US20200054675A1 - Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy - Google Patents

Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy Download PDF

Info

Publication number
US20200054675A1
US20200054675A1 US16/428,362 US201916428362A US2020054675A1 US 20200054675 A1 US20200054675 A1 US 20200054675A1 US 201916428362 A US201916428362 A US 201916428362A US 2020054675 A1 US2020054675 A1 US 2020054675A1
Authority
US
United States
Prior art keywords
cell
car
cytokine
recited
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/428,362
Other languages
English (en)
Inventor
John DiPersio
Matthew Cooper
Alun Carter
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Washington University in St Louis WUSTL
Original Assignee
Washington University in St Louis WUSTL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Washington University in St Louis WUSTL filed Critical Washington University in St Louis WUSTL
Priority to US16/428,362 priority Critical patent/US20200054675A1/en
Assigned to WASHINGTON UNIVERSITY reassignment WASHINGTON UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CARTER, Alun, COOPER, MATTHEW, DIPERSIO, John
Publication of US20200054675A1 publication Critical patent/US20200054675A1/en
Priority to US17/746,645 priority patent/US12304941B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/10—Cellular immunotherapy characterised by the cell type used
    • A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/10—Cellular immunotherapy characterised by the cell type used
    • A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/22—Immunosuppressive or immunotolerising
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31—Chimeric antigen receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/418—Antigens related to induction of tolerance to non-self
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/42—Cancer antigens
    • A61K40/4202—Receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/42—Cancer antigens
    • A61K40/4202—Receptors, cell surface antigens or cell surface determinants
    • A61K40/421—Immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41—Vertebrate antigens
    • A61K40/42—Cancer antigens
    • A61K40/4202—Receptors, cell surface antigens or cell surface determinants
    • A61K40/421—Immunoglobulin superfamily
    • A61K40/4211—CD19 or B4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/53—Colony-stimulating factor [CSF]
    • C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C12N5/0638—Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/27—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by targeting or presenting multiple antigens
    • A61K2239/29—Multispecific CARs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48—Blood cells, e.g. leukemia or lymphoma
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • CRS cytokine release syndrome
  • INFy INFy
  • granulocyte-macrophage colony-stimulating factor IL-10
  • IL-6 IL-6
  • CRS can be fatal. Additionally, neurotoxicity often presents even after the initial symptoms of CRS have subsided. The pathogenesis of CRS and associated neurotoxicity is poorly understood and further understanding of the mechanism would be useful for the successful translation of CAR-T therapy. In the meanwhile, disrupting the pathogenesis of CRS by reducing the level of cytokine genes available for expression is one way to mitigate the condition.
  • CAR chimeric antigen receptor
  • These gene deletion methods may include, but are not limited to, insertion of the CAR into a locus of a cytokine/chemokine/transcription factor gene, blocking its expression; gene editing with Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or CRISPR; expression of an scFv with an endoplasmic reticulum (ER) binding tether to bind the cytokine in the ER and prevent secretion; and transfection of small hairpin RNAs (shRNAs) or small interfering RNAs (siRNAs).
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR CRISPR
  • CRS cytokine release syndrome
  • CAN CAR-T associated neuropathy
  • FIG. 1 Illustrates the concept of inserting a CAR into the gene for a cytokine in order to block its translation, thereby deleting it or reducing its level, thus preventing or reducing cytokine release syndrome and/or CAR-bearing immune effector cell associated neuropathy (CAR-T associated neuropathy).
  • CAR-T associated neuropathy CAR-bearing immune effector cell associated neuropathy
  • FIG. 2 Shows a timeline for a method of treatment of hematologic malignancies using the CAR-T cells disclosed herein. Those of skill in the art will appreciate that some flexibility is possible in the time frames shown.
  • FIG. 3 Shows the AAV donor construct for insertion of CD34 into the GM-CSF locus.
  • FIG. 4 Shows the WC40 plasmid vector for use in inserting GFP into the CD3c locus.
  • FIG. 5 Shows the AAV donor construct for insertion of GFP into the CDR locus.
  • FIG. 6 Shows a CAR19-GM-CSF PEBL-trCD34 construct.
  • FIG. 7 Shows IL-6 expression in T cells, iDC cells, T cells+iDC, T cells+beads, and iDC+beads+T cells for GM-CSF knock-out, wild-type, and controls at 24 hours.
  • FIG. 8 Shows IL-6 expression in CAR19, iDC only, Act MQ only, MC only, RAMOS only, CAR19+iDC, CAR19+ActMQ, CAR19+MQ, CAR19+RAMOS, iDC+RAMOS+CAR-T, ActMQ+RAIVIOS+CAR-T, and MQ+RAMOS+CAR-T for CAR19 GM-CSF knock-out, CAR19, and controls at 24 hours.
  • FIG. 9 Shows IL-6 expression in T cells, iDC cells, T cells+iDC, T cells+beads, and iDC+beads+T cells for GM-CSF knock-out, wild-type, and controls at 48 hours.
  • FIG. 10 Shows IL-6 expression in CAR19, iDC only, Act MQ only, MC only, RAMOS only, CAR19+iDC, CAR19+ActMQ, CAR19+MQ, CAR19+RAMOS, iDC+RAMOS+CAR-T, ActMQ+RAIVIOS+CAR-T, and MQ+RAMOS+CAR-T for CAR19 GM-CSF knock-out, CAR19, and controls at 48 hours.
  • FIG. 11 Shows a set-up of an ELISA plate for detecting specific markers of CAR-T cells.
  • FIG. 12 a and FIG. 12 b Shows the results for an ELISA assay detecting specific markers of the CAR-T cells.
  • FIG. 12 a shows the top half of the ELISA plate
  • FIG. 12 b shows the bottom half of the plate.
  • the sub-rows indicate [450] test, [540] ref, Pathlength, 450, 540, Corrected [450], and Corrected [540].
  • Embodiment 1 is a chimeric antigen receptor (CAR)-bearing immune effector cell that is deficient in a cytokine or in a chemokine or in a transcription factor that is involved in cytokine release syndrome.
  • CAR chimeric antigen receptor
  • cytokine-deficient cells as well as the use of such cells in, for example, immunotherapy and adoptive cell transfer for the treatment of diseases. Accordingly, provided herein are the following additional embodiments.
  • Embodiment 2 The cell as recited in embodiment 1, wherein the cytokine or chemokine or transcription factor deficiency is effected by deletion or suppression of a gene encoding the cytokine or chemokine or transcription factor.
  • Embodiment 3 The cell as recited in any of embodiments 1 or 2, wherein the deletion or suppression is effected by inserting the CAR into a locus of the cytokine or chemokine or transcription factor gene.
  • Embodiment 4 The cell as recited in any of embodiments 1 to 3, wherein the CAR is part of a construct that also includes a selectable marker.
  • Embodiment 5 The cell as recited in any of embodiments 1 to 4, wherein the selectable marker comprises a green fluorescence (GFP) gene, a yellow fluorescent (YFP) gene, a truncated CD34 (tCD34) gene, or a truncated EGFR (tEGFR) gene.
  • GFP green fluorescence
  • YFP yellow fluorescent
  • tCD34 truncated CD34
  • tEGFR truncated EGFR
  • Embodiment 6 The cell as recited in any of embodiments 1 to 5, wherein the cytokine or chemokine or transcription factor deficiency is effected by deletion or suppression of the cytokine or chemokine gene, by Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) editing.
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Embodiment 7 The cell as recited in any of embodiments 1 to 6, wherein deletion or suppression is effected using CRISPR.
  • Embodiment 8 The cell as recited in any of embodiments 1 to 7, wherein deletion or suppression is effected using Cas9-CRISPR.
  • Embodiment 9 The cell as recited in any of embodiments 1 to 8, wherein the Cas9 is delivered into the cell as mRNA or protein.
  • Embodiment 10 The cell as recited in any of embodiments 1 to 9, wherein the Cas9 is delivered into the cell as mRNA.
  • Embodiment 11 The cell as recited in any of embodiments 1 to 10, wherein the Cas9 is delivered into the cell as protein.
  • Embodiment 12 The cell as recited in any of embodiments 1 to 11, wherein a guide RNA (gRNA) targeting the gene to be deleted or suppressed is delivered contemporaneously with the Cas9.
  • gRNA guide RNA
  • Embodiment 13 The cell as recited in any of embodiments 1 to 12, wherein the delivery is by electroporation.
  • Embodiment 14 The cell as recited in any of embodiments 1 to 13, wherein the cytokine or chemokine or transcription factor deficiency is effected by suppression of the cytokine or chemokine or transcription factor gene transcript by transfection of one or more types of small interfering RNAs (siRNA).
  • siRNA small interfering RNAs
  • Embodiment 15 The cell as recited in any of embodiments 1 to 14, wherein the cytokine or chemokine or transcription factor deficiency is effected by suppression of the cytokine or chemokine or transcription factor gene transcript by transduction of one or more types of short hairpin RNAs (shRNA).
  • shRNA short hairpin RNAs
  • Embodiment 16 A chimeric antigen receptor (CAR)-bearing immune effector cell expressing at least one CAR, wherein:
  • the at least one CAR is inserted into a locus of a cytokine or chemokine or transcription factor gene or transcription factor gene;
  • cytokine or chemokine or transcription factor gene is deleted or suppressed by a method chosen from Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), and Clustered Regularly Interspaces Short Palindromic Repeats (CRISPR) editing;
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR Clustered Regularly Interspaces Short Palindromic Repeats
  • the cytokine or chemokine or transcription factor is suppressed by expression of an scFv with an endoplasmic reticulum (ER) binding tether to bind the cytokine or chemokine in the ER and prevent secretion;
  • ER endoplasmic reticulum
  • RNAs small interfering RNAs
  • cytokine or chemokine or transcription factor gene transcript is suppressed by transduction of short hairpin RNAs (shRNAs).
  • shRNAs short hairpin RNAs
  • Embodiment 17 The cell as recited in any of embodiments 1 to 16, wherein the cell is chosen from a chimeric antigen receptor T cell (CAR-T), a CAR-bearing iNKT cell (iNKT-CAR), and a CAR-bearing natural killer (NK) cell (NK-CAR), or a CAR-bearing macrophage.
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • Embodiment 18 The cell as recited in any of embodiments 1 to 17, wherein the cell is a CAR-T.
  • Embodiment 19 The cell as recited in any of embodiments 1 to 18, wherein the cell is a dual or tandem CAR-T.
  • Embodiment 20 The cell as recited in any of embodiments 1 to 17, wherein the cell is an iNKT-CAR.
  • Embodiment 21 The cell as recited in any of embodiments 1 to 20, wherein the cell is a dual or tandem iNKT-CAR.
  • Embodiment 22 The cell as recited in any of embodiments 1 to 17, wherein the cell is a CAR-macrophage.
  • Embodiment 23 The cell as recited in any of embodiments 1 to 22, wherein the cell is a dual or tandem CAR-macrophage.
  • Embodiment 24 The cell as recited in any of embodiments 1 to 23, wherein the cytokine or chemokine or transcription factor contributes to the development of cytokine release syndrome.
  • Embodiment 25 The cell as recited in any of embodiments 1 to 24, wherein the cytokine or chemokine or transcription factor is selected from among those recited in Table 10.
  • Embodiment 26 The cell as recited in any of embodiments 1 to 25, wherein the cytokine or chemokine or transcription factor is produced by T cells that activate or localize myeloid cells.
  • Embodiment 27 The cell as recited in any of embodiments 1 to 26, wherein the cytokine or chemokine or transcription factor is a T cell surface receptor gene that activates myeloid or CAR-T cells.
  • Embodiment 28 The cell as recited in any of embodiments 1 to 27, wherein the gene that is deleted or suppressed is a T cell surface receptor that is integrated into CAR-T cell signaling.
  • Embodiment 29 The cell as recited in any of embodiments 1 to 28, wherein the cytokine or chemokine or transcription factor drives T cell/CAR-T cell differentiation.
  • Embodiment 30 The cell as recited in any of embodiments 1 to 29, wherein the cytokine or chemokine is a transcription factor that drives T cell/CAR-T cell differentiation.
  • Embodiment 31 The cell as recited in any of embodiments 1 to 30, wherein the cytokine or chemokine or transcription factor is chosen from MCP1 (CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, 11-4, and IFNy.
  • MCP1 CCL2
  • MCP-2 MCP-2
  • GM-CSF G-CSF
  • M-CSF M-CSF
  • 11-4 IFNy.
  • Embodiment 32 The cell as recited in any of embodiments 1 to 31, wherein the cytokine or chemokine or transcription factor is GM-CSF.
  • Embodiment 33 The cell as recited in any of embodiments 1 to 32, wherein the cell is a GM-CSF deficient CAR-T cell.
  • Embodiment 34 The cell as recited in any of embodiments 1 to 33, wherein the cell is a GM-CSF deficient iNKT-CAR cell.
  • Embodiment 35 The cell as recited in any of embodiments 1 to 34, wherein the immune effector cells to be used are harvested from a healthy donor.
  • Embodiment 36 The cell as recited in any of embodiments 1 to 35, wherein the donor is a human.
  • Embodiment 37 The cell as recited in any of embodiments 1 to 36, wherein the chimeric antigen receptor(s) specifically binds at least one antigen expressed on a malignant cell.
  • Embodiment 38 The cell as recited in any of embodiments 1 to 37, wherein the one or more antigens expressed on a malignant cell is chosen from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1a.
  • Embodiment 39 The cell as recited in any of embodiments 1 to 38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant T cell.
  • Embodiment 40 The cell as recited in any of embodiments 1 to 39, wherein the antigen is selected from CD2, CD3c, CD4, CD5, CD7, TCRA, and TCR ⁇ .
  • Embodiment 41 The cell as recited in any of embodiments 1 to 38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant B cell.
  • Embodiment 42 The cell as recited in any of embodiments 1 to 41, wherein the antigen is selected from CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD38, and CD45.
  • Embodiment 43 The cell as recited in any of embodiments 1 to 42, wherein the antigen is selected from CD19 and CD20.
  • Embodiment 44 The cell as recited in any of embodiments 1 to 38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant mesothelial cell.
  • Embodiment 45 The cell as recited in any of embodiments 1 to 44, wherein the antigen is mesothelin.
  • Embodiment 46 The cell as recited in any of embodiments 1 to 38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant plasma cell.
  • Embodiment 47 The cell as recited in any of embodiments 1 to 46, wherein the antigen is selected from BCMA, CS1, CD38, and CD19.
  • Embodiment 48 The cell as recited in any of embodiments 1 to 47, wherein the chimeric antigen receptor expresses the extracellular portion of the APRIL protein, the ligand for BCMA and TACI, effectively co-targeting both BCMA and TACI.
  • Embodiment 49 The cell as recited in any of embodiments 1 to 48, wherein the CAR-T cell further comprises a suicide gene.
  • Embodiment 50 The cell as recited in any of embodiments 1 to 49, wherein endogenous T cell receptor mediated signaling is negligible in the cell.
  • Embodiment 51 The cell as recited in any of embodiments 1 to 50, wherein the cell does not induce alloreactivity or graft-versus-host disease.
  • Embodiment 52 The cell as recited in any of embodiments 1 to 51, wherein the cell does not induce fratricide.
  • Embodiment 53 A method of treatment of cancer in a patient, which has a reduced incidence of cytokine release syndrome and/or CAR-T associated neuropathy, comprising the administration of cells as recited in any of embodiments 1 to 52.
  • Embodiment 54 The method as recited in embodiment 53, wherein the cancer is a hematologic malignancy.
  • Embodiment 55 The method as recited in any of embodiments 53 to 54, wherein the hematologic malignancy is a T-cell malignancy.
  • Embodiment 56 The method as recited in any of embodiments 53 to 55, wherein the T cell malignancy is T-cell acute lymphoblastic leukemia (T-ALL).
  • T-ALL T-cell acute lymphoblastic leukemia
  • Embodiment 57 The method as recited in any of embodiments 53 to 56, wherein the T cell malignancy is non-Hodgkin's lymphoma.
  • Embodiment 58 The method as recited in any of embodiments 53 to 57, wherein the hematologic malignancy is multiple myeloma.
  • Embodiment 59 The method as recited in any of embodiments 53 to 58, wherein the hematologic malignancy is AML.
  • Embodiment 60 The method as recited in any of embodiments 53 to 59, wherein the cancer is a solid tumor.
  • Embodiment 61 The method as recited any of embodiments 53 to 60, wherein the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
  • Embodiment 62 A method of prevention or reduction of cytokine release syndrome or CAR-T associated neuropathy in a patient receiving chimeric antigen receptor T cell (CAR-T), CAR-bearing iNKT cell (iNKT-CAR), CAR-bearing natural killer (NK) cell (NK-CAR), or CAR-bearing macrophage (CAR-macrophage) immunotherapy, comprising the administration of cells as recited in any of embodiments 53 to 61 as the immunotherapy.
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • CAR-macrophage CAR-macrophage
  • Embodiment 63 The method of any of embodiments 53 to 62, wherein the patient is being treated for cancer.
  • Embodiment 64 The method as recited in any of embodiments 53 to 63, wherein the cancer is a hematologic malignancy.
  • Embodiment 65 The method as recited in any of embodiments 53 to 64, wherein the hematologic malignancy is a T-cell malignancy.
