁰ C.

The enzymes used for DNA manipulation were purchased from Bethesda Research Laboratories, New England Biolabs, and / or Boehringer, and used according to the manufacturer's instructions.

Yeast growth media: Selective medium: YNB (yeast nitrogen base without amino acid (Difco Labs) 0.675 % (w / v) with 2% (w / v) glucose).

YEPD medium: 1 % (w / v) yeast extract, 2 % (w / v) peptone and 2 % (w / v) glucose.

- methods for the production of recombinant DNA-molecule ^en from "Molecular Cloning", T. Maniatis et al, Cold Spring Harbor Lab ·.. (1982).

PMSF: phenylmethylsulphonyl fluoride.

-61-The following abbreviations are used:

PBS: phosphate buffered saline (per liter): (pH 7.4) 8.0 g NaCl

0.2 g KCl

1.15 g Na ₂ HPO ₄

0.2 g KH ₂ PO ₄

0.1 g of CaCl ₂ 0.1 g of MgCl ₂ . 6H ₂ O

BSA: bovine serum albumin (^ 40-70, Sigma) X-gal: 5-bromo-4-chloroindoyl-β-D-galactopyran.oside available from Sigma Chemical Co., St. Louis, Missouri.

L-BROTH (per liter): 10 g tryptone

5 g NaCl

5 g of yeast extract

1 ml of 0.1M MgSO ₄

After autoclaving, add 5 ml of a sterile thiamine solution (1 mg / ml). For solid media, add 15 g agar per liter.

Example 1 Construction of plasmid pRIT10167

The starting material was the plasmid p6y, which contains in pBR322 a 2.1 kb HindIII fragment of the yeast DNA coding for the TDH3 gene. p3R322 is from Bolivar et al., Gene,

QQ (1977), 95-113. The p6y plasmid was constructed and characterized by Musti et al., Gene, 25 (1983), 133, and by Drs. M. Rosenberg of the National Institute of Health. The HindIII fragment was recloned into a pBR322 derivative without EcoRI site and the plasmid pRIT10164 (a non-essential step) was obtained. The following manipulations were performed to attach a BamHI site

-62-

introduce the G residue of the ATG codon of the TDH3 coding sequence and obtain a HindIII-BamHI DNA fragment with TDH3 promoter activity in which the TDH3 sequences are intact and not altered by manipulation. The DNA prepared as described above of pRIT10164 was measured by two times cesium chloride-ethidium bromide density gradient centrifugation, as essentially from Kahn et al. (Methods in Enzymology, 68, 268, 1979). 150 μg of the pRIT10164 DNA was digested to completion with 75 units of the endonuclease XbaI, extruded with phenol and ether, ethanol precipitated and the DNA taken up in 0.01M tromethamine HCl buffer to a concentration of 1 μg per μΐ. Samples of 20 μg of this Xba I-cleaved DNA were digested with the nuclease Bal31 to remove the 61 base pairs of DNA between the ATG codon and the XbaI site. Digestions with Bal 31 were carried out at 30 ⁰ C for 1 to 3 minutes in a buffer at pH 3.1 containing 600 mM NaCl, 12 mM CaCl _9, 12 mM MgCl _0, 1 mM EDTA, 20 mM tromethamine-HCl, performed one unit of Bal31 nuclease was used per 20 μg of DNA in a reaction volume of 200 μl.

The enzyme reactions were stopped by adding ethylenebis (oxyethylene-nitrilo) -tetraacetic acid (EGTA) to a final concentration of 20 mM. The samples were extracted with equal volumes of phenol and ether and precipitated with ethanol. Each DNA sample was resuspended in 20 μl of 10 mM Tromethamine HCl buffer pH 7.5. The extent of Bal31 digestion was measured by digesting about 2.5 μg of each DNA sample with the endonuclease Hpal and comparing the size of the Hpal-XbaI fragment with the 335 base pair Hpal-XbaI fragment from pRIT10164 , After 2 minutes of digestion with Bal31, approximately 41 to 88 nucleotides were removed from the Xbal-Hpal fragment of pRIT10164.

This result indicates that a similar number of base pairs from the other XbaI site to the ATG codon

-63-

have been ferrite. 5 μg of the DNA obtained after the 2-minute Bal31 digestion was cleaved with the endonuclease BamHI, extracted with phenol and collected by ethanol precipitation. This DNA was treated with 5 units of T4 polymerase in the presence of deoxynucleotide triphosphates to form single stranded regions on the BamHI and. To refill Bal31 posts. The DNA was extracted with phenol and collected by ethanol precipitation. 2.3 μg of this DNA was treated with 5 units of T4 DNA ligase. Half of the ligation batch was used to generate competent cells of E. coli strain K12 MM294, which were prepared by the method of Cohen et al., Proc. Natl. Acad. Be. 69 (1972), 2110, to transform. 1 ml of the transformed E. coli population was diluted in 350 ml of L-broth with -200 μg / in ampicillin and the entire plasmid DNA was purified from the resulting culture.

Eighty micrograms of this plasmid DNA containing a population of plasmid molecules with Bal31-induced deletions of about 40 to 80 base pairs were sequentially digested with 75 units of endonuclease HindIII and 96 units of endonuclease BamHI to release DNA fragments containing a BamHI Site after the treatments described above. This is the case where the Bal31 digestion stopped at a G remainder. This cut DNA was separated on a preparative 1% agarose gel. The desired HindIII-BamHI fragments of 1000 to 1100 base pairs in size were excised from the gel in two pieces, one containing about 1070 base pairs of DNA and the other gel containing about 1030 base pairs of DNA. The DNA was obtained from the agarose gel pieces by repeated freezing and thawing and subsequent centrifugation in which the agarose was sedimented. The supernatant liquid was forced through a Millipore GV Millex filter and the DNA was collected by two ethanol precipitations and

-64-

finally resuspended in 20 μM of 0.01 M Tromethamine HCl buffer at pH 7.5.

Analysis of agarose gel electrophoresis and comparison with a HindIII, XbaI-digested pRITI064 DNA and with the fragments of a HindIII EcoRI digested / I't'hagen DNA revealed that two separate HindIII-BamHI fragment populations were obtained. One fragment population was about 1070 base pairs in size and the other about 1030 base pairs in size as compared to the 1120 base pair HindIII-XbaI starting fragment from pRIT10164. About 100 ng of the 1030 base pair HindIII BamHI fragment population was ligated with 200 ng of plasmid pUC9 digested with HindIII and BamHI and treated with alkaline phosphatase (see U.S. Patent 4,264,731).

The ligation mixture was used to transform competent cells of E. coli strain JM103 and to select for ampicillin resistance. The transformation of E. coli strain JM103 was carried out according to the method described by Cohen et al., Supra.

The vector pUC9 and E. coli strain JM103 are known from Vieira and Messing, Gene, 19 (1982), 259, and were obtained from J. Messing (University of Minnesota). The pUC9 vector is available from Amersham (Buckinghamshire, United Kingdom) and Pharmacia (Uppsala, Sweden). E. coli strain JMI03 is available from J. Messing (University of Minnesota). Another E. coli strain having the characteristics of E. coli strain JM103, strain JM101, is deposited with the American Type Culture Collection, Rockville, Maryland under ATCC 33876 and may also be used as a host. Approximately 400 ampicillin-resistant colonies were obtained per ml and 98 colonies thereof were tested on a medium containing X-gal. Of these, 95 were white and indicated the successful insertion of a foreign DNA fragment between the HindIII and BamHI sites of the vector.

-65-

Plasmids of single transformed colonies were prepared after amplification of the plasmids by adding spectinomycin (15 μg / ml) to the laboratory scale culture medium (Birnboim and Doyl, Nucl. Acid Res., 7 (1979), 1513).

The recombinant plasmids were analyzed on a 7.5% polyacrylamide gel after double digestion with Avail and BamHI and with the 450 base pair AvaH XbaI fragment containing the promoter and N-terminal coding region of pRIT10164, and with the Hpall-Pragmenten of pBR322 DNA compared. In 35 of 36 plasmids, an Avall-BamHI fragment was found that has deletions of 20 to 90 base pairs in comparison with pRIT10164. Three plasmids containing deletions of about 80 base pairs of lpRIT10166), 50 base pairs (pRIT10167-Fig, 8) and 45 base pairs (pRIT10165) were selected for further assays. The plasmid DNA was purified by CsCl-ethidium-bromide density gradient centrifugation and 25 μg each with EcoRI

32-digested. The EcoRI ends were labeled with γ-P-ATP in a kinase reaction and the nucleotide sequence of the HindIII-EcoRI fragments of each plasmid was determined according to Maxam and Gilbert (Methods in Enzymology, 65 (1980), 499. The labeling and sequencing of The EcoRI site from the pUC9 vector portion of each recombinant plasmid is a convenient means to determine the sequence at the adjacent BamHI site that indicates the end of the deletion in the TDH3 DNA fragment the plasmid pRIT10166 the BamHI site at a G residue in the 5'-untranslated region 25 bases

gQ pairs has re-emerged upstream of the ATG codon; in PRIT10165 the BamHI site is located at the second base of the third codon and in pRIT10167 at the G of the ATG codon.

The HindIII-BamHI fragment of the TDH3 DNA in pRITi0167 contains all the necessary sequences in unaltered form for

-66-the TDH3 promoter activity.

Example 2 Construction of the Vector pRIT10172

The 1050 base pair HindIII-BamHI TDH3 D ^ 'fragment from pRIT10167, prepared according to Example 1, was prepared in the methods described in Broach et al. , Gene, 8 (1979), 121, known shuttle vector YEp13 recloned. The HindIII-BamHI TDH3 DNA fragment was ligated between the HindIII site of the two micron DNA of the vector and the BamHI site, yielding the recombinant plasmid pRIT12159. The DNA of pRIT12159 was cleaved with XbaI and BamHI and the resulting 1650 base pair fragment was ligated into the plasmid pRIT10774 instead of a similar XbaI-BamHI fragment containing the arg ³ promoter. The plasmid pRIT10774 is known from Cabezon et al., (Proc. Natl. Acad., Sci., USA 81, 6594 6598, 1986) This plasmid, in which the BamHI and Xhol sites of the vector portion are deleted by in vitro manipulation contains the YEpI3 replicon, a 1470 base pair HindIII-BamHI fragment possessing the arg ³ promoter region, and a 11 50 base pair BamHI-HindIII fragment possessing the arg ³ transcription termination region Arg ³ promoter insert from pRIT10774 through the TDH3 promoter insert yields plasmid pRIT10172, thus having a single BamHI site adjacent to the transcription termination signal on the 1150 base pair BamHI-HindIII arg ³ DNA fragment ATG of the TDH3 promoter insert.

Foreign DNA can therefore be cloned into this site. Further, the two DNA inserts joined together through HindIII sites can be taken as an expression unit on a 2200 base pair HindIII fragment and inserted into other vectors. Fig. 9 shows a restriction map of pRITiO172.

-67-

Example 3

Preparation of the plasmid pRIT12290

A 1050 base pair HindIII-EcoRI fragment from pRIT10167 (Figure 8), prepared as described in Example 1, which has the HindIII-BamHI TDH3 promoter fragment and the BamHI-SmaI EcoRI part of the pUC9 polylinker, was ligated between the HindIII and EcoRI sites of a pBR322 derivative ligated. The result was the recombinant plasmid pRIT12176. The pBR322 derivative used has a BamHI site deletion after this site has been filled in by the T4 DNA polymerase.

The plasmid DNA from pRIT10158 (Figure 8), prepared according to Example 4 (b), was digested with EcoRI and treated with T4 DNA polymerase to fill in the EcoRI single stranded area. This preparation was further digested with the endonuclease CIaI. Another sample of pRIT10158 DNA was digested with the endonucleases CIaI and HaellI and a 1150 base pair ClaI-HaellI fragment having the arg ³ gene transcription termination region was obtained by preparative agarose gel electrophoresis and electroelution. This fragment was ligated with EcoRI digested, T4 DNA polymerase-treated and CIaI-digested pRIT10158 DNA. The ligation mixture was used to transform competent cells of E. coli strain MM294, prepared according to Cohen et al., Supra, and then selected for ampicillin resistance. From the transformed colonies, a plasmid was isolated, which was identified as pRIT10162, in which the ClaI HaeIII arg ³ transcription termination fragment was inserted into pRIT10158 between the Cla I and filled EcoRI Stelie, and in which the EcoRI site has been restored , Fig. 8 shows the preparation of pRIT10162. The plasmid DNA pRITiO162 was cleaved with EcoRI and PstI, also digested with EcoRI and PstI

-68 DNA from pRIT12176 mixed and ligated. The ligase mixture was used to transform cells of the E. coli K12 strain MM294 by the method of Cohen et al., Supra, and to select for ampicillin resistance. A plasmid, pRIT12208, was obtained from a transformed colony in which the 4630 base pair EcoRI-PstI fragment from pRIT12176 had been ligated to the 1930 base pair EcoRI-PstI fragment of pRIT10162, and in which the arg ³ Transcription termination region

jQ of the TDH3 promoter region is attached. The arg ³ and TDH3 DNA regions can be obtained by cleavage with HindIII in a 2200 3ase pair large fragment from pRIT12208. To obtain the other orientation of this fragment with respect to the vector sequences, the 2200 base pair HindIII fragment of pRITi2208 was recloned in the HindIII site of a pBR322 derivative. In this plasmid derivative, the EcoRI and BamHI sites were sequentially deleted in replenishment reactions by the T4 DNA polymerase. The resulting recombinant plasmid, in which the 2200 base pair HindIII fragment is in a different orientation with respect to the vector sequence, compared to pRIT12208, is identified as pRIT12290. Fig. 10 shows a restriction map of pRITt2290. In the plasmids pRIT12208 and pRIT12290, between the TDH3 promoter and arg ³ transcription termination fragments are the unique BamHI, SmaI and Ecol restriction sites, which are well suited for cloning DNA fragments containing coding sequences. The promoter and transcription termination regions may be co-administered in a 2200 base pair HindIII fragment.

oQ ment be obtained as an expression unit and transferred into other vectors wer'den.

The BamHI site is particularly well suited because it is located at the ATG codon of the TDH3 gene and thus can be used for fusion of other genes with the TDH3 promoter to express them in yeast as illustrated below. Such

-69-

Fusioniarten sequences can be obtained from pRIT12208 or pRIT12290 by cleavage with the endonuclease HindIII or other endonucleases at the flanking restriction sites as an expression unit and inserted into yeast shuttle vectors.

Example 4 Construction of plasmids pRIT1067 / 7, pRIT10909 and pRIT10158

a) PRIT10677

A 1 372 base pair BamHI fragment of cloned HBV DNA was excised from pRIT10616 (Harford et al., Dev. Biol. Standard, 54 (1983), 125-130, and digested with BamHI

! 5 split pBR327 DNA mixed and ligated. This BamHI fragment contains part of the HBsAg precursor region, the HBsAg coding sequence and 3 'non-coding sequences. From the ligation mixture, the plasmid pRIT10677 was selected which contains the HBV BamHI fragment in the orientation that the XbaI site of the HBV DNA is adjacent to the Sall site of the pBR327 vector DNA. Fig. 8 shows the preparation of pRITiO677.

b) PRIT10909

The 3300 base pair HindIII fragment of Crabeel

M. et al. , EMBO J., 2 (1983), 205-212, known plasmid pMC200 (available without restriction from American Type Culture Collection, Rockville, Maryland, USA, under ATCC 39131) was recloned into a pBR322 derivative in which the

gO EcoRI site in a fill-in reaction by the T4 DNA polysaccharide.

lymerase was deleted. A resulting recombinant plasmid, pRIT10158, (Figure 8), was selected by adjacent to the 3 'region of the arg ³ gene HindIII fragment. the CIaI site of the modified pBR32? vector is located. From pRIT10158 became one

gp 1150 base pair large Clal Haelll fragment obtained

contains the transcription termination region of the arg ³ gene.

-70-

This 1150 base pair fragment was ligated with the CIaI and Hpal digested DNA of plasmid pRIT10677 (described above in part a) to generate the arg ³ termination region at the Hpal site downstream of the HBsA encode Oen region is to introduce. The resulting plasmid is pRIT10909. Fig. 8 shows the production of PRIT10909. Fig. 3 shows a restriction map of pMC200.