  • Embodiment 66 The method as recited in any of embodiments 53 to 65, wherein the T cell malignancy is T-cell acute lymphoblastic leukemia (T-ALL).
  • T-ALL T-cell acute lymphoblastic leukemia
  • Embodiment 67 The method as recited in any of embodiments 53 to 66, wherein the T cell malignancy is non-Hodgkin's lymphoma.
  • Embodiment 68 The method as recited in any of embodiments 53 to 67, wherein the hematologic malignancy is multiple myeloma.
  • Embodiment 69 The method as recited in any of embodiments 53 to 68, wherein the hematologic malignancy is AML.
  • Embodiment 70 The method as recited in any of embodiments 53 to 69, wherein the cancer is a solid tumor.
  • Embodiment 71 The method as recited in any of embodiments 53 to 70, wherein the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
  • Embodiment 72 A method of blocking the expression of a cytokine gene or chemokine gene or transcription factor gene in a chimeric antigen receptor T cell (CAR-T), CAR-bearing iNKT cell (iNKT-CAR), CAR-bearing natural killer (NK) cell (NK-CAR), or CAR-bearing macrophage (CAR-macrophage) comprising the insertion of a CAR into a locus of the cytokine gene or chemokine gene or transcription factor gene.
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • CAR-macrophage CAR-macrophage
  • Embodiment 73 The method of any of embodiments 53 to 72, wherein blocking the expression of the cytokine gene or chemokine gene or transcription factor gene does not reduce CAR-T cell-mediated killing.
  • Embodiment 74 A method of making a CAR-T (immune effector) cell that does not cause or contribute to CRS or CAR-T-associated neuropathy (CAN) comprising deleting or suppressing a cytokine or chemokine or transcription factor gene.
  • CAR-T immune effector
  • Embodiment 75 The method of any of embodiments 53 to 74, wherein deleting or suppressing the cytokine or chemokine or transcription factor gene does not reduce CAR-T cell-mediated killing.
  • Embodiment 76 The method as recited in any of embodiments 53 to 75, wherein the deletion or suppression is effected by inserting the CAR into a locus of the cytokine or chemokine or transcription factor gene.
  • Embodiment 77 The method as recited in any of embodiments 53 to 76, wherein the CAR is part of a construct that also includes a selectable marker.
  • Embodiment 78 The method as recited in any of embodiments 53 to 77, wherein the selectable marker comprises a green fluorescence (GFP) gene, a YFP gene, a tCD34 gene, or a tEGFR gene.
  • GFP green fluorescence
  • Embodiment 79 The method of any of embodiments 53 to 78, wherein the insertion of a CAR with a selectable marker into the cytokine or chemokine or transcription factor gene allows a single-step purification of TCR-negative cells.
  • Embodiment 80 The method of any of embodiments 53 to 79, wherein the insertion of a CAR with a selectable marker into the cytokine or chemokine or transcription factor gene allows a single step purification of CAR+ cytokine negative cells.
  • Embodiment 81 The method as recited in any of embodiments 53 to 80, wherein the deletion or suppression is effected using Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) editing.
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Embodiment 82 The method as recited in any of embodiments 53 to 81, wherein the deletion or suppression is effected using CRISPR.
  • Embodiment 83 The method as recited in any of embodiments 53 to 82, wherein the deletion or suppression is effected using Cas9-CRISPR.
  • Embodiment 84 The method as recited in any of embodiments 53 to 83, wherein the Cas9 is delivered into the cell as mRNA or protein.
  • Embodiment 85 The method as recited in any of embodiments 53 to 84, wherein the Cas9 is delivered into the cell as mRNA.
  • Embodiment 86 The method as recited in any of embodiments 53 to 85, wherein the Cas9 is delivered into the cell as protein.
  • Embodiment 87 The method as recited in any of embodiments 53 to 86, wherein a guide RNA (gRNA) targeting the gene to be deleted or suppressed is delivered contemporaneously with the Cas9.
  • gRNA guide RNA
  • Embodiment 88 The method as recited in any of embodiments 53 to 87, wherein the delivery is by electroporation.
  • Embodiment 89 The method as recited in any of embodiments 53 to 88, wherein the deletion or suppression is effected by suppression of the cytokine or chemokine or transcription factor gene transcript by transduction of one or more types of short hairpin RNAs (shRNA).
  • shRNA short hairpin RNAs
  • Embodiment 90 The method as recited in any of embodiments531 to 89, wherein the deletion or suppression is effected by transducing a construct encoding a protein expression blocker (PEBL).
  • PEBL protein expression blocker
  • Embodiment 91 The method of any of embodiments 53 to 90, wherein the construct encodes an antibody-derived single-chain variable fragment specific for the cytokine, chemokine or TF gene.
  • Embodiment 92 The method of any of embodiments 53 to 91, wherein deletion of the cytokine, chemokine, or transcription factor gene does not reduce CAR-T-mediated killing.
  • Embodiment 93 The method of any of embodiments 53 to 92, wherein the CAR to be inserted comprises a donor template.
  • Embodiment 94 The method of any of embodiments 53 to 93, wherein donor template comprises an adeno-associated virus (AAV), a single-stranded DNA, or a double-stranded DNA.
  • AAV adeno-associated virus
  • CAR chimeric antigen receptor
  • the cytokine deficiency is effected by ablation of a cytokine gene or a chemokine gene, or a transcription factor gene.
  • the ablation is effected by inserting the CAR into a locus of the cytokine/chemokine/transcription factor gene.
  • the CAR is part of a construct that also includes a selectable marker.
  • the cytokine deficiency is effected by deletion or suppression of the cytokine/chemokine/transcription factor gene, by Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaces Short Palindromic Repeats (CRISPR) editing.
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR Clustered Regularly Interspaces Short Palindromic Repeats
  • the cytokine deficiency is effected by suppression of the cytokine/chemokine/transcription factor gene transcript by transfection of small interfering RNAs (siRNAs).
  • siRNAs small interfering RNAs
  • CAR chimeric antigen receptor
  • the cell is chosen from a chimeric antigen receptor T cell (CAR-T), a CAR-bearing iNKT cell (iNKT-CAR), and a CAR-bearing natural killer (NK) cell (NK-CAR).
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • the cell is a CAR-T.
  • the cell is a dual or tandem CAR-T.
  • the cell is an iNKT-CAR.
  • the cell is a dual or tandem iNKT-CAR.
  • the cytokine contributes to the development of cytokine release syndrome.
  • the cytokine is chosen from MCP1 (CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, IL-4, and IFNy.
  • the cytokine is GM-CSF.
  • the cell is a GM-CSF deficient CAR-T cell.
  • the cell is a GM-CSF deficient iNKT-CAR cell.
  • the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant T cell.
  • the antigen is selected from CD2, CDR, CD4, CD5, CD7, TCRA, and TCR ⁇ .
  • the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant B cell.
  • the antigen is selected from CD19 and CD20.
  • the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant mesothelial cell.
  • the antigen is mesothelin.
  • the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant plasma cell.
  • the antigen is selected from BCMA, CS1, CD38, and CD19.
  • the chimeric antigen receptor expresses the extracellular portion of the APRIL protein, the ligand for BCMA and TACI, effectively co-targeting both BCMA and TACI.
  • the CAR-T cell further comprises a suicide gene.
  • endogenous T cell receptor mediated signaling is negligible in the cell.
  • the cell does not induce alloreactivity or graft-versus-host disease.
  • the cell does not induce fratricide.
  • Also disclosed herein is a method of treatment of cancer in a patient, which has a reduced incidence of cytokine release syndrome and/or CAR-T associated neuropathy, comprising the administration of chimeric antigen receptor (CAR)-bearing immune effector cells as disclosed herein.
  • CAR chimeric antigen receptor
  • the cancer is a hematologic malignancy.
  • the hematologic malignancy is a T-cell malignancy.
  • the T cell malignancy is T-cell acute lymphoblastic leukemia (T-ALL).
  • T-ALL T-cell acute lymphoblastic leukemia
  • the T cell malignancy is non-Hodgkin's lymphoma.
  • the hematologic malignancy is multiple myeloma.
  • the cancer is a solid tumor.
  • the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
  • Also disclosed herein is a method of prevention or reduction of cytokine release syndrome, CAR-T associated neuropathy in a patient receiving chimeric antigen receptor T cell (CAR-T), CAR-bearing iNKT cell (iNKT-CAR), or CAR-bearing natural killer (NK) cell (NK-CAR) immunotherapy, comprising the administration of chimeric antigen receptor (CAR)-bearing immune effector cells as disclosed herein as the immunotherapy.
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • Also disclosed herein is a method of blocking the expression of a cytokine/chemokine/transcription factor gene in a chimeric antigen receptor T cell (CAR-T), CAR-bearing iNKT cell (iNKT-CAR), or CAR-bearing natural killer (NK) cell (NK-CAR), comprising the insertion of a CAR into a locus of the cytokine/chemokine/transcription factor gene.
  • CAR-T chimeric antigen receptor T cell
  • iNKT-CAR CAR-bearing iNKT cell
  • NK-CAR CAR-bearing natural killer cell
  • a chimeric antigen receptor is a recombinant fusion protein comprising: 1) an extracellular ligand-binding domain, i.e., an antigen-recognition domain, 2) a transmembrane domain, and 3) a signaling transducing domain.
  • An engineered chimeric antigen receptor polynucleotide that encodes for a CAR comprises: a signal peptide, an antigen recognition domain, at least one co-stimulatory domain, and a signaling domain.
  • the antigen-specific extracellular domain of a chimeric antigen receptor recognizes and specifically binds an antigen, typically a surface-expressed antigen of a malignancy.
  • An “antigen-specific extracellular domain” (or, equivalently, “antigen-binding domain”) specifically binds an antigen when, for example, it binds the antigen with an affinity constant or affinity of interaction (KD) between about 0.1 pM to about 10 ⁇ M, preferably about 0.1 pM to about 1 ⁇ M, more preferably about 0.1 pM to about 100 nM.
  • KD affinity constant or affinity of interaction
  • an antigen-specific extracellular domain suitable for use in a CAR of the present disclosure may be any antigen-binding polypeptide, a wide variety of which are known in the art.
  • the antigen-binding domain is a single chain Fv (scFv).
  • Other antibody based recognition domains cAb VHH (camelid antibody variable domains) and humanized versions thereof, lgNAR VH (shark antibody variable domains) and humanized versions thereof, sdAb VH (single domain antibody variable domains) and “camelized” antibody variable domains are suitable for use.
  • T-cell receptor (TCR) based recognition domains such as single chain TCR (scTv, single chain two-domain TCR containing V ⁇ V ⁇ ) are also suitable for use.
  • a chimeric antigen receptor of the present disclosure also comprises an “intracellular domain” that provides an intracellular signal to the CAR-bearing immune effector cell upon antigen binding to the antigen-specific extracellular domain.
  • the intracellular signaling domain of a chimeric antigen receptor of the present disclosure is responsible for activation of at least one of the effector functions of the T cell in which the chimeric receptor is expressed.
  • effector function refers to a specialized function of a differentiated cell, such as an iNKT cell.
  • An effector function of an iNKT cell for example, may be NK transactivation, T cell activation and differentiation, B cell activation, dendritic cell activation and cross-presentation activity, and macrophage activation.
  • intracellular domain refers to the portion of a CAR that transduces the effector function signal upon binding of an antigen to the extracellular domain and directs the iNKT cell to perform a specialized function.
  • suitable intracellular domains include the zeta chain of the T-cell receptor or any of its homologs (e.g., eta, delta, gamma, or epsilon), MB 1 chain, 829, Fe Rill, Fe R1, and combinations of signaling molecules, such as CD3 ⁇ and CD28, CD27, 4-1 BB, DAP-1 0, OX40, and combinations thereof, as well as other similar molecules and fragments.
  • Intracellular signaling portions of other members of the families of activating proteins may be used, such as Fc ⁇ RIII and Fc ⁇ RI. While usually the entire intracellular domain will be employed, in many cases it will not be necessary to use the entire intracellular polypeptide. To the extent that a truncated portion of the intracellular signaling domain may find use, such truncated portion may be used in place of the intact chain as long as it still transduces the effector function signal.
  • the term intracellular domain is thus meant to include any truncated portion of the intracellular domain sufficient to transduce the effector function signal.
  • the antigen-specific extracellular domain is linked to the intracellular domain of the chimeric antigen receptor by a “transmembrane domain.”
  • a transmembrane domain traverses the cell membrane, anchors the CAR to the T cell surface, and connects the extracellular domain to the intracellular signaling domain, thus impacting expression of the CAR on the T cell surface.
  • Chimeric antigen receptors may also further comprise one or more costimulatory domain and/or one or more spacer.
  • a “costimulatory domain” is derived from the intracellular signaling domains of costimulatory proteins that enhance cytokine production, proliferation, cytotoxicity, and/or persistence in vivo.
  • a “peptide hinge” connects the antigen-specific extracellular domain to the transmembrane domain.
  • the transmembrane domain is fused to the costimulatory domain, optionally a costimulatory domain is fused to a second costimulatory domain, and the costimulatory domain is fused to a signaling domain, not limited to CD3 ⁇ .
  • a costimulatory domain is fused to a second costimulatory domain
  • the costimulatory domain is fused to a signaling domain, not limited to CD3 ⁇ .
  • inclusion of a spacer domain between the antigen-specific extracellular domain and the transmembrane domain, and between multiple scFvs in the case of tandem CAR may affect flexibility of the antigen-binding domain(s) and thereby CAR function.
  • Suitable transmembrane domains, costimulatory domains, and spacers are known in the art.
  • Engineered CARs may be introduced into CAR-bearing immune effector cells using retroviruses, which efficiently and stably integrate a nucleic acid sequence encoding the chimeric antigen receptor into the target cell genome.
  • Other methods known in the art include, but are not limited to, lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR/Cas systems (e.g., type I, type II, or type Ill systems using a suitable Cas protein such Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas1 Od, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or
  • Zinc finger nucleases ZFNs
  • TALENs transcription activator-like effector nucleases
  • Manipulation of PI3K signaling can be used to prevent altered CAR-T cell differentiation due to constitutive CAR self-signaling and foster long-lived memory T cell development.
  • pharmacologic blockade of PI3K during CAR-T manufacture and ex vivo expansion can abrogate preferential effector T cell development and restore CAR-T effector/memory ratio to that observed in empty vector transduced T cells, which can improve in vivo T cell persistence and therapeutic activity.
  • Inhibition of p110 ⁇ PI3K can enhance efficacy and memory in tumor-specific therapeutic CD8 T cells, while inhibition of p110 ⁇ PI3K can increase cytokine production and antitumor response.
  • CD3-zeta significantly enhances the constitutive activation of the PI3K, AKT, mTOR, and glycolysis pathways, and fostered formation of short-lived effector cells over central/stem memory cells. See, e.g., Zhang W. et al., “Modulation of PI3K signaling to improve CAR T cell function,” Oncotarget, 2018 Nov. 9; 9(88): 35807-35808.
  • Suitable antigens to be genome-edited in the iNKT cells disclosed herein, and to be recognized by the CARs of iNKT-CARs disclosed herein, include antigens specific to hematologic malignancies. These can include T cell-specific antigens and/or antigens that are not specific to T cells.
  • the antigen may be specifically bound by the chimeric antigen receptor of an iNKT-CARs cell, and the antigen for which the iNKT-CARs cell is deficient, is an antigen expressed on a malignant T cell, preferably an antigen that is overexpressed on malignant T cell (i.e., a T cell derived from a T-cell malignancy) in comparison to a nonmalignant T cell.
  • antigens include CD2, CD3 ⁇ , CD4, CD5, CD7, TRAC, and TCR ⁇ .
  • T-cell malignancies comprise malignancies derived from T-cell precursors, mature T cells, or natural killer cells.
  • T-cell malignancies include T-cell acute lymphoblastic leukemia/lymphoma (T-ALL), T-cell large granular lymphocyte (LGL) leukemia, human T-cell leukemia virus type 1-positive (HTLV-1 +) adult T-cell leukemia/lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), and various peripheral T-cell lymphomas (PTCLs), including but not limited to angioimmunoblastic T-cell lymphoma (AITL), ALK-positive anaplastic large cell lymphoma, and ALK-negative anaplastic large cell lymphoma.
  • T-ALL T-cell acute lymphoblastic leukemia/lymphoma
  • LGL large granular lymphocyte
  • HTLV-1 + human T-cell leukemia virus type 1-positive (HTLV-1 +) adult T-cell leuk
  • Suitable CAR antigens can also include antigens found on the surface of a multiple myeloma cell, i.e., a malignant plasma cell, such as BCMA, CS1, CD38, and CD19.