Example 5

Construction of plasmids pRIT10911 and pRIT10912

The BamHI site in pRIT10167 (Example 1) and the naturally occurring BamHI site in the precursor region of the HBsAg gene in pRIT10616 (harp cd et al., Dev. Biol.

Standard, 54 (1983), 125-130, cloned adw serotype HBV virus are in the same reading frame. This allows fusion with the TDH3 promoter fragment to form a fused DNA sequence, which is an ATG Condon, 42 codons of and following the HBsAg precursor sequence

226 codons of the HBsAg coding sequence. The starting material for the HBV DNA Ta. M »it used in this fusion was the plasmid pRIT1 0909 (see above, Example 4, part b)). This plasmid contains a 935 base pair BamHI-Hpal insert containing part of the coding region of the HBsAg precursor region, the complete HBsAg coding sequence and 128 base pairs of the 3 'untranslated DNA, and to the downstream of its Hpal site a 11 50 base pair Haelll-Clalll DNA fragment from pRIT10158 containing the arg ³ transcription termination region was ligated. pRIT10158 is described above in Example 4 part b). The 2085 base pair EcoI-BamHI fragment was excised from pRIT10909 and ligated between the EcoRI and BamHI sites of pRIT10167 prepared as described in Example a) above. The plasmid was created

-71-

pRIT10911. The 3135 pb HindIII fragment from pRIT10911, containing yeast DNA transcription signals and the HBsAg coding sequence, was inserted into the shuttle vector YEpI3. The result was the plasmid pRIT10912. Fig. 8 shows the preparation of pRIT10911.

Example 6 Construction of plasmids pRIT10903 and pRIT10914

The aim of the constructions described below was to remove excess nucleotides at the 5 'end of a DNA fragment encoding at least the N-terminal region of the mature HBsAg so that a 6 bp restriction site at the first base of the second Codons is created. The resulting fragment can then be fused to promoter fragments having a 6 base pair restriction site on the initiation codon using mungo bean nuclease or S1 nuclease to remove single stranded areas and blunt ends for ligation, as Rosenberg has done et al., Methods in Enzymology, 101C, 123 (1983).

A 1225 bp FnuDII fragment of HBV DNA from PRIT10616 (see Harford et al., 1983, Devel, Biol. Standard, 54, 125-130) containing the HBsAg gene was isolated with synthetic octomer EcoRI Labeled and ligated into the EcoRI site of the vector pACYC184. The result was the plasmid pRIT10679 (FIG. 8). The vector pACYC184 was obtained from S. Cohen and is from Ch'ang A.C.Y. and Cohen S. (1978), J. Bacteriol., 134, 1141-1156. pACYC184 is also available from the American Type Culture Collection, Rockville, Md., USA under ATCC 37033. From this EcoRI (FnuDII) fragment, a 125 bp EcoRI-XbaI fragment was obtained which contains the C-terminal region of the HBsAg progeny.

-72-

runner DNA containing HBsAg ATG codon and 90 bp of the HBsAg coding sequence. This 125 bp ExoRI-XbaI fragment was inserted between the EcoRI and XbaI sites of pRIT10158 (see Example 4b). The resulting plasmid pRIT10903 therefore contains a single EcoRI site at the junction between arg ³ DNA and HBV DNA and a single Xho I site in the arg ³ promotor region. Fig. Shows the preparation of pRIT10903.

150 μg of pRIT10903 plasmid DNA purified by CsCl-ethidium bromide density gradient centrifugation was cleaved with 80 units of EcoRI endonuclease, extracted with phenol, ethanol precipitated and dissolved in 10 mM tromethamine-HCl buffer (pH 7.5 ) was added to a concentration of 1 μg per μΐ. The DNA was divided into three samples each of 50 ug and incubated at 30 ⁰ C 50, 75 and 90 seconds with Bal 31 nuclease. Each reaction mixture contained the same reaction buffer described in Example 1, 50 μg of EcoRI-digested pRITi0903 DNA and 2.5 units of the nuclease Bal31 in a final volume of 500 μΐ. The reactions were stopped by addition of EGTA to a final concentration of 20 mM. The reaction mixtures were placed on ice, extracted with an equal volume of phenol and precipitated with ethanol. The Bal31-treated DNA samples were each taken up in 50 μl of 10 mM tromethamine HCl buffer. 2.5 μg of the DNA was digested with the endonuclease BstIII and compared on a 7.5% polyacrylamide gel with the EcoRI-BstEII digest of pRIT10903, which releases a 285 bp fragment. The treatment with nuclease Bal31 75 seconds at 30 ⁰ C reduces the size of the EcoRI-BstEII fragment by 10 to 'JO bp. The result is a series of single DNA fragments estimated to be 10, 30, 45, and 60 bp apart. Removal of 29 bp from the original FnuDII site would eliminate all HBsAg precursor DNA and HBsAg ATG codons lead.

-73-

5 μg of pRIT10903 DNA, which had been treated with Bal31 for 75 seconds, was digested with 8 units of Nuclease Xhol, extracted with phenol and precipitated with ethanol. This DNA was then incubated with 5 units of T4 DNA polymerase in the presence of deoxynucleotide triphosphates to fill single strand areas at the Xhol and Bal31 ends, phenol treated, and ethanol precipitated. The DNA was then incubated with 16 units of T4 DNA ligase for 16 hours at 16 ^° C. The ligation mixture was finally used to transform competent cells of the E. coli K12 strain MM294 and then to select for ampicillin resistance, as is known from the method of Cohen et al., Supra. About 2000 ampicillin-resistant colonies per ml were obtained after plating. Plasmids were prepared from 47 individual colonies on a laboratory scale (see Birnboim et al., Supra), of which 23 have an XhoI site, indicating that the replenishment reaction at the original XhoI site and the ligation to a 3 ' -End, ending with a G-remainder, has been successful. These 23 plasmids were further digested with Xhol and XbaI to compare the size of the small restriction fragment compared to the original EcoRI-XbaI fragments from pPITiO9O3.

Several plasmids have been identified that have estimated deletions of 25 to 40 bp. A plasmid, pRIT109i4, whose Xhol-Xbal fragment is estimated to be 95-100 bp in size, was selected for further study. Fig. 8 shows the preparation of pRIT10914. DNA of this plasmid was purified by CaCl-ethidium bromide density gradient centrifugation, and 25 μg of such DNA was digested with 140 units of Xba I endonuclease.

The XbaI ends were labeled with gamma P-ATP and the labeled DNA was probed with 15 units of the HindIII endonuclease.

-74-

columns. The small 765 bp HindIII-XbaI fragment was isolated by polyacrylamide gel electrophoresis and electroelution and subsequently precipitated by ethanol. The nucleotide sequence at and around the XhoI site was determined by sequencing this fragment from the labeled XbaI end of Maxam and Gilbert. Sequence data indicated that the XhoI site is located at the first base of the second codon of the HBsAg coding sequence.

XhoI

CTCGAGAAC

HBsAg nucleotides

After removal of single-stranded regions, this fragment is therefore suitable for fusion with the BamHI extension of the TDH3 promoter fragment of pRIT10167 (Example 1).

Example 7 Construction of plasmids pRIT12211, pRIT12209, pRIT12230 and pRIT12265

The plasmid pRIT10911, prepared as described in example 5, was used as starting material for further manipulations. In order to introduce desired Restriktioiisstellen, the plasmid with the endonucleases BamHJ. and XbaI split and replaced the excised fragment with a 2275 bp BamHI-XbaI fragment from pRIT10158 (Example 4). This manipulation results in plasmid pRIT12211 in which the HindIII-BamHI TDH3 promoter fragment is adjacent to a BamHI-XbaI fragment containing an XhoI site. Further, this plasmid contains an XbaI-HindIII fragment in which the C-terminal region of the HBsAg coding sequence and 128 bp of the 3 'non-coding sequence are fused to the 1150 bp arg ³ transcription termination region. Fig. 8 shows the preparation of pRITi2211. The plasmid pRIT12211

-75-

was cleaved with the endonucleases Xhol and XbaI. This removed a 1600 bp fragment which was replaced by a 94 bp Xhol-XbaI fragment of the modified HBsAg DNA from pRIT10914 prepared according to Example 5. This 94 bp fragment was purified after the double digestion of pRITiO914 DNA with Xhol and XbaI by polyacrylamide gel electrophoresis and subsequent electroelution from the corresponding Gelstückchen and precipitated by ethanol. The plasmid pRIT12209 (see Figure 8) resulting from the insertion of the 94 bp fragment was purified by CsCl-ethidium bromide density gradient centrifugation. Fifty μg of this DNA was digested with 90 units of the BamHI endonuclease and 60 units of the Xhol endonuclease to remove the 990 bp insignificant DNA between the TDH3 promoter and the HBsAg coding region. The DNA was then extracted with phenol and then precipitated with ethanol. 16 ug of this DNA was for 30 minutes at 30 ⁰ C with 20 units of mung bean nuclease (PL Biochemicals) in a volume of 125 incubated μΐ. The incubation buffer used contained 30 mM sodium acetate (pH 4.6), 250 mM sodium chloride, 1 mM zinc chloride and 5 % glycerol. The reaction was stopped by addition of sodium dodecyl sulfate to a final concentration of 0.2 % , and the DNA was extracted with an equal volume of phenol and then precipitated with ethanol. A subset of 0.5 μg of this mungo bean nuclease treated sample was incubated with 2 units of T4 DNA ligase for 16 hours at 16 ° C and then cleaved with 2 units of BamHI endonuclease to destroy any vector molecules heretofore left untreated. This mixture was used to transform cotyledonous cells of E. coli K12 strain MM294 and then selected for ampicillin resistance according to Cohen et al., Supra. About 2000 ampicillin-resistant colonies per ml of transformation mixture were obtained. From 24 amplified colonies, the plasmids were run on a laboratory scale (according to

-76-the method of Birnboim et al., Supra).

Sixteen of the 24 plasmids yielded two fragments of DNA of size after digestion with endo-nuclease HindIII

2700 bp (pUC9 vector) and 3000 bp. The 3000 bp fragment has the size expected for a DNA fragment in which the HBsAg coding sequence and the arg ³ termination region are ligated to the TDH3 promoter fragment. 10

Four plasmid candidates were taken for further study. The DNA of each plasmid was cleaved with the endonuclease XbaI, labeled with PATP in a kinase reaction, cleaved with HindIII endonuclease, and resolved by polyacrylamide gel electrophoresis. The 1190 bp labeled HindIII-XbaI fragment was isolated by electroelution and precipitated by ethanol. The sequence of each isolated fragment was determined according to Maxam and Gilbert, supra. Two plasmids were found that possess the correct sequence ATGGAGAAC for a perfect fusion between the TDH3 promoter region and the HBsAg gene. One of these plasmids, pRIT12230, was used for further manipulations. Fig. 8 shows the production of PRIT12230. The DNA of this plasmid (pRIT12230) was cleaved with the endonuclease HindIII and the 3000 bp fragment in which the HBsAg coding sequence fused to the TDH3 promoter is ligated into the shuttle vector XEp13. The resulting plasmid, pRIT12265, was prepared according to the method described by Ito et al., J. Bact. 153 (1983), 163, described. into the yeast strain HC5 (MATa, leu2-3, Ieu2-112, his3, can1-11) (obtained from J. Broach (State University of NY, Stony Brook).) This strain of yeast is also of no limitation to the American Type Culture Collection available at ATCC 20630.

2 7 4 O

-77-

Example 8

Construction of plasmids pRIT12288 and pRIT12322

Plasmid pRIT12230 (Example 7) contains 3'-downstream of the stop codon of the HBsAg structural gene 128 bp, which do not encode HBV.

To remove these 128 bp, 25 μg of pRIT12230 prepared according to Example 7 were digested with Accl and EcoRI. pRIT12230 contains a single Accl site that is 7 nucleotides in the coding sequence of the S gene before the TAA stop codon. The digested DNA was electrophoresed on a 1% agarose gel and the larger 4200 bp vector fragment was obtained from the gel by electroelution and precipitated by ethanol.

Artificial 12mer and 14er single stranded DNA linker molecules with the following sequences were prepared for insertion between the Accl and EcoRI sites of pRIT12330:. 5 ¹ ATACATTTAACG 3 ¹

12 mer

3 'TGTAAATTGCT' & AA 5 '

14 mer.

This restores the correct C-terminal HBsAg codons and the TAA-stop codon and provides for the addition of transcription termination fragments an EcoRI site that is not found anywhere else in the TDH3 promoter or the HBsAg coding sequences.

100 pmol of the synthetic 12 mer and 100 pmol of the synthetic 14 mer single strands are mixed together in a final volume of 10 to 20 μΐ, heated for 15 minutes at 70 ⁰ C and then slowly cooled to room temperature within 3 hours to store the two strands adjacent to each other to achieve complementary sequences. To

-78-

To this "annealing" mixture is added 0.15 pmol (400 ng) of the 4200 bp AccI-EcoRI fragment from pRIT12230, 10X concentrated ligation buffer and 2 units of T4 DNA ligase.

This mixture is incubated for 4 hours at 16 ° C, then another 2 units of T4. Added TNA ligase. The mixture is then placed on ice overnight. The Iigierte mixture is used to competent ropes of the

IQ strain MM294 and then ampicillin resistance according to Cohen et al., Proc. Natl. Acad. Sci., USA, 69 (1972), 2110. Plasmids are prepared from 12 or more laboratory scale single cells according to the method of Birnboim and Doy, Nucl. Acids Res., 7 (1979),

jL5 1513, and analyzed by restriction endonucleases. Plasmids with the insertion of the linker between the Accl and EcoRI sites show a single 4200 bp DNA band after digestion with Accl or EcoRI. The correctness of the linker insertion in such a plasmid can

2Q by DNA sequencing from the EcoRI site or the Accl site according to the chemical modification method of Maxam and Gilbert (Methods in Enzymology, 65 (1980), 499).

To obtain a transcription termination fragment, a plasmid with the AccI-EcoRI linker insert obtained as described above was digested with the endonuclease EcoRI and treated with alkaline phosphatase (U.S. Patent 4,264,732). The 2650 bp HindIII fragment of

₃ Q pRIT10162 prepared according to Example 3 was recloned into the HindIII site of the vector pBR327. The result was the plasmid pRIT12288. pBR3L7 is known from Soberon et al., Gene, 9 (1980), 287-305, and can be prepared from the plasmid pRIT12309 as described in Example 10, part (b).

at the American Type Culture Collection under ATCC 67187

-79-

is available. Fig. 8 shows the construction of PRIT12288.

The HindIII fragment is oriented in pRIT12288 so that the arg ³ -Transkriptions termination region is located next to the EcoRI-rnd ClaI restriction sites on the pBR327 moiety. From pRIT12288, a 1180 bp EcoRI fragment containing the arg ³ transcription termination region is obtained. This fragment is ligated to the described EcoRI-digested and alkaline phosphatase-treated pRIT12230 derivative. Plasmids resulting from the ligation mixture are assayed for insertion and orientation of the 1180 bp EcoRI fragment. The orientation of the insert can be determined by cleavage with the endonuclease HindIII, which liberates fragments of 2880 and 2720 bp in size, if the insert has the desired orientation.

A plasmid, pRIT12322, was constructed in which the Accl-EcoRI linker displaces the 128 bp unwanted HBV DNA and contains the 1180 bp Eco RI fragment from pRIT12288 x in the correct orientation, downstream of the HBsAg encoding Sequence. A 2900 bp Hind III fragment can be excised from pRITi2322 which contains the HBsAg expression unit to which the TDH3 promoter, the HBsAg coding sequence and the arg ³ -Transkriptions termination region belongs. Fig. 8 shows the construction of pRITi2322; see. Also, Figure 11, which shows a restriction map of pRIT12232 and indicates which portions thereof are from pRIT12288 and pRIT12230.

Example 9 Construction of plasmid pRIT12329

As described in Example 8, pRIT12322 contains a 2900 bp

-80-

large HindIII fragment containing all the necessary signal sequences for the expression of HBsAg under the control of the TDH3 promoter. This expression unit was ligated into a yeast shuttle vector.