  • the CAR may be designed to express the extracellular portion of the APRIL protein, the ligand for BCMA and TACI, effectively co-targeting both BCMA and TACI for the treatment of multiple myeloma.
  • Suitable antigens to be genome-edited in the iNKT cells disclosed herein, and to be recognized by the CARs of iNKT-CARs disclosed herein, are given below in Tables 1-10. These include CD2, CD3 ⁇ , CD4, CD5, CD7, TRAC, TCR ⁇ , BCMA, CS1, and CD38.
  • the CAR-T, iNKT, NK and other CAR-bearing immune effector cells encompassed by the present disclosure are optionally deficient in one or more antigens to which the chimeric antigen receptor specifically binds and are therefore fratricide-resistant.
  • the one or more antigens of the cell is modified such the chimeric antigen receptor no longer specifically binds the one or more modified antigens.
  • the epitope of the one or more antigens recognized by the chimeric antigen receptor may be modified by one or more amino acid changes (e.g., substitutions or deletions) or the epitope may be deleted from the antigen.
  • expression of the one or more antigens is reduced in the cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more.
  • Methods for decreasing the expression of a protein are known in the art and include, but are not limited to, modifying or replacing the promoter operably linked to the nucleic acid sequence encoding the protein.
  • the cell is modified such that the one or more antigens is not expressed, e.g., by deletion or disruption of the gene encoding the one or more antigens.
  • the CAR-bearing immune effector cell may be deficient in one or preferably all the antigens to which the chimeric antigen receptor specifically binds.
  • CRISPR/cas9 gene editing can be used to modify a cell to be deficient in one or more antigens.
  • Zinc finger nucleases ZFNs
  • TALENs transcription activator-like effector nucleases
  • CAR-T, iNKT, NK and other CAR-bearing immune effector cells encompassed by the present disclosure may further be deficient in endogenous T cell receptor (TCR) signaling as a result of deleting a part of the T Cell Receptor (TCR)-CD3 complex.
  • TCR T Cell Receptor
  • decreasing or eliminating endogenous TCR signaling in CAR-T cells may prevent or reduce graft versus host disease (GvHD) when allogenic T cells are used to produce the CAR-T cells.
  • GvHD graft versus host disease
  • TCR-CD3 receptor complex e.g., the TCR receptor alpha chain (TRAC), the TCR receptor beta chain (TRBC), CD3 ⁇ CD3 ⁇ CD3 ⁇ , and/or CD3 ⁇ .
  • Deleting a part of the TCR receptor complex may block TCR mediated signaling and may thus permit the safe use of allogeneic T cells as the source of CAR-T cells without inducing life-threatening GvHD.
  • CAR-bearing immune effector cells encompassed by the present disclosure may further comprise one or more suicide genes.
  • suicide gene refers to a nucleic acid sequence introduced to a cell by standard methods known in the art that, when activated, results in the death of the cell.
  • Suicide genes may facilitate effective tracking and elimination of the CAR-bearing immune effector cells in vivo if required. Facilitated killing by activating the suicide gene may occur by methods known in the art.
  • Suitable suicide gene therapy systems known in the art include, but are not limited to, various the herpes simplex virus thymidine kinase (HSVtk)/ganciclovir (GCV) suicide gene therapy systems or inducible caspase 9 protein.
  • a suicide gene is a CD34/thymidine kinase chimeric suicide gene.
  • the disclosure provides an engineered T cell comprising a single CAR, that specifically binds an antigen or cell surface protein, wherein the T cell is optionally deficient in that antigen or cell surface protein (e.g., CD7CART ⁇ CD7 cell).
  • the deficiency in the antigen or cell surface protein resulted from (a) modification of antigen or cell surface protein expressed by the T cell such that the chimeric antigen receptors no longer specifically binds the modified antigen or cell surface protein (e.g., the epitope of the one or more antigens recognized by the chimeric antigen receptor may be modified by one or more amino acid changes (e.g., substitutions or deletions) or the epitope may be deleted from the antigen), (b) modification of the T cell such that expression of antigen or cell surface protein is reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) modification of the T cell such that antigen or cell surface protein is not expressed (e.g., by deletion or disruption of the gene encoding antigen or cell surface protein).
  • modification of antigen or cell surface protein expressed by the T cell such that the chimeric antigen receptors no longer specifically binds the modified antigen or cell surface protein
  • the CAR-T cell may be deficient in one or preferably all the antigens or cell surface proteins to which the chimeric antigen receptor specifically binds.
  • the methods to genetically modify a T cell to be deficient in one or more antigens or cell surface proteins are well known in art and non-limiting examples are provided herein.
  • the CRISPR-Cas9 system is used to modify a T cell to be deficient in one or more antigens. Any of these may be accomplished by the methods disclosed herein.
  • the T cell comprises a suicide gene.
  • the CAR for a CD7 specific CAR-T cell may be generated by cloning a commercially synthesized anti-CD7 single chain variable fragment (scFv) into a 3rd generation CAR backbone with CD28 and/or 4-1BB internal signaling domains.
  • scFv single chain variable fragment
  • An extracellular hCD34 domain may be added after a P2A peptide to enable both detection of CAR following viral transduction and purification using anti-hCD34 magnetic beads.
  • a similar method may be followed for making CARs specific for other malignant T cell antigens.
  • CAR-T cells encompassed by the present disclosure may further be deficient in endogenous T cell receptor (TCR) signaling as a result of deleting a part of the T Cell Receptor (TCR)-CD3 complex.
  • TCR T Cell Receptor
  • decreasing or eliminating endogenous TCR signaling in CAR-T cells may prevent or reduce graft versus host disease (GvHD) when allogenic T cells are used to produce the CAR-T cells.
  • GvHD graft versus host disease
  • TCR-CD3 receptor complex e.g., the TCR receptor alpha chain (TRAC), the TCR receptor beta chain (TCR ⁇ ) or subtypes thereof, TCR ⁇ , TCR ⁇ , CD3 ⁇ , CD3 ⁇ , and/or CD3 ⁇ .
  • Deleting a part of the TCR receptor complex may block TCR mediated signaling and may thus permit the safe use of allogeneic T cells as the source of CAR-T cells without inducing life-threatening GvHD.
  • CAR-T cells encompassed by the present disclosure may further comprise one or more suicide genes as described herein.
  • CAR amino acid sequences that can be expressed on the surface of a genome-edited CAR-T cell derived from a cytotoxic T cell, a memory T cell, or a gamma delta ( ⁇ ) T cell.
  • a tandem CAR-T cell is a T cell with a single chimeric antigen polypeptide comprising two distinct extracellular ligand-binding (antigen/protein recognition) domains capable of interacting with two different cell surface molecules (e.g., antigen/protein), wherein the extracellular ligand-binding domains are linked together by one or more flexible linkers and share one or more costimulatory domains, wherein the binding of the first or second extracellular ligand-binding domain will signal through one or more the costimulatory domains(s) and a signaling transducing domain.
  • the T cell is deficient in one or more antigens or cell surface proteins (e.g., CD7 and CD2 for a CD7*CD2-tCAR ⁇ CD7 ⁇ CD2 cell, or CD2 for a CD3*CD2-tCAR ⁇ CD3 ⁇ CD2 cell).
  • CD7 and CD2 for a CD7*CD2-tCAR ⁇ CD7 ⁇ CD2 cell, or CD2 for a CD3*CD2-tCAR ⁇ CD3 ⁇ CD2 cell.
  • the deficiency in the antigen(s) or cell surface protein(s) resulted from (a) modification of antigen or cell surface protein expressed by the T cell such that the chimeric antigen receptor no longer specifically binds the modified antigen(s) or cell surface protein(s) (e.g., the epitope of the one or more antigens recognized by the chimeric antigen receptor may be modified by one or more amino acid changes (e.g., substitutions or deletions) or the epitope may be deleted from the antigen), (b) modification of the T cell such that expression of antigen(s) or cell surface protein(s) is/are reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) modification of the T cell such that antigen(s) or cell surface protein(s) is/are not expressed (e.g., by deletion or disruption of the gene encoding antigen or cell surface protein).
  • modification of antigen or cell surface protein expressed by the T cell such that
  • the CAR-T cell may be deficient in one or preferably all the antigens or cell surface proteins to which the chimeric antigen receptor specifically binds.
  • the methods to genetically modify a T cell to be deficient in one or more antigens or cell surface proteins are well known in art and non-limiting examples are provided herein.
  • the CRISPR-Cas9 system is used to modify a T cell to be deficient in one or more antigen(s) or cell surface protein(s). Any of these may be accomplished by the methods disclosed herein.
  • the T cell comprises a suicide gene.
  • a tCAR for a genome-edited, tandem CAR-T cell i.e., CD2*CD3-tCART ⁇ CD2 ⁇ CD3 ⁇
  • CD2*CD3-tCART ⁇ CD2 ⁇ CD3 ⁇ may be generated by cloning a commercially synthesized anti-CD2 single chain variable fragment (scFv) and an anti-CD3 single chain variable fragment (scFv), separated by a peptide linker, into a lentiviral vector containing, e.g., a 2 nd or 3 rd generation CAR backbone with CD28 and/or 4-1BB internal signaling domains.
  • An extracellular hCD34 domain may be added after a P2A peptide to enable both detection of CAR following viral transduction and purification using anti-hCD34 magnetic beads.
  • a similar method may be followed for making tCARs specific for other malignant T cell antigens.
  • a linear tandem CAR-T cell comprises a chimeric antigen receptor (CAR) polypeptide comprising a first signal peptide, a first extracellular ligand-binding domain, a second extracellular ligand-binding domain, a hinge region, a transmembrane domain, one or more co-stimulatory domains, and a signaling transducing domain, wherein the first extracellular ligand-binding antigen recognition domain and the second extracellular ligand-binding antigen recognition domain have affinities for different cell surface molecules, i.e., antigens on a cancer cell, for example, a malignant T cell, B cell, or plasma cell; and wherein the linear tandem CAR-T cell possesses one or more genetic modifications, deletions, or disruptions resulting in reduced expression of the cell surface molecules in the linear tandem CAR-T cell.
  • CAR chimeric antigen receptor
  • the signal peptide is the signal peptide from human CD8 ⁇ .
  • the first extracellular ligand-binding domain comprises a single chain antibody fragment (scFv), comprising the light (V L ) and the heavy (V H ) variable fragment, designated V H 1 and V L 1 and joined by a linker (e.g., GGGGS (SEQ ID NO: 3065)). In some embodiments, this linker peptide is repeated 2, 3, 4, 5 or 6 times.
  • the first antigen recognition domain can be selected from: I) V H 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 1 or 2) V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1.
  • the second extracellular ligand-binding domain comprises a single chain antibody fragment (scFv), comprising the light (V L ) and the heavy (V H ) variable fragment, designated V H 2 and V L 2 and joined by a linker (e.g., GGGGS (SEQ ID NO: 3065)). In some embodiments, this linker peptide is repeated 2, 3, 4, 5 or 6 times.
  • the first antigen recognition domain can be selected from: 1) V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2 or 2) V L 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2.
  • first antigen recognition domain and second antigen recognition domain are connected by a short linker peptide of 5 amino acids (GGGGS (SEQ ID NO: 3065)). In some embodiments, this linker peptide is repeated 2, 3, 4, 5, or 6 times.
  • the first extracellular ligand-binding domain antigen recognition comprises a single chain antibody fragment (scFv), comprising the heavy (V H ) and the light (V L ) variable fragment, designated V H 1 and V L 1, and joined by a linker (e.g., GGGGS (SEQ ID NO: 3065)), targets a cell surface molecule, i.e., an antigen expressed on a malignant cell.
  • scFv single chain antibody fragment
  • V H the heavy
  • V L variable fragment
  • a linker e.g., GGGGS (SEQ ID NO: 3065)
  • the heavy (V H ) and the light (V L ) variable fragment, designated V H 1 and V L 1, targeting an antigen expressed on a malignant T cell is selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1a.
  • the second extracellular ligand-binding domain antigen recognition comprises a single chain antibody fragment (scFv), comprising the heavy (V H ) and the light (V L ) variable fragment, designated V H 2 and V L 2, and joined by a linker (e.g., GGGGS (SEQ ID NO: 3065)), and targets a cell surface molecule, i.e., an antigen, expressed on a malignant cell.
  • scFv single chain antibody fragment
  • V H the heavy
  • V L variable fragment
  • the heavy (V H ) and the light (V L ) variable fragments, designated V H 2 and V L 2, targeting an antigen expressed on a malignant T cell is selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1a and differs from the variable heavy (V H 1) and light sequences (V L 1) of the first extracellular ligand-binding domain of the CAR molecule.
  • hairpin tandem CAR constructs may be provided herein, such as including, but not limited to, a construct incorporating the V H and V L domains of CD2 and CD3 scFvs (Table 6).
  • the disclosure provides an engineered T cell with two distinct chimeric antigen receptor polypeptides with affinity to different antigen(s) or cell surface protein(s) expressed within the same effector cell, wherein each CAR functions independently.
  • the CAR may be expressed from single or multiple polynucleotide sequences that specifically bind different antigen(s) or cell surface protein(s), wherein the T cell is deficient in the antigen(s) or cell surface protein(s) to which the CARs bind (e.g., CD7*CD2-dCAR ⁇ CD7ACD2 cell).
  • the deficiency in the antigen(s) or cell surface protein(s) resulted from (a) modification of antigen or cell surface protein expressed by the T cell such that the chimeric antigen receptor no longer specifically binds the modified antigen(s) or cell surface protein(s) (e.g., the epitope of the one or more antigens recognized by the chimeric antigen receptor may be modified by one or more amino acid changes (e.g., substitutions or deletions) or the epitope may be deleted from the antigen), (b) modification of the T cell such that expression of antigen(s) or cell surface protein(s) is/are reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) modification of the T cell such that antigen(s) or cell surface protein(s) is/are not expressed (e.g., by deletion or disruption of the gene encoding antigen or cell surface protein).
  • modification of antigen or cell surface protein expressed by the T cell such that
  • the CAR-T cell may be deficient in one or preferably all the antigens or cell surface proteins to which the chimeric antigen receptor specifically binds.
  • the methods to genetically modify a T cell to be deficient in one or more antigens or cell surface proteins are well known in art and non-limiting examples are provided herein.
  • the CRISPR-Cas9 system is used to modify a T cell to be deficient in one or more antigen(s) or cell surface protein(s). Any of these may be accomplished by the methods disclosed herein.
  • the T cell comprises a suicide gene.
  • a dCAR for a genome-edited, dual CAR-T cell i.e., CD2*CD3 ⁇ -dCART ⁇ CD2 ⁇ CD3 ⁇
  • CD2*CD3 ⁇ -dCART ⁇ CD2 ⁇ CD3 ⁇ may be generated by cloning a commercially synthesized anti-CD2 single chain variable fragment into a lentiviral vector containing, e.g., a 2 nd or 3 rd generation CAR backbone with CD28 and/or 4-1BB internal signaling domains and cloning a commercially synthesized anti-CD3 ⁇ single chain variable into the same lentiviral vector containing an additional 2 nd or 3 rd generation CAR backbone with CD28 and/or 4-1BB internal signaling domains resulting in a plasmid from which the two CAR constructs are expressed from the same vector.
  • hCD34 domain may be added after a P2A peptide to enable both detection of CAR following viral transduction and purification using anti-hCD34 magnetic beads.
  • a similar method may be followed for making tCARs specific for other malignant T cell antigens.
  • a dual CAR-T cell comprises (i) a first chimeric antigen receptor (CAR) polypeptide comprising a first signal peptide, a first antigen recognition domain, a first hinge region, a first transmembrane domain, a first co-stimulatory domain, and a first signaling domain; and (ii) a second chimeric antigen receptor polypeptide comprising a second signaling peptide, a second antigen recognition domain, a second hinge region, a second transmembrane domain, a second co-stimulatory domain, and a second signaling domain; wherein the first antigen recognition domain and the second antigen recognition domain have affinities for different target antigens; and wherein the dual CAR-T cell possesses one or more genetic disruptions resulting in reduced expression of the target antigen in the dual CAR-T cell.
  • CAR chimeric antigen receptor
  • the first signal peptide is a CD8a signal sequence.
  • the first antigen recognition domain is fusion protein of the variable regions of immunoglobulin heavy and light chains, designated V H 1 and V L 1, for the first antigen recognition domain, connected by a short linker peptide of 5 amino acids (GGGGS) 3-4 (SEQ ID NO: 3065)). In some embodiments, this linker peptide is repeated 3 or 4 times. In some embodiments, the first antigen recognition domain can be selected from V H 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 1 or V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1.
  • the first hinge region comprises CD8a.