The DNA of the shuttle vector YEp13 was cleaved with HindIII endonuclease, treated with alkaline phosphatase and used as a recipient for the HindIII fragment from pRIT12322 prepared according to Example 8. A plasmid, pRIT12329, was isolated which, in addition to the YEpI3 replicon, also contains the 2900 bp HindIII fragment with the expression unit as described in Example 8.

Example 10

Construction of plasmid vectors for expression of hybrid antigenic HBsAg-CS in yeast

A. Construction of Plasmids pRITi2573 and pRIT12574 Plasmid WR201 was obtained from the Walter Reed Army Institute of Research and was obtained by insertion of a 2.3 kb EcoRI fragment from AmPfI (Dame et al., Science, 225 (1984). , 5 93-599) containing the complete DNA sequence of the Circumsporözoiden (CS) protein of Plasmodium falciparum, in the vector pUC8. Figure 2k shows the schematic restriction map and a strategy for sequencing the clone AmPFA. The positions of restriction sites shown in the figure were determined from the sequence and detected by restriction digestion : A ₁ Avail; Ac, Acc !; B ₁ Bstnl; D ₁ Dral; Dd, Ddel; F, Fokl; N, Ndel; R ₁ Rsal; S, Stül; T, TthIII; Tq, Taql; X, XhoII. The arrows indicate the starting point, the direction and the extent of the particular sequences. The CS protein coding sequence is indicated by a thick line. Figure 3A shows the nucleotide sequence of the CS protein gene of P. falciparum. The nucleotide sequence of the CS protein gene in

-81-

i ^st shown. Vector pUC8 is known from Vieira et al., Gene, 19 (1982), 259. pUC8 is available from Amersham and Pharmacia. A 1215 bp Stul-Rsal fragment of the WR201 plasmid containing the CS protein-encoding sequence without the first 52 bp (Figure 12) was purified by electroelution from a 7.5% polyacrylamide gel. This fragment was digested with Sau3A q <to cut to form smaller fragments. These include, but are not limited to, a 192 bp Sau3A fragment encoding 16 repeating tetrapeptides of the CS protein and three identical 24 bp Sau3A fragments encoding two repeating tetrapeptides of the CS protein.

The plasmid pRITiO91 1 (prepared according to Example 5) i _s t a pUC9 derivative containing a 3136 bp HindIII fragment of an expression unit in which a 1050 bp HindIII-BamHI Hefeqlycerinaldehyd-3-phosphate dehydrogenase (TDH3) Promoter fragment (which provides the ATG) at the BamHI site is fused to a 935 bp BamHI-Hpal fragment of the HBV DNA. This HBV DNA fragment encodes the 42 terminal amino acids of the Pre S2 region, the 226 amino acids of the S gene (serotype adw), and has 128 bp of 3 'noncoding DNA. The S gene is flanked by a 1150 bp yeast DNA fragment containing the arg ³ transcription termination signal. pUC9 is known from Vieira et al., Gene, 19 (1982), 259-268. The BamHI site of pRIT10911, which is located at the ATG initiation codon, is in readout phase with the Sau3A sites of the repetitive epitope of CS of Plasmodium falciparum.

The DNA of the plasmid pRIT10911 was cleaved with the endonuclease BamHI, treated with alkaline phosphatase, extracted with phenol and precipitated by ethanol. 0.2 μg of this DNA was mixed with 0.2 μl of the Sau3A digested Stul-Rsal CS gene fragment prepared as described above and treated with T4 DNA ligase. The ligation mixture was used to obtain competent cells of the

-82-

E. coli strain K1 2 ΜΜ294, prepared according to Cohen et al., Proc. Natl. Acad. Sci., USA, 69 (1972), 2110. Thirty-two plasmids of transformed single colonies were prepared after amplification of the plasmids by addition of spectinomycin (300 μg / ml) to the culture medium on a laboratory scale (Birnboim et al., Nucleic Acids Research, 7 (1979), 1513). The recombinant plasmids were analyzed after digestion with BamHI and XbaI on a 7.5% polyacrylamide gel and with the 219 bp BamHI-XbaI fragment from pRITiO911 (plasmid containing the sequence for the first 42 amino acids of the pre S2). Precursor region and the beginning sequence of the HBsAg region) and compared with the Haelll fragments of the <j> x174 DNA.

Among the 32 plasmids, one plasmid displayed a 411 bp BamHI-XbaI fragment corresponding to the insertion of a 192 bp Sau3A fragment in the correct orientation. This plasmid was designated pRIT12572. Another plasmid showed a 243 bp BamHI-XbaI fragment that corresponded to the insertion of a 24 bp Sau3A fragment in the correct orientation. This plasmid was designated pRIT12571. Fig. 12 shows the preparation of pRIT12571 and PRIT12572.

The HindIII fragments from pRIT12572 and pRITi2571 containing the TDH3 promoter, the hybrid CS-HBsAg coding sequence and the arg ³ termination region were recloned into YEpI3. This gave rise to the plasmids pRIT12574 and PRIT12573 (FIG. 12). YEp13 is known from Broach et al., Gene, 8 (1979), 121-133. Fig. 12 shows the preparation of PRIT12573 and pRITi2574.

Lithiumacetatbehandelte yeast cells (Ito et al., J. Bacteriol. 153 (1983), 163-168), the strain Saccharomyces cerevisiae DC-5. (A, leu2-3, Ieu2-112, his ^3, can1-11) and Saccharomyces cerevisiae 10S44C (pep4-3, leu2-3, leu2-112) were obtained by

-83-

transformed the plasmids pRIT10912, pRIT12574 and pRITi2573 and selected for leucine independence. The yeast strains DC5 and 10S44C were obtained from M. Crabee] from the Ceria Institute, Anderlecht, Belgium (see also Cabezon, T. et al., Proc Natl. Acad., Sci., USA, 81 (1984), 6594 -6598,). The yeast strain DC5 was deposited in the American Type Culture Collection, Rockville, Maryland, USA, under ATCC 20630 under the Budapest Treaty of June 2, 1982. The yeast strain 10S44C was described in the American Type Culture Collection, 0 Rockville, Maryland, USA Budapest Treaty on Aug. 18, 1986 under ATCC 20819. The expected hybrid protein of pRIT12573 is said to contain 277 amino acids, while the expected hybrid protein of pRIT12574 is to contain 333 amino acids.

It is also possible to extend the CS epitope region in the vector of the invention. For example, in the BamHI site of plasmids pRIT12572 and pRIT12571, additional Sau3A fragments of the CS protein DNA, e.g. 192 bp or 24 bp Sau3A fragments are ligated as follows:

The plasmid DNA of pRIT12572 or pRIT12571 is cleaved with the endonuclease BamHI and treated with alkaline phosphatase. The 1215 bp Stul-Rsal fragment of the WR201 plasmid obtained as described above is digested with the endonuclease Sau3A to release the 192 bp and 24 bp fragments having the tetrapeptide repeats. These fragments are digested with BamHI and treated with alkaline phosphatase.

_g0 gates pRIT12572 or pRIT12571 mixed and treated with T4 DNA ligase. The ligation mixtures are used to transform E. coli strain K12 cells. The cells are selected for ampicillin resistance. Plasmids from transformed colonies are

o lent ₅ the size of the Bam HI-Xba I fragments by endonuclease digestion and selected similarly digested DNA

-84-

from pRIT12572 or pRIT12571, particularly compared to the 411 bp and 243 bp BamHI-XbaI fragments of pRIT12572 and pRIT12571, which carry the fusion of the repeating CS sequences and the portion of the Pre S2-S coding sequence. An increase in the size of these fragments of 192 bp or 24 bp indicates the insertion of a repeating tetrapeptide fragment at the BamHI site of PRIT12572 and pRIT12571. The presence of a BamHI site in such plasmids indicates the insertion of the 192 bp or 24 bp Sau3A fragments in the correct orientation for fusion to the ATG codon. This process described above can be repeated if it is desired to introduce additional 192 bp or 24 bp Sau3A fragments encoding the repeating CS tetrapeptides, thereby expanding the CS tetrapeptide region on the hybrid particle. As already stated, the HindIII fragments containing the expression units can be excised from such derivatives of pRIT12572 or pRIT12571 by conventional methods and inserted into YEp13 or other suitable yeast cloning vectors and introduced into yeast cells.

B. Construction of pRIT12309, pRITi2314 and the expression shuttle vector pRIT12377 containing the complete 2 micron yeast DNA

Plasmid pRIT12309 comprises the complete 6318 bp 2 micron yeast DNA sequence cloned into the EcoRI site of plasmid vector pBR327. The 6318 bp 2 micron yeast DNA sequence was obtained from plasmid pCV1 9, which was given by J. Broach, Princeton University. The plasmid pRIT12309 was deposited in the E. coli strain K12 MM924 under the Budapest Treaty in the American Type Culture Collection, Rockville, Maryland, USA under ATCC 67187. FIG. Figure 13 shows a restriction map of pRITi2309. The insertion of the 2 micron DNA sequence into one of the two EcoRI sites of

-85-

pBR327 interrupts the 2 micron A coding region and results in the resulting hybrid molecule pRITi 2309 having no Α-gene or FLP function. A description of the 2 micron structure and function is available from Broach J., "The Molecular Biology of the yeast Saccharomyces: Life Cycle and Inheritance", 445-470, Strathern J.N., Jones E.W. and Broach J.R. (Eds.), Cold Spring Harbor Laboratory, New York (1981).

pBR327 is known from Soberon et al., Gene, 9 (1980), 287-305 and was obtained from F. Bolivar (Department of Molecular Biology, National University of Mexico, Mexico 20DF). It is known to a person skilled in the art that the plasmid pBR 327 can be obtained from the plasmid pRIT12309. The pRIT12309 plasmid DNA is isolated from the E. coli strain deposited in the American Type Culture Collection under ATCC 67187 by one of the numerous conventional methods, digested with EcoRI and religated. The ligation mixture is used to transform competent E. coli K'i2 cells and selected for ampicillin or tetracycline resistance A significant number of the transformed colonion will contain plasmids in which only the pBR327 half of pRIT12309 is present without one of the 2 micron DNA fragments.

The 2850 bp Clal-Sall fragment containing the TDH3-arg ³ expression unit and flanking pBR322 sequences from pRIT12290 (described in Example 3) was recloned into the vector pRIT12309 between the Clal and Sall sites. The resulting plasmid, pRITi2314, was cleaved with the endonuclease Sail and ligated to the 2218 bp SaII-Xhol fragment from YEp13 containing the yeast LEU2 gene. Fig. 14 shows the preparation of pRIT12314. YEp13 is available from the American Type Culture Collection under ATCC 37115. The ligation mixture was used to prepare competent cells of the strain JA221, which according to Cohen et al.,

-86-

a.a.O., were transformed and selected for leucine independence and ampicillin resistance.

Strain JA221 is available from the American Type Culture Collection under ATCC 33875.

A plasmid, pRIT12544, in which the 2218 bp Sall-Xhol LEU2 gene fragment was inserted into the SalI site of pRIT12314 was obtained from a clone of this transformation.

* ® th. The orientation of this insertion is such that the back resulting Sall site is located on that side, which is the TDH3-arg ³ expression unit at the next. The plasmid pRIT12544 is an E. coli yeast shuttle vector with a single BamHI and SmaI site lying between the TDH3 promoter and arg ³ transcription termination regions. These restriction sites are suitable for the insertion of DNA sequences which are to be under the control of the TDH3 promoter. Fig. 14 shows the preparation of pRIT12544.

C. Construction of Plasmid pRIT12658 The 3328 bp HindIII fragment from pRIT12574, a YEp13 derivative prepared according to Example 10, Part A, was transformed into a pBR322 derivative with a BamHI site deleted, which was subjected to a fill-in reaction by the T4 DNA fragment. Polymerase was destroyed, recloned. The result was the plasmid pRIT12608. This plasmid contains a unique BamHI site located at the ATG initiation codon of the CS-HBsAG coding sequence (Figure 15). The 2550 bp BamHI-SalI fragment from pRIT12608 containing the CS-HBsAg coding sequence, the arg ³ transcription termination reaction

gion and flanking pBR322 sequences was cloned between the BamHI and Sall sites of pRIT12544 (Figure 15) as described above. The plasmid was created

-87-

pRIT12658 (Figure 15). Through this exchange, the CS-HBsAg coding sequence was placed under the control of the TDH3 promoter in a yeast shuttle vector containing the complete 2 micron DNA. Fig. 15 shows the production of PRIT12658.

Example 11 Synthesis of a Hybrid Protein in Yeast

The yeast strains (Saccharomyces cerevisiae) DC5 or 10S44C were prepared according to the method described by Ito et al., J. Bacteriol., 153 (1983), 163-168, in each case with the plasmids PRIT10912 (Example 5), pRIT12573 (Example 10). , pRITi2574 (Example 10), pRIT12658 (Example 10), pRIT12329 (Example 9) and pRITi0172 (Example 2), then separated into liquid medium lacking leucine (YNB or YNB + 80 μg / ml histidine) cultivated and in the. harvested in the middle l.ogphase. Cells from 1 or 2 ml of culture were collected by centrifugation and resuspended in 50 μL of 0.125M Tris-HCl (pH 6.8) buffer containing 20 % glycerol, 4 % SDS, 6M urea and 10 % 2-mercaptoethanol. After incubation for 5 minutes at 100 ⁰ C, the sample was divided into halves, which are then separated in a 12.5% separating, 5% gel layer according to the method of Laemmli (Nature, 227 ^(1971): 680 ) were separated by electrophoresis.

HBsAg and CS protein sequences were determined by the protein immunoblot technique (see Burnette, Anal., Biochem., 112 (1981), 195-203; Gershoni and Palade, Anal. Biochem., 131 (1983), 1 Towbin and Gordon, J. Immunol., Methods, 72 (1984), 31-3-340). After electrical transfer of the proteins to a nitrocellulose filter (Schleicher and Schull, 0.45 μm) (Towbin et al., Proc. Natl. Acad. Sei., USA, 76 (1979), 4350-4354), the filter became 1 hour

-88-

in front

at 37 ° C in 3% gelatin-containing PBS / incubated. Subsequently, the filter was washed 5 times for 5 minutes each with PBS containing 0.1% Tween 20 (polyoxyethylene sorbitan monolaurate) and one half of the filter for 1 hour at room temperature with a mixture of 5 monoclonal antibodies against the CS protein (Dame et Science, 225 (1984), 593-599], in PBS, 1 % gelatin The other half of the filter was treated with a monoclonal antibody to HBsAg, HepYTAS12, in PBS, 1 % gelatin HepYTAS12 an anti-healed yeast HBsAg antibody directed against the reduction- and denaturation-resistant epitope The filters were each washed for 5 minutes with PBS, 0.1 % Tween 20 and with a second biotinylated anti-mouse sheep antibody (Amersham) in PBS , 1 % gelatin, treated at room temperature for 1 hour The filters were washed again with PBS, 0.1 % Tween 20, 5 times for 5 minutes each and then for 30 minutes at room temperature with a streptavidin-biotinylated horseradish peroxidase (HRP) complex (Amersham). The filters were again washed 3 times for 5 minutes each with PBS, 0.1 % Tween 20, and finally with 30 μΐ H "O" and HRP color developer reagent containing 30 mg 4-chloronaphine halin-1-ol (BioRad). in 10 ml of methanol, and 50 ml of PBS, incubated. The molecular weights of the antigens were estimated by comparison with the previously stained protein markers ovalbumin, alphachymotrypsinogen, beta-lactoglobulin, lysozyme, cytochrome C (BRL).

Both yeast strains DC5 and 10S44C transformed with pRIT12573 showed the production of an antigen that reacts with both anti-CS and anti-HBsAg antibodies and has an estimated molecular weight of 30 kd. , Both yeast strains DC5 and 10S44C transformed with pRIT12574 or pRIT12658 showed the production of an antigen that reacts with both anti-CS and anti-HBsAg antibodies and that has an estimated

-89-

Molecular weight of 37 kd. Some smaller molecular weight antigens have also been found, suggesting degradation of the hybrid protein. Control samples of cells containing plasmids lacking CS or HBsAg sequences (pRIT10172) showed no response. Control samples of cells containing plasmids with only HBsAg sequences (pRIT12329 or pRITiO912) showed only one reaction with the anti-HBsAg antibodies.

These results indicate that a hybrid protein of expected molecular weight containing CS and HBsAg sequences is synthesized in those yeasts transformed with a plasmid containing the CS coding sequence in the reading phase with the Pre S2 HBsAg contains fused-coding sequence.

Further, it has been shown that the band intensity in the anti-HBsAg reaction is about the same for the protein of pRIT12573 and pRIT12574, while the intensity of the anti-CS reaction for a protein of pRIT12574 is substantially higher than for a protein of pRIT12573. This indicates that with the same amount of HBsAg sequences, there are more sequences of the repeating epitope of the CS protein in pRIT12574 than in pRIT12573.

Example 12

Synthesis of hybrid particles presenting the CSP epitope

The yeast strains (Saccharomyces cerevisiae) DC5 or 10S44C containing either pRIT10172 (Example 2), pRIT12329 (Example 9), pRIT12573 (Example 10) or pRIT12574 (Example 10) were transfected into a selective medium (200 ml YNB or YNB + 80 μg / ml histidine) until the end of the log phase. The cells were collected by centrifugation and

-90-

in 10 ml of a 50 mM sodium phosphate buffer (pH 7.4) containing 0.5% Tween 20 (polyoxyethylene sorbitan monolaurate), 1 mM PMSF (phenylmethylsulfonyl fluoride) and 2.5 % isopropanol. The cells were disrupted by passing twice through a French press at a pressure of (1.38 χ 10 Pa) (20,000 psi). The suspension was centrifuged for 30 minutes at 30,000 × g. The total protein concentration of the liquid supernatant (crude cell extract) was determined by a method described by Lowry et al. (J. Biol. Chem., 193 (1951), 265-275). methods described with bovine serum albumin as standard. The presence of HBsAg was assessed by using a radioimmunoassay kit (AUSRIA II, Abbott Laboratories, North Chicago, Illinois) or an ELISA kit (Enzygnost-HBsAg Mikro, Behringwerke, Marburg).

The availability of CS sequences in the HBsAg particles for immune responses was examined in the ELISA assay discussed above. Appropriate dilutions of samples to be tested (in PBS containing 0.2 % BSA) were allowed to bind overnight to the anti-HBsAg solid phase (Enzygnost Kit). The bound HBsAg particles were incubated for 1 hour at 37 ° C with a 1: 10,000 dilution (in PBS containing 0.1% BSA) of a mixture of 5 monoclonal antibodies against the CS protein (Dame et al., Science , 225 (1984), 593-599 ^ as the first antibody and then with a 1: 500 dilution (in 'PBS containing 0.1 % BSA) of a biotinylated anti-mouse sheep immunoglobulin (Amersham) as the second Antibody incubated for 1 hour at 37 ° C. Evidence was obtained by incubating a 1: 1000 dilution (in PBS containing 0.1 % BSA) of a streptavidin-biotinylated horseradish peroxidase complex (Amersham) and a chromogen from the Enzygnost kit for 30 minutes at 37 ° C. Between each incubation step, the trays were washed 4 times with a wash solution from the Enzygnost kit The color development was performed at 510 nm in a (Titertek Multiskan

-91-

tech) photometer determined.

Measurement of protein concentration and AUSRIA activity (Table II) in crude cell extracts revealed that pRIT12573 resulted in the same level of expression of HBsAg as pRIT12329, but pRIT12574 showed 10-fold lower AUSRIA activity. Immunoblot analyzes of these extracts revealed that an equal amount of HBsAg-related protein was synthesized in these three cases.

Table II AUSRIA activity in crude cell extracts

plasmid gene protein HBsAg (RIA) HBsAg (Mg / ml) (Ng / ml) ng / mg protein

PRIT10172 - S 24 bp) PreS2-S 5.6 0 0 PRIT12329 CS ( 192 bp) PreS2-S 3.3 5700 1730 FRIT12573 CS ( 3.6 4000 1110 PRIT12574 2.8 450 160

The ELISA assay revealed that there was a structure expressing HBsAg and CS epitopes in pRITi2573 and pRIT12574 extracts (Table III) and that more responsive CS epitopes per HBsAg epitope in pRIT12574 extracts than in pRIT12573 extracts available.

To investigate the nature of these positive RIA and ELISA assay structures, mix 1 ml of the crude cell extracts with 1.5M cesium chloride in 50 nM sodium phosphate (pH 7.4) and 40 hours at 40,000Xg in a Beckman SW50.1 rotor centrifuged. Pooled fractions were assayed for the presence of HFsAg and CS antibody binding activity in the RIA and ELISA assays described above. HBsAg

-92-

and CS antigenic activity were each in the same fraction of the gradients of pRIT12573 and pRIT12574. Their float density was slightly higher (rho = 1.20 g / cm ³ ) than that in the gradient of pRIT12329 (rho = 1.18 g / cm ³ ).

Immunoblot analyzes of the gradient fractions confirmed the RIA / ELISA results. HBsAg and / or CS sequences were found only in those fractions that responded in the RIA / ELISA assay. 10

-93-

Table III

HBsAg and CS epitopes present in the antigen bound to immobilized anti-HBsAg antibodies

Raw cell extract from:

ELISA (HBsAg) ELISA (CS) dilution ^OD ₅ io ^{nm OD} 510 ^nm

1OS44C (PRIT1O172)

10S44C (PRIT12329)

1OS44C (PRIT12573)

10S44C (PRIT12574)

Loox

0000

0065

Loox 0580 0054 200X 0341 0041 400X 0188 • 0.056 Loox 1298 1596 200X 1080 1299 400X 0702 0898 80Ox 0336 0560 160Ox 0155 0323 3200X 0075 0189 Loox 0662 1678 200X 0370 1506 400X 0183 1130 80Ox 0079 0798 160Ox 0044 0449 32OOX 0061 0205

These results indicate that the hybrid proteins expressed in pRIT12573 and pRIT12574 are expressed in yeast

Particles that are similar to the 22 nm HBsAg Psrtikeln. The particles produced by the expression of pRIT12573 and pRIT12574 show the CS sequences / their surface, as evidenced by their ability to react with anti-CS antibodies. In the case of pRIT12574, those CS sequences in the RIA

-94-

In part, test the accessibility of the a-determinant of HBsAg (which is mainly responsible for AUSRIA activity).

Example 13 A. Purification of Hybrid Particles

The crude cell extract of yeast strain 10S44C containing pRIT12574 prepared according to Example 10 was purified by polyethylene glycol (PEG) 400 precipitation and concentrated by ultrafiltration in an AMICON DC chamber. This chamber contains a membrane that allows proteins to pass only up to a size of 100 kd.

The further purification of the hybrid particles was carried out by conventional methods, such as CsCl centrifugation, hydroxyapatite chromatography and gel filtration.

The final purified cell extract from 10S44C containing pRIT12574 showed a major peak in the exclusion volume of a HPLC TSK-3000 (LKB) acid having HBsAg and CS antigenicity. SDS-polyacrylamide gel electrophoresis (Laemmli, Nature, 22, 7 (1971), 680) showing silver staining (Wray et al., Anal. Biochem.

118 (1981), 197-203j, showed a major band with an estimated molecular weight (MW) of 37 kd. Electron microscopy after uranyl acetate negative staining revealed particles about the same size and shape as HBsAg obtained from yeast.

B. Purification of Hybrid Particles Crude yeast cell extracts are prepared by washing the washed yeast cells in the presence of the same weight of 50 mM sodium phosphate extraction buffer (pH 8.1), 4 mM Titriplex III, 1 % Tween 20, 4 mM PMSF and 10 % Isopropanol are added, broken up according to the "Dynomill" method.

-95-

The cell debris is removed by centrifugation at 11,000 xg for 90 min. 500 ml of the centrifuged crude extract are adjusted to pH 7.2 with 1N acetic acid and stirred overnight at 4 ⁰ C in the presence of 10 g of colloidal Kieseierde (Aerosil 380, Degussa). Subsequently, the suspension was centrifuged at 3500 kg for 1 hour and the pellet was washed three times in the course of 15 minutes with 150 ml of 0.15M NaCl added with 2 mM PMSF and 5 mM EDTA. Finally, the Aerosil pellet is eluted for 3 hours at 37 ° C with 250 ml of 10 mM pyrophosphate buffer (pH 9.5) containing 2 % Tween 20. To the eluate is added dropwise a 1M calcium chloride solution to a final concentration of 30 mM calcium chloride and the pH is adjusted to 7. The solution is allowed to stand overnight at 4 ° C and then at 6500xg for 15 minutes. centrifuged. The supernatant is dialysed against 2 × 51 μmol Tris / HCl (pH 7.1) at 4 ° C. and subsequently diluted four times with dialysis buffer.

After addition of 30 mM calcium chloride and 1 M sodium chloride, the diluted antigen solution adjusted to pH 7.1 is applied to a 150 ml column of phenyl Sepharose FF equilibrated with the same CaCl 2 / NaCl-containing Tris buffer at a flow rate of 30 cm / h separated. Subsequently, the column is washed with equilibration buffer,

the bis / OD _28Q nm goes to zero and eluted with 6M urea in 10 mM Tris / HCl pH 9 at the same flow rate.

Alternatively, the dialyzed and four times diluted antigen solution is supplemented with 20 % (NH ₄ ) "SO" (pH 7) and added to a 150 ml column of phenyl-Sepharose FF containing 10% Tris / HCl (pH 7.1) 20%. (NH _{4 2} SO ₄ J equilibrated separated at a flow rate of 30 cm / hr.. After washing the column with the equilibration buffer the column was eluted at the same flow rate with 10 mM Tris / HCl, pH 7.1, eluted.

-96-

The antigen-positive fractions were pooled and finally centrifuged at 4 ° C in one or two consecutive cesium chloride density gradients at 245 ° C for 65 hours. The purified hybrid CS-HBsAg particles have a float density of 1.23 g / cm ³ .

Example 14 Immunogenicity of hybrid particles

Hybrid particles purified from the yeast strain Saccharomyces cerevisiae 10S44C containing pRIT12574 and prepared according to Example 13 were injected in this form or with aluminum hydroxide as adjuvant into laboratory animals (Young et al., Science 228 (1985), 958-962). ..

C57Bl / 6 mice (6-8 weeks old), guinea pigs and cat

and rabbits were immunized subcutaneously / intraperitoneally on days 0, 21 and 49. The animals were bled on days 7, 28, 56 and 84. After coagulation of the blood overnight at 4 ° C the serum was separated and frozen until use at -70 ⁰ C.

Rabbits, two groups of two animals each, received 10 μl of the CS-HBsAg hybrid protein in 1 ml doses with or without aluminum hydroxide at each immunization. As a control, two rabbits were immunized with 10 μg of Heptavax B (Merck Sharpe & Dohme) following the same schedule. Mice and guinea pigs, in groups of 5 animals, received 1 and 5 μg of the hybrid protein in 0.5 ml doses at each immunization. Non-immunized animals served as controls.

In order to determine the antibody response, the sera from mice were pooled for each group, while sera from guinea pigs and rabbits were examined individually. Anti-Cb antibody titers were measured in the ELISA test.

-97-

in which the recombinant CS protein R32tet32 was used as antigen (see Young et al., Science, 228 (1985), 958 962). Anti-HBsAg titers were determined using the AUSAB kit (Abbott Laboratories) and the WHO standard.

Neither guinea pigs nor mice developed any appreciable antibody response to HBsAg with repeated administration. In contrast, these animal species developed an anti-CS antibody response that was enhanced by repeated administration. In the ELISA, an absorbance value of 1 was obtained at 1600-fold (mice) and 900-fold (guinea pig) serum dilutions. The immunogenicity of the hybrid particles was not enhanced by adsorption on aluminum hydroxide.

In contrast, rabbits developed antibodies against CS and HBsAg. Reciprocal titers with an adsorption value of 1 in the anti-CS ELISA test gave 800 and

3200. Anti-HBsAg titers obtained with the hybrid particles adsorbed on aluminum hydroxide gave 4000 and 20,000 mUl / ml, while the rabbits immunized with Heptavax gave a titer of 10 to 10 mUl / ml Adsorption of the hybrid particles to aluminum hydroxide enhanced the immune response.

Sera from mice, guinea pigs and rabbits reacted strongly in the (circumsporozoid) precipitin reaction and also well inhibited the penetration of sporozoites into liver tumor cells in vitro (Young et al., Science, 228 (1905), 958-962 / ( see Table IV.) Both reactions indicate a protective immune response.

14 9 2 91 22 3 O 96 24 1 O 100

-98-

Table IV

(Circumsporozo i d) -precipitin (CSP) reactivity and per cent inhibition of penetration of sporozoites {% IES) into HepG2-A 16 liver tumor cells

animals

1 week after the second CSP reactivity % IES administration (4+ 2+ 0)

United mouse rabbit # 36

Guinea pig # 1107

The CSP reactivity is given in parentheses:

0 - no detectable CSP reactivity

2+ - granular precipitate on the sporozoite surface

4+ - filamentous filament from the end of the sporozoites

Example 15 Vaccine Preparation

A vaccine is prepared as follows: to a buffered aqueous solution of 3 % aluminum hydroxide, 10 mM sodium phosphate, 150 mM NaCl, pH 6.8; sterilized by filtration), particles prepared according to the invention are added in the same buffer with stirring to a final concentration of the polypeptide of 100 μg / ml and the aluminum (Al ⁺ ) of 0.5 mg / ml. The pH is maintained at 6.8. The mixture is allowed to stand overnight at 0 ^° C. Thimersol is added to a final concentration of 0.005 % . The pH is checked and, if necessary, adjusted to 6.8 again.

-99-

Examples of Pre S2-S Protein and Pre Sl-Pre S2-S Protein Production in Yeast

It has been found that the insertion of the Pre f S2-S protein-anchoring> seguence in a. Yeast expression vector in yeast leads to the synthesis of particles that show the glycosylated Pre S2 protein on their surface and are very similar to the natural 22 nm HBsAg particles. It has not previously been described correctly that yeasts transformed with any part of the HBV genome express a glycosylated product.

The following examples relate to the expression of the glycosylated form of a protein in yeast which, in addition to the Pre S2 region, also contains the S protein region of the hepatitis B surface antigen. For use as a human vaccine, the protein can be isolated and purified from yeast cells in the form of particles. The PreS1-Pre S2-S protein expressed in yeast cells is also glycosylated and can be isolated and purified from yeast cells in the form of particles for use in a hepatitis B virus vaccine. With regard to the proof of glycosylation, the following should be noted:

1. Examples 25, 26 and 27 correspond to the binding of concanavalin A, the effect of tunicamycin and the

OQ is suggestive of Endoglycosidae H. Each example shows that the Pre S2-S protein species is 33 kd glycosylated. Thus, glycosylation was demonstrated by three independent methods.

2, The specificity of these agents is:

or a) Concanavalin A binds preferentially to mannose residues; b) Tunicamycin inhibits all glycosylations which are N-

-100-

glycosidically bound to asparagine;

c) the endoglycosidase H cleaves asparagine bound high mannose oligosaccharides by leaving an N-acetylglucosamine residue attached to the asparagine.

3. It is concluded from the combined results of Examples 25, 26 and 27 and that described above that the 33 kd form of Pre S2-S protein (tunicamycin inhibition, sensitivity to Endo H) is an N-linked high mannose oligosaccharide chain Share (sensitivity to Endo H). The observed change in molecular weight (about 3,000) after treatment with tunicamycin and digestion with Endo H indicates that the oligosaccharide structure is made up of about 10 sugar residues. This is about the size of a core glycosylation in yeast. Thus, probably only one of the three possible glycosylation sites in the pre S2-S protein is glycosylated.

4. The purification schemes described in Examples 28 and 29, which are aligned with respect to the sugar residues of a glycoprotein, contain an affinity chromatographic step.