  • the first transmembrane domain is CD8 or CD28.
  • the first co-stimulatory domain comprises 4-1BB, CD28, or a combination of both, in either order, i.e., 4-1BB-CD28 or CD28-4-1BB.
  • the first signaling domain is CD3 ⁇ or a CD3 ⁇ bi-peptide., i.e., CD3 ⁇ -CD3 ⁇ .
  • the second signal peptide is a CD8a signal sequence of SEQ NO:1.
  • the second antigen recognition domain is fusion protein of the variable regions of immunoglobulin heavy and light chains, designated V H 2 and V L 2, for the second antigen recognition domain, connected by a short linker peptide of 5 amino acids (GGGGS (SEQ ID NO: 3065)). In some embodiments, this linker peptide is repeated 3 or 4 times. In some embodiments, the second antigen recognition domain can be selected from V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2 or V L 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2.
  • the second hinge region comprises CD8a.
  • the second transmembrane domain is CD8 or CD28.
  • the second co-stimulatory domain comprises 4-1BB, CD28, or a combination of both, in either order, i.e., 4-1BB-CD28 or CD28-4-1BB.
  • the second signaling domain is CD3 ⁇ or a CD3 ⁇ bi-peptide, i.e., CD3 ⁇ -CD3 ⁇ .
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V H 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 1 and a second antigen recognition domain fusion protein of V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1 and a second antigen recognition domain fusion protein of V L 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2 and a second antigen recognition domain fusion protein of V H 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 1.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V L 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2 and a second antigen recognition domain fusion protein of V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V H 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L I and a second antigen recognition domain fusion protein of V L 2 (GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1 and a second antigen recognition domain fusion protein of V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V H 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V L 2 and a second antigen recognition domain fusion protein of V L 1—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 1.
  • the CAR polypeptide comprises a first antigen recognition domain fusion protein of V L 2—(GGGGS) 3-4 (SEQ ID NO: 3066)—V H 2 and a second antigen recognition domain fusion protein of V H 1 (GGGGS) 3-4 (SEQ ID NO: 3066)—V L 1.
  • the CAR polypeptide comprises at least one high efficiency cleavage site, wherein the high efficiency cleavage site is selected from P2A, T2A, E2A, and F2A.
  • the CAR polypeptide comprises a suicide gene.
  • the CAR polypeptide comprises a mutant cytokine receptor.
  • the dual CAR-T cell targets two antigens selected from CD5, CD7, CD2, CD4, CD3, CD33, CD123 (IL3RA), CD371 (CLL-1; CLEC12A), CD117 (c-kit), CD135 (FLT3), BCMA, CS1, CD38, CD79A, CD79B, CD138, and CD19, APRIL, and TACI.
  • Cytokine release syndrome is caused by a large, rapid release of cytokines from immune cells in response to immunotherapy (or other immunological stimulus). Accordingly, reducing the level of cytokines released would prevent or reduce the development and/or maintenance of CRS. As disclosed herein, this can be accomplished by modifying, disrupting, or deleting one or more cytokine/chemokine/transcription factor genes.
  • One method to accomplish this is genetic ablation (gene silencing) in which gene expression is abolished through the alteration or deletion of genetic sequence information.
  • TALENs Transcription Activator-like Effector Nucleases
  • ZFNs Zinc Finger Nucleases
  • CRISPR CRISPR
  • siRNAs small interfering RNAs
  • PEBLs protein expression blockers
  • ER endoplasmic reticulum
  • PEBL constructs can be readily combined with other gene modification systems for ex vivo cell processing of immune cells.
  • a short hairpin RNA or small hairpin RNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression, i.e., of antigens, via RNA interference (RNAi).
  • RNAi RNA interference
  • Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors.
  • Cytokines or chemokines that can be deleted from immune effector cells as disclosed herein, e.g., by targeted transduction of a CAR into the gene sequence of the cytokine include without limitation the following: XCL1, XCL2, CCL1, CCL2, CCL3, CCL4, CCLS, CCL7, CCL8, CCL11, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CX3CL1, IL-1 ⁇ , IL-1 ⁇ , IL-1RA, IL-18, IL-2, IL-4, IL-7, IL-9, IL
  • the cytokine is chosen from cytokine is chosen from MCP1 (CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN ⁇ .
  • transcription factors that can be deleted from immune effector cells as disclosed herein include AHR, BCL6, FOXP3, GATA3, MAF, RORC, SPI1, and TBX21.
  • sequences of these genes are known and available in the art and can include, for example, those provided in Table 10.
  • Cytokine/chemokine gene targets of specific interest for deletion or suppression (e.g., ablation, knock-out, KO) in CAR-T cells for the mitigation of CRS have been categorized into groups based on biological function. CRS development is dependent upon CAR-T cell activation and subsequent cytokine release, which initiates a dysregulated immune system in the recipient of the CAR-T cell therapy. Several studies have indicated that recipient myeloid activation is necessary for the development of CRS.
  • the first group of potential genes to KO in CAR-T are surface receptors that, when engaged with myeloid cells in normal immunological responses activate the myeloid cells (e.g., CD40L).
  • the second group are cytokines that are released from CAR-T cells that activate myeloid cells (e.g., GM-CSF). In both these categories, the goal is to prevent CAR-T cell signaling, which will activate recipient myeloid cells and initiate CRS.
  • the third category of targets are endogenous T cell receptors that increase T cell activation (potentially in the absence of tumor target) that are integrated into the CAR-T receptor (e.g., endogenous CD28).
  • the aim is to curtail activation of the CAR-T from non-tumor interactions, such as activated myeloid cells that could engage with CD28 on activated T cells, thus amplifying T cell cytokine production and subsequent myeloid activation.
  • the fourth and fifth categories of gene KO targets are transcription factors and cytokines that drive CAR-T cell differentiation and subsequent functional characteristics.
  • CAR-T cells that are phenotypically similar to normal cytotoxic T cells (CTL, typically identified by CD8 expression) are capable of direct tumor killing through T cell mediated effector functions.
  • CTL are supported and maintained by T helper cells (expressing CD4).
  • T helper cells expressing CD4.
  • subsets of T helper cells can support CTL (i.e., Thl cells) or inhibit (i.e., Th2 cells).
  • Other T cells, such as Tregs can also inhibit CTL development and function.
  • the aim is to target cytokines or transcription factors in the CAR-T population that would lead to CAR-T differentiation into non-cytotoxic T cell populations.
  • Th2 cells produce cytokines (such as GM-CSF and IL-4), which are indicative markers of CRS. It is likely that CAR-T phenotypes, which cannot optimally kill tumor cells, will be activated via CAR-T receptors, produce signals that drive CRS in the host, increase the time required for tumor killing, and require higher CAR-T cell doses than optimized “killing” products. Thus, knocking out or ablating (or suppressing) transcription factors (such as GATA3) or cytokines (such as IL-4) will prevent (or reduce) Th2 bias and reduce CRS.
  • cytokines such as GM-CSF and IL-4
  • IL-5 is a key cytokine produced by Th2 cells, eosinophils and mast cells. Excessive levels of ferritin are observed in mastocytosis and several diseases involving mast cell dysregulation. Additionally, many mast cell diseases include neurological dysregulation.
  • CX3CR1 is a T cell chemokine receptor that principally directs T cells and potentially CAR-T cells into the CNS.
  • OX40 is the T cell receptor which facilitates activation by cell-cell interaction with OX40L on eosinophils and mast cells.
  • the cytokine is chosen from CCL2 (MCP1), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN ⁇ .
  • the genome-edited immune effector cells disclosed herein, and/or generated using the methods disclosed herein express one or more chimeric antigen receptors (CARs) and can be used as a medicament, i.e., for the treatment of disease.
  • the cells are CAR-T cells.
  • Cells disclosed herein, and/or generated using the methods disclosed herein, may be used in immunotherapy and adoptive cell transfer, for the treatment, or the manufacture of a medicament for treatment, of cancers, autoimmune diseases, infectious diseases, and other conditions.
  • the cancer may be a hematologic malignancy or solid tumor.
  • Hematologic malignancies include leukemias, lymphomas, multiple myeloma, and subtypes thereof.
  • Lymphomas can be classified various ways, often based on the underlying type of malignant cell, including Hodgkin's lymphoma (often cancers of Reed-Sternberg cells, but also sometimes originating in B cells; all other lymphomas are non-Hodgkin's lymphomas), B-cell lymphomas, T-cell lymphomas, mantle cell lymphomas, Burkitt's lymphoma, follicular lymphoma, and others as defined herein and known in the art.
  • Hodgkin's lymphoma often cancers of Reed-Sternberg cells, but also sometimes originating in B cells; all other lymphomas are non-Hodgkin's lymphomas
  • B-cell lymphomas of cells of Reed-Sternberg cells, but also sometimes originating in B cells
  • B-cell lymphomas include, but are not limited to, diffuse large B-cell lymphoma (DLBCL), chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma (SLL), and others as defined herein and known in the art.
  • DLBCL diffuse large B-cell lymphoma
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • T-cell lymphomas include T-cell acute lymphoblastic leukemia/lymphoma (T-ALL), peripheral T-cell lymphoma (PTCL), T-cell chronic lymphocytic leukemia (T-CLL) Sezary syndrome, and others as defined herein and known in the art.
  • T-ALL T-cell acute lymphoblastic leukemia/lymphoma
  • PTCL peripheral T-cell lymphoma
  • T-CLL T-cell chronic lymphocytic leukemia Sezary syndrome
  • Leukemias include Acute myeloid (or myelogenous) leukemia (AML), chronic myeloid (or myelogenous) leukemia (CML), acute lymphocytic (or lymphoblastic) leukemia (ALL), chronic lymphocytic leukemia (CLL) hairy cell leukemia (sometimes classified as a lymphoma), and others as defined herein and known in the art.
  • AML Acute myeloid (or myelogenous) leukemia
  • CML chronic myeloid (or myelogenous) leukemia
  • ALL acute lymphocytic leukemia
  • CLL chronic lymphocytic leukemia
  • Plasma cell malignancies include lymphoplasmacytic lymphoma, plasmacytoma, and multiple myeloma.
  • the medicament can be used for treating cancer in a patient, particularly for the treatment of solid tumors such as melanomas, neuroblastomas, gliomas or carcinomas such as tumors of the brain, head and neck, breast, lung (e.g., non small cell lung cancer, NSCLC), reproductive tract (e.g., ovary), upper digestive tract, pancreas, liver, renal system (e.g., kidneys), bladder, prostate and colorectum.
  • solid tumors such as melanomas, neuroblastomas, gliomas or carcinomas
  • solid tumors such as melanomas, neuroblastomas, gliomas or carcinomas
  • solid tumors such as melanomas, neuroblastomas, gliomas or carcinomas
  • NSCLC non small cell lung cancer
  • reproductive tract e.g., ovary
  • pancreas e.g., liver
  • renal system e.g., kidneys
  • bladder e.g., prostate and colorectum.
  • the medicament can be used for treating cancer in a patient, particularly for the treatment of hematologic malignancies selected from multiple myeloma and acute myeloid leukemia (AML) and for T-cell malignancies selected from T-cell acute lymphoblastic leukemia (T-ALL), non-Hodgkin's lymphoma, and T-cell chronic lymphocytic leukemia (T-CLL).
  • hematologic malignancies selected from multiple myeloma and acute myeloid leukemia (AML)
  • T-cell malignancies selected from T-cell acute lymphoblastic leukemia (T-ALL), non-Hodgkin's lymphoma, and T-cell chronic lymphocytic leukemia (T-CLL).
  • the cells may be used in the treatment of autoimmune diseases such as lupus, autoimmune (rheumatoid) arthritis, multiple sclerosis, transplant rejection, Crohn's disease, ulcerative colitis, dermatitis, and the like.
  • the cells are chimeric autoantibody receptor T-cells, or CAAR-Ts displaying antigens or fragments thereof, instead of antibody fragments; in this version of adoptive cell transfer, the B cells that cause autoimmune diseases will attempt to attack the engineered T cells, which will respond by killing them.
  • the cells may be used in the treatment of infectious diseases such as HIV and tuberculosis.
  • the CAR-T cells of the present disclosure can undergo robust in vivo T cell expansion and can persist for an extended amount of time.
  • the treatment of a patient with CAR-T cells of the present disclosure can be ameliorating, curative or prophylactic. It may be either part of an autologous immunotherapy or part of an allogenic immunotherapy treatment.
  • autologous it is meant that cells, cell line or population of cells used for treating patients are originating from said patient or from a Human Leucocyte Antigen (HLA) compatible donor.
  • HLA Human Leucocyte Antigen
  • allogeneic is meant that the cells or population of cells used for treating patients are not originating from the patient but from a donor.
  • the treatment of cancer with CAR-T cells of the present disclosure may be in combination with one or more therapies selected from antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, radiotherapy, laser light therapy, and radiation therapy.
  • CAR-T cells or a population of CAR-T cells of the present disclosure of the present disclosure be carried out by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • the CAR-T cells compositions described herein, i.e., mono CAR, dual CAR, tandem CARs, may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous or intralymphatic injection, or intraperitoneally.
  • the cell compositions of the present disclosure are preferably administered by intravenous injection.
  • the administration of CAR-T cells or a population of CAR-T cells can consist of the administration of 10 4 -10 9 cells per kg body weight, preferably 10 5 to 10 6 cells/kg body weight including all integer values of cell numbers within those ranges.
  • the CAR-T cells or a population of CAR-T cells can be administrated in one or more doses.
  • the effective amount of CAR-T cells or a population of CAR-T cells are administrated as a single dose.
  • the effective amount of cells are administered as more than one dose over a period time. Timing of administration is within the judgment of a health care provider and depends on the clinical condition of the patient.
  • the CAR-T cells or a population of CAR-T cells may be obtained from any source, such as a blood bank or a donor. While the needs of a patient vary, determination of optimal ranges of effective amounts of a given CAR-T cell population(s) for a particular disease or conditions are within the skill of the art.
  • An effective amount means an amount which provides a therapeutic or prophylactic benefit. The dosage administered will be dependent upon the age, health and weight of the patient recipient, type of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • the effective amount of CAR-T cells or a population of CAR-T cells or composition comprising those CAR-T cells are administered parenterally.
  • the administration can be an intravenous administration.
  • the administration of CAR-T cells or a population of CAR-T cells or composition comprising those CAR-T cells can be directly done by injection within a tumor.
  • the CAR-T cells or a population of the CAR-T cells are administered to a patient in conjunction with, e.g., before, simultaneously or following, any number of relevant treatment modalities, including but not limited to, treatment with cytokines, or expression of cytokines from within the CAR-T, that enhance T-cell proliferation and persistence and, include but not limited to, IL-2, IL-7, and IL-15.
  • relevant treatment modalities including but not limited to, treatment with cytokines, or expression of cytokines from within the CAR-T, that enhance T-cell proliferation and persistence and, include but not limited to, IL-2, IL-7, and IL-15.
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with agents that inhibit immunosuppressive pathways, including but not limited to, inhibitors of TGF- ⁇ , interleukin 10 (IL-10), adenosine, VEGF, indoleamine 2,3 dioxygenase 1 (IDO1), indoleamine 2,3-dioxygenase 2 (IDO2), tryptophan 2-3-dioxygenase (TDO), lactate, hypoxia, arginase, and prostaglandin E2.
  • agents that inhibit immunosuppressive pathways including but not limited to, inhibitors of TGF- ⁇ , interleukin 10 (IL-10), adenosine, VEGF, indoleamine 2,3 dioxygenase 1 (IDO1), indoleamine 2,3-dioxygenase 2 (IDO2), tryptophan 2-3-dioxygenase (TDO), lactate, hypoxia, arginas
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with T-cell checkpoint inhibitors, including but not limited to, anti-CTLA4 (Ipilimumab) anti-PD1 (Pembrolizumab, Nivolumab, Cemiplimab), anti-PDL1 (Atezolizumab, Avelumab, Durvalumab), anti-PDL2, anti-BTLA, anti-LAG3, anti-TIM3, anti-VISTA, anti-TIGIT, and anti-KIR.
  • T-cell checkpoint inhibitors including but not limited to, anti-CTLA4 (Ipilimumab) anti-PD1 (Pembrolizumab, Nivolumab, Cemiplimab), anti-PDL1 (Atezolizumab, Avelumab, Durvalumab), anti-PDL2, anti-BTLA, anti-LAG3, anti-TIM3, anti-VISTA, anti-TIGIT, and
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with T cell agonists, including but not limited to, antibodies that stimulate CD28, ICOS, OX-40, CD27, 4-1BB, CD137, GITR, and HVEM
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with therapeutic oncolytic viruses, including but not limited to, retroviruses, picornaviruses, rhabdoviruses, paramyxoviruses, reoviruses, parvoviruses, adenoviruses, herpesviruses, and poxviruses.
  • therapeutic oncolytic viruses including but not limited to, retroviruses, picornaviruses, rhabdoviruses, paramyxoviruses, reoviruses, parvoviruses, adenoviruses, herpesviruses, and poxviruses.
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with immunostimulatory therapies, such as toll-like receptors agonists, including but not limited to, TLR3, TLR4, TLR7 and TLR9 agonists.
  • immunostimulatory therapies such as toll-like receptors agonists, including but not limited to, TLR3, TLR4, TLR7 and TLR9 agonists.
  • the CAR-T cells or a population of CAR-T cells of the present disclosure may be used in combination with stimulator of interferon gene (STING) agonists, such as cyclic GMP-AMP synthase (cGAS).
  • STING interferon gene
  • cGAS cyclic GMP-AMP synthase
  • Immune effector cell aplasia is also a concern after adoptive cell transfer therapy.
  • the malignancy treated is a T-cell malignancy
  • CAR-T cells target a T cell antigen
  • normal T cells and their precursors expressing the antigen will become depleted, and the immune system will be compromised.
  • methods for managing these side effects are attendant to therapy. Such methods include selecting and retaining non-malignant T cells or precursors, either autologous or allogeneic (optionally engineered not to cause rejection or be rejected), for later expansion and re-infusion into the patient, after CAR-T cells are exhausted or deactivated.
  • CAR-T cells which recognize and kill subsets of TCR-bearing cells, such as normal and malignant TRBC1 + , but not TRBC2 + cells, or alternatively, TRBC2 + , but not TRBC1 + cells, may be used to eradicate a T cell malignancy while preserving sufficient normal T cells to maintain normal immune system function.
  • activation in reference to cells is generally understood to be synonymous with “stimulating” and as used herein refers to treatment of cells that results in expansion of cell populations.
  • activation is often accomplished by exposure to CD2 and CD28 (and sometimes CD2 as well) agonists, typically antibodies, optionally coated onto magnetic beads or conjugated to a colloidal polymeric matrix.
  • antigen as used herein is a cell surface protein recognized by (i.e., that is the target of) T cell receptor or chimeric antigen receptor.
  • antigens are substances, typically proteins, that are recognized by antibodies, but the definitions overlap insofar as the CAR comprises antibody-derived domains such as light (V L ) and heavy (V H ) chains recognizing one or more antigen(s).
  • cancer refers to a malignancy or abnormal growth of cells in the body. Many different cancers can be characterized or identified by particular cell surface proteins or molecules. Thus, in general terms, cancer in accordance with the present disclosure may refer to any malignancy that may be treated with an immune effector cell, such as a CAR-T cell as described herein, in which the immune effector cell recognizes and binds to the cell surface protein on the cancer cell. As used herein, cancer may refer to a hematologic malignancy, such as multiple myeloma, a T-cell malignancy, or a B cell malignancy.
  • T cell malignancies may include, but are not limited to, T-cell acute lymphoblastic leukemia (T-ALL) or non-Hodgkin's lymphoma.
  • T-ALL T-cell acute lymphoblastic leukemia
  • a cancer may also refer to a solid tumor, such as including, but not limited to, cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
  • a “cell surface protein” as used herein is a protein (or protein complex) expressed by a cell at least in part on the surface of the cell.
  • cell surface proteins include the TCR (and subunits thereof) and CD7.
  • combination therapy means the administration of two or more therapeutic agents to treat a therapeutic condition or disorder described in the present disclosure. Such administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule having a fixed ratio of active ingredients or in multiple, separate capsules for each active ingredient. In addition, such administration also encompasses use of each type of therapeutic agent in a sequential manner. In either case, the treatment regimen will provide beneficial effects of the drug combination in treating the conditions or disorders described herein.
  • composition refers to an immunotherapeutic cell population combination with one or more therapeutically acceptable carriers.
  • disease as used herein is intended to be generally synonymous, and is used interchangeably with, the terms “disorder,” “syndrome,” and “condition” (as in medical condition), in that all reflect an abnormal condition of the human or animal body or of one of its parts that impairs normal functioning, is typically manifested by distinguishing signs and symptoms, and causes the human or animal to have a reduced duration or quality of life.
  • donor template refers to the reference genomic material that the cell uses as a template to repair the a double-stranded break through the homology-directed repair (HDR) DNA repair pathway.
  • the donor template contains the piece of DNA to be inserted into the genome (containing the gene to be expressed, CAR, or marker) with two homology arms flanking the site of the double-stranded break.
  • a donor template may be an adeno-associated virus, a single-stranded DNA, or a double-stranded DNA.
  • fratricide means a process which occurs when a CAR-T cell (or other CAR-bearing immune effector cell) becomes the target of, and is killed by, another CAR-T cell comprising the same chimeric antigen receptor as the target of CAR-T cell, because the targeted cell expresses the antigen specifically recognized by the chimeric antigen receptor on both cells.
  • CAR-T comprising a chimeric antigen receptor which are deficient in an antigen to which the chimeric antigen receptor specifically binds will be “fratricide-resistant.”
  • a “genome-edited” or “gene-edited” as used herein means having a gene or potion of the genome added, deleted, or modified (e.g., disrupted) to be non-functional.
  • a “genome-edited T cell” is a T cell that has had a gene such as a CAR recognizing at least one antigen added; and/or has had a gene such as the gene(s) to the antigen(s) that are recognized by the CAR deleted, and/or has had the gene to the TCR or a subunit thereof disrupted.
  • a “healthy donor,” as used herein, is one who does not have a malignancy (particularly a hematologic malignancy, e.g., a T-cell malignancy).
  • an “immature dendritic cell” or “iDC” refers to an immature dendritic cell.
  • terapéuticaally acceptable refers to substances which are suitable for use in contact with the tissues of patients without undue toxicity, irritation, and allergic response, are commensurate with a reasonable benefit/risk ratio, and/or are effective for their intended use.
  • terapéuticaally effective is intended to qualify the amount of active ingredients used in the treatment of a disease or disorder or on the effecting of a clinical endpoint.
  • patient is generally synonymous with the term “subject” and includes all mammals including humans.
  • a “malignant B cell” is a B cell derived from a B-cell malignancy.
  • B cell malignancies include, without limitation, (DLBCL), chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma (SLL), and B cell-precursor acute lymphoblastic leukemia (ALL).
  • compositions of matter such as antibodies
  • compositions of matter such as cells
  • a “malignant T cell” is a T cell derived from a T-cell malignancy.
  • T-cell malignancy refers to a broad, highly heterogeneous grouping of malignancies derived from T-cell precursors, mature T cells, or natural killer cells.
  • T-cell malignancies include T-cell acute lymphoblastic leukemia/lymphoma (T-ALL), human T-cell leukemia virus type 1-positive (HTLV-1+) adult T-cell leukemia/lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), Adult T-cell lymphoma/leukemia (HTLV-1 associated), Aggressive NK-cell leukemia, Anaplastic large-cell lymphoma (ALCL), ALK positive, Anaplastic large-cell lymphoma (ALCL), ALK negative, Angioimmunoblastic T-cell lymphoma (AITL), Breast implant-associated anaplastic large-cell lymphoma, Chronic lymphoproliferative disorder of NK cells, Extra nodal NK/T-cell lymphoma, nasal type, Enteropathy-type T-cell lymphoma, Follicular T-cell lymphoma, Hepatosplenic T-cell lymphoma, Indolent T-cell lymph
  • a “malignant plasma cell” is a plasma cell derived from a plasma cell malignancy.
  • the term “plasma-cell malignancy” refers to a malignancy in which abnormal plasma cells are overproduced.
  • Non-limiting examples of plasma cell malignancies include lymphoplasmacytic lymphoma, plasmacytoma, and multiple myeloma.
  • suicide gene refers to a nucleic acid sequence introduced to a CAR-T cell by standard methods known in the art, that when activated result in the death of the CAR-T cell. If required suicide genes may facilitate the tracking and elimination, i.e., killing, of CAR-T cells in vivo. Facilitated killing of CAR-T cells by activating a suicide gene can be accomplished by standard methods known in the art. Suicide gene systems known in the art include, but are not limited to, several herpes simplex virus thymidine kinase (HSVtk)/ganciclovir (GCV) suicide gene therapy systems and inducible caspase 9 proteins. In one embodiment, the suicide gene is a chimeric CD34/thymidine kinase.
  • an “immune effector cell” is a leukocyte that can modulate an immune response.
  • Immune effector cells include T cells, B cells, natural killer (NK) cells, iNKT cells (invariant T-cell receptor alpha natural killer T cells), and macrophages.
  • T cell receptor (TCR)-bearing immune effector cells include, of course, T cells, but also cells which have been engineered to express a T cell receptor.
  • Immune effector cells may be obtained or derived/generated from any appropriate source, such as including, but not limited to, healthy donors, peripheral blood mononuclear cells, cord blood, and induced pluripotent stem cells (iPSC).
  • a “CAR-bearing immune effector cell” is an immune effector cell which has been transduced with at least one CAR.
  • a “CAR-T cell” is a T cell which has been transduced with at least one CAR; CAR-T cells can be mono, dual, or tandem CAR-T cells.
  • CAR-T cells can be autologous, meaning that they are engineered from a subject's own cells, or allogeneic, meaning that the cells are sourced from a healthy donor, and in many cases, engineered so as not to provoke a host-vs-graft or graft-vs-host reaction.
  • a “chimeric antigen receptor” or “CAR” as used herein and generally used in the art refers to a recombinant fusion protein that has an extracellular ligand-binding domain, a transmembrane domain, and a signaling transducing domain that directs the cell to perform a specialized function upon binding of the extracellular ligand-binding domain to a component present on the target cell.
  • a CAR can have an antibody-based specificity for a desired antigen (e.g., tumor antigen) with a T cell receptor-activating intracellular domain to generate a chimeric protein that exhibits specific anti-target cellular immune activity.
  • First-generation CARs include an extracellular ligand-binding domain and signaling transducing domain, commonly CD3 ⁇ or Fc ⁇ RI ⁇ .
  • Second generation CARs are built upon first generation CAR constructs by including an intracellular costimulatory domain, commonly 4-1BB or CD28. These costimulatory domains help enhance CAR-T cell cytotoxicity and proliferation compared to first generation CARs.
  • the third generation CARs include multiple costimulatory domains, primarily to increase CAR-T cell proliferation and persistence. Chimeric antigen receptors are distinguished from other antigen binding agents by their ability both to bind MHC-independent antigens and transduce activation signals via their intracellular domain.
  • CAR-iNKT cell (equivalently, iNKT-CAR) means an iNKT cell that expresses a chimeric antigen receptor.
  • a dual iNKT-CAR cell (equivalently, iNKT-dCAR) is an iNKT-CAR cell that expresses two distinct chimeric antigen receptor polypeptides with affinity to different target antigens expressed within the same effector cell, wherein each CAR functions independently.
  • the CAR may be expressed from a single or multiple polynucleotide sequences.
  • a tandem iNKT-CAR cell is an iNKT-CAR cell with a single chimeric antigen polypeptide containing two distinct antigen recognition domains with affinity to different targets, wherein the antigen recognition domains are linked through a peptide linker and share common costimulatory domain(s), and wherein binding of either antigen recognition domain will signal though a common costimulatory domains(s) and signaling domain.
  • chimeric antigen receptor T cell (equivalently, CAR-T) means an T cell that expresses a chimeric antigen receptor.
  • dual CAR-T means a CAR-T cell that expresses cells two distinct chimeric antigen receptor polypeptides with affinity to different target antigen expressed within the same effector cell, wherein each CAR functions independently.
  • the CAR may be expressed from single or multiple polynucleotide sequences.
  • tandem CAR-T means a single chimeric antigen polypeptide containing two distinct antigen recognition domains with affinity to different targets wherein the antigen recognition domain is linked through a peptide linker and share common costimulatory domain(s), wherein the binding of either antigen recognition domain will signal through a common co-stimulatory domains(s) and signaling domain.
  • NK-CAR chimeric antigen receptor natural killer
  • a chimeric antigen receptor macrophage (equivalently, CAR-macrophage) would have a meaning analogous to the definitions of CAR-T, iNKT-CAR, and NK-CAR.
  • cytokine release syndrome refers to a condition that may occur after treatment with some types of immunotherapy, such as monoclonal antibodies and CAR-T or other CAR-bearing immune effector cells. Cytokine release syndrome is caused by a large, rapid release of cytokines into the blood from immune cells affected by the immunotherapy. Symptoms of CRS include fever, fatigue, loss of appetite, muscle and joint pain, nausea, vomiting, diarrhea, rashes, fast breathing, rapid heartbeat, low blood pressure, seizures, headache, confusion, delirium, hallucinations, tremor, and loss of coordination. CRS can manifest along a spectrum of mild to fatal, and can be ranked by severity as follows:
  • CAR-T associated neuropathy means neuropathy that arises subsequent to administration of CAR-T therapy to a patient, often after intervening cytokine release syndrome has occurred and subsided.
  • the term is relatively new, mainly because CAR-T therapy is relatively new; see, e.g., Vasthie P and Breitbart WS, “Chimeric antigen receptor T-cell neuropsychiatric toxicity in acute lymphoblastic leukemia,” Palliat Support Care. 2017 August; 15(4): 499-503.
  • CAR-T associated neuropathy should be understood at this time to be equivalent to the term “CAR-bearing immune effector cell associated neuropathy,” since similar neuropathy could arise from therapy with, e.g., iNKT-CARs or NK-CARs.
  • cytokine is one of a class of small ( ⁇ 5-20 kDa), soluble signaling proteins that are that are synthesized and secreted by certain cells of the immune system at variable, and occasionally locally high, concentrations and by binding to receptors on other cells, send signals to and have an effect on those cells.
  • a “chemokine” is a chemotactic cytokine, i.e., a subspecies of cytokine that is able to induce chemotaxis in nearby responsive cells.
  • to be “deficient” in a cytokine or protein means to lack sufficient quantity of the cytokine or protein for the cytokine or protein to elicit its normal effect.
  • a cell that is “deficient” in GM-CSF, for example, (a “GM-CSF deficient” cell) could be entirely lacking in GM-CSF, but it also could express such a negligible quantity of GM-CSF that the GM-CSF present could not contribute in any meaningful way to the development or maintenance of cytokine release syndrome.
  • deletion as used herein in reference to the effect of editing on a gene or its protein product, means alteration or loss of part the sequence of DNA encoding the protein so as to reduce or prevent expression of the protein product.
  • suppression in the same context means to reduce expression of the protein product; and the term “ablation” in the same context means to knock out (KO) or prevent expression of the protein product. Deletion encompasses suppression and ablation.
  • secretable protein is s protein secreted by a cell which has an effect on other cells.
  • secretable proteins include cytokines, chemokines, and transcription factors.
  • a “selectable marker” refers to a marker that allows distinguishing between different cell types, such as a cell into which a CAR has been successfully inserted (i.e., a gene-edited or modified cell). Selectable markers are well known in the art and materials and methods for their use are readily available.
  • a selectable marker appropriate in accordance with the present disclosure may be a fluorescent protein gene, such as including, but not limited to, a green fluorescence (GFP) gene or a yellow fluorescent protein (YFP) gene.
  • GFP green fluorescence
  • YFP yellow fluorescent protein
  • a selectable marker may be a splice variant of a CD34 gene, such as a truncated CD34 (tCD34) gene or a truncated EGFR (tEGFR) gene.
  • a selectable marker described herein, such as GFP, or others known and available in the art may be inserted alone into a gene as described herein (i.e., without a CAR), or may be inserted as a component of a construct comprising the selectable marker and a CAR.
  • RNA short hairpin RNA
  • small hairpin RNA small hairpin RNA
  • shRNA is an artificial RNA molecule, often about 80 base pairs in length and with a tight hairpin turn, that can be used to silence target gene expression via processing within the cell into siRNA which in turn knocks down gene expression.