5. Phenylboronate has specificity for 1,2-cis diol groups.

6. Linsensepharose is glucose-mannose-specific.

Example 16

Construction of pRIT12662 - an E. coli vector containing the Pre S2-S expression unit (Fig. 16)

Plasmid pRIT12290, prepared according to Example 3, was modified by placing the synthetic BamHI-Eco-RI extension fragment coding for the N-terminal amino acids of the Pre S2 region between the TDH3 promoter and arg ³ terminator fragments is ligated. This was done as follows:

-101-

The plasmid pRI ^rr 12290 was cleaved with the endonucleases BamHI and EcoRI and dephosphorylated with alkaline phosphatase. 200 pmol of the phosphorylated synthetic extension fragment

BamH I 5 'GATC CAG TGG 3 EcoRI

GATC gin Trp 3 5 ' CAG TGG 5 3 ' GTC ACCTTAA

were ligated with 0.1 pmol of the BamHI-EcoRI cut and dephosphorylated plasmid pRIT12290 using a unit (U) of T4 DNA ligase. The Li <tionation mixture was used to transform E. coli strain MM294 and selected for ampicillin resistance.

Ig A transformant having the desired plasmid with the synthetic extension fragment between the BamHI and EcoRI sites was identified and tsolated. The plasmid was designated pRIT12621. In the next step, the four additional base pairs (core of the BamHI site) in pRIT12621 were removed to bring the ATG codon into the read-out phase with the second codon of the Pre S2 region. In the next step, an EcoRI fragment containing the remainder of the Pre S2 coding region and the complete S coding region was ligated into the EcoRI site of pRIT1 2621. The complete Pre S2-S coding sequence was obtained. At this stage, DNA manipulations, which include linearization, deletion, and recircularization of plasmid pRIT12621, were performed without amplification by transformation of the intermediate plasmids. The procedure was as follows:

30 pmol (120 μg) of pRITi2621 DNA was linearized with 120 units of BamHI. After separation of the restriction enzyme by phenol extraction, the plasmid was precipitated by ethanol and taken up in the appropriate buffer,

*> ⁷ 4 O

-102-

to digest the single strand areas of the BamHI site with 280 units of mungo bean nuclease. The nuclease was removed by phenol extraction followed by ethanol precipitation. The thus-treated plasmid was resuspended in the ligation buffer and recircularized with 10 units of T4 DNA ligase.

The mixture containing the ligated plasmid was extracted with phenol, precipitated with ethanol and taken up in the appropriate buffer and cleaved with the enzyme EcoRI. After separation of the EcoRI endonuclease by phenol extraction and ethanol precipitation, 0.05 pmol (0.2 μg of DNA) was resuspended in the ligation buffer and incubated with 0.4 pmol (0.2 μg) of an 838 bp EcoRI fragment, which was isolated from pRIT12581 and which contains the entire C-terminal coding region of the pre S2-S protein.

A plasmid substantially similar to pRIT12581 can be constructed as follows. The vector pUC9 (available from Amersham and Pharmacia) is digested with the endonuclease EcoRI and treated with alkaline phosphatase (US Pat. No. 4,264,731). The plasmid pRIT10616 (ATCC 39131) is cleaved with EcoRI and AccI and the 826 pb EcoRI-AccI fragment containing part of the Pre S2-S coding region is obtained by preparative polyacrylamide gel electrophoresis and electroelution. Approximately 0.4 pmol (0.2 μg) of this fragment is mixed with about 10 pmol of a synthetic extension fragment having the following 12 bp 1 and formed as described in Example 8 by annealing the two single strands. This mixture is treated with T4 DNA ligase and then cut with the restriction enzyme EcoRI. To this mixture so treated is added 0.2 μg of the EcoRI-digested and alkaline phosphatase-treated pUC9 vector prepared as described above, and the mixture treated with T4 DNA ligase E. coli strain K12 transformed and listed on page 102a

- 102a -

He

Tyr Stop 5 'ATACATTTAACG

Acc l

3 'TGTAAATTGCTTAA

-103-

Ampicillin resistance selected. Colonies of these transformants were screened for the presence of a plasmid which also has an 888 bp EcoRI fragment in addition to the 2650 bp pUCii vector fragment. This EcoRI fragment comprises an 826 bp EcoRI-AccI-Pre S2-S fragment and

the 12 bp synthetic AccI-EcoRI linker. The correctness of this construction can be proven by DNA sequencing according to Maxam and Gilbert. Preferably, the DNA sequencing, starting from - ^ q of a restriction site, which occurs only in the pUC9 polylinker once.

The ligation mixture treating the plasmid DNA of pRIT12621 treated as described above and the 838 bp

^ q EcoRI fragment from pRIT12581 was used to transform E. coli strain MM294 according to Cohen et al., supra. A transformant containing a plasmid with the EcoRI fragment in the correct orientation was identified and the plasmid designated pRIT12662 (see FIG.

1A and Fig. 16). Fig. 1A shows the preparation of pRIT12662, Fig. 16 shows a restriction map of pRIT12662. The Pre S2 region of pRIT12662 was sequenced after Maxam and Gilbert to check the reading frame at the N-terminus, which looks like this:

Met GIn Trp Asn Ser

AAAC AAAC AAA ATG CAG TGG AAT TCC

PTDH3 pre S2-S

modified region

-104-

It is known to those skilled in the art that the vector pRIT12662 can also be used to introduce further functional DNA sequences into the Pre S2 region by suitable in vitro manipulations of the vector. The Pre S2 coding sequence contains the restriction sites for the EcoRI, PstI and BamHI endonucleases. Each of these restriction sites can be used to introduce functional DNA sequences encoding peptides of interest and to create, in the reading phase, fusions with the Pre S2 region. Such fusions will be from the Pre S2-introduced Sequeoz-Pre S2-S type. These restriction sites may also be manipulated in vitro by, for example, Botstein et al., Science, 229 (1985) _t 1193-1201.beschriebenenVerfahren to create other vectors and provide other restriction sites or reading frames for insertion of functional DNA sequences.

Example 17

Construction of pRIT12377 and pRIT12660, a yeast plasmid expressing the Pre S2-S protein

DNA of the plasmid pRIT12309, prepared according to Example 10B, was cleaved with the endonucleas: Sail and ligated with a 2218 bp XhoI-Sall DNA fragment containing the yeast LEU2 gene üP.Tält and by digestion of YEpI 3 and by Purification from a polyacrylamide gel was obtained. The ligation mixture was used to transform cells of E. coli K12 strain JA221 and then selected for ampicillin resistance and leucine independence. Strain JA221 is available from the American Type Culture Collection at 33875. From a transformed colony, the plasnr.d pRIT12377 was identified, which contains the 2218 bp LEU2 Xhol-Sall fragment in the SalI site of pRIT '. 2309 contains.

-105-

The orientation of the fragment is such that the recovered Sall site is on the side of the pBR327 DNA on which the aval site is located. The plasmid pRIT12377 is an E. coli yeast shuttle vector that fulfills the

Possesses flexible functions for selection, replication and stability in both organisms.

The 3050 bp HindIII fragment from pRIT12662 (Example 16) containing the Pre S2-S expression unit was amplified

* 0 Polyacrylamide gel electrophoresis purified, treated with T4 polymerase and ligated into pRIT12377. pRITi2377 had previously been opened by BamHI and treated by T4 DNA polymerase. This ligation mixture was used to transform cells of E. coli strain MM294. The cells were then selected for ampicillin resistance. An E. coli transformant having the plasmid pRITi2660 was obtained. Fig. 17 shows the preparation of pRIT12660.

nn This plasmid, pRIT12660, was used to isolate two strains of Saccharomyces cerevisiae, namely strain DC4 cir ° and strain 10S44C cir ° according to Hinnen et al., Proc. Natl. Acad. Sci., USA, 79 (1978), 2157-2161.

Both strains, DC5 cir ° and 10S44C cir °, were identified in the 25th

American Type Culture Collection, Rockville, Md., USA, according to the Budapest Treaty on Aug. 18, 1986 under ATCC 20820 and ATCC 20818.

Beispiej. 18

The Pre S2 region in plasmid pRIT12662

-106-

The Pre S2 region in plasmid pRIT12662 was sequenced after Maxam and Gilbert. It has been found that there are four base changes compared to another adw2 serotype virus (Valenzuela et al., Supra, 1980 - Table I, p. 11), which resulted in three amino acid exchanges. At position - 45 an alanine residue instead of a threonine residue, at position - 34 a phenylalanine residue instead of a leucine residue and at position - 11 a serine residue instead of an isoleucine residue. The last exchange concerns a residue that has not been altered in all known serotypes (Lo et al., Biochem., Biophys. Res. Com., 2 (1986), 382-383).

Example 19 Synthesis of Particles Having a Receptor for Polymerized Human Serum Albumin (pHSA)

The yeast strains (Saccharomyces cerevisiae) DC5 cir ° or 10S44C cir ° containing either pRIT12660 or pRIT12363 (Example 16) were mixed in the selective medium (200 ml YNB + 80 μg / ml histidine (DC5 cir °) or YNB (10S44C cir °) ) until the log phase. pRIT12363 is identical to pRIT12660 except that pRIT12363 nw contains the S gene from HBV. Cells were collected by centrifugation and resuspended in 50 mM sodium phosphate pH 8 containing 0.5% Tween 20 (polyethylene sorbitan monolaurate), 1 mM PMSF (phenylmethylsulfonyl fluoride) and 2.5% isopropanol. The cells were disrupted by passing twice through a French press at a pressure of (1.38 x 10 Pa) (20,000 psi). The suspension was centrifuged at 30,000xg for 30 minutes. The total protein concentration in the liquid supernatant (crude cell extract) was measured according to Lowry et al., J. Biol. Chem., 193 (1951), 265-275, using bovine serum albumin as a standard. The

-107-

The nature of HBsAg-related material was examined using a radioimmunoassay kit (AUSRIA II) available from Abbott Laboratories. The results (Table V) show that pRIT12660 controls the synthesis of an antigenic material related to the HBsAg particles. The level of expression based on AUSRIA activity is about the same as in the yeast strains DC5 cir and 10S44C cir °.

In a radioimmunoassay for detecting a receptor for polymerized human serum albumin (pHSA) (Pontisso et al., J. Virol. Methods, 6 (1983), 151-159), the crude extract of cells containing pRIT12660 gave a positive response unlike the crude extract from cells containing pRIT12363. No reaction over the background was obtained with polymerized Rinaerserumalbumin.

Cesium chloride equilibrium centrifugation of the crude extracts of cells containing pRIT12660 showed the AUSRIA-positive material in a band with the buoyant density rho = 1.20 g / cm ³ . This band corresponded to that obtained with HBsAg particles from serum or yeast. The material from this part of the gradient gives a positive result in the pHSA test.

The above-mentioned results show that in yeast cells containing pRIT12660, an HBsAg-related protein is expressed which has a receptor for pHSA on its surface and which is incorporated into a structure similar to the 22 nm sized particles from the serum ,

-108-

Table VA AUSRIA activity in crude cell extracts

tribe

plasmid

Protein mg / ml

HBsAg-related HBsAg-related antigenicity antigenicity

nq / ml

nq / mq bread

DC5 cir ° PRIT1266O 13.4 DC5 cir ° PRIT1266O 12.6 10S44C cir ° PRIT1266O 10.8 1OS44C cir ° PRIT1266O 9.5

7 7 6 6

522 555 556 631

Example 20

4 S-related protein species expressed in yeasts transformed with pRITi2660

, '^ ^For analyzing of HBsAg related protein monomers expressed in cells containing pRIT12660, the cells in the selective medium were either in Erlenmeyer flasks or in cultured and fermenters until the log phase were collected by centrifugation.

To the sedimented cells (0.1 g) were first 20 μΐ 40 mM PMSF in isopropanol and then 200 μΐ buffer buffer for SDS-polyacrylamide gel electrophoresis (0.125M Tris-HCl, pH 6.8 with 20 % glycerol, 4 % SDS , 6M urea and 10 % 2-mercaptoethanol). The samples were strongly vortexed and heated part quantities of 2 to 20 .mu.l further diluted in sample buffer to a final volume of 40 μΐ, 5 minutes at 100 ⁰ C and sodium in a 12.5% separation 5% layer - Gel according to a method known from Laemmli (Nature, 227 (1971), 680) electrophoretically separated.

-109-

After electrotransfer (Towbin et al., Proc. Natl. Acad.

Sci., USA, 76 (1979), 4350-4354), the proteins on a nitrocellulose filter (0.45 μm, BioRad), the filter was preincubated for 1 hour at 37 ° C in PBS with 3 % gelatin. The filter was incubated with a monoclonal antibody directed against a denaturation-reduction-resistant epitope of human isolated HBsAg (monoclonal antibody No. 6, obtained from H. Thomas, Royal Free Hospital, London, England). Antibody binding was determined by sequential incubation with biotinylated sheep anti-mouse immunoglobulin (RPN 1021, Amersham, 1: 250 dilution in PBS with 1 % gelatin), streptavidin-biotinylated horseradish peroxidcise complex (RPN 1051, Amersham, dilution 1: 400 in PBS with 1 % gelatin)

and 30 μΐ HO ₂ and HRP color developing reagent containing 4-chloronaphthalene-1-ol (BioRad), 30 mg in 10 ml of methanol and 50 ml of PBS. Between each incubation, the filter was washed with PBS containing 0.1 % Tween 20.

The immunoblot showed four protein bands related to the S protein (p23) which have an estimated molecular weight of 33 kd, 30 kd, 28 kd and 25 kd and were detected by the monoclonal antibody. The majority of the S protein-related material is found in the 33 kd protein band and migrates slightly faster than the gp33 protein known from Stibbe and Gerlich (Virology, 123 (1982), 436-442). The smallest protein band migrates more slowly than the yeast-synthesized S protein (p23).

Example 21

4 S-related protein species (33 kd, 30 kd, 28 kd and 25 kd) which are assembled into particles

Crude extracts from cells containing pRITi2660 (Example 16) are prepared as described in Example 19.

-110-

Alternatively, yeast cells are grown in a Dynomill (in the presence of the same weight of extraction buffer) (200 mM Tris, 3M NaCl, 10 mM EDTA, 10 mM ethylene glycol bis (beta-aminoethyl ether) -N, N, N ', N'-tetraacetic acid (EGTA), 4 mM PMSF, 10% isopropanol) and then centrifuged for 45 minutes at 30,000Xg.

The particles attributable to pRITi2660 are partially purified from the crude cell extract by ultrafiltration, cesium chloride equilibrium centrifugation and hydroxyapatite chromatography. These methods are known. The four protein bands of the S protein-related material, as determined by Western blot analysis, are purified by these steps.

Immunoblot analysis (as described in Example 20) of the AUSRIA-positive cesium chloride fractions after equilibrium centrifugation showed that the 4S-related bands are present in each fraction with the same relative amounts.

The material is thus distributed in a homogeneous manner over the peak fractions of the gradient

\

Example 22

33 kd and 30 kd proteins that have a receptor for polymerized human serum albumin

Human serum albumin (Sigma, A 8763) was polymerized by a glutaraldehyde treatment (Merck, A-12179) and purified according to a method described in Pontisso et al. (J. Virol., Methods, 6 (1973), 151 159) The reactivity of the 4S-related proteins to pHSA was tested in a Western blot Partially purified preparations of particles bound to pRIT126b0 (Example 21V SDS-polyacrylamide gel electrophoresis was separated and switched to a nitro-.

-111-

cellulose filter according to Example 20 transferred. The nitrocellulose filter was washed sequentially with pHSA (15 μg / ml in PBS with 1 % gelatin), rabbit antiserum to human albumin (Behringwerke, ORCB 04/05, 1/125 dilution in PBS with 1 % gelatin), biotinylated donkey anti-rabbit Immunoglobulin (Amersham RPN 1004, 1/250 dilution in PBS with 1 % gelatin), streptavidin-biotinylated horseradish peroxidase (Amersham RPN 1051 1/400 dilution in PBS with 1 % gelatin) and H_O ₂ and 4-chloro-naphthalene-1 Incubated oil according to Example 20.

The two largest S-related protein bands (the 33kd and 30kd protein) reacted with pHSA, while the two smallest (28kd and 25kd proteins) did not react. 15

Example 23

33 kd and 30 kd proteins containing a specific sequence for the Pre S2 region of the Pre S2-S protein

A peptide which has 23 of 26 N-terminal amino acids of the Pre S2-S protein was synthesized (NH ₂ -Met-Glu-Trp-Asn-Ser-Thr-Aia-Phe-His-Gin-Ala-Leu-Gin -Asp-Pro-Arg-Val-Arg-Gly-Leu-Tyr-Leu-Pro-Ala-Gly-Cys-COOH) and bound to limpet hemocyanin (Peninsula Laboratories) via the C-terminal end. Rabbits were subcutaneously immunized with 100 μg of the conjugate (this corresponds to 20 μg of peptide) in Freund's complete adjuvant. On days 8 and 15, another 100 μg of conjugate was administered in Freund's complete adjuvant and on days 28, 69 and 149 another 100 μg in PBS. The development of the antibody titer was followed by taking blood samples at regular intervals and testing serum dilutions by incubation with synthetic peptide present in solid phase.

Bound antibodies were detected by iodinated protein A (New England Nuclear). For use in immunoblot

-112-

Sera were selected which had an anti-peptide titer greater than or equal to 1/5120. The serum was used after a 100-fold dilution or after partial purification of the IgG. IgG was partially purified by precipitation with Na-SC 2 (120 mg / ml serum), resuspended in PBS and repeated precipitation with 14 % Na 2 SO 4. The resuspended IgG solution was desalted on a PD1O column (Pharmacia).

The determination of the reactivity of these antibodies to the S-related proteins in the immunoblot was carried out according to Example 22 by adding biotinylated donkey anti-rabbit immunoglobulin, streptavidin-biotinylated horseradish peroxidase and H ₂ O_ and 4-chloro-naphthalene-1 oil.

Proteins from partially purified preparations of the particles due to pRIT12660 (Example 21) were separated by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose according to Example 20. The gel was also loaded with S protein (p23) particles purified from yeast containing pRIT12363. The immunoblot showed that the two largest S-related protein bands (33kd and 30kd band) react with the anti-peptide antibodies while the two smallest (28kd and 25kd bands) did not react. The S protein (p23) shows no reaction with the anti-peptide antibody.

Example 24

Human anti-hepatitis B antibodies from naturally infected individuals that recognize one or more epitopes on 33kd and 30kd Pre S2-S proteins that are not present on the S protein

-113-

The reactivity of pooled gamma globulin from anti-hepatitis B positive patients (Belgian Red Cross, 100-150 IU / ml Lot 85A08) against the four S-related proteins was tested with the immunoblot method described in Example 20. A partially purified preparation (Example 21) of particles due to pRIT12660 was dissociated by SDS and the released proteins separated by CDS-polyacrylamide gel electrophoresis. After transfer of the proteins to a nitrocellulose filter, the filter was incubated with a 10-fold dilution of anti-hepatitis B gamma globulin in PBS with 1 % gelatin. Antibody binding was performed as described in Example 20 by sequential incubation with biotinylated sheep antihuman immunoglobulin (Amersham RPN1003, 1/250 dilution in PBS with 1 % gelatin), streptavidin-biotinylated horseradish peroxidase, and H "O_ and 4-chloro-naphthalene. 1-oil determined.

The two largest S-related protein bands (33 kd and 30 kd band) react with the human antibodies, while the two smallest (28 kd and 25 kd bands) show no reaction. The S protein (p23) derived from particles of yeast cells containing pRIT12363 does not react with these human antibodies. These results show that gamma globulin, which is obtained from infected individuals, ¹ specifically recognizes epitopes on denatured and reduced pre S2-S protoins that are not present on denatured reduced Tiss S protein. It is known that the epitopes on the S-protein derived from human yeast or yeast are predominantly the same. >

Example 10A

The 33 kd protein species possesses a mannose-containing oligosaccharide structure.

-114-

The pre S2-S protein from partially purified preparations of particles from 10S44C cir ° cells containing pRITi2660 was electrophoresed and transferred to a nitrocellulose filter according to Example 20. The gel also contained the S protein from purified yeast particles containing pRITi2363 and HBsAg particles from infected human serum, which were used by Drs. W.H. Gerlich, Institute for Medical Microbiology, University of Göttingen.

10

One half of the nitrocellulose filter was incubated with 50 μg / ml Concanavalin A (Calbiochem A grade) in 10 mM tris pH 7.5, 150 mM sodium chloride, 1 mM CaCl ₂ , 1 mM MnCl ₂ and 0.05 % Tween 20 and subsequently with 30 μg / ml horseradish peroxidase (Sigma type VI P 8375) in 10 mM tris pH 7.5, 150 mM NaCl and 0.05% Tween 20 and with H "O ₂ and 4-chloronaphthalen-1-ol according to the example 20 incubated.

Between the individual incubation steps, FiIte.v was incubated with 10 mM Tris pH 7.5, 150 mM sodium chloride and 0.05% Tween 20 (Hawkes, Anal. Biochem., 123 (1982), 143-146; Clegg, Anal Biochem., 127 (1982), 389-394). The other half of the nitrocellulose filter was incubated with monoclonal antibody 6 and treated according to Example 20.

The 33K protein band reacts with the concanavalin A peroxidase reagent, while none of the 30 kd, 28 kd and 25 kd protein bands or the S protein derived from cells react with 3Q containing pRIT12363. In the presence of 0.1 M methyl alpha-D-mannopyranoside, the binding of concanavalin A to the 33K protein is prevented.

35

-115-

Example 26 An oligosaccharide structure N-glycosidically linked to asparagine

Cells containing pRIT12660 or pRIT12377 (Example 17) were cultured in the selective medium [YNB + 80 μg / ml histidine (DC5 cir ^e ) or YNB (10S44C cir °) 3 to an OD ₆₂ _nm of 0.2. Tunicamycin (Calbiochem) was added to a final concentration of 10 μg / ml and the culture

35 incubated at 30 ⁰ C for 30 minutes. Then 20 μCi S-methionine (1000 Ci / mmol) (New England Nuclear) per ml was added and the cultures were incubated for an additional 15 minutes. 2 ml of the labeled cell culture, either capped with tunicamycin or left untreated, were centrifuged in (microfuge) and the cells were then taken up in 40 μL of 1 % SDS and vigorously vortexed in the presence of 0.3 g glass beads (diameter 0 , 45 to 0.50 mm) unlocked.

Immunoprecipitation was performed essentially according to the method described by Julius et al. Cell, 36 (1984), 309-318. The lysate was boiled for 3 minutes at 100 ^° C., diluted with 0 _v 5 ml of PBS containing 1 % Triton X100, 0.5 % sodium deoxycholate and 0.1% SDS, and boiled again at 100 ^° C. for 1 minute.

25 μΐ of a 10% suspension of prewashed Immunopräzipitin (formalin-fixed Staph Α cells, Bethesda Research Laboratories) were added to the boiled extract and C ·· eser then 30 minutes bsi 0 ⁰ C. The mixture was purified by centrifugation in a microfuge for 5 minutes. To the liquid supernatant was added 2.5 μΐ of the monoclonal antibody 6 specific for the S protein (see Example 20) and the mixture was incubated at ⁰ ° C for 1 h. An additional 25 μM of the immunoprecipitin was then added and the mixture

-116-

was incubated at ⁰ ° C for 30 minutes. The immune complexes were collected by centrifugation (5 minutes in a microcentrifuge) and washed with PBS containing 2M urea with PBS containing 1 % 2-mercaptoethanol and with PBS without additive. The last obtained sediments were resuspended in sample buffer for electrophoresis according to Example 20.

Samples containing 10 cpm were electrophoresed in a 12.5% SDS-polyacrylamide gel (see Example 20). After electrophoresis, the gels were fixed in 40 % methanol, 10 % acetic acid, treated with amplifier solution (Amersham) for autoradiography, and dried under reduced pressure on a filter paper. The autoradiography was created by a Kodak X-Omat S-FiIm was placed on the gels and these were then enclosed at -70 ^0C.

These results showed that cells containing pRIT12660 synthesize a 33 kd protein in the absence of tunicamycin while synthesizing a 30 kd protein in the presence of tunicamycin. Both bands are absent in the corresponding samples of cells containing pRIT12377.

This result shows that the 3kd Pre S2-S protein expressed in the yeast strain DC5 cir carries an oligosaccharide moiety which is N-linked to the asparagine residue N-glycosidically bound kd form of the pre S2-S protein, which is not much larger than a core glycosylation.

Example 27 Oligosaccharide structure containing a high proportion of mannose

-117-

Crude extracts from cells containing pRIT12660, or partially purified particles from these extracts containing Pre S2-S (Example 21) were mixed with endo-N-acetylglucosaminidase (Endo H; EC.3.2.1.96) from Streptomyces plicatus. (New England Nuclear).

Partially purified particles (50 μΐ, 450 ug / ml protein) were boiled for 3 minutes at 100 ⁰ C in the presence of 0.1% sodium dodecyl sulfate and then veraiAnnt 10-fold with 100 mM sodium citrate pK. 5 To 240 μΐ of this mixture was added 2.4 μΐ of Endo H (74 μg / ml). Samples with and without added Endo H were incubated for 4 hours at 37 ° C. The analysis of the Endo Η-treated and untreated samples by SDS-polyacrylamide gel electrophoresis and immunoblot, in which to determine the monoclonal antibody 6 against the S protein; as described in Example 20, showed the disappearance of the 33 kdr band and the appearance of a 31 kd band after treatment with Endo H. The 31 kd band still reacts with the concanavalin A peroxidase reagents, such as described above. The other bands (30 kd, 28 kd and 25 kd) were unaffected by Endo H treatment. Longer incubations or higher Endo H concentrations gave identical results. The result shows that the oligosaccharide structure bound to the 33 kd protein contains a high proportion of mannose and is about the size of a core glycosylation.

Example 28 Purification of Particles Containing the Pre S2-S Protein

Ro yeast extracts of yeast cells containing Pre S2-S particles were prepared by washing the washed yeast cells in a "Dynomill" in the presence of an equal weight of extraction buffer containing either 50 mM sodium phosphate pH 8.1,

-118-

Contains 4 mM EDTA, 1.0 % Tween 20, 4 mM PMSF and 10 % isopropanol or 200 mM Tris-HCl pH 9.0, 3, OM NaCl, 10 mM EDTA, 10 mM EGTA (ethylene glycol-bis-beta-aminoethyl ether -N, N, N ', N'-tetraacetic acid), 1% Tween 20, 4 mM PMSF and 10 % isopropanol.

The homogeneous suspension is adjusted to pH 8.0 or 9.0 and then centrifuged for 45 minutes at 30,000 * g.

500 ml of the crude yeast extract, adjusted to pH 7.2, are mixed with 10 g of colloidal silica gel (Aerosil 380 Degussa). The colloidal suspension is stirred overnight at 4 ° C and then centrifuged off at low speed. The sediment is washed three times with 150 ml 0.15 M NaCl for 15 minutes each, and then eluted batchwise with 250 ml of 10M Pyrophosphatpuf f it (pH 9, 3) containing 2% Tereen-20 ", for 3 hours at 37 ⁰ C. The Eluate, a yellowish, slightly iridescent solution, is passed through a 50 ml column of phenyl boronate agarose (Amicon) equilibrated in 10 mM pyrophosphate buffer pH 9. The flow rate is 15 ml / hr.

The column is further washed with 2 column volumes of the equilibration buffer and then in the reverse direction with 100 mM sorbitol in 50 mM Tris (pH 7.2) at a flow rate of 15 ml / hr. eluted. Eluted fractions of the peak were pooled and added after adjusting the pH to 8.1 over a (DEAE-Fractogel) TSK column equilibrated in 50 mM Tris pH 8.1. Particles are eluted in the same buffer containing 75 mM NaCl. After this step, residual nucleic acids are removed (<1 μg / 20 μg protein). The results are shown in Table VI.

-119-

Table VI Two Step Purification of Pre S2-S-Containing Particles

fraction

mg S-related

protein mg ml (RIA) protein

mg

mg poly- lipids saccharides

crude extract

500 11.3 14,600 5,286

7850

Eluate (Aerosil)

270

5.96

385

554

249

Flow PBA column

315

2.83 *

365

360

267

Eluate · PBA column

70

2.3

2.9

2.5

* not sufficiently glycosylated to be attached to the column.

Material purified from cells containing pRIT12660 according to Example 28 and further purified by cesium chloride equilibrium centrifugation was examined by electron microscopy after staining with uranyl acetate. The study revealed single particle structures approximately 19 microns in diameter and further that such hybrid particles contained between 5 to 20 μg Tween 20 per 100 μg protein.

example

Affinity chromatography on lenssepharose

-120-

In this example, chromatography on phenyl boronate agarose is replaced by affinity chromatography on Lens-Sepharose (Pharmacia).

Fifty milliliters of the Aerosil eluate obtained according to Example 28 were added to a 5 ml column of lens sepharose equilibrated in an equilibration buffer containing 10 mM Tris (pH 7.2), 0.14M NaCl and 0.3 % Tween has been. The column was washed with 2 column volumes of an equilibration buffer containing 10 mM Tris (pH 7.2) and then eluted with this equilibration buffer which additionally contains a sugar. The sugar used has a specificity for lenses and is, for example, 0.5M alpha-methyl mannopyranoside. The results are shown in Table VII.

Table VII

Use of Lens Sepharose Affinity Chromatography to Purify Pre S2-S Containing Particles

fraction

Volume _v q S-related _Total _

τ · OG

(ml) protein (RIA) protein

crude extract

Eluate (Aerosil)

2170

1700

3 gr

138 mg

Flow Lens Sepharose

Eluate Lentil Sepharose

12.5

428

925

1.26 mg

The investigation revealed that the hybrid particles purified as described contain from 5 to 50 μg Tween 20 per 100 μg protein.

Contained -111-tein.

Example 30 Immunogenicity of Pre S2-S Particle

The immunogenicity of particles isolated from extracts of cells containing pRIT12660 (Example 16) was assayed on 2 mouse strains: Balb / c (H ₂ d) and NMR 1 (H ₀ Q). Before the injection, the particles were added to Al (OH). The mice (5 mice per group) were injected intraperitoneally with 0.3 μg of the RIA-reactive material. One month after immunization, the mice were bled and the sera from mice of the same group pooled. The titer of the anti-S antibodies of the pooled sera was determined using the AUSAB kit (Abbott Labs) and the WHO standard. Titers were converted to mlu / ml according to the Hollinger formula (Hollinger et al., Szmuness et al., Viral Hepatitis, Philadelphia: Franklin Institute Press, 1982, 451-466). The anti-Pre S2 antibodies were determined in a solid phase assay (RIA) in which the synthetic Pre S2 peptide of Example 23 is fixed to a synthetic resin and the bound antibodies are detected by a goat

1 25 anti-mouse immunoglobulin IgG, which is labeled with iodine, can be determined. The results summarized in Table VIII show that the particles of cells containing pRIT12660 induce antibodies to the anti-S and anti-Pre S2 peptide in both mouse strains. In the mouse strain NMR1, a higher antibody titer is induced against the anti-Pre S2 peptide than in the Starnm Balb / c. The anti-S titer obtained in strains Balb / c or NMR1 is 2 to 3 times higher than that obtained by a higher dose of particles without Pre S2 sequence from cells containing pRIT12363. Pre S determinants enhance the response to S determinants. This enhancement effect is not apparent when the Pre S2 synthetic peptide is

-122-

together with particles lacking the Pre S2 sequence is injected. Moreover, the synthetic Pre S2 peptide alone is unable to elicit anti-pre S2 antibodies.

This demonstrates that the linkage of Pre S2 determinants and S determinants on the same particle is necessary to obtain an anti-Pre S2 response. In addition, this linkage leads to an improved anti-S response. 10

The results of the immunogenicity studies concerning the Pre S2-S particle are summarized in Table VIII. 15

-123-

Table VIII Immunogenicity of the Pre S2-S particle

dose

Injected Antigen-related Antigen (Ug) (I)

Titers of

Anti-S antibody

(mlU / ml) (2)

Balb / c NMRl

Yeast-derived S-particle due to PRIT12363

1

1404

719

Anti-Pre S2 Antibody (3)

Balb / c NMRl

Yeast containing 1.55 S-particles due to PRIT12363 and the synthetic Pre S2 peptide

0.08 ug

Synthetic Pre S2 peptide:

l 0.08 ug

Yeast derived (Pre S2-S) particle due to pRIT12660

748

1163

0.3 3344

2418

120

(1) determined by the AUSRIA kit (Abbott Labs) and the "Proposed International Reference Preparation" by Dr. med. Shield, National Institute of Biological Standardization, London.

-124-

(2) determined with the AUSAB Kit (Abbott Labs) and the

WHO standard (3) determined with a Festpiü'senradioi mmun test and fixed to a synthetic synthetic Pre S2 peptide.

The titer has the dilution, which leads to a clear binding of the antibody (2.5 times stronger than the negative control serum)

 10

Examples of expression of the entire Pre S1-Pre S2-S protein coding sequence in yeast

Example 31

Construction of the plasmid pRIT12845 expressing the Pre S1-Pre S2-S protein in yeast

In the first step, the TDH3 promoter region was fused to the Pre S1 N-terminal region from the HBV genome. The starting material was the plasmid pRIT12792, which has a 495 bp Ncol-XbaI fragment containing the Pre S1-Pre S2 coding sequence except for the last asparagine codon. The Ncol site overlaps the ATG codon of the amino acid residue at site-163 of the HBV Pre S1 sequence. The sequence of the NcoI-XbaI fragment is shown in Fig. 4A.

A substantially similar plasmid to pRIT12792 is pRIT12793 (5940 bp) deposited with the American Type Culture Collection, Rockville, Maryland, USA under the Budapest Treaty on Sept. 5, 1986 under ATCC 67193. From the plasmid pRIT12793 a 495 bp Ncol-XbaI fragment can be obtained which contains the complete PreSi-Pre S2 coding sequence. This fragment, which at the 3'-end the

-125-

Sequence αCGAACTAATAATCTAGA differs from that shown in Fig. 4A by a single nucleotide. This nucleotide is underlined. In the following examples, PRIT12792 can be replaced by pRIT12793. The NcoI-XbaI fragments contained in pRIT12792 and pRIT12793 were obtained by in vitro manipulation of the pre S1-Pre S2 DNA region of the hepatitis B virus stalk (serotype adw) whose DNA is cloned in pRIT10616. Pla.-jmid pRIT10616 is available from the American Type Culture Collection under ATCC 39131.

52 μg of pRIT12792 was cleaved with the restriction enzyme Ncol and XbaI and treated with mungo bean nuclease to remove the 5 'protruding ends. 600 ng (2 pmol) of the treated and purified 495 bp Ncol-XbaI fragment were ligated with 170 ng (0.02 pmol) of the pRIT12314 vector. pRIT12314 had been opened with the restriction enzymes BamHI and Smal and also treated with mungo bean nuclease. pRITi2314 contains the complete 2 micron DNA fragment of S. cerevisiae and a Fxpression unit in which the TDH3 promoter is qotrennt by an ia-HI-SmaI-EcoRI linker from the arg ³ termination ^ n.

BamH I EcoR I

Smal

ATGGATCCCCGGGAATTC ....

Promoter TDH-. Termination Region ARG ₃

A detailed description of the construction of pRIT12314 can be found in Example 10 (3). The ligation mixture described above was used to transform E. coli, strain MM294, and was then selected for ampicillin resistance

-126-

containing a plasmid in which the Pre S1-Pre S2 fragment is inserted in the correct orientation were obtained. The plasmids of these transformants are pRIT12843 (a .... f) (Figure 18).

The second step was the insertion of the S-coding region into each of the plasmids pRIT12843 (a .... f) to obtain the complete Pre S1-S2-S gene.

This was done as follows:

The plasmids pRIT12843 (a .... f) were each cut with the enzymes BamHI and Sail. The BamHI site is located at the beginning of the Pre S2 region, while the Sall site lies behind the arg ³ termination region in the pBR327 DNA.

80 ng (0.012 / μmol) of the largest BamHI-SalI fragment

(10,400 bp) derived from each plasmid pRIT12843 (a f)

were ligated with 300 ng (0.11 pmol) of the small BamHI-SalI fragment of pRIT12660 (Example 16). The small (4800 bp) BamHI-SalI fragment from pRIT12660 ent _r holds a part of the pre S2-S-coding sequence, the ARG terminator sequences and the LEU2 yeast sequence-. After ligation and transformation of E. coli, strain MM294, with each of the plasmids pRIT12843 (a .... f) according to Cohen et al.,

supra, a series of ampicillin-resistant clones were obtained carrying the designated plasmids pRIT12845 (a .... f). Fig. 18 shows the preparation of pRIT12845 (a .... f). These plasmids were used to solubilize individually the sucrose.

myces cerevisiae strain 10S44C cir ° according to Ito et al. to 30

transform. Cultures of individual transformed clones were tested with the AUSRIA test (Abbott). Crude cell extracts from digested yeast cells were resuspended in PBS containing 0.5 % Tween 20, 2 mM PMSF and 5 % isopropanol. From each of the six separate transformations -

[with pRIT12845 (a .... f ^ a transformant was excluded

-127-

chooses and tests. Five of the six transformants tested gave a positive AUSRIA test. ,

To determine whether a protein showing S-related antigenicity in the AUSRIA assay was full size, samples of the crude cell extracts described above were immunoblotted as described in Example 20. Four of the five AUSRIA positive transformants showed an S-related protein of about 39K. One transformant (extract yes) showed an S-related protein of 23K. The plasmid responsible for the expression of the 39K protein in the extract (s) is called pRlT12845; see. Fig. 18.

15

Example 32

Particles composed of Pre S1-Pre S2-S protein carrying a receptor for polymerized human β β-serum albumin and a pre S1 epitope on its surface

Crude extracts from cells of strain 10S44C cir °, which are either

containing pRIT12845, pRITi2660 or pRITi2377, and crude extracts from cells of strain DC5 cir °, containing pRIT12363, were prepared according to Example 19. Determination of total protein concentration, HBsAg-related antigenicity, and determination of a polymerized human serum albumin receptor were performed according to Example 19. The result showed strong binding activity for polymerized human serum albumin in extracts of strain 10S44C cir ° containing pRIT12843 I or pRIT12660 (see also Example 10) but no binding activity in extracts of strain 10S44C cir 'containing pRIT12377 or of strain DC5 cir ° , the

OO

pRIT12363 included.

-128-

Cesium chloride equilibrium centrifugation of crude extracts from cells of strain 10S44C cir ° containing pRIT12845 (described in Example 12) and the HBsA related antigenicity determined in the AUSRIA assay for individual cesium chloride fractions gave the antigen a band having a buoyant density of about 1.2 g / cm ³ . This was confirmed by immunoblot analysis of the cesium chloride fractions. Pre S1 antibody binding activity in the casiumchloride fractions was determined in the ELISA assay described in Example 12. Following binding of the antigen to the solid-phase anti-HBsAg antibodies, the bound antigen was incubated with monoclonal antibody MA18 / 7 (Example 31), which was then biotinylated anti-mouse immunoglobulin, streptavidin-biotinylated

horseradish peroxidase complex and chromogen according to Example 12 was determined.

It has been found that the Pre S1-specific antibody binding activity and the HBsAg-related antigenicity in the cesium chloride gradient run at the same level. These results demonstrate that Pre S1-Pre S2-S protein produced in cells of strain 10S44C cir ° containing pRIT12845 is incorporated into particles similar to the 22 nm HBsAg particles from the serum. The particles show on their surface Pre S1 n-specific sequences and a receptor for polymerized human serum albumin. From the level of activity of the particle in the AUSRIA test and the intensity of the reaction of the Pre S1-Pre S2-S protein in an immunoblot analysis, it can be concluded that the

Q ₀ S determinants of the particle are partially blocked by the Pre S sequences? N that particles or deformed.

Example 33

Two proteins, with a molecular weight of about 38 and 45 kd, both Pre S1, Pre S2 and S epitopes

-129-

j and expressed in yeast containing pRIT12845.

HBsAg-related protein monomers expressed in cells containing pR.TT12845 were analyzed as described in Example 20.

The migration and immunoreactivity of cellular proteins

were mixed with proteins from HBsAg particles (serotype ad), the

^ q were purified from human serum (obtained from Dr. W.H.

Gerlich, Institute of Medical Microbiology, University of Göttingen).

Three immunoreactants were used to analyze the proteins ^:

the monoclonal antibody recognizing an S epitope (obtained from H. Thomas example 20).

a polyvalent rabbit antiserum against the synthetic Pre S2 peptide (described in Example 23)

2Q - monoclonal antibody MA18 / 7 specific for a pre S1 epitope; see. Heerman et al., J. Virol., 52 (1984), 396 - 402.

The immunoblot showed among the cellular proteins from the cells of strain 10S44C containing pRIT12845 the presence of two proteins that react specifically with all three immunoreagents described above. The molecular weight of these two proteins was estimated to be 38 and 45 kd. The molecular weight determination of the proteins O _{0 was} based on the migration of the serum-derived

HBsAg as described by Heerman et al., J. Virol., 52 (1984), 396, 402. The 38 kd. large Pre S1 Pre S2-S protein encoded by pRIT12845 migrates slightly faster than the ρ39 Pre S1-Pre S2-S protein derived from _g5 HBsAg particles. The p39 protein of serotype ad particles from human serum is thought to have a pre S1

7 4 0

-130-

Region of 119 amino acids (Heerman et al., J. Virol. 52, 396 - 402, 1984). pRIT12845 encodes a pre S1 region of 108 amino acids.

These results show that yeast cells containing pRIT12845 express two proteins of about 38 and <5 kd, the Pre S1. Wear pre S2 and S epitopes.

YQ example 34

The 45 kd Pre S1-Pre S2-S protein species containing an N-glycosidically linked oligosaccharide chain containing a high proportion of mannose

Cells containing pRIT12845 were incubated with an equal weight of glass beads (diameter 0.45 to 0.55 mm) in an equal weight 10 mM sodium phosphate buffer (pH 7.4) containing 2 % SDS and 8 mM EDTA contains, by vigorous stirring up with a (vortex) mixer

2Q closed.

After centrifugation, the supernatant was boiled at 100 ^° C. for 4 minutes.

10 μΐ of boiled liquid supernatant were washed with. 40 μM 25 mM sodium citrate buffer (pH 5.0) and 2 μM EndoH (74 μg / ml) (see Example 27). Samples with and without added endoH were incubated at 37 ° C for 2 1/2 hours.

QQ The EndoH-treated and untreated samples were analyzed by SDS-polyacrylamide gel electrophoresis and Immunoblot according to Example 20. The blot was analyzed with monoclonal antibodies 6 (S-specific) and MA18 / 7 (Pre S1-specific) (see Example 33).

The immunoblot showed with both monoclonal antibodies the

-131-

Disappearance of the 45 kd band and the appearance of a 41 kd band after EndoH treatment. The migration of the 38 kd band was not affected by the EndoH treatment.

These results indicate that the 45 kd Pre S1-Pre S2-S protein species carries an N-linked oligosaccharide chain containing a high mannose content.

Example 35 The 38 kd Pre S1-Pre S2-S Protein Containing Myristic Acid Covalently Bonded Through an Ί Amide Bond

Cells of the yeast strain 10S44C cir ° containing either pRIT12845, pRIT12660 or pRIT12377 were grown in YNB to an optical density of 0.4 _on.

ozunm

Cells (20 ml of culture) were labeled with 1 mCi of 3H-labeled myristic acid (New England Nuclear) for 60 minutes and then collected by centrifugation. The cells were washed with cold water, resuspended in 100μl of 5mM Tris-HCl (pH 7.4) containing 3mM (DTT), 1 % SDS, and 1mM PMSF, and replaced with 100mg glass beads by weekly, 30x Whirling for a few seconds was broken apart from a vortex, with ice being cooled between the individual fluidization steps. Cell debris was removed by centrifugation for 1 minute in an Eppendorff 5414 centrifuge (Towler and Glaser, Proc. Natl. Acad., Sei., 83 (1986), 2812-2816). 20 μl of the extract were treated for 3 1/2 hours at room temperature with _f 7 μl of a freshly prepared solution of 4M hydroxylamine, 20 mM glycine pH 10,

Hydroxylamine treated and untreated samples were resolved by SDS-polyacrylamide gel electrophoresis and presented by subsequent autoradiography according to Example 26. The hydroxylamine-untreated samples were

-132-

also subjected to an immunoblot analysis with the monoclonal antibody against an S-epitope according to Example 20.

The immunoblot showed results identical to those of Examples 20 and 33. Autoradiography revealed a labeled band of 38 kd only in the extracts from cells containing pRIT12845. The band was hydroxylamine-stable.

, ester This indicates that 3H-labeled myristic acid is present via an amide bond. No labeled bands specific for the extracts of cells containing pRIT12660 were determined.

These results show that the 38 kd Pre S1-Pre S2-S protein has a myrmic covalently bound via an amide bond.

ester

contains stingic acid. In general, myristic acid / covalently binds to proteins via an amide bond to an amino-terminal glycine. This indicates that the remainder Met at the N-terminus of the Pre S1-Pre S2-S protein has been removed and that the residue Gly, at position 2 has become available for acylation with myristic acid.

Example 36 Use of Pre S1 Vectors for Insertion of Functional DNA Sequences

The starting material is the plasmid pRIT12793 described in Example 31. The plasmid contains the Pre S1-Pre S2 coding sequence on a 495 bp Ncol-XbaI fragment. The plasmid pRIT12793 is cleaved with the restriction endonuclease Ncol, treated with T4 DNA polymerase to fill in the overhanging single strands and rescored with XbaI endonuclease. The Ncol-XbaI fragment thus treated was purified by polyacrylamide gel electrophoresis and electroelution and inserted into the vector pUC12,

-133-

which was cleaved with the endonucleases SmaI and XbaI. The cloning vector pUC12 is available from Amersham (Little Chalfont, Bucks, United Kingdom) and Pharmacia (Piscataway, NJ). The plasmid pRITX is shown in FIG.

5B. receive. In the Pre S1-Pre S2 region of the pRITX plasmid, the unique Ncol site overlaps the ATG start codon of the Pre S1 region. An XbaI site is immediately adjacent and downstream of the TAA stop codon at the C-terminus of the Pre S2 coding sequence. The only BstX restriction site is near the N-terminal end of the Pre Sl coding region.

It is known to those skilled in the art that the vector pRITX or similar derivatized vectors containing the pre S1-S2 sequences can be used for insertion at the BstXI site of other functional DNA sequences encoding peptides of interest, around these sequences

Reading phase to merge into / with the Pre S1 region.

In addition, functional DNA sequences following double digestion of pRITX and derivatives with BstX and BamHI or EcoRI and PstI and the removal of the major portion of the Pre S1 coding region and the N-terminal portion of the Pre S2 sequence may be introduced between the corresponding restriction sites become. Such fusions will be of type Pre S1-introduced functional DNA pre S2 sequences. Once such fusions are made, they can be recombined into other plasmids containing the remainder of the Pre S1-Pre S2 sequences and those sequences required for stability and replication in E. coli and Saccharomyces cerevisiae (see Example 16A) are.

Example 37 Fusion of a peptide from proteins of the HTLVIII virus and the Pre S2 region from the Pre S2-S sequence to produce new hybrid particles

-134-

The Pre S2 region of an HBV Pre S2 coding sequence can also be used for fusion with peptide sequences of other viral antigens, including those of the retrovirus known as HIV, HTLV-III or LAV, which is the causative agent of AIDS.

The cloned genome of an HIV virus is from Ratner L. et al. , Nature, 313 (1985), 277-284, and Shaw G. et al. , Science, 226 (1984), 1165-1171,. known. From this genomic clone, various subfragments can be obtained as functional DNA sequences encoding peptides of interest. The fusion of such functional sequences with the Pre S2-S sequence can be exploited to produce novel hybrid particles containing HIV viral protein epitopes. Such hybrid particles can serve as the basis for a human vaccine against the infectious HIV virus.

The following peptide regions are of interest:

a) C7 peptide

This region comprises 45 amino acid residues; it lies directly at the site, - where the precursor coat protein is cleaved; see. Starcich B.R. et al., Cell, 45 (1986); 637-648.

b) peptide 121 .

This region has a relatively conserved amino acid sequence present in several retroviral (transmembrane) envelope proteins; see. Cianciolo G.J. et al., Science, 230 (1985), 453-455. This sequence is believed to be involved in retrovirus-induced immunosuppression; see. Synderman R. and Cianciolo G.J., Immunol. Today, 5 (1984), 240.

-135-

c) "Dreesman peptide"

The synthetic peptide corresponds to the amino acid sequence 735 to 752 of the glycosylated precursor envelope protein of HIV. This peptide was developed by Kennedy R.C. et al., Science, 231 (1986), 1556-1559, used to immunize rabbits. The antiserum obtained was used to study the detection of HIV envelope proteins by induced antibodies. The results obtained suggest that this region can induce an immune response against the native glycoprotein.

A. Fusion of the DNA sequence of the C7 peptide of an HTLV-III

Isolate with Pre S2-S Region of pRIT10911 The starting material was plasmid pBH10-R2, which contains the cloned genome of HIV isolate BH10. This plasmid was developed by R.C. Gallo, National Institutes of Health, Bethesda, MD. A 3108 bp Sall-Xhol fragment containing the viral origin of replication was excised from pBHi0-R2 and cloned between the Sail and Xhol sites of pUC18. The result was the plasmid pRIT12901. A restriction map of this Sall-Xhol fragment is shown in Figure 1-B. The plasmid pUC18 is described by Norrander J. et al., Gene, 26 (1983), 101-106 and available from Pharmacia Inc., Piscataway, N.J.

For fusion, pRIT1290 'was cleaved at the endonucleases Bgl II and Mbo II and the resulting 117 bp fragment was isolated by polyacrylamide gel electrophoresis and electroelution (see Fig. 1B). The DNA of this fragment was treated with mungo bean nuclease to remove supernatant single stranded regions and then ligated with the DNA of pRIT10911 (see Example 5) which had been digested with BamHI and treated with mungo bean nuclease. From this ligation mixture, the plasmid pRIT12893 was isolated, in which the 117 bp BglII-MboII fragment from pRIT12901 had been inserted into pRIT10911. The nucleotide sequence in

-136-

Range of the fusion point of the TDH3 promoter and the mungo · bean nuclease-treated 117 bp HTLV-III BglII-MboII fragment was determined. It was found that IO nucleotides were too much removed from the BglII end of the fragment. The following sequence was obtained:

5 'ATGGAGGAGGAGATATGAGGGA 3'

in which the first underlined ATG codon is that of the TDH3 promoter from pRIT10911 and the second is an internal ATG co-promoter.

I is don of the C7 peptide fragment. The second ATG codon overlaps with a TGA termination codon. This termination codon is in the same reading frame as the first ATG codon. The determination of the DNA sequence of the 3 'end of the fusion region in pRIT12893 showed the correct sequence for the

of

in the drab phase fusion / Mbo II, mungo bean nuclease-treated end of the HTLV III fragment and the Pre S2 sequence of pRIT10911, as shown in Figure 2B.

The DNA of pRIT12893 was then cleaved with the endonuclease HindIII and the resulting 3250 bp fragment isolated and purified by agarose gel electrophoresis and electroelution. The 3250 bp HindIII fragment was then inserted into the HindIII site of plasmid YEpI3. The result was pRIT12894. The DNA of the plasmid was then used to 2β transform cells of yeast strains DC5 and 10S44C according to Ito et al. (see Example 10). The cells were selected for leucine independence.

QQ Transcription and translation in yeast cells of the C7-Pre S2-S fusion DNA in pRIT12894 results in the synthesis of a small, 5 amino acid peptide beginning at the TDH3 ATG codon and ending at the underlined TGA codon, as well a C7-Pre S2-S fusion peptide starting at the second ATG codon inside the C7 sequence. This. Fusion product contains 38 amino acid residues of the C7 peptide instead of the

-137-

45. Amino acid residues of the intact BglII-MboII mongoose, Bonnen nuclease treated C7 fragment. Other plasmids than pRIT12893 obtained from the same ligation mixture can be screened and sequenced to see if they carry a fusion corresponding to the complete fragment.

B. Fusion of the DNA sequence of peptide 121 with the pre S2-S region of pRIT10911

For fusion, the DNA of pRIT12901 (described in part A) was cleaved with the endonucleases Hhal and HindIII to liberate the 230 bp fragment shown in Figure 1B. This fragment was purified by polyacrylamide gel electrophoresis and electroelution and then treated with T4 DNA polymerase to fill out supernatant single stranded areas.

The thus treated fragment was ligated with the DNA of pRIT10911 digested with BamHI and treated with mungo bean nuclease. From this ligation mixture was obtained the plasmid pRIT12897 into which the 230 bp fragment of HIV DNA in the correct reading frame had been inserted for fusion with the Pre S2 sequence of pRIT10911 (see Fig. 3B). The DNA of the plasmid pRIT12897 was cleaved with the endonuclease, Kidlll, and the resulting 3365 bp fragment containing the TDH3 promoter, the HIV-Pre S2-S-FU-sion and the arg ³ -terminating region by agarose gel electrophoresis and electroelution cleaned. This 3365 bp fragment was ligated into YEp13 which had been cleaved with the endonuclease HindIII. The result was the plasmid pRIT12898. This plasmid was used to transform cells of yeast strains DC5 and 10S44C according to Ito et al. used according to Example 10. The cells were selected for leucine _r independence.

C. Fusion of the DNA sequence of the "Dreesman" peptide with the Pre S2 region of pRIT1.911

-138-

A synthetic 60 bp fragment having the sequence given below was prepared in a manner known per se, namely by synthesis of two single strands and their juxtaposition:

5 'GATCTCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGA 3 · 3' AGCTGTCCGGGCTTCCTTATCTTCTTCTTCCACCTCTCTC ¹ Γ 5

5 ¹ GACAGAGACAGATCCCCG 3 ·

3 ¹ CTGTCTCTGTCTAGGGGCCTAC 5 '

This fragment has BgIII at the 5 'end and BamHI protruding single strand areas at the 3' end. About 200 ng of a double stranded fragment and 300 ng of the RamHI cleaved

¹ μl of plasmid pRIT10911 was mixed and ligated. From this ligation mixture, the plasmid pRIT12899 was obtained, into which the 60 bp fragment had been inserted at the BamHI site of pRIT10911 so that a fusion in the reading frame was formed (see Fig. 4B). DNA

pRIT12899 was cleaved with HindIII endonuclease and the resulting 3200 bp HindIII fragment purified by agarose gel electrophoresis and electroelution. This HindIII fragment was inserted into the HindIII site of YEpI3. The resulting plasmid pRIT12900 was generated. This plasmid was then used to transform cells of the yeast strains DC5 and 10S44C according to Ito et al. used according to Example 10. The cells were selected for leucine independence.

Example 38

Expression of pRIT12894 and pRITi2898-encoded fusion proteins

Yeast strains DC5 or 10S44C containing either YEp13, pRIT12363, pRIT10912, pRIT12894 or pRIT12898,

-139-

were cultured separately in liquid medium without leucine (YNB + 80 μg / ml histidine or YNB). Cellular proteins were analyzed by immunoblot according to Example 11. The first antibody used was a monoclonal antibody directed against a denaturation- and reduction-resistant epitope of a human-derived HBsAg (monoclonal antibody 6, obtained from H. Thomas, Royal Free Hospital, London, England). pRIT10912 is described in Example 5. pRIT12894 and PRIT12898 are described in Example 37. In pRIT12363, the 2900 bp HindIII fragment of pRIT12322 (Example 8) containing the S gene of HBV fused to the TDH3 promoter is present in a yeast plasmid vector identical to PRIT12377 (Example 10, Part B). is. pRIT12363 produces HBsAg under the control of the TDH3 promoter.

Among the total cellular proteins from the yeast strains DC5 and 10S44C, those with. pRIT12894, the immunoblot identified an S protein-related protein band corresponding to an estimated molecular weight of about 32 kd. An estimated protein molecular weight of about 45 kd was used with the S protein; All of the cellular proteins from yeast strains DC5 and 10S44C transformed by pRIT12898 were found. Among the total cellular proteins from the yeast strain DC5 transformed by pRIT10912, an S protein-related protein band with an estimated molecular weight of about 29 kd was found.

Crude extracts of cells of the yeast strain DC5 containing either pRIT12363, pRIT10912 or pRIT12894 were prepared according to Example 12. Protein concentration and AUSRIA activity were measured according to Example 12. Immunoblot analysis of these crude extracts was performed as described above.

,

The Cäsiumcilorid-Gleichgewichtszentrifuation of the crude extracts (described in Example 12) and determining the HBsAg related antigenicity in the cesium chloride fractions by the AUSRIA ^test, the antigen showed a band with the buoyant density of about 1.2 g / cm ^3. This result was confirmed by the immunoblot analysis of the cesium chloride fractions.

These results indicated that the 32 kd fusion protein produced in cells of the yeast strain DC5 carrying pRIT12894 is incorporated into particles similar to the 22 nm HBsAg particle from human serum. From the level of activity of those particles in the AUSRIA test, _and the intensity of the reaction of the 32 kd protein in the immunobiotan analysis, it can be concluded that the S determinants of these particles are partially blocked by the C7 sequences or be deformed.

From these results, it is concluded that yeast cells of strains DC5 and 10S44C transformed with either pRIT12894 or pRIT12898 specifically synthesize a fusion protein having a molecular weight of about 32 kd or 45 kd, both carrying an S epitope.

It is known to those skilled in the art that hybrid particles carrying HIV virus peptide epitopes can be isolated and purified from cultures of yeast cells transformed with pRIT12894, pRIT12898 or pRITi2900 by conventional methods. Such purified particles may then be co-administered with an adjuvant such as Al (OH) ₃ or AlPO. be used as a human vaccine. The preferred dose is in the range of 1 to 1000 μg protein and is determined by conventional tests. The invention also encompasses other viral HIV protein peptide regions that can be fused to the pre S2-S region of HBV coding sequences to form hybrid particles that display an HIV epitope of interest.

Claims (13)

-141- claim 1. A process for the preparation of recombinant surface proteins or hybrid particles of HBV / HIV or Plasmodium, characterized in that an HBV, HIV or Plasmodium gene coding for the corresponding surface protein, or a part of the gene in reading phase to aas 3 'end of at least a portion of the Pre S2 region of the HBV genome, said portion being sufficiently large to encode an immunogenic protein, which functionally ligates said fusion DNA molecule to an expression control sequence of an expression vector, the recombinant gene obtained Injecting a DNA molecule into an euharyotic host organism, cultivating the resulting transformed host organism in a culture medium and isolating the protein or the hybrid particle from the cell lysate or culture medium. 2. The method according to claim 1, characterized in that one uses for the preparation of the recombinant HBV surface protein or hybrid particle, either the Pre S2, Pre S1 or the entire Pre S1 Pre S2 DNA sequence. 3. The method according to claim 1, characterized in that one uses for the production of the recombinant Plasmodium surface protein or hybrid particle encoding the circumsporozoide (CS) protein DNA sequence. 4. The method according to claim 1, characterized in that one uses the sequence coding for the HIVC7 protein, the peptide 121 or the Dressman peptide sequence for the production of the recombinant HIV surface protein or hybrid particle. -142- 5. The method according to claim 3, characterized in that a 192 bp large SauIIIA fragment coding for 16 repeating tetrapeptides is used as CS protein-coding DNA sequence, this fragment by SauIIIA cleavage of a 1215 bp large, for the CS Protein minus the first 52 bp coding, StuI-RSal fragment of the plasmid WR 201 is obtained. 6. The method according to claim 5, characterized in that in addition further SauIIIA fragments of the CS protein-encoding DNA sequence can be used. 7. The method according to claim 1, characterized in that is used as an expression control sequence of the TDH3 promoter. 8. The method according to claim 1, characterized in that a yeast cell is used as eu!: Aryontischer host. S. The method according to claim 8, characterized in that are used as yeasts of the genus Saccharomyces. 10. The method according to claim 9, characterized in that are used as yeasts of the species Saccharomyces cerevisiae or Saccharomyces carlsbergensis. 11. The method according to claim 10, characterized in that are used as yeasts of the strain DC5, DC5 cir °, 10S44C or 10S44C cir °. _f 12. The method according to claim 2, characterized in that one uses a Pre S1 DNA sequence coding for the following amino acid sequence: -143- -163 ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met GIy Thr Asn Leu Sec VaI Pro Asn Pco Leu GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pco Asp His Gin Leu Asp Pco GCA TTC GGA GCC AAC TCA AAC AAT CCA GAT Ala Phe Gly Ala Asn Sec Asn Asn Pco Asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Tcp Asp Phe Asn Pco He Lys Asp His Tcp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pco Ala Ala Asn Gin VaI GIy VaI GIy AIa TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe GIy Pco GIy Leu The Pco Pco His GIy GCT ATT TTG GGG TGG AGC CCT CAG GCT CAG Gly He Leu Gly Tcp Sec Pco Gin Ala GIn GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT GIy He Leu The VaI Sec The He Pco CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA , Pco Pco AIa Lake The Asn Acg Gin Sec GIy AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Acg GIn Pco The Pco He See Pc _? o Pco Leu AGA GAC AGT CAT CCT CAG GCC Acg Asp Sec His Pco Gin Ala -144- 13. The method according to claim 2, characterized in that one uses a Pre S2 DNA sequence coding for the following amino acid sequence: -55 -50 oc Mec-Gln-Asn-tcp-Sec-The-Ala-Phe-His-Gln-Ala-Leu-Gln-Asp -40 -30 Pco-Arg-Val-Arg-Gly-Leu-Phe-TYC Pco-Ala-Gly-Gly-Sec-Sec-Sec -20
Gly-Thc-Val-Asn-P co-Ala-P co-Asn-Ile-Ala-Sec-His-Ile-Sec - ¹⁰ Sec-Sec-Sec-Ala -Arg-Thr-GLy-As ρ-P co-VaI-The-As η 14. The method according to claim 2, characterized in that one uses a Pre S1 Pre 52 DNA sequence coding for the following amino acid sequence: Pee Sl Regio n -163 ATG GGG ACG AAT CTT TCT GTT CCC AAC CCT CTG Met Giy The Asn Leu Sec VaI Pco Asn Pco Leu 25 GGA TTC TTT CCC GAT CAT CAG TTG GAC CCT GIy Phe Phe Pco Asp His Gin Leu Asp Pco GCA TTC GGA GCC AAC TCA AAC AAT CCA GAT 30 ALa Phe GLy ALa Asn Lake 'Asn Asn Pco Asp TGG GAC TTC AAC CCC ATC AAG GAC CAC TGG Tcp Asp Phe Asn Pco ILe Lys Asp His Tcp CCA GCA GCC AAC CAG GTA GGA GTG GGA GCA Pco Ala ALa Asn GLn VaL GLy VaL GLy ALa -145- TTC GGG CCA GGG CTC ACC CCT CCA CAC GGC Phe GIy Pro Gly leu Thr Pco Pro His GIy GGT ATT TTG GGG TGG AGC CCT CAG GCT CAG GIy He Leu GIy Trp Ser Pro Gin Ala Gin GGC ATA TTG ACC ACA GTG TCA ACA ATT CCT Gily Lie Leu Thr Thr VaI Ser Thr lie Pro CCT CCT GCC TCC ACC AAT CGG CAG TCA GGA Pro Pro Ala Ser Thr Asn Arg Gin Ser Gly AGG CAG CCT ACT CCC ATC TCT CCA CCT CTA Arg Gin Pro Thr Pro He Ser Pro Pro Leu AGA GAC AGT CAT CCT CAG GCC Arg Asp Ser His Pro Gin Ala Pre S2 region
-55 ATG CAG TGG AAT TCC ACT GCC TTC CAC CAA Met Gin Trp Asn Ser Thr Ala Phe His GLn GCT CTG CAG GAT CCC AGA GTC AGG GGT CTG Ala Leu Gin Asp Pro Arg VaI Arg GIy Leu TAT TTT CCT GCT GGT GGC TCC AGT TCA GGA Tyr Phe Pro Ala GLy GIy Ser Ser Ser GIy ACA GTA AAC CCT GCT CCG AAT ATT GCC TCT Thr VaI Asn Pro AIa Pro Asn lie Ala Ser CAC ATA TCG TCA AGC TCC GCG AGG hCT GGG His He Ser Ser Ser Ser AIa Arg Thr GIy GAC CCT GTG ACG AAC Asp Pro VaI Thr Asn