  • shRNAs can be incorporated into genomic DNA, and provide stable and long-lasting expression.
  • transduction is the process by which foreign DNA is introduced into a cell by a virus or viral vector such as a plasmid, for example by short hairpin RNAs (shRNAs); it often provides long-lasting or permanent silencing of a gene. It may be accomplished by methods known in the art, including electroporation.
  • shRNAs short hairpin RNAs
  • Transfection is the process of deliberately introducing purified nucleic acids into eukaryotic cells, for example small interfering RNAs (siRNAs); it produces transient silencing of a gene by RNA interference with mRNA transcripts.
  • Transduction is the process by which foreign DNA is introduced into a cell by a virus or viral vector such as a plasmid, for example by short hairpin RNAs (shRNAs); it often provides long-lasting or permanent silencing of a gene. Both may be accomplished by methods known in the art, including electroporation.
  • FIG. 1 shows the deletion of a cytokine gene by using Cas9/CRISPR to target a locus in a cytokine gene, then use homology-directed repair to insert the CAS construct.
  • the CAS construct would contain a marker, such as a selectable marker as described herein.
  • a marker such as a selectable marker as described herein.
  • One challenge with this concept is that is hard to select and sort out the cells have been edited from those that still express the cytokine/chemokine.
  • One way to overcome this is to insert the CAR construct containing a marker, into gene that has been deleted. It has previously been demonstrated that inserting CAR19 into the TRAC gene allows the selection of TRAC-negative, CAR-positive cells. This would allow sorting of cells that have both expression of the car and have the cytokine deleted.
  • CAR-bearing immune effector cells e.g., CAR-T
  • CAR-T CAR-bearing immune effector cells
  • Step 1 Cells are harvested, isolated, and purified, for example using magnetic selection with a labelled antibody-coated magnetic beads that bind to a cell-specific protein (available from, e.g., Miltenyi Biotec). For T cells, anti-CD3/CD28 beads could be used. Other purification techniques are known in the art and could be used.
  • Step 3 Cells are thereafter activated.
  • T cells may be activated using antiCD3/CD28 beads for two days prior to bead removal.
  • an antibody could be used.
  • the antigen that is the target of the CAR may be deleted from the cell surface or its expression suppressed to prevent subsequent fratricide.
  • Target deletion may be accomplished by electroporation with Cas9 mRNA and gRNA against the target(s).
  • Other techniques could be used to suppress expression of the target. These include other genome editing techniques such as TALENs, ZFNs, RNA interference, and eliciting of internal binding of the antigen to prevent cell surface expression. Deletion of the target may not be required in every circumstance. Examples of gRNAs that may be used include those shown in Tables 8-10, as well as others known in the art.
  • RNA sequences for use in removing surface antigens on immune effector cells Target gene gRNA sequence CD7 5′_2′OMe (A(ps)U(ps)C(ps))ACGGAGGUCAAUGUCUA GUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG GCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U(ps)U_3′ (SEQ ID NO: 40) CD7g10 5′_2′OMe (G(ps)U(ps)A(ps))GACAUUGACCUCCGUG AGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG GCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U_3′ (SEQ ID NO: 41) CD7g4 5′_2′OMe (A(ps
  • Cells may then be transduced with a CAR targeted to (i.e., that recognizes) one or more antigen or protein targets, for example with a lentivirus containing a CAR construct.
  • a CAR targeted to i.e., that recognizes
  • antigen or protein targets for example with a lentivirus containing a CAR construct.
  • Any other suitable method of transduction/transfection may be used, for example transfection using DNA-integrating viral or non-viral vectors containing transposable elements, or transient expressing of non-DNA integrating polynucleotides, such as mRNA, or insertion of CAR polynucleotide into site of nuclease activity using homologous or non-homologous recombination.
  • Step 6 CAR-bearing immune effector cells are then cultured to expand their population.
  • a tCAR cell recognizing two antigens can be made.
  • the two antigens can be deleted from the cell surface, or suppressed as described above, but electroporation with gRNA for each of the two targets and Cas9 mRNA.
  • Step 5 cells are then transduced with a CAR that recognizes two targets.
  • a dCAR cell targeting two antigens can be made. This variation would contain two separate CARs, each recognizing a different antigen.
  • the following steps may be taken to provide a genome-edited CAR-T cell with suppressed expression and/or secretion of a specific cytokine or chemokine.
  • This example describes the making of a CD19 targeting CAR-T which is deficient in expression of GM-CSF.
  • certain of the steps may be conducted sequentially or out of the order listed below, though perhaps leading to different efficiency.
  • T cells are purified via leukapheresis chamber using a Miltenyi human PanT isolation kit, then resuspended in media. Cells are counted and the number of human T cell activation CD3/CD28 beads required to obtain 3:1 bead:cell ratio determined. Beads are washed 2 ⁇ with T cell media, then cells diluted at 1.256 cells/mL in hXcyte media. Human T cell activation CD3/CD28 beads are added. Into each well of a 6-well plate are aliquoted 4 mL/well of 1.256 cell/mL solution. Cells are incubated at 37° C.
  • Target deletion may be accomplished by electroporating with Cas9 mRNA and gRNA against the target(s).
  • Other techniques could be used to suppress expression of the target. These include other genome editing techniques such as TALENs, RNA interference, and eliciting of internal binding of the antigen to prevent cell surface expression.
  • gRNAs examples include those shown in Tables 8-10, as well as others known in the art.
  • RNA sequences for use in reducing CRS Target gene gRNA sequence GM-CSF 5′_2′OMe(U(ps)A(ps)C(ps))UCAGGUUCAGGAGACGC GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC2′OMe (U(ps)U(ps)U(ps)U_3′ (SEQ ID NO: 50) RNA; (ps) indicate phosphorothioate. Underlined bases denote target sequence.
  • EO-115 100 ⁇ l transfection volume is programmed, and the entire supplement added to the NucleofectorTM Solution P3.
  • Cell culture plates are prepared by filling appropriate number of wells with desired volume of recommended culture media (2 ml in 6 well plate) and pre-incubating/equilibrating plates in a humidified 37° C./5% CO 2 incubator. Beads are magnetically removed (twice to ensure complete removal), then cells counted and cell density determined. The required number of cells are centrifuged at 90 ⁇ g for 10 minutes at room temperature, the supernatant removed completely.
  • Cells are then resuspended in PBS (1 ml) and transferred to a microcentrifuge tube, and the required number of cells centrifuged at 90 ⁇ g for 10 minutes at room temperature. The supernatant is removed completely, and the cell pellet resuspended carefully in complete room temperature 4D NucleofectorTM Solution P3, 4 ⁇ 10 6 per 100 ⁇ l). Twenty ⁇ g of gRNA (gGM-CSF) is added to each tube of 15 ⁇ g Cas9 mRNA. Then 100 ⁇ l of cells is added to each tube of Cas9/gRNA, gently mixed and everything transferred into the NucleocuvetteTM. The cuvette is gently tapped to remove bubbles.
  • gGM-CSF gGM-CSF
  • Electroporation is carried out using program (Human T cell stim EO-115). After run completion, the NucleocuvetteTM is carefully removed from the vessel from the retainer using a specialized tool. Cells are resuspended with pre-warmed medium. The media is then taken up from destination well, added to cuvette, and gently pipetted up and down two to three times. This is then transferred to well. This procedure is repeated with media from same well and incubated at 37° C.
  • Genome-edited CAR-T cells may then be transduced with one or more CARs targeted to (i.e., that recognizes) one or more targets, for example with a lentivirus containing a CAR construct. Any other suitable method of transduction may be used.
  • Samples of cells may then be assessed for transduction efficiency by taking a 5 ⁇ 10 5 cells from each sample and analyzing by flow cytometry. Samples are washed with RB, and 3 ⁇ l of anti-CD34 PE antibody added (to detect the CAR as the construct contains human truncated CD34). Thereafter, 5 ul of CD3 APC is added, the cells washed, and flow cytometry performed. CAR-T cells should be CD3 ⁇ positive, CD34 positive.
  • T cells are harvested (Day 11). Tumor burden may be imaged in mouse using bioluminescent imaging. 3 ⁇ 10 7 CAR-T are injected per mouse I.P.
  • Serum cytokine levels (Day 12) are measured, e.g., using the Luminex multiplex cytokine profiling assay to check for elevations in CRS-related cytokines.
  • a 4-hr chromium release assay against targets cells (Raji) may be performed to assess in vitro activity (Day 11).
  • CAR chimeric antigen receptor
  • CAR chimeric antigen receptor
  • T-ALL Testing efficacy of cells in a xenogeneic model of T-ALL: 1 ⁇ 10 5 Click Beetle Red luciferase (CBR) labeled CCRF-CEM T-ALL (99% CD7+ by FACS) cells will be injected I.V. into NSG recipients prior to infusion of 2 ⁇ 10 6 to 1 ⁇ 10 7 CART-bearing immune effector cells or non-targeting CAR19-bearing immune effector cells control cells i.v. on day +4. In contrast to mice receiving CART19-bearing immune effector cells or mice injected with tumor only, mice receiving CART-bearing immune effector cells will demonstrate significantly prolonged survival and reduced tumor burden as determined by bioluminescent imaging.
  • CBR Click Beetle Red luciferase
  • mice receiving iNKT-CAR-CS1 will demonstrate significantly prolonged survival and reduced tumor burden as determined by bioluminescent imaging.
  • CRS in vivo mouse model of CRS is disclosed in Giavridis et al., “CART cell-induced cytokine release syndrome is mediated by macrophages and abated by IL-1 blockade,” Nat Med 2018 May 28.
  • tumor cells are injected intraperitoneally into immune deficient mice and allowed to develop into a tumor.
  • the mice are then given CAR-T cells targeting the cancerous cells and monitored for several days to induce the onset of CRS, after which mice are sacrificed and cells and tissue obtained for analysis.
  • Mice may also be treated for CRS and monitored for success or failure of treatment (i.e., administering antibodies against cytokines produces as a result of administration of CAR-T cells).
  • Analyses appropriate for monitoring CRS in such a model may include monitoring of weight change in the mice after administration of CAR-T cells, percent survival of mice, serum levels of inflammatory factors, i.e., murine SAA3 (equivalent to human C-reactive protein), cytokine levels before and after administration of CAR-T cells, species of origin of pro-inflammatory cytokines (i.e., human versus murine cytokines; and/or percent survival of mice treated with CAR-T cells that received antibodies against specific cytokines.
  • mice that eventually die from CRS symptoms or complications may be classified as having severe CRS, while mice that survive but suffer greater than 10% weight loss may be classified as having non-severe CRS.
  • monocytes and macrophages are the main source for IL-6 in CRS.
  • HSPCs hematopoietic stem and progenitor cells
  • CRS CRS-associated cytokine
  • these mice exhibit typical symptoms of CRS, including high fever and elevated levels of certain cytokines implicated in CRS, such as IL-1 and/or IL-6.
  • Control of CRS in these mice may be accomplished by blocking the receptor for the cytokine using, for example, antibodies, depletion of cell types expressing the cytokine, or administration of an antagonist of the cytokine.
  • monocytes are the main source of the pro-CRS cytokine IL-6, and depletion of monocytes eliminated CRS and protected the mice from death from CRS.
  • CRS animal models are known in the art and may also be used as deemed appropriate.
  • IL-7 may be directly injected into a mouse or other animal model to induce or initiate CRS for control purposes, as described herein.
  • recombinant or transgenic IL-7 may be expressed in a cell to result in increased IL-7 signaling.
  • a constitutively signaling cytokine receptor such as an IL-7 receptor
  • an IL-7 receptor may be engineered into an immune effector cell such that the immune effector cell itself triggers IL-7 signaling, but is unresponsive to extracellular IL-7, and initiation of IL-7 signaling of surrounding lymphocytes is avoided.
  • co-expressing a constitutively signaling IL-7 receptor with a CAR recognizing a specific disease or tumor antigen results in increased T-cell proliferation, survival, and antitumor activity.
  • a constitutively expressing IL-7 receptor is able to transmit IL-7 signaling without the need for IL-7 ligand or the common gamma ⁇ c chain, a component of the native IL-7 receptor, along with IL-7R ⁇ .
  • a CAR or any protein of interest may be inserted into the gene for the T cell receptor.
  • MacLeod et al. (“Integration of a CD19 CAR into the TCR Alpha Chain Locus Streamlines Production of Allogeneic Gene-Edited CAR T Cells,” Molec Therapy 25(4):P949-961, 2017) reports the generation of allogeneic CART cells by targeting the insertion of a CAR transgene directly into the native TCR locus using an engineered homing endonuclease and an AAV donor template.
  • Anti-CD19 CAR T cells produced in this manner do not express the endogenous cell-surface TCR, exhibit potent effector functions in vitro, and mediate clearance of CD19+ tumors in an in vivo mouse model.
  • the resulting gene-edited CAR T cells exhibit potent anti-tumor activity in vitro and in vivo in preclinical models, suggesting that these cells have potential for safe and efficacious use as adoptive cellular therapy in unrelated patients with CD19+ hematological malignancies.
  • CRS cytokines and/or chemokines
  • One way to prevent CRS is to administer antibodies recognizing a specific CRS-inducing cytokine or chemokine to the patient or subject such that the amount of circulating cytokine/chemokine is reduced.
  • administering antibodies recognizing a specific cytokine and/or chemokine can prevent or reduce the occurrence of CRS in a patient or subject.
  • One exemplary way to prevent CRS is to insert a CAR into a gene for a cytokine or chemokine that is involved in initiation or prolonging of CRS.
  • Disruption or ablation of a cytokine or chemokine gene in a CAR-T or other immune effector cell prevents the initiation of CRS by that particular cytokine or chemokine.
  • GMCSF GMCSF
  • other genes involved in initiating or prolonging CRS may also be disrupted in this or a similar manner as described herein. Disruption of the GMCSF gene is described at least in Sachdeva et al.
  • TALEN or other gene-editing enzyme may be designed or engineered to target a cytokine or chemokine gene of choice in a CAR-T cell, and the expression of the gene monitored by methods known in the art. Significant reduction in the expression and secretion of the cytokine or chemokine gene by the CAR-T cell was reported, which implies that the occurrence of CRS would be reduced. Additionally, this approach was found to simultaneously maintain both the proliferation capability and the anti-tumor activity of the CAR-T cell, as assessed by transwell assays and serial killing assays.
  • antibodies to a cytokine or chemokine causing or contributing to CRS may also be used.
  • an antibody recognizing the GM-CSF protein may be administered to a patient or subject receiving CAR-T therapy.
  • This practice is known in the art, particularly for reduction of CRS as a result of IL-6 signaling using the IL-6R antagonist tocilizumab, however other antibodies or antagonists recognizing cytokines or chemokines, or antagonists of their receptors, may be used as deemed appropriate by a clinician.
  • Appropriate antibodies will bind to the circulating cytokine or chemokine, and antagonists will bind to the native receptors for the cytokine or chemokine, thus preventing downstream CRS-promoting activities in the subject.
  • both of these approaches may be employed in a subject, i.e., insertion of a CAR into the gene for a cytokine or chemokine to inactivate the gene, and also administering antibodies against the same cytokine or chemokine to the subject.
  • the following steps may be taken to provide a genome-edited, CRS-resistant, CAR-T cell in which the CAR is expressed from the gene edited loci with a selectable marker disclosed herein. It is not possible to select and purify edited cells based on the deletion of genes that encode internal or secreted proteins, thus a selectable marker is required to enrich for this gene modification.
  • This example describes the making of a CD19CART ⁇ GMCSF ⁇ CD3 ⁇ cell, in which the deletion of GM-CSF mitigates risk of CRS and deletion of CD3 ⁇ prevents TCR signaling and graft vs host disease (GvHD).
  • GvHD graft vs host disease
  • Step 1 T Cell Activation (Day 0)
  • T cells Purify T cells from leukapheresis chamber using a Miltenyi human PanT isolation kit. Resuspend in media. Count cells. Determine number of human T cell activation CD3/CD28 beads required to obtain 3:1 bead:cell ratio. Wash beads 2 ⁇ with T cell media. Dilute cells at 1.256 cells/mL in hXcyte media. Add human T cell activation CD3/CD28 beads. Aliquot 4 mL/well of 1.256 cell/mL solution into 6 well plate. Incubate cells at 37° C.
  • the target gene is genetically deleted and the CAR inserted into the gene edited loci.
  • the DNA double-stranded break can be repaired using homology directed repair using a donor template to repair the break and insert the desired sequence into the edited loci.
  • Target deletion may be accomplished by electroporating with Cas9 mRNA and gRNA against the target(s).
  • the donor template may be a DNA plasmid, or a double-stranded linear DNA, or a single stranded-stranded linear DNA containing homology to the DNA surrounding the double-stranded breaks electroplated with the Cas9/gRNA.
  • the homology arms align to either side of the double-stranded break induced by gRNA GM-CSF.
  • a viral vector such as AAV may be used as the source of the donor template.
  • Other techniques could be used to induce DNA double strand breaks. These include other genome editing techniques such as TALENs and mega-nucleases.
  • gRNAs for GM-CSF and CD3 ⁇ are as follows:
  • hGMCSF gRNA (SEQ ID NO: 50) 5′_2′OMe(U(ps)A(ps)C(ps))UCAGGUUCAGGAGACGCGUUUUAGA GCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U_3′ CD38 gRNA: (SEQ ID NO: 47) 5′_2′OMe(A(ps)G(ps)G(ps))GCAUGUCAAUAUUACUGGUUUUAGA GCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U 3′
  • Step 3 Transduction of T Cells with AAV Vector Containing HDR Repair Construct to Introduce CAR and a Selectable Marker into GM-CSF Loci
  • Sequences for components of vectors described herein are provided in the sequence listing, such as including, but not limited to, SEQ ID NOs:3048-3064.
  • recombinant AAV6 donor vector FIG. 3 , containing ITR-Right homology arm (SEQ ID NO:51), EF1a promotor (SEQ ID NO:52), CAR19 p2a trCD34 (SEQ ID NO:53), Left homology arm (SEQ ID NO:54), ITR (SEQ ID NO:55), is added to the cell culture 2-4 hrs after electroporation with a MOI between 1 ⁇ 10 4 and 1 ⁇ 10 6 .
  • Step 4 Assessment of CRISPR Activity and Td Efficiency (Day 10)
  • TCR-negative cells can be purified using TCRa/b negative selection to remove TCR positive cells.
  • GM-CSF deleted cells can be enriched using a CD34-positive selection on the Miltenyi Automacs. This enriches the GM-SCF ⁇ cells and removes TCR+ cells.
  • Step 5 Assessment of CAR-T Activity In Vivo
  • Direct insertion of GFP into the CD3e locus of a Jurkat cell line may be performed using the method details below.
  • Donor template ‘plasmid’ is shown in the table below.
  • Day 4 FACS cells for GFP and CD3 APC. Assess editing efficiency by loss of CD3 and integration of the AAV-GFP donor by GFP fluorescence.
  • Step 1 T Cell Activation (Day 0)
  • T cells Purify T cells from leukapheresis chamber using Miltenyi human PanT isolation kit. Resuspend in media. Count cells. Determine number of human T cell activation CD3/CD28 beads required to obtain 3:1 bead:cell ratio. Wash beads 2 ⁇ with T cell media. Dilute cells at 1.256 cells/mL in hXcyte media. Add human T cell activation CD3/CD28 beads. Aliquot 4 mL/well of 1.256 cell/mL solution into 6 well plate. Incubate cells at 37° C.
  • the target gene is genetically deleted and the CAR inserted into the gene edited loci.
  • the DNA double-stranded break can be repaired using homology-directed repair using a donor template to repair the break and insert the desired sequence into the edited loci.
  • Target deletion may be accomplished by electroporating with Cas9 mRNA and gRNA against the target(s).
  • the donor template may be a DNA plasmid, or double-stranded linear DNA, or single-stranded linear DNA containing homology to the DNA surrounding the double-stranded breaks electroporated with the Cas9/gRNA.
  • a viral vector such as AAV may be used as the source of the donor template.
  • Other techniques could be used to induce DNA double-stranded breaks. These include other genome editing techniques, such as TALENs and mega-nucleases.
  • Step 3 Transduction of T cells with AAV vector containing HDR repair construct
  • Recombinant AAV6 (or other serotypes of AAV) donor vector is added to the cell culture 2-4 hrs after electroporation with an MOI between 1 ⁇ 10 4 and 1 ⁇ 10 6 .
  • Step 4 Assessment of CRISPR Activity and Td Efficiency (Day 10)
  • CD34+ (CAR+) and TCR-negative cells can be purified in a single step using a positive selection of CD34+ cells on a Miltenyi Automacs. This enriches the CAR+ cells and removes and TCR+ cells (as CAR insertion disrupts TCR signaling).
  • Step 5 Assessment of CAR-T Activity In Vivo
  • short hairpin RNA can be used to knock down or eliminate expression of a cytokine/chemokine/transcription factor gene in an immune effector cell.
  • sERteps may be taken to provide CRS resistance.
  • a selectable marker is required to enrich for this gene modification as cytokines are secreted proteins, thus.
  • This example describes the making of a cell CAR19-GM-CSF PEBL, in which blockade of GM-CSF secretion mitigates risk of CRS. As those of skill in the art will recognize, certain of the steps may be conducted sequentially or out of the order listed below, though perhaps leading to different efficiency.
  • Step 1 T Cell Activation (Day 0)
  • T cells Purify T cells from leukapheresis chamber using Miltenyi juman PanT isolation kit. Resuspend in media. Count cells. Determine number of human T cell activation CD3/CD28 beands required to obtain 3:1 bead:cell ratio. Wash beads 2 ⁇ with T cell media. Dilute cells at 1.256 cells/mL in hXcyte media. Add human T cell activation CD3/CD28 beads. Aliquot 4 ml/well of 1.256 cells/mL solution into 6-well plate. Incubate at 37° C.
  • Step 2 Transduction of T Cells with PEBL CAR (Day 1)
  • T cells are transduced with a CAR targeted to (i.e., that recognizes) one or more antigen or protein targets, for example with a Lentivirus containing a CAR construct targeting CD19, combined with the anti-GM-CSF PEBL.
  • a CAR targeted to i.e., that recognizes
  • one or more antigen or protein targets for example with a Lentivirus containing a CAR construct targeting CD19, combined with the anti-GM-CSF PEBL.
  • Expression from a polycistronic vector is preferable, allowing CD34 expression to mark both CAR and PEBL expression.
  • expression can be achieved with the same viral vector expressing both the CAR and PEBL individually, or as independent transductions with separate vectors containing CAR and PEBL.
  • Any other suitable method of transduction may be used, for example, AAV, retrovirus, etc, or through direct insertion of the CAR PEBL complex into a targeted location of the genome using homology directed repair and a donor vector containing the construct.
  • Step 3 Assessment of Td Efficiency (Day 10)
  • CAR+ and GC-CSF deficient (PEBL+) cells can be enriched using a CD34-positive selection on the Miltenyi Automacs. This enriches the GC-CSF suppressed cells and enriches CAR+ cells.
  • PEBL constructs targeting GM-CSF are provided in FIG. 6 and Tables 17 and 18.
  • CD19 positive B-ALL cell line RAMOS was used to evaluate CRS in an in vitro assay. Prior to assay, RAMOS cells were stably transfected with GFP using lentiviral transduction and cultured in RPMI +10% FBS+Pen/Strep.
  • T cell cells Primary human T cells and monocytes were isolated from normal healthy human donors. T cell cells were isolated from PBMC using CD4+CD8+ selection (Miltenyi Biotec) and monocytes were separated using Miltenyi biotec classical Monocyte Isolation beads according to the manufactures protocol.
  • T cells were subsequently resuspended at a concentration of 1 ⁇ 10 6 cells/mL in Xcyte media supplemented with 50 U/mL IL-2 and 10 ng/ml IL-15 in the presence of anti-CD3/CD28 beads (Bead to cell ratio 3:1). Twenty-four hours after initial stimulation, T cells were transfected with lentiviral vector encoding the CD19 CAR construct in the presence of polybrene (final conc. 6 ⁇ g/ml). Stimulatory beads were removed on day 2.
  • CART19 cells were suspended at 4 ⁇ 10 6 T cells were electroporated in 100 ⁇ l buffer P3 with 15 ⁇ g spCas9 mRNA (Trilink CA.) and 20 ⁇ g of GM-CSF gRNA (Trilink) using a nucleofector 4D, program EO-115. Control CAR19 T cells were electroporated without GM-CSF gRNA. T-cells were subsequently evaluated at day 6 for CD34 (bicistronic marker of CAR-T) and intracellular GM-CSF expression using flowcytometry prior to co-culture assay.
  • CD34 bicistronic marker of CAR-T
  • monocytes (1 ⁇ 10 6 ) were plated in 6 mLs of RPMI 1640 supplemented with supplemented with 0.1 mmol/L MEM Non-Essential Amino Acids, 2 mmol/L L-glutamine, 100 units/mL penicillin, 100 ⁇ g/mL streptomycin (Life Technologies) and 10% fetal calf serum (cR10).
  • cR10 was subsequently supplemented with 0.2 ⁇ g/mL human IL-4 (Peptotec) and 0.2 ⁇ g/mL GM-CSF (Peptotec).
  • cR10 was supplemented with 10% human AB serum instead of fetal calf serum (hR10).
  • hR10 medium was supplemented with 30 ng/ml of LPS.
  • cytokines and LPS were replenished.
  • Macrophages, activated macrophages and iDC were harvested using 2 mmol/L EDTA (immature dendritic cells) on day 6 post-isolation. Twenty-four hours later, cells were harvested with 2 mmol/L EDTA and stained with CD45, CD80 and CD86 to confirm immature DC and mature DC differentiation.
  • Co-culture assay CAR-T cells were combined at the following ratios in 200 ul per 96 well: 12.5K UCART-19 (with or with-out GM-CSF KO), Target, 50K Ramos cells (CD19+) and monocyte derived cells, 1K iDC or 5K macrophages or 5K activated macrophages.
  • Co-cultures were subsequently incubated for at 37° C. and 100 ul of assay supernatant was collected at 24 hr and 48 hr for cytokine analysis.
  • Cytokine concentration determination from culture supernatants was performed using IL-6 ELISA plate (R&D systems). Prior to analysis supernatant's were centrifuged at 300 g for 10 mins at 4° C. and subsequently diluted 1:10 in assay calibrator diluent. Measurements were performed using standard product protocols.
  • T cell cells Primary human T cells and monocytes were isolated from normal healthy human donors. T cell cells were isolated from PBMC using CD4+CD8+ selection (Miltenyi Biotec) and monocytes were separated using Miltenyi Biotec classical Monocyte Isolation beads according to the manufactures protocol.
  • T cell culture and gene editing T cells were subsequently resuspended at a concentration of 106 cells/mL in Xcyte media supplemented with 50 U/mL IL-2 and 10 ng/ml IL-15 in the presence of anti-CD3/CD28 beads (Bead to cell ratio 3:1) (Life Technologies, catalog #111.32D). Twenty-four hours after initial stimulation. Stimulatory beads were removed on day 2. 4 ⁇ 10 6 T cells were electroporated in 100 ⁇ l buffer P3 with 15 ⁇ g spCas9 mRNA (Trilink CA.) and 20 ⁇ g of TRAC gRNA (Trilink) using a nucleofector 4D, program EO-115. Control CAR19 T cells were electroporated without GM-CSF gRNA. T-cells were subsequently evaluated at day 6 for GM-CSF expression prior to co-culture assay using flowcytometry.
  • monocytes (1 ⁇ 10 6 ) were plated in 6 mLs of RPMI 1640 supplemented with supplemented with 0.1 mmol/L MEM Non-Essential Amino Acids, 2 mmol/L L-glutamine, 100 units/mL penicillin, 100 ⁇ g/mL streptomycin (Life Technologies) and 10% fetal calf serum (cR10).
  • cR10 was subsequently supplemented with 0.2 ⁇ g/mL human IL-4 (Peptotec) and 0.2 ⁇ g/mL GM-CSF (Peptotec).
  • cytokines and LPS were replenished.
  • iDC were harvested using 2 mmol/L EDTA (immature dendritic cells) on day 6 post-isolation.
  • Co-culture assay T cells were combined at the following ratios in 200 ul per 96 well: 12.5K T cells (with or with-out GM-CSF KO), 50K anti-CD3/CD28 beads and 1K iDC Co-cultures were subsequently incubated for at 37° C. and 100 ul of assay supernatant was collected at 24 hr and 48 hr for cytokine analysis.
  • Cytokine concentration determination from culture supernatants was performed using IL-6 ELISA plate (R&D systems). Prior to analysis supernatants were centrifuged at 300 ⁇ g for 10 mins at 4° C. and subsequently diluted 1:10 in assay calibrator diluent. Measurements were performed using standard product protocols.
  • GM-CSF deficient T cells induced significantly lower IL-6 expression across the different monocyte lineages.
  • the following steps may be taken to provide a genome-edited, CRS-resistant, CAR-T cells.
  • This example describes the making of a CD19CART ⁇ GMCSF ⁇ CD3 ⁇ mutant IL-7R T cell, in which the deletion of GM-CSF mitigates risk of CRS, deletion of CD3e prevent TCR signaling and GvHD and the mutant IL-7R enhances proliferation of the CAR-T sufficiently to induce CRS in this model.
  • Sequences encoding a mutant, constitutively active IL-7R sequence can be found in Table 19, or found in the art. As those of skill in the art will recognize, certain of the steps may be conducted sequentially or out of the order listed below, though perhaps leading to different efficiency.
  • Step 1 T Cell Activation (Day 0)
  • T cells Purify T cells from a leukapheresis chamber using a Miltenyi human PanT isolation kit. Resuspend in media. Count cells. Determine the number of human T cell activation CD3/CD28 beads required to obtain a 3:1 bead:cell ratio. Wash beads 2 ⁇ with T cell media. Dilute cells at 1.256 cells/mL in hXcyte media. Add human T cell activation CD3/CD28 beads. Aliquot 4 mL/well of 1.256 cell/mL solution into a 6 well plate. Incubate cells at 37° C.
  • CAR-T cells may then be transduced with one or more CARs targeted to (i.e., that recognizes) one or more targets, for example with a lentivirus containing a CAR construct. Any other suitable method of transduction may be used.
  • cytokine/chemokine/transcription factor genes or transcription factors may be deleted to prevent secretion of factors that induce secretion of cytokines from myeloid cells. Deletion may be accomplished by electroporating with Cas9 mRNA and gRNA against the target(s). Other techniques, however, could be used to suppress expression of the target. These include other genome editing techniques such as TALENs, RNA interference, and eliciting of internal binding of the antigen to prevent cell surface expression. Examples of gRNAs that may be used include those shown in Tables 8-10, and others known in the art.
  • Cells are harvested, isolated, and purified, for example using magnetic selection with a labelled antibody-coated magnetic beads that bind to a cell-specific protein (available from, e.g., Miltenyi Biotec).
  • a labelled antibody-coated magnetic beads that bind to a cell-specific protein (available from, e.g., Miltenyi Biotec).
  • anti-CD3/CD28 beads could be used.
  • Other purification techniques are known in the art and could be used.
  • Step 4 Assessment of CRISPR Activity and Td Efficiency (Day 10)
  • TCR negative cells can be purified using TCRa/b negative selection to remove TCR positive cells.
  • Step 5 Assessment of CAR-T Activity In Vivo
  • a modified gRNA protocol for T cell CRISPR and CAR-T transduction of UCART19 is provided below.
  • T cells Purify T cells from a leukapheresis chamber using a Miltenyi human PanT isolation kit. Resuspend in media. Count cells. Determine the number of human T cell activation CD3/CD28 beads required to obtain a 3:1 bead:cell ratio. Wash beads 2 ⁇ with T cell media. Dilute cells at 1.256 cells/mL in hXcyte media. Add human T cell activation CD3/CD28 beads
  • T cells may then be transduced with one or more CARs targeted to (i.e., that recognizes) one or more targets, for example with a lentivirus containing a CAR construct. Any other suitable method of transduction may be used.
  • EO-115 100 ⁇ l transfection volume is programmed, and the entire supplement added to the NucleofectorTM Solution P3.
  • Cell culture plates are prepared by filling appropriate number of wells with desired volume of recommended culture media (2 ml in 6 well plate) and pre-incubating/equilibrating plates in a humidified 37° C./5% CO 2 incubator. Beads are magnetically removed (twice to ensure complete removal), then cells counted and cell density determined. The required number of cells are centrifuged at 90 ⁇ g for 10 minutes at room temperature, the supernatant removed completely.
  • Cells are then resuspended in PBS (1 ml) and transferred to a microcentrifuge tube, and the required number of cells centrifuged at 90 ⁇ g for 10 minutes at room temperature. The supernatant is removed completely, and the cell pellet resuspended carefully in complete room temperature 4D NucleofectorTM Solution P3, 4 ⁇ 10 6 per 100 ⁇ l). Twenty ⁇ g of gRNA (gGM-CSF and gTRAC) are added to each tube of 15 ⁇ g Cas9 mRNA. Then 100 ⁇ l of cells is added to each tube of Cas9/gRNA, gently mixed and everything transferred into the NucleocuvetteTM. The cuvette is gently tapped to remove bubbles.
  • gRNA gGM-CSF and gTRAC
  • Electroporation is carried out using program (Human T cell stim EO-115). After run completion, the NucleocuvetteTM is carefully removed from the vessel from the retainer using a specialized tool. Cells are resuspended with pre-warmed medium. The media is then taken up from destination well, added to cuvette, and gently pipetted up and down two to three times. This is then transferred to well. This procedure is repeated with media from same well and incubated at 37° C.
  • Samples of cells may then be assessed for transduction efficiency by taking a 5 ⁇ 10 5 cells from each sample and analyzing by flow cytometry. Samples are fix permeablised and anlaysed by FACS for CD3, CD34 and intracellular GM-CSF.
  • CD3 deplete T cells and inject into mice.
  • mice with 5 ⁇ 10 6 CAR+ T cells/mouse Inject mice with 5 ⁇ 10 6 CAR+ T cells/mouse.
  • mice are then bled on days 0, 1, 2, 3, 5, 7, 14, and 21 for FACS and plasma measurements, weighed, and body temperature is determined.
  • the panel for detecting specific markers of the CAR-T cells is as follows:
  • Cytokine analysis and assessment of CRS is assed using Millipore luminex multiplex cytokine analysis.
  • Sequences for preparation of a vector as described herein include, but are not limited to, the following:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
US16/428,362 2018-06-01 2019-05-31 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy Abandoned US20200054675A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/428,362 US20200054675A1 (en) 2018-06-01 2019-05-31 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy
US17/746,645 US12304941B2 (en) 2018-06-01 2022-05-17 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862679597P 2018-06-01 2018-06-01
US16/428,362 US20200054675A1 (en) 2018-06-01 2019-05-31 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/746,645 Continuation US12304941B2 (en) 2018-06-01 2022-05-17 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy

Publications (1)

Publication Number Publication Date
US20200054675A1 true US20200054675A1 (en) 2020-02-20

Family

ID=68696762

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/428,362 Abandoned US20200054675A1 (en) 2018-06-01 2019-05-31 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy
US17/746,645 Active US12304941B2 (en) 2018-06-01 2022-05-17 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/746,645 Active US12304941B2 (en) 2018-06-01 2022-05-17 Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy

Country Status (5)

Country Link
US (2) US20200054675A1 (enExample)
EP (1) EP3802578A4 (enExample)
JP (1) JP2021525530A (enExample)
CN (1) CN112533942A (enExample)
WO (1) WO2019232425A1 (enExample)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112876535A (zh) * 2021-02-08 2021-06-01 浙江华缔药业集团医药开发有限公司 生物活性多肽及其应用
US11248213B2 (en) 2017-08-07 2022-02-15 The Regents Of The University Of California Platform for generating safe cell therapeutics
WO2022098756A1 (en) * 2020-11-03 2022-05-12 WUGEN, Inc. Chimeric antigen receptor cell therapy
US11661459B2 (en) 2020-12-03 2023-05-30 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
WO2023225249A1 (en) * 2022-05-20 2023-11-23 President And Fellows Of Harvard College Methods and compositions relating to treatment of cns diseases
US11883432B2 (en) 2020-12-18 2024-01-30 Century Therapeutics, Inc. Chimeric antigen receptor system with adaptable receptor specificity
US12269888B2 (en) 2020-12-03 2025-04-08 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12350349B2 (en) 2016-08-03 2025-07-08 Washington University Gene editing of CAR-T cells for the treatment of T cell malignancies with chimeric antigen receptors
CA3101505A1 (en) * 2018-05-31 2019-12-05 Washington University Chimeric antigen receptor t cells (car-t) for the treatment of cancer
JP2022516389A (ja) * 2018-05-31 2022-02-28 ワシントン・ユニバーシティ 血液悪性腫瘍を治療するためのゲノム編集インバリアントナチュラルキラーＴ（ｉＮＫＴ）細胞
EP3802578A4 (en) 2018-06-01 2022-03-23 Washington University SUPPRESSION OF CYTOKINE RELEASE SYNDROME IN CHIMERIC ANTIGEN RECEPTOR CELL THERAPY
CN109735558B (zh) * 2018-12-12 2022-04-15 中南大学 一种重组car19-il24基因、慢病毒载体、car19-il24-t细胞及应用
US11786553B2 (en) 2019-03-01 2023-10-17 Allogene Therapeuctics, Inc. Chimeric cytokine receptors bearing a PD-1 ectodomain
WO2021127261A1 (en) * 2019-12-17 2021-06-24 The General Hospital Corporation Engineered immune cells with reduced toxicity and uses thereof
EP3845646A1 (en) * 2019-12-30 2021-07-07 Secarna Pharmaceuticals GmbH & Co. KG Modified antisense oligonucleotide for inhibition of foxp3 expression
AU2021227191A1 (en) * 2020-02-24 2022-08-25 Allogene Therapeutics, Inc. BCMA car-T cells with enhanced activities
AU2021251113A1 (en) * 2020-04-06 2022-10-27 Celledit Llc Genetically modified immune cells expressing a chimeric antigen receptor and having reduced proinflammatory cytokine signaling
CN111548420B (zh) * 2020-05-14 2021-10-15 深圳普瑞金生物药业有限公司 一种抗间皮素嵌合抗原受体、表达基因、表达载体、t细胞及其用途
CN118056012B (zh) * 2021-08-24 2025-05-30 赛斯尔擎生物技术（上海）有限公司 一种修饰细胞的方法
CN114410686B (zh) * 2021-12-24 2023-10-03 武汉大学 一种工程化外泌体原位纳米疫苗及其制备方法和应用
CN116102662A (zh) * 2022-10-10 2023-05-12 武汉波睿达生物科技有限公司 一种靶向ca9的融合嵌合抗原受体、重组表达载体及其应用
JP2025535448A (ja) * 2022-10-20 2025-10-24 マイクロ クリスパー プライベート リミテッド 免疫療法におけるサイトカイン放出症候群の軽減
AU2023362750A1 (en) * 2022-10-20 2025-06-05 Microcrispr Pvt Ltd. Attenuation of cytokine release syndrome in immunotherapy
CN116240173B (zh) * 2023-02-02 2024-09-27 西安电子科技大学 一种冷热肿瘤调控型car-单核/巨噬细胞及其制备方法和应用
CN117164712B (zh) * 2023-02-22 2024-05-24 成都优赛诺生物科技有限公司 一种靶向cd22的单域抗体、嵌合抗原受体及其应用
WO2025077790A1 (en) * 2023-10-11 2025-04-17 Chengdu Ucello Biotechnology Co., Limited Engineered immune cells and uses thereof
CN117186202B (zh) * 2023-11-08 2024-02-02 北京大学第三医院（北京大学第三临床医学院） 一种新细胞因子csbf及其在干眼治疗中的应用
CN117866110B (zh) * 2023-12-27 2024-06-11 广东唯泰生物科技有限公司 一种靶向flt-3的第四代嵌合抗原受体及其应用
CN119345372A (zh) * 2024-10-28 2025-01-24 北京大学人民医院 Cd132在治疗aml中的应用

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2778701T3 (es) 2012-07-13 2020-08-11 The Trustees Of The Univ Of Pennsylvania Center For Technology Transfer Gestión de toxicidad para la actividad antitumoral de CAR
WO2015066262A1 (en) * 2013-11-04 2015-05-07 Trustees Of Dartmouth College Methods for preventing toxicity of adoptive cell therapy
HRP20201906T1 (hr) 2013-12-20 2021-04-02 Fred Hutchinson Cancer Research Center Označene kimerne efektorske molekule i njihovi receptori
EP3243831A1 (en) * 2014-02-27 2017-11-15 Ucl Business Plc Variants of the proliferation-inducing ligand (april)
ES2926384T3 (es) * 2015-02-06 2022-10-25 Nat Univ Singapore Métodos para mejorar la eficacia de células inmunitarias terapéuticas
US11497767B2 (en) 2015-02-18 2022-11-15 Enlivex Therapeutics R&D Ltd Combination immune therapy and cytokine control therapy for cancer treatment
WO2017112877A1 (en) 2015-12-22 2017-06-29 Icell Gene Therapeutics, Llc Chimeric antigen receptors and enhancement of anti-tumor activity
US11111505B2 (en) * 2016-03-19 2021-09-07 Exuma Biotech, Corp. Methods and compositions for transducing lymphocytes and regulating the activity thereof
CA3020923A1 (en) * 2016-04-15 2017-10-19 Memorial Sloan Kettering Cancer Center Transgenic t cell and chimeric antigen receptor t cell compositions and related methods
US12350349B2 (en) 2016-08-03 2025-07-08 Washington University Gene editing of CAR-T cells for the treatment of T cell malignancies with chimeric antigen receptors
WO2018064602A1 (en) * 2016-09-30 2018-04-05 Baylor College Of Medicine Chimeric antigen receptor therapy with reduced cytotoxicity for viral disease
CN106636090B (zh) * 2016-10-11 2019-08-09 上海优卡迪生物医药科技有限公司 人源白细胞介素6的siRNA、重组表达CAR-T载体及其构建方法和应用
WO2018073393A2 (en) * 2016-10-19 2018-04-26 Cellectis Tal-effector nuclease (talen) -modified allogenic cells suitable for therapy
WO2018073391A1 (en) 2016-10-19 2018-04-26 Cellectis Targeted gene insertion for improved immune cells therapy
CA3048648A1 (en) * 2017-01-10 2018-07-19 The General Hospital Corporation T cells expressing a chimeric antigen receptor
US10870703B2 (en) * 2017-10-02 2020-12-22 Humanigen, Inc. Methods of treating immunotherapy-related toxicity using a GM-CSF antagonist
JP7621795B2 (ja) 2017-10-19 2025-01-27 セレクティス 改善された免疫細胞療法のためのｎｋ阻害物質遺伝子の標的指向遺伝子組み込み
AU2018370217A1 (en) 2017-11-17 2020-05-28 Memorial Sloan-Kettering Cancer Center Methods and compositions for alleviating Cytokine Release Syndrome
EP3802578A4 (en) 2018-06-01 2022-03-23 Washington University SUPPRESSION OF CYTOKINE RELEASE SYNDROME IN CHIMERIC ANTIGEN RECEPTOR CELL THERAPY

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11248213B2 (en) 2017-08-07 2022-02-15 The Regents Of The University Of California Platform for generating safe cell therapeutics
US11674121B2 (en) 2017-08-07 2023-06-13 The Regents Of The University Of California Platform for generating safe cell therapeutics
US12049644B2 (en) 2017-08-07 2024-07-30 The Regents Of The University Of California Platform for generating safe cell therapeutics
US12264336B2 (en) 2017-08-07 2025-04-01 The Regents Of The University Of California Platform for generating safe cell therapeutics
US12467037B2 (en) 2017-08-07 2025-11-11 The Regents Of The University Of California Platform for generating safe cell therapeutics
WO2022098756A1 (en) * 2020-11-03 2022-05-12 WUGEN, Inc. Chimeric antigen receptor cell therapy
US11661459B2 (en) 2020-12-03 2023-05-30 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
US12269888B2 (en) 2020-12-03 2025-04-08 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
US11883432B2 (en) 2020-12-18 2024-01-30 Century Therapeutics, Inc. Chimeric antigen receptor system with adaptable receptor specificity
CN112876535A (zh) * 2021-02-08 2021-06-01 浙江华缔药业集团医药开发有限公司 生物活性多肽及其应用
WO2023225249A1 (en) * 2022-05-20 2023-11-23 President And Fellows Of Harvard College Methods and compositions relating to treatment of cns diseases

Also Published As

Publication number Publication date
EP3802578A1 (en) 2021-04-14
CN112533942A (zh) 2021-03-19
US20230074186A1 (en) 2023-03-09
US12304941B2 (en) 2025-05-20
WO2019232425A1 (en) 2019-12-05
JP2021525530A (ja) 2021-09-27
EP3802578A4 (en) 2022-03-23

Similar Documents

Publication Publication Date Title
US12304941B2 (en) Suppression of cytokine release syndrome in chimeric antigen receptor cell therapy
US20250101099A1 (en) Chimeric antigen receptor t cells (car-t) for the treatment of cancer
US20250043243A1 (en) Methods for genome-editing and activation of cells
US20240150428A1 (en) Genome-edited invariant natural killer t (inkt) cells for the treatment of hematologic malignancies
JP7148580B2 (ja) 特定の組成を有する遺伝子により改変されたｔ細胞製剤
ES3042082T3 (en) Methods of making chimeric antigen receptor-expressing cells
TW202134264A (zh) 嵌合抗原受體及其用途
RU2716716C2 (ru) Композиции и способы для бустинга эффективности адоптивной клеточной иммунотерапии
US20210284714A1 (en) Materials and methods for treating cancer
WO2022164976A2 (en) Immunostimulatory cytokine combination and therapeutic use thereof
US20220401480A1 (en) Drug for Treating Cancer, Combination Drug, Drug Composition, Immune Responsive Cell, Nucleic Acid Delivery Vehicle, and Product
WO2023108150A1 (en) Methods for cancer immunotherapy
CN118702821A (zh) 靶向型融合细胞因子
RU2811466C2 (ru) Т-клетки с химерными антигенными рецепторами (car-t) для лечения рака
WO2022098756A1 (en) Chimeric antigen receptor cell therapy
US20240158467A1 (en) Materials and methods for treating cancer
WO2025207642A1 (en) Cxcr3 isoforms to improve recombinant receptor trafficking
WO2021147891A1 (zh) 一种经修饰的免疫效应细胞及其用途

Legal Events

Date Code Title Description
AS Assignment

Owner name: WASHINGTON UNIVERSITY, MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:COOPER, MATTHEW;DIPERSIO, JOHN;CARTER, ALUN;SIGNING DATES FROM 20190621 TO 20190628;REEL/FRAME:051273/0172

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION