US20100112575A1 - Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing - Google Patents

Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing Download PDF

Info

Publication number
US20100112575A1
US20100112575A1 US12/560,708 US56070809A US2010112575A1 US 20100112575 A1 US20100112575 A1 US 20100112575A1 US 56070809 A US56070809 A US 56070809A US 2010112575 A1 US2010112575 A1 US 2010112575A1
Authority
US
United States
Prior art keywords
chromosome
dna
sequence
sequencing
fetal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/560,708
Other languages
English (en)
Inventor
Hei-Mun Christina Fan
Stephen R. Quake
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Leland Stanford Junior University
Original Assignee
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=42040105&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20100112575(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to US12/560,708 priority Critical patent/US20100112575A1/en
Application filed by Leland Stanford Junior University filed Critical Leland Stanford Junior University
Assigned to THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY reassignment THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: QUAKE, STEPHEN R., FAN, HEI MUN CHRISTINA
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: STANFORD UNIVERSITY
Priority to US12/696,509 priority patent/US8195415B2/en
Publication of US20100112575A1 publication Critical patent/US20100112575A1/en
Priority to US13/102,717 priority patent/US8682594B2/en
Priority to US13/218,317 priority patent/US20110319272A1/en
Priority to US13/452,083 priority patent/US8296076B2/en
Priority to US13/921,881 priority patent/US9404157B2/en
Priority to US14/168,714 priority patent/US9353414B2/en
Priority to US15/195,135 priority patent/US10669585B2/en
Priority to US16/852,663 priority patent/US20200270700A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/38—Pediatrics
    • G01N2800/385—Congenital anomalies
    • G01N2800/387—Down syndrome; Trisomy 18; Trisomy 13

Definitions

  • the present invention relates to the field of molecular diagnostics, and more particularly to the field of prenatal genetic diagnosis.
  • Fetal aneuploidy and other chromosomal aberrations affect 9 out of 1000 live births (1).
  • the gold standard for diagnosing chromosomal abnormalities is karyotyping of fetal cells obtained via invasive procedures such as chorionic villus sampling and amniocentesis. These procedures impose small but potentially significant risks to both the fetus and the mother (2).
  • Non-invasive screening of fetal aneuploidy using maternal serum markers and ultrasound are available but have limited reliability (3-5). There is therefore a desire to develop non-invasive genetic tests for fetal chromosomal abnormalities.
  • sequence tag refers to a relatively short (e.g., 15-100) nucleic acid sequence that can be used to identify a certain larger sequence, e.g., be mapped to a chromosome or genomic region or gene. These can be ESTs or expressed sequence tags obtained from mRNA.
  • Venter et al. “The sequence of the human genome,” Science, 2001 Feb. 16; 291(5507):1304-51 discloses the sequence of the human genome, which information is publicly available from NCBI.
  • Another reference genomic sequence is a current NCBI build as obtained from the UCSC genome gateway.
  • Wheeler et al. “The complete genome of an individual by massively parallel DNA sequencing,” Nature, 2008 Apr. 17; 452(7189):872-6 discloses the DNA sequence of a diploid genome of a single individual, James D. Watson, sequenced to 7.4-fold redundancy in two months using massively parallel sequencing in picolitre-size reaction vessels. Comparison of the sequence to the reference genome led to the identification of 3.3 million single nucleotide polymorphisms, of which 10,654 cause amino-acid substitution within the coding sequence.
  • the present invention comprises a method for analyzing a maternal sample, e.g., from peripheral blood. It is not invasive into the fetal space, as is amniocentesis or chorionic villi sampling.
  • fetal DNA which is present in the maternal plasma is used.
  • the fetal DNA is in one aspect of the invention enriched due to the bias in the method towards shorter DNA fragments, which tend to be fetal DNA.
  • the method is independent of any sequence difference between the maternal and fetal genome.
  • the DNA obtained preferably from a peripheral blood draw, is a mixture of fetal and maternal DNA.
  • the DNA obtained is at least partially sequenced, in a method which gives a large number of short reads.
  • This method does not require the sequence differentiation of fetal versus maternal DNA, because the summed contribution of both maternal and fetal sequences in a particular chromosome or chromosome portion will be different as between an intact, diploid chromosome and an aberrant chromosome, i.e., with an extra copy, missing portion or the like. In other words, the method does not rely on a priori sequence information that would distinguish fetal DNA from maternal DNA.
  • the abnormal distribution of a fetal chromosome or portion of a chromosome i.e., a gross deletion or insertion
  • the median count of autosomal values i.e., number of sequence tags per autosome
  • the term “chromosome portion” is used herein to denote either an entire chromosome or a significant fragment of a chromosome. For example, moderate Down syndrome has been associated with partial trisomy 21q22.2 ⁇ qter.
  • the present method can be applied to arbitrarily small fractions of fetal DNA. It has been demonstrated to be accurate down to 6% fetal DNA concentration. Exemplified below is the successful use of shotgun sequencing and mapping of DNA to detect fetal trisomy 21 (Down syndrome), trisomy 18 (Edward syndrome), and trisomy 13 (Patau syndrome), carried out non-invasively using cell-free fetal DNA in maternal plasma. This forms the basis of a universal, polymorphism-independent non-invasive diagnostic test for fetal aneuploidy. The sequence data also allowed us to characterize plasma DNA in unprecedented detail, suggesting that it is enriched for nucleosome bound fragments. The method may also be employed so that the sequence data obtained may be further analyzed to obtain information regarding polymorphisms and mutations.
  • the present invention comprises, in certain aspects, a method of testing for an abnormal distribution of a specified chromosome portion in a mixed sample of normally and abnormally distributed chromosome portions obtained from a single subject, such as a mixture of fetal and maternal DNA in a maternal plasma sample.
  • a method of testing for an abnormal distribution of a specified chromosome portion in a mixed sample of normally and abnormally distributed chromosome portions obtained from a single subject such as a mixture of fetal and maternal DNA in a maternal plasma sample.
  • One carries out sequence determinations on the DNA fragments in the sample, obtaining sequences from multiple chromosome portions of the mixed sample to obtain a number of sequence tags of sufficient length of determined sequence to be assigned to a chromosome location within a genome and of sufficient number to reflect abnormal distribution.
  • Using a reference sequence one assigns the sequence tags to their corresponding chromosomes including at least the specified chromosome by comparing the sequence to reference genomic sequence.
  • the present method also involves correcting for nonuniform distribution sequence tags to different chromosomal portions.
  • a number of windows of defined length are created along a chromosome, the windows being on the order of kilobases in length, whereby a number of sequence tags will fall into many of the windows and the windows covering each entire chromosome in question, with exceptions for non-informative regions, e.g., centromere regions and repetitive regions.
  • Various average numbers i.e., median values, are calculated for different windows and compared.
  • the present invention may comprise a computer programmed to analyze sequence data obtained from a mixture of maternal and fetal chromosomal DNA.
  • Each autosome (chr. 1-22) is computationally segmented into contiguous, non-overlapping windows. (A sliding window could also be used).
  • Each window is of sufficient length to contain a significant number of reads (sequence tags, having about 20-100 by of sequence) and not still have a number of windows per chromosome.
  • a window will be between 10 kb and 100 kb, more typically between 40 and 60 kb. There would, then, for example, accordingly be approximately between 3,000 and 100,000 windows per chromosome.
  • Windows may vary widely in the number of sequence tags that they contain, based on location (e.g., near a centromere or repeating region) or G/C content, as explained below.
  • the median (i.e., middle value in the set) count per window for each chromosome is selected; then the median of the autosomal values is used to account for differences in total number of sequence tags obtained for different chromosomes and distinguish interchromosomal variation from sequencing bias from aneuploidy.
  • This mapping method may also be applied to discern partial deletions or insertions in a chromosome.
  • the present method also provides a method for correcting for bias resulting from G/C content. For example, some the Solexa sequencing method was found to produce more sequence tags from fragments with increased G/C content. By assigning a weight to each sequence tag based on the G/C content of a window in which the read falls.
  • the window for GC calculation is preferably smaller than the window for sequence tag density calculation.
  • FIG. 1 is a scatter plot graph showing sequence tag densities from eighteen samples, having five different genotypes, as indicated in the figure legend. Fetal aneuploidy is detectable by the over-representation of the affected chromosome in maternal blood.
  • FIG. 1A shows sequence tag density relative to the corresponding value of genomic DNA control; chromosomes are ordered by increasing G/C content.
  • the samples shown as indicated, are plasma from a woman bearing a T21 fetus; plasma from a woman bearing a T18 fetus; plasma from a normal adult male; plasma from a woman bearing a normal fetus; plasma from a woman bearing a T13 fetus.
  • FIG. 1B is a detail from FIG. 1A , showing chromosome 21 sequence tag density relative to the median chromosome 21 sequence tag density of the normal cases. Note that the values of 3 disomy 21 cases overlap at 1.0. The dashed line represents the upper boundary of the 99% confidence interval constructed from all disomy 21 samples.
  • the chromosomes are listed in FIG. 1A in order of G/C content, from low to high. This figure suggests that one would prefer to use as a reference chromosome in the mixed sample with a mid level of G/C content, as it can be seen that the data there are more tightly grouped.
  • FIG. 1B represents an enlargement of the chromosome 21 data.
  • FIG. 2 is a scatter plot graph showing fetal DNA fraction and gestational age.
  • the fraction of fetal DNA in maternal plasma correlates with gestational age.
  • Fetal DNA fraction was estimated by three different ways: 1. From the additional amount of chromosomes 13, 18, and 21 sequences for T13, T18, and T21 cases respectively. 2. From the depletion in amount of chromosome X sequences for male cases. 3. From the amount of chromosome Y sequences present for male cases. The horizontal dashed line represents the estimated minimum fetal DNA fraction required for the detection of aneuploidy. For each sample, the values of fetal DNA fraction calculated from the data of different chromosomes were averaged.
  • FIG. 2 suggests that the present method may be employed at a very early stage of pregnancy. The data were obtained from the 10-week stage and later because that is the earliest stage at which chorionic villi sampling is done. (Amniocentesis is done later). From the level of the confidence interval, one would expect to obtain meaningful data as early as 4 weeks gestational age, or possibly earlier.
  • FIG. 3 is a histogram showing size distribution of maternal and fetal DNA in maternal plasma. It shows the size distribution of total and chromosome Y specific fragments obtained from 454 sequencing of maternal plasma DNA from a normal male pregnancy. The distribution is normalized to sum to 1. The numbers of total reads and reads mapped to the Y-chromosome are 144992 and 178 respectively. Inset: Cumulative fetal DNA fraction as a function of sequenced fragment size. The error bars correspond to the standard error of the fraction estimated assuming the error of the counts of sequenced fragments follow Poisson statistics.
  • FIG. 4 is a pair of line graphs showing distribution of sequence tags around transcription start sites (TSS) of ReSeq genes on all autosomes and chromosome X from plasma DNA sample of a normal male pregnancy (top, FIG. 4A ) and randomly sheared genomic DNA control (bottom, FIG. 4B ).
  • TSS transcription start sites
  • the number of tags within each 5 bp window was counted within ⁇ 1000 bp region around each TSS, taking into account the strand each sequence tag mapped to.
  • the counts from all transcription start sites for each 5 bp window were summed and normalized to the median count among the 400 windows. A moving average was used to smooth the data.
  • a peak in the sense strand represents the beginning of a nucleosome, while a peak in the anti-sense strand represents the end of a nucleosome.
  • a peak in the anti-sense strand represents the end of a nucleosome.
  • five well-positioned nucleosomes are observed downstream of transcription start sites and are represented as grey ovals. The number below within each oval represents the distance in base pairs between adjacent peaks in the sense and anti-sense strands, corresponding to the size of the inferred nucleosome. No obvious pattern is observed for the genomic DNA control.
  • FIG. 5A is a scatter plot graph showing the mean sequence tag density for each chromosome of all samples, including cell-free plasma DNA from pregnant women and male donor, as well as genomic DNA control from male donor, is plotted above. Exceptions are chromosomes 13, 18 and 21, where cell-free DNA samples from women carrying aneuploid fetuses are excluded. The error bars represent standard deviation. The chromosomes are ordered by their G/C content. G/C content of each chromosome relative to the genome-wide value (41%) is also plotted.
  • FIG. 5B is a scatter plot of mean sequence tag density for each chromosome versus G/C content of the chromosome. The correlation coefficient is 0.927, and the correlation is statistically significant (p ⁇ 10 ⁇ 9 ).
  • FIG. 5C is a scatter plot of the standard deviation of sequence tag density of each chromosome versus G/C content of the chromosome.
  • the correlation coefficient between standard deviation of sequence tag density and the absolute deviation of chromosomal G/C content from the genome-wide G/C content is 0.963, and the correlation is statistically significant (p ⁇ 10-12).
  • FIG. 6 is a scatter plot graph showing percent difference of chromosome X sequence tag density of all samples as compared to the median chromosome X sequence tag density of all female pregnancies. All male pregnancies show under-representation of chromosome X.
  • FIG. 7 is a scatter plot graph showing a comparison of the estimation of fetal DNA fraction for cell-free DNA samples from 12 male pregnancies using sequencing data from chromosomes X and Y.
  • the dashed line represents a simple linear regression line, with a slope of 0.85.
  • FIG. 8 is a line graph showing length distribution of sequenced fragments from maternal cell-free plasma DNA sample of a normal male pregnancy at 1 bp resolution. Sequencing was done on the 454/Roche platform. Reads that have at least 90% mapping to the human genome with greater than or equal to 90% accuracy are retained, totaling 144992 reads. Y-axis represents the number of reads obtained. The median length is 177 bp while the mean length is 180 bp.
  • FIG. 9 is a schematic illustrating how sequence tag distribution is used to detect the over and under-representation of any chromosome, i.e., a trisomy (over representation) or a missing chromosome (typically an X or Y chromosome, since missing autosomes are generally lethal).
  • a trisomy over representation
  • a missing chromosome typically an X or Y chromosome, since missing autosomes are generally lethal
  • the normalized sequence tag density for chromosome 1 would be M1/N; for chromosome 22 it would be M22/N. Close examination of panel A, for example would show that towards the zero end of the chromosome, this procedure obtained about 175 reads per 50 kb window. In the middle, near the centromere, there were no reads, because this portion of the chromosome is ill defined in the human genome library.
  • the normalized sequence tag density of each chromosome is M/N (e.g., chr 1:M1/N; chr 22:M22/N). Such normalization is necessary to compare different patient samples since the total number of sequence tags (thus, the sequence tag density) for each patient sample is different (the total number of sequence tags fluctuates between ⁇ 8 to ⁇ 12 million).
  • the analysis thus flows from frequency of reads per coordinate (A and C) to # reads per window (B and D) to a combination of all chromosomes.
  • FIG. 10 is a scatter plot graph showing data from different samples, as in FIG. 1 , except that bias for G/C sampling has been eliminated.
  • FIG. 11 is a scatter plot graph showing the weight given to different sequence samples according to percentage of G/C content, with lower weight given to samples with a higher G/C content.
  • G/C content ranges from about 30% to about 70%; weight can range over a factor of about 3.
  • FIG. 12 is a scatter plot graph which illustrates results of selected patients as indicated on the x axis, and, for each patient, a distribution of chromosome representation on the Y axis, as deviating from a representative t statistic, indicated as zero.
  • FIG. 13 is a scatter plot graph showing the minimum fetal DNA percentage of which over- or under-representation of a chromosome could be detected with a 99.9% confidence level for chromosomes 21, 18, 13 and Chr. X, and a value for all other chromosomes.
  • FIG. 14 is a scatter plot graph showing a linear relationship between log10 of minimum fetal DNA percentage that is needed versus log10 of the number of reads required.
  • Sequence tag density means the normalized value of sequence tags for a defined window of a sequence on a chromosome (in a preferred embodiment the window is about 50 kb), where the sequence tag density is used for comparing different samples and for subsequent analysis.
  • a “sequence tag” is a DNA sequence of sufficient length that it may be assigned specifically to one of chromosomes 1-22, X or Y. It does not necessarily need to be, but may be non-repetitive within a single chromosome. A certain, small degree of mismatch (0-1) may be allowed to account for minor polymorphisms that may exist between the reference genome and the individual genomes (maternal and fetal) being mapped. The value of the sequence tag density is normalized within a sample.
  • sequence tag density as calculated in this way would ideally be about 1 for a disomic chromosome.
  • sequence tag densities can vary according to sequencing artifacts, most notably G/C bias; this is corrected as described. This method does not require the use of an external standard, but, rather, provides an internal reference, derived from al of the sequence tags (genomic sequences), which may be, for example, a single chromosome or a calculated value from all autosomes.
  • T21 means trisomy 21.
  • T18 means trisomy 18.
  • T13 means trisomy 13.
  • Aneuploidy is used in a general sense to mean the presence or absence of an entire chromosome, as well as the presence of partial chromosomal duplications or deletions or kilobase or greater size, as opposed to genetic mutations or polymorphisms where sequence differences exist.
  • Massively parallel sequencing means techniques for sequencing millions of fragments of nucleic acids, e.g., using attachment of randomly fragmented genomic DNA to a planar, optically transparent surface and solid phase amplification to create a high density sequencing flow cell with millions of clusters, each containing ⁇ 1,000 copies of template per sq. cM. These templates are sequenced using four-color DNA sequencing-by-synthesis technology. See, products offered by Illumina, Inc., San Diego, Calif. In the present work, sequences were obtained, as described below, with an Illumina/Solexa 1G Genome Analyzer. The Solexa/Illumina method referred to below relies on the attachment of randomly fragmented genomic DNA to a planar, optically transparent surface.
  • the plasma DNA does not need to be sheared. Attached DNA fragments are extended and bridge amplified to create an ultra-high density sequencing flow cell with ⁇ 50 million clusters, each containing ⁇ 1,000 copies of the same template. These templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. This novel approach ensures high accuracy and true base-by-base sequencing, eliminating sequence-context specific errors and enabling sequencing through homopolymers and repetitive sequences.
  • High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Short sequence reads are aligned against a reference genome and genetic differences are called using specially developed data analysis pipeline software.
  • Solexa's oligonucleotide adapters are ligated onto the fragments, yielding a fully-representative genomic library of DNA templates without cloning.
  • Single molecule clonal amplification involves six steps: Template hybridization, template amplification, linearization, blocking 3′ ends, denaturation and primer hybridization.
  • Solexa's Sequencing-by-Synthesis utilizes four proprietary nucleotides possessing reversible fluorophore and termination properties. Each sequencing cycle occurs in the presence of all four nucleotides.
  • the presently used sequencing is preferably carried out without a preamplification or cloning step, but may be combined with amplification-based methods in a microfluidic chip having reaction chambers for both PCR and microscopic template-based sequencing. Only about 30 by of random sequence information are needed to identify a sequence as belonging to a specific human chromosome. Longer sequences can uniquely identify more particular targets. In the present case, a large number of 25 bp reads were obtained, and due to the large number of reads obtained, the 50% specificity enabled sufficient sequence tag representation.
  • the complexity of the system lies primarily in the sample preparation and in the microfabricated, massively parallel platform, which contains 1.6 million picoliter-sized reactors in a 6.4-cm 2 slide.
  • Sample preparation starts with fragmentation of the genomic DNA, followed by the attachment of adaptor sequences to the ends of the DNA pieces.
  • the adaptors allow the DNA fragments to bind to tiny beads (around 28 ⁇ in diameter). This is done under conditions that allow only one piece of DNA to bind to each bead.
  • the beads are encased in droplets of oil that contain all of the reactants needed to amplify the DNA using a standard tool called the polymerase chain reaction.
  • the oil droplets form part of an emulsion so that each bead is kept apart from its neighbor, ensuring the amplification is uncontaminated.
  • each bead ends up with roughly 10 million copies of its initial DNA fragment.
  • the DNA-template-carrying beads are loaded into the picoliter reactor wells—each well having space for just one bead.
  • the technique uses a sequencing-by-synthesis method developed by Uhlen and colleagues, in which DNA complementary to each template strand is synthesized.
  • the nucleotide bases used for sequencing release a chemical group as the base forms a bond with the growing DNA chain, and this group drives a light-emitting reaction in the presence of specific enzymes and luciferin. Sequential washes of each of the four possible nucleotides are run over the plate, and a detector senses which of the wells emit light with each wash to determine the sequence of the growing strand. This method has been adopted commercially by 454 Life Sciences.
  • Non-invasive prenatal diagnosis of aneuploidy has been a challenging problem because fetal DNA constitutes a small percentage of total DNA in maternal blood (13) and intact fetal cells are even rarer (6, 7, 9, 31, 32).
  • fetal DNA constitutes a small percentage of total DNA in maternal blood (13) and intact fetal cells are even rarer (6, 7, 9, 31, 32).
  • By directly sequencing maternal plasma DNA we could detect fetal trisomy 21 as early as 14th week of gestation.
  • Using cell-free DNA instead of intact cells allows one to avoid complexities associated with microchimerism and foreign cells that might have colonized the mother; these cells occur at such low numbers that their contribution to the cell-free DNA is negligible (33, 34).
  • cell-free fetal DNA clears from the blood to undetectable levels within a few hours of delivery and therefore is not carried forward from one pregnancy to the next (
  • Rare forms of aneuploidy caused by unbalanced translocations and partial duplication of a chromosome are in principle detectable by the approach of shotgun sequencing, since the density of sequence tags in the triplicated region of the chromosome would be higher than the rest of the chromosome. Detecting incomplete aneuploidy caused by mosaicism is also possible in principle but may be more challenging, since it depends not only on the concentration of fetal DNA in maternal plasma but also the degree of fetal mosaicism. Further studies are required to determine the effectiveness of shotgun sequencing in detecting these rare forms of aneuploidy.
  • the present method is applicable to large chromosomal deletions, such as 5p-Syndrome (five p minus), also known as Cat Cry Syndrome or Cri du Chat Syndrome.
  • 5p-Syndrome is characterized at birth by a high-pitched cry, low birth weight, poor muscle tone, microcephaly, and potential medical complications.
  • amenable disorders addressed by the present methods are p-, monosomy 9P, otherwise known as Alfi's Syndrome or 9P-, 22q11.2 deletion syndrome, Emanuel Syndrome, also known in the medical literature as the Supernumerary Der(22) Syndrome, trisomy 22, Unbalanced 11/22 Translocation or partial trisomy 11/22, Microdeletion and Microduplication at 16p11.2, which is associated with autism, and other deletions or imbalances, including those that are presently unknown.
  • Mapping shotgun sequence information i.e., sequence information from a fragment whose physical genomic position is unknown
  • Plasma DNA samples used in this study were obtained about 15 to 30 minutes after amniocentesis or chorionic villus sampling. Since these invasive procedures disrupt the interface between the placenta and maternal circulation, there have been discussions whether the amount of fetal DNA in maternal blood might increase following invasive procedures. Neither of the studies to date have observed a significant effect (41, 42).
  • the average fetal DNA fraction estimated from sequencing data is higher than the values estimated from digital PCR data by an average factor of two (p ⁇ 0.005, paired t-test on all male pregnancies that have complete set of data).
  • One possible explanation for this is that the PCR step during Solexa library preparation preferentially amplifies shorter fragments, which others have found to be enriched for fetal DNA (22, 23). Our own measurements of length distribution on one sample do not support this explanation, but nor can we reject it at this point. It should also be pointed out that using the sequence tags we find some variation of fetal fraction even in the same sample depending on which chromosome we use to make the calculation ( FIG. 7 , Table 1).
  • nucleosome occupancy throughout the eukaryotic genome is not necessarily uniform and depends on factors such as function, expression, or sequence of the region (30, 43), the representation of sequences from different loci in cell-free maternal plasma may not be equal, as one usually expects in genomic DNA extracted from intact cells.
  • the quantity of a particular locus may not be representative of the quantity of the entire chromosome and care must be taken when one designs assays for measuring gene dosage in cell-free maternal plasma DNA that target only a few loci.
  • Shotgun sequencing can potentially reveal many more previously unknown features of cell-free nucleic acids such as plasma mRNA distributions, as well as epigenetic features of plasma DNA such as DNA methylation and histone modification, in fields including perinatology, oncology and transplantation, thereby improving our understanding of the basic biology of pregnancy, early human development and disease.
  • sequencing equipment was used in the present illustrative examples, namely the Solexa/Illumina sequencing platform and the 454/Roche platform. It will be apparent to those skilled in the art that a number of different sequencing methods and variations can be used.
  • One sequencing method that can be used to advantage in the present methods involves paired end sequencing. Fluorescently labeled sequencing primers could be used to simultaneously sequence both strands of a dsDNA template, as described e.g., in Wiemann et al. ( Anal. Biochem. 224: 117 [1995 ]; Anal. Biochem. 234: 166 [1996].
  • Paired End reads are approximately 84-nucleotide DNA fragments that have a 44-mer adaptor sequence in the middle flanked by a 20-mer sequence on each side.
  • the two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest.
  • paired end reads By using paired end reads in the present method, one may obtain more sequence information from a given plasma DNA fragment, and, significantly, one may also obtain sequence information from both ends of the fragment.
  • the fragment is mapped to the human genome as explained here elsewhere. After mapping both ends, one may deduce the length of the starting fragment. Since fetal DNA is known to be shorter than maternal DNA fragments circulating in plasma, one may use this information about the length of the DNA fragment to effectively increase the weight given to sequences obtained from shorter (e.g., about 300 by or less) DNA fragments. Methods for weighting are given below.
  • Another method for increasing sensitivity to fetal DNA is to focus on certain regions within the human genome.
  • Other microdeletions and microduplications are set forth in Table 1 of US 2005/0181410, published Aug. 18, 2005 under the title “Methods and apparatuses for achieving precision genetic diagnosis.”
  • sequence-based methodologies such as sequencing by array, or capture beads with specific genomic sequences used as capture probes.
  • sequence-based methodologies such as sequencing by array, or capture beads with specific genomic sequences used as capture probes.
  • the use of a sequencing array can be implemented as described in Chetverin et al., “Oligonucleotide arrays: new concepts and possibilities,” Biotechnology (N Y). 1994 November; 12(11):1093-9, as well as Rothberg, US 2002/0012930 A1 entitled “Method of Sequencing a Nucleic Acid,” and Reeve et al., “Sequencing by Hybridization,” U.S. Pat. No. 6,399,364.
  • the target nucleic acid to be sequenced may be genomic DNA, cDNA or RNA.
  • the sample is rendered single stranded and captured under hybridizing conditions with a number of single stranded probes which are catalogued by bar coding or by physical separation in an array.
  • Emulsion PCR as used in the 454 system, the SOLiD system, and Polonator (Dover Systems) and others may also be used, where capture is directed to specific target sequences, e.g., genome sequences mapping uniquely to chromosome 21 or other chromosome of interest, or to a chromosome region such as 15q11 (Prader-Willi syndrome), or excessive CGG repeats in the FMR1 gene (fragile X syndrome).
  • the subsequencing method is in one aspect contrary to conventional massively parallel sequencing methodologies, which seek to obtain all of the sequence information in a sample.
  • This alternative method selectively ignores certain sequence information by using a sequencing method which selectively captures sample molecules containing certain predefined sequences.
  • the method proceeds as described below, where one obtains a large number of sequence reads from one or more reference chromosomes, which are compared to a large number of reads obtained from a chromosome of interest, after accounting for variations arising from chromosomal length, G/C content, repeat sequences and the like.
  • the present methods involve analyzing sequence data in a defined chromosomal sliding “window,” such as contiguous, nonoverlapping 50 Kb regions spread across a chromosome.
  • Partial trisomies of 13q, 8p (8p23.1), 7q, distal 6p, 5p, 3q (3q25.1), 2q, 1q (1q42.1 and 1q21-qter), partial Xpand monosomy 4q35.1 have been reported, among others.
  • partial duplications of the long arm of chromosome 18 can result in Edwards syndrome in the case of a duplication of 18q21.1-qter (See, Mewar et al., “Clinical and molecular evaluation of four patients with partial duplications of the long arm of chromosome 18 ,” Am J Hum Genet. 1993 December; 53(6):1269-78).
  • Plasma of DNA Input DNA* Tags P1 Plasma DNA ⁇ 47XX +21 35 1.6 761 8.0 8206694 P2 Plasma DNA ⁇ 47XY +21 18 1.4 585 5.2 7751384 P6 Plasma DNA ⁇ 47XX +21 14 1.6 410 4.3 6699183 P7 Plasma DNA ⁇ 47XY +21 18 2.2 266 3.8 8324473 P14 Plasma DNA ⁇ 47XX +21 23 3.2 57 1.2 8924944 P17 Plasma DNA ⁇ 47XX +21 16 2.3 210 3.2 11599833 P19 Plasma DNA ⁇ 46XY 18 3.2 333 7.0 7305417 P20 Plasma DNA ⁇ 47XY +21 18 1.3 408 3.6 11454876 P23 Plasma DNA ⁇ 46XY 10 1.6 258 2.7 11851612 P26 Plasma DNA ⁇ 46XY 13 3.0 340 6.7 1147
  • the amount of DNA is in Plasma (cell equivalent/ml plasma)*.
  • the approximate amount of input DNA is that use for Sequencing Library Construction (ng).
  • ng Sequencing Library Construction
  • each sample represents a different patient, e.g., P1 in the first row.
  • the total number of sequence tags varied but was frequently was in the 10 million range, using the Solexa technology.
  • the 454 technology used for P25 and P13 gave a lower number of reads.
  • the median count per 50 kb window for each chromosome was selected.
  • the median of the autosomal values i.e., 22 chromosomes
  • the inter-chromosomal variation within each sample was also consistent among all samples (including genomic DNA control).
  • the mean sequence tag density of each chromosome correlates with the G/C content of the chromosome (p ⁇ 10 ⁇ 9 ) ( FIG. 5A , 5 B).
  • the standard deviation of sequence tag density for each chromosome also correlates with the absolute degree of deviation in chromosomal G/C content from the genome-wide G/C content (p ⁇ 10 ⁇ 12 ) ( FIG. 5A , 5 C).
  • chromosome 21 sequence tag density for all 9 T21 pregnancies is clearly separated from that of pregnancies bearing disomy 21 fetuses (p ⁇ 10 ⁇ 5 ), Student's t-test) ( FIGS. 1A and 1B ).
  • the coverage of chromosome 21 for T21 cases is about ⁇ 4-18% higher (average ⁇ 11%) than that of the disomy 21 cases.
  • sequence tag density of chromosome 21 for T21 cases should be (1+ ⁇ /2) of that of disomy 21 pregnancies, where ⁇ is the fraction of total plasma DNA originating from the fetus, such increase in chromosome 21 coverage in T21 cases corresponds to a fetal DNA fraction of ⁇ 8% ⁇ 35% (average ⁇ 23%) (Table 1, FIG. 2 ).
  • ⁇ is the fraction of total plasma DNA originating from the fetus
  • Plasma DNA of pregnant women carrying T18 fetuses (2 cases) and a T13 fetus (1 case) were also directly sequenced. Over-representation was observed for chromosome 18 and chromosome 13 in T18 and T13 cases respectively ( FIG. 1A ). While there were not enough positive samples to measure a representative distribution, it is encouraging that all of these three positives are outliers from the distribution of disomy values. The T18 are large outliers and are clearly statistically significant (p ⁇ 10 ⁇ 7 ), while the statistical significance of the single T13 case is marginal (p ⁇ 0.05). Fetal DNA fraction was also calculated from the over-represented chromosome as described above ( FIG. 2 , Table 1).
  • the fraction of fetal DNA in maternal cell-free plasma DNA is usually determined by comparing the amount of fetal specific locus (such as the SRY locus on chromosome Y in male pregnancies) to that of a locus on any autosome that is common to both the mother and the fetus using quantitative real-time PCR (13, 22, 23).
  • fetal specific locus such as the SRY locus on chromosome Y in male pregnancies
  • We applied a similar duplex assay on a digital PCR platform see Methods to compare the counts of the SRY locus and a locus on chromosome 1 in male pregnancies. SRY locus was not detectable in any plasma DNA samples from female pregnancies.
  • digital PCR that for the majority samples, fetal DNA constituted ⁇ 10% of total DNA in maternal plasma (Table 2), agreeing with previously reported values (13).
  • the percentage of fetal DNA among total cell-free DNA in maternal plasma can also be calculated from the density of sequence tags of the sex chromosomes for male pregnancies.
  • sequence tag density of chromosome Y of plasma DNA from male pregnancies we estimated fetal DNA percentage to be on average ⁇ 19% (range: 4-44%) for all male pregnancies (Table 2, above, FIG. 2 ).
  • sequence tag density of chromosome X in male pregnancies should be (1 ⁇ e/2) of that of female pregnancies, where e is fetal DNA fraction.
  • nucleosome positioning around transcription start sites.
  • Experimental data from yeast and human have suggested that nucleosomes are depleted in promoters upstream of transcription start sites and nucleosomes are well-positioned near transcription start sites (27-30).
  • a peak in the sense strand represents the beginning of a nucleosome while a peak in the antisense strand represents the end.
  • sequence tag numbers are treated statistically based on data from the reference human genome. That is, for example, sequence tags from fragments with higher GC content may be overrepresented, and suggest an aneuploidy where none exists.
  • the sequence tag information itself may not be informative, since only a small portion of the fragment ordinarily will be sequenced, while it is the overall G/C content of the fragment that causes the bias.
  • a method described in detail in Examples 8 and 10, for correcting for this bias, and this method may facilitate analysis of samples which otherwise would not produce statistically significant results.
  • This method for correcting for G/C bias of sequence reads from massively parallel sequencing of a genome, comprises the step of dividing the genome into a number of windows within each chromosome and calculating the G/C content of each window. These windows need not be the same as the windows used for calculating sequence tag density; they may be on the order of 10 kb-30 kb in length, for example. One then calculates the relationship between sequence coverage and G/C content of each window by determining a number of reads per a given window and a G/C content of that window. The G/C content of each window is known from the human genome reference sequence. Certain windows will be ignored, i.e., with no reads or no G/C content.
  • Microfluidic digital PCR was used to quantify the amount of total and fetal DNA using Taqman assays targeting at the EIF2C1 locus on chromosome 1 (Forward: 5′ GTTCGGCTTTCACCAGTCT 3′ (SEQ ID NO: 1); Reverse: 5′ CTCCATAGCTCTCCCCACTC 3′ (SEQ ID NO: 2); Probe: 5′ HEX-GCCCTGCCATGTGGAAGAT-BHQ1 3′ (SEQ ID NO: 3); amplicon size: 81 bp) and the SRY locus on chromosome Y (Forward: 5′ CGCTTAACATAGCAGAAGCA 3′ (SEQ ID NO: 4); Reverse: 5′ AGTTTCGAACTCTGGCACCT 3′ (SEQ ID NO: 5); Probe: 5′ FAM-TGTCGCACTCTCCTTGTTTTTGACA-BHQ1 3′ (SEQ ID NO: 6); amplicon size: 84 bp) respectively.
  • a Taqman assay targeting at DYS14 (Forward: 5′ ATCGTCCATTTCCAGAATCA 3′ (SEQ ID NO: 6); Reverse: 5′ GTTGACAGCCGTGGAATC 3′ (SEQ ID NO: 7); Probe: 5′ FAM-TGCCACAGACTGAACTGAATGATTTTC-BHQ1 3′ (SEQ ID NO: 8); amplicon size: 84 bp), a multi-copy locus on chromosome Y, was used for the initial determination of fetal sex from cell-free plasma DNA with traditional real-time PCR.
  • PCR reactions were performed with 1 ⁇ iQ Supermix (Bio-Rad), 0.1% Tween-20 (microfluidic digital PCR only), 300 nM primers, and 150 nM probes.
  • the PCR thermal cycling protocol was 95 C for 10 min, followed by 40 cycles of 95 C for 15 s and 60 C for 1 min. Primers and probes were purchased form IDT.
  • a total of 19 cell-free plasma DNA samples including 18 from pregnant women and 1 from a male blood donor, and genomic DNA sample from whole blood of the same male donor, were sequenced on the Solexa/Illumina platform. ⁇ 1 to 8 ng of DNA fragments extracted from 1.3 to 5.6 ml cell-free plasma was used for sequencing library preparation (Table 1). Library preparation was carried out according to manufacturer's protocol with slight modifications. Because cell-free plasma DNA was fragmented in nature, no further fragmentation by nebulization or sonication was done on plasma DNA samples.
  • Genomic DNA from male donor's whole blood was sonicated (Misonix XL-2020) (24 cycles of 30 s sonication and 90 s pause), yielding fragments with size between 50 and 400 bp, with a peak at 150 bp. ⁇ 2 ng of the sonicated genomic DNA was used for library preparation. Briefly, DNA samples were blunt ended and ligated to universal adaptors. The amount of adaptors used for ligation was 500 times less than written on the manufacturer's protocol. 18 cycles of PCR were performed to enrich for fragments with adaptors using primers complementary to the adaptors.
  • the size distributions of the sequencing libraries were analyzed with DNA 1000 Kit on the 2100 Bioanalyzer (Agilent) and quantified with microfluidic digital PCR (Fluidigm). The libraries were then sequenced using the Solexa 1G Genome Analyzer according to manufacturer's instructions.
  • Cell-free plasma DNA from a pregnant woman carrying a normal male fetus was also sequenced on the 454/Roche platform. Fragments of DNA extracted from 5.6 ml of cell-free plasma (equivalent to ⁇ 4.9 ng of DNA) were used for sequencing library preparation.
  • the sequencing library was prepared according to manufacturer's protocol, except that no nebulization was performed on the sample and quantification was done with microfluidic digital PCR instead of capillary electrophoresis.
  • the library was then sequenced on the 454 Genome Sequencer FLX System according to manufacturer's instructions.
  • Electropherograms of Solexa sequencing libraries were prepared from cell-free plasma DNA obtained from 18 pregnant women and 1 male donor. Solexa library prepared from sonicated whole blood genomic DNA from the male donor was also examined. For libraries prepared from cell-free DNA, all had peaks at average 261 bp (range: 256-264 bp). The actual peak size of DNA fragments in plasma DNA is ⁇ 168 bp (after removal of Solexa universal adaptor (92 bp)). This corresponds to the size of a chromatosome.
  • Solexa sequencing produced 36 to 50 bp reads.
  • the first 25 bp of each read was mapped to the human genome build 36 (hg18) using ELAND from the Solexa data analysis pipeline.
  • the reads that were uniquely mapped to the human genome having at most 1 mismatch were retained for analysis.
  • a sliding window of 50 kb was applied across each chromosome, except in regions of assembly gaps and microsatellites, and the number of sequence tags falling within each window was counted and the median value was chosen to be the representative of the chromosome.
  • chromosome X fetal DNA was estimated as 2*(1 ⁇ x), where x was the ratio of chromosome X sequence tag density of each male pregnancy to the median chromosome X sequence tag density of all female pregnancies.
  • chromosome Y fetal DNA fraction was estimated as the ratio of chromosome Y sequence tag density of each male pregnancy to that of male donor plasma DNA. Because a small number of chromosome Y sequences were detected in female pregnancies, we only considered sequence tags falling within transcribed regions on chromosome Y and subtracted the median number of tags in female pregnancies from all samples; this amounted to a correction of a few percent.
  • a confidence interval gives an estimated range of values, which is likely to include an unknown population parameter, the estimated range being calculated from a given set of sample data. (Definition taken from Valerie J. Easton and John H. McColl's Statistics Glossary v1.1)
  • sequence tags that mapped uniquely to the human genome with at most 1 mismatch (on average ⁇ 5 million) for analysis.
  • the distribution of reads across each chromosome was examined. Because the distribution of sequence tags across each chromosome was non-uniform (possibly technical artifacts), we divided the length of each chromosome into non-overlapping sliding window with a fixed width (in this particular analysis, a 50 kbp window was used), skipping regions of genome assembly gaps and regions with known microsatellite repeats.
  • the width of the window is should be large enough such that there are a sufficient number of sequence tags in each window, and should be small enough such that there are sufficient number of windows to form a distribution.
  • the window width can be reduced.
  • the number of sequence tags in each window was counted.
  • the distribution of the number of sequence tags per 50 kb for each chromosome was examined.
  • the median value of the number of sequence tags per 50 kb (or ‘sequence tag density’) for each chromosome was chosen in order to suppress the effects of any under- or over-represented regions within the chromosome. Because the total number of sequence tags obtained for each sample was different, in order to compare among samples, we normalized each chromosomal sequence tag density value (except chromosome Y) by the median sequence tag density among all autosomes (non-sex chromosomes).
  • reads were aligned to the human genome build 36 (hg18, see hyper text transfer protocol (http) genome.ucsc.edu/cgi-bin/hgGateway) using the 454 Reference Mapper. Reads having accuracy of greater than or equal to 90% and coverage (i.e., fraction of read mapped) greater than or equal to 90% were retained for analysis. To study the size distribution of total and fetal DNA, the number of retained reads falling within each 10 bp window between 50 bp to 330 bp was counted.
  • the number of reads falling within different size ranges may be studied, i.e., reads of between 50-60 bp, 60-70 bp, 70-80 bp, etc., up to about 320-330 bp, which is around the maximum read length obtained.
  • TSS transcription start sites
  • the distribution of sequence tags around transcription start sites (TSS) of RefSeq genes were analyzed (data not shown). The plots were similar to FIG. 4 . Each plot represented the distribution for each plasma DNA or gDNA sample. Data are obtained from three different sequencing runs (P1, P6, P52, P53, P26, P40, P42 were sequenced together; male genomic DNA, male plasma DNA, P2, P7, P14, P19, P31 were sequenced together; P17, P20, P23, P57, P59, P64 were sequenced together). The second batch of samples suffers greater G/C bias as observed from inter- and intra-chromosomal variation. Their distributions around TSS have similar trends with more tags at the TSS.
  • Digital PCR is the amplification of single DNA molecule.
  • DNA sample is diluted and distributed across multiple compartments such that on average there is less than 1 copy of DNA per compartment.
  • a compartment displaying fluorescence at the end of a PCR represents the presence of at least one DNA molecule.
  • the count of positive compartments from the microfluidic digital PCR chip of each assay is converted to the most probable count according to the method described in the supporting information of the following reference: Warren L, Bryder D, Weissman I L, Quake S R (2006) Transcription factor profiling in individual hematopoietic progenitors by digital RT-PCR. Proc Nat Acad Sci, 103: 17807-12.
  • x be the ratio of ChrX sequence tag density of male to female pregnancies.
  • the denominator of this ratio is taken to be the median sequence tag density of all female pregnancies.
  • Fetal DNA fraction ⁇ (sequence tag density of ChrY in maternal plasma/sequence tag density of ChrY in male plasma)
  • x be the ratio of trisomic chromosome sequence counts (or sequence tag density) of trisomic to disomic pregnancies.
  • the denominator of this ratio is taken to be the median sequence tag density of all disomic pregnancies.
  • This example shows a refinement of results indicating sequences mapping to different chromosomes and permitting the determination of the count of different chromosomes or regions thereof. That is, the results as shown in FIG. 1A may be corrected to eliminate the variations in sequence tag density shown for chromosomes higher in G/C content, shown towards the right of the Figure. This spread of values results from sequencing bias in the method used, where a greater number of reads tend to be obtained depending on G/C content.
  • the results of the method of this example are shown in FIG. 10 .
  • FIG. 10 is an overlay which shows the results from a number of different samples, as indicated in the legend.
  • chromosome sequence tag densities can be seen as significantly above a median sequence tag density; disomic chromosomes are clustered about a line running along a density value of about 1.
  • results from chromosome 19 far right, highest in G/C content
  • Samples (such as P13 in the present study) which could not have been unambiguously interpreted now may be. Since G/C content is the opposite of A/T content, the present method will correct for both. Either G/C bias or A/T bias can result from different sequencing methods.
  • an arbitrary window of known human genomic DNA sequence is chosen for determining G/C content of different reads.
  • the window can be much smaller e.g., 10 kb or 5 kb, but a size of 20 kb makes computation easier.
  • b Calculate the relationship between sequence coverage and G/C content. Assign weight to each read according to G/C content. For each sample, the number of read per 20 kb bin is counted. The number of read is plotted against G/C content. The average number of read is calculated for every 0.1% G/C content, ignoring bins with no reads, bins with zero G/C percent, and bins with over-abundant reads. The reciprocal of the average number of reads for a particular G/C percent relative to the global median number of read is calculated as the weight. Each read is then assigned a weight depending on the G/C percent of the 20 kb window it falls into.
  • FIG. 12 illustrates the results of an analysis of patients P13, P19, P31, P23, P26, P40, P42, P1, P2, P6, P7, P14, P17, P20, P52, P53, P57, P59 and P64, with their respective karyotypes indicated, as in Table 1, above.
  • the dotted line shows the 99% confidence interval, and outliers may be quickly identified. It may be seen by looking below the line that male fetuses have less chromosome X (solid triangles). An exception is P19, where it is believed that there were not enough total reads for this analysis.
  • Step 1 Calculate at statistic for each chromosome relative to all other chromosome in a sample.
  • Each t statistic tells the value of each chromosome median relative to other chromosomes, taking into account the number of reads mapped to each chromosome (since the variation of the median scales with the number of reads).
  • the present analyses yielded about 5 million reads per sample. Although one may obtain 3-10 million reads per sample, these are short reads, typically only about 20-100 bp, so one has actually only sequenced, for example about 300 million of the 3 billion by in the human genome.
  • Step 2 Calculate the average t statistic matrix by averaging the values from all samples with disomic chromosomes.
  • Each patient sample data is placed in at matrix, where the row is chr1 to chr22, and the column is also chr1 to chr22.
  • Each cell represents the t value when comparing the chromosomes in the corresponding row and column (i.e., position (2,1) in the matrix is the t-value of when testing chr2 and chr1) the diagonal of the matrix is 0 and the matrix is symmetric.
  • the number of reads mapping to a chromosome is compared individually to each of chr1-22.
  • Step 3 Subtract the average t statistic matrix from the t statistic matrix of each patient sample. For each chromosome, the median of the difference in t statistic is selected as the representative value.
  • the t statistic for 99% confidence for large number of samples is 3.09. Any chromosome with a representative t statistic outside ⁇ 3.09 to 3.09 is determined as non-disomic.
  • FIG. 13 and FIG. 14 show results obtained from 19 patient plasma DNA samples, 1 donor plasma DNA sample, and duplicate runs of a donor gDNA sample. It is estimated in FIG. 13 that the minimum fetal DNA % of which over-representation of chr21 can be detected at the best sampling rate ( ⁇ 70k reads mapped to chr21) is ⁇ 6%. (indicated by solid lines in FIG. 13 ). The lines are drawn between about 0.7 ⁇ 10 5 reads and 6% fetal DNA concentration. It can be expected that higher numbers of reads (not exemplified here) the needed fetal DNA percentage will drop, probably to about 4%.
  • FIG. 14 the data from FIG. 13 are presented in a logarithmic scale. This shows that the minimum required fetal DNA concentration scales linearly with the number of reads in a square root relationship (slope of ⁇ 0.5).
  • y 2 ⁇ y 1 is the difference in means (or amount of over- or under-representation of a particular chromosome) to be measured;
  • s is the standard deviation of the number of reads per 50 kb in a particular chromosome;
  • the 99.9% confidence interval of the median for each chromosome is estimated from bootstrapping 5000 samples from the 50 kb read distribution data using the percentile method.
  • the half width of the confidence interval is estimated as 0.5*confidence interval.
US12/560,708 2008-09-20 2009-09-16 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing Abandoned US20100112575A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US12/560,708 US20100112575A1 (en) 2008-09-20 2009-09-16 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US12/696,509 US8195415B2 (en) 2008-09-20 2010-01-29 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/102,717 US8682594B2 (en) 2008-09-20 2011-05-06 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/218,317 US20110319272A1 (en) 2008-09-20 2011-08-25 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US13/452,083 US8296076B2 (en) 2008-09-20 2012-04-20 Noninvasive diagnosis of fetal aneuoploidy by sequencing
US13/921,881 US9404157B2 (en) 2008-09-20 2013-06-19 Noninvasive diagnosis of fetal aneuploidy by sequencing
US14/168,714 US9353414B2 (en) 2008-09-20 2014-01-30 Noninvasive diagnosis of fetal aneuploidy by sequencing
US15/195,135 US10669585B2 (en) 2008-09-20 2016-06-28 Noninvasive diagnosis of fetal aneuploidy by sequencing
US16/852,663 US20200270700A1 (en) 2008-09-20 2020-04-20 Noninvasive diagnosis of fetal aneuploidy by sequencing

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9875808P 2008-09-20 2008-09-20
US12/560,708 US20100112575A1 (en) 2008-09-20 2009-09-16 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/696,509 Division US8195415B2 (en) 2008-09-20 2010-01-29 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/218,317 Continuation US20110319272A1 (en) 2008-09-20 2011-08-25 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing

Publications (1)

Publication Number Publication Date
US20100112575A1 true US20100112575A1 (en) 2010-05-06

Family

ID=42040105

Family Applications (9)

Application Number Title Priority Date Filing Date
US12/560,708 Abandoned US20100112575A1 (en) 2008-09-20 2009-09-16 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US12/696,509 Active US8195415B2 (en) 2008-09-20 2010-01-29 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/102,717 Active US8682594B2 (en) 2008-09-20 2011-05-06 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/218,317 Abandoned US20110319272A1 (en) 2008-09-20 2011-08-25 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US13/452,083 Active US8296076B2 (en) 2008-09-20 2012-04-20 Noninvasive diagnosis of fetal aneuoploidy by sequencing
US13/921,881 Active US9404157B2 (en) 2008-09-20 2013-06-19 Noninvasive diagnosis of fetal aneuploidy by sequencing
US14/168,714 Active US9353414B2 (en) 2008-09-20 2014-01-30 Noninvasive diagnosis of fetal aneuploidy by sequencing
US15/195,135 Active 2029-09-29 US10669585B2 (en) 2008-09-20 2016-06-28 Noninvasive diagnosis of fetal aneuploidy by sequencing
US16/852,663 Pending US20200270700A1 (en) 2008-09-20 2020-04-20 Noninvasive diagnosis of fetal aneuploidy by sequencing

Family Applications After (8)

Application Number Title Priority Date Filing Date
US12/696,509 Active US8195415B2 (en) 2008-09-20 2010-01-29 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/102,717 Active US8682594B2 (en) 2008-09-20 2011-05-06 Noninvasive diagnosis of fetal aneuploidy by sequencing
US13/218,317 Abandoned US20110319272A1 (en) 2008-09-20 2011-08-25 Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US13/452,083 Active US8296076B2 (en) 2008-09-20 2012-04-20 Noninvasive diagnosis of fetal aneuoploidy by sequencing
US13/921,881 Active US9404157B2 (en) 2008-09-20 2013-06-19 Noninvasive diagnosis of fetal aneuploidy by sequencing
US14/168,714 Active US9353414B2 (en) 2008-09-20 2014-01-30 Noninvasive diagnosis of fetal aneuploidy by sequencing
US15/195,135 Active 2029-09-29 US10669585B2 (en) 2008-09-20 2016-06-28 Noninvasive diagnosis of fetal aneuploidy by sequencing
US16/852,663 Pending US20200270700A1 (en) 2008-09-20 2020-04-20 Noninvasive diagnosis of fetal aneuploidy by sequencing

Country Status (17)

Country Link
US (9) US20100112575A1 (fr)
EP (5) EP3751005A3 (fr)
AU (1) AU2009293354B2 (fr)
CA (4) CA3069082C (fr)
CY (2) CY1118802T1 (fr)
DK (2) DK2562268T3 (fr)
ES (2) ES2620294T3 (fr)
HK (1) HK1217354A1 (fr)
HR (2) HRP20170435T1 (fr)
HU (2) HUE031849T2 (fr)
IL (2) IL211794A (fr)
LT (2) LT2562268T (fr)
PL (2) PL2334812T3 (fr)
PT (2) PT2562268T (fr)
SG (1) SG10201500567VA (fr)
SI (2) SI2334812T1 (fr)
WO (1) WO2010033578A2 (fr)

Cited By (117)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080138809A1 (en) * 2006-06-14 2008-06-12 Ravi Kapur Methods for the Diagnosis of Fetal Abnormalities
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US20100112590A1 (en) * 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US20100124752A1 (en) * 2006-02-02 2010-05-20 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US20100216153A1 (en) * 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
US20100304978A1 (en) * 2009-01-26 2010-12-02 David Xingfei Deng Methods and compositions for identifying a fetal cell
US20110033862A1 (en) * 2008-02-19 2011-02-10 Gene Security Network, Inc. Methods for cell genotyping
US20110092763A1 (en) * 2008-05-27 2011-04-21 Gene Security Network, Inc. Methods for Embryo Characterization and Comparison
US20110178719A1 (en) * 2008-08-04 2011-07-21 Gene Security Network, Inc. Methods for Allele Calling and Ploidy Calling
WO2011090559A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Méthodes de séquençage et compositions de diagnostic prénatal
WO2011090556A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Procédés pour déterminer une fraction d'acide nucléique fœtal dans des échantillons maternels
WO2011091046A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Identification de cellules polymorphes dans des mélanges d'adn génomique par séquençage du génome entier
US8168389B2 (en) 2006-06-14 2012-05-01 The General Hospital Corporation Fetal cell analysis using sample splitting
WO2012078792A2 (fr) 2010-12-07 2012-06-14 Stanford University Détermination non invasive de l'héritage foetal des haplotypes parentaux à l'échelle du génome
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
US20130029852A1 (en) * 2010-01-19 2013-01-31 Verinata Health, Inc. Detecting and classifying copy number variation
US20130130921A1 (en) * 2011-05-31 2013-05-23 Berry Genomics Co., Ltd. Kit, a Device and a Method for Detecting Copy Number of Fetal Chromosomes or Tumor Cell Chromosomes
WO2013086352A1 (fr) * 2011-12-07 2013-06-13 Chronix Biomedical Biomarqueurs pour acides nucléiques circulants associés au cancer de la prostate prostate cancer associated circulating nucleic acid biomarkers
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
CN103374518A (zh) * 2012-04-12 2013-10-30 维里纳塔健康公司 拷贝数变异的检测和分类
US8682592B2 (en) 2005-11-26 2014-03-25 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US8688388B2 (en) * 2011-10-11 2014-04-01 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US8700338B2 (en) 2011-01-25 2014-04-15 Ariosa Diagnosis, Inc. Risk calculation for evaluation of fetal aneuploidy
US8712697B2 (en) 2011-09-07 2014-04-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
US8756020B2 (en) 2011-01-25 2014-06-17 Ariosa Diagnostics, Inc. Enhanced risk probabilities using biomolecule estimations
US20140228226A1 (en) * 2011-09-21 2014-08-14 Bgi Health Service Co., Ltd. Method and system for determining chromosome aneuploidy of single cell
US8825412B2 (en) 2010-05-18 2014-09-02 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US20140336075A1 (en) * 2011-12-17 2014-11-13 Bgi Diagnosis Co., Ltd. Method and system for determinining whether genome is abnormal
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
US9163282B2 (en) 2010-05-18 2015-10-20 Natera, Inc. Methods for non-invasive prenatal ploidy calling
EP2948886A2 (fr) * 2013-01-25 2015-12-02 Sequenom, Inc. Procédés et processus d'évaluation non invasive de variations génétiques
US9206417B2 (en) 2012-07-19 2015-12-08 Ariosa Diagnostics, Inc. Multiplexed sequential ligation-based detection of genetic variants
US9228234B2 (en) 2009-09-30 2016-01-05 Natera, Inc. Methods for non-invasive prenatal ploidy calling
KR101614471B1 (ko) * 2013-02-28 2016-04-21 주식회사 테라젠이텍스 유전체 서열분석을 이용한 태아 염색체 이수성의 진단 방법 및 장치
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
US9367663B2 (en) * 2011-10-06 2016-06-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US9499870B2 (en) 2013-09-27 2016-11-22 Natera, Inc. Cell free DNA diagnostic testing standards
US9547748B2 (en) 2011-06-29 2017-01-17 Bgi Health Service Co., Ltd. Method for determining fetal chromosomal abnormality
US9567639B2 (en) 2010-08-06 2017-02-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
JP2017073144A (ja) * 2011-10-06 2017-04-13 セクエノム， インコーポレイテッド 遺伝的変異の非侵襲的評価のための方法およびプロセス
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US9890421B2 (en) 2010-08-06 2018-02-13 Ariosa Diagnostics, Inc. Assay systems for genetic analysis
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US9984198B2 (en) 2011-10-06 2018-05-29 Sequenom, Inc. Reducing sequence read count error in assessment of complex genetic variations
US9994897B2 (en) 2013-03-08 2018-06-12 Ariosa Diagnostics, Inc. Non-invasive fetal sex determination
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10095831B2 (en) 2016-02-03 2018-10-09 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
US10113196B2 (en) 2010-05-18 2018-10-30 Natera, Inc. Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping
US10131951B2 (en) 2010-08-06 2018-11-20 Ariosa Diagnostics, Inc. Assay systems for genetic analysis
US10131947B2 (en) 2011-01-25 2018-11-20 Ariosa Diagnostics, Inc. Noninvasive detection of fetal aneuploidy in egg donor pregnancies
US10167508B2 (en) 2010-08-06 2019-01-01 Ariosa Diagnostics, Inc. Detection of genetic abnormalities
US10179937B2 (en) 2014-04-21 2019-01-15 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10196681B2 (en) 2011-10-06 2019-02-05 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10233496B2 (en) 2010-08-06 2019-03-19 Ariosa Diagnostics, Inc. Ligation-based detection of genetic variants
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10289800B2 (en) 2012-05-21 2019-05-14 Ariosa Diagnostics, Inc. Processes for calculating phased fetal genomic sequences
US10318704B2 (en) 2014-05-30 2019-06-11 Verinata Health, Inc. Detecting fetal sub-chromosomal aneuploidies
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci
US10364467B2 (en) 2015-01-13 2019-07-30 The Chinese University Of Hong Kong Using size and number aberrations in plasma DNA for detecting cancer
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US10424394B2 (en) 2011-10-06 2019-09-24 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10438691B2 (en) 2013-10-07 2019-10-08 Sequenom, Inc. Non-invasive assessment of chromosome alterations using change in subsequence mappability
US10457995B2 (en) 2012-09-04 2019-10-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10482994B2 (en) 2012-10-04 2019-11-19 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10497461B2 (en) 2012-06-22 2019-12-03 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10504613B2 (en) 2012-12-20 2019-12-10 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10526658B2 (en) 2010-05-18 2020-01-07 Natera, Inc. Methods for simultaneous amplification of target loci
US10533223B2 (en) 2010-08-06 2020-01-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US10577655B2 (en) 2013-09-27 2020-03-03 Natera, Inc. Cell free DNA diagnostic testing standards
US10591391B2 (en) 2006-06-14 2020-03-17 Verinata Health, Inc. Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US10622094B2 (en) 2013-06-21 2020-04-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10643738B2 (en) 2013-01-10 2020-05-05 The Chinese University Of Hong Kong Noninvasive prenatal molecular karyotyping from maternal plasma
US10669585B2 (en) 2008-09-20 2020-06-02 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US10699800B2 (en) 2013-05-24 2020-06-30 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10704086B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10704090B2 (en) 2006-06-14 2020-07-07 Verinata Health, Inc. Fetal aneuploidy detection by sequencing
US10741269B2 (en) 2013-10-21 2020-08-11 Verinata Health, Inc. Method for improving the sensitivity of detection in determining copy number variations
CN111627498A (zh) * 2020-05-21 2020-09-04 北京吉因加医学检验实验室有限公司 一种测序数据gc偏向性校正的方法及其装置
US10801063B2 (en) 2013-12-28 2020-10-13 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10894976B2 (en) 2017-02-21 2021-01-19 Natera, Inc. Compositions, methods, and kits for isolating nucleic acids
US10894974B2 (en) 2012-09-04 2021-01-19 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10930368B2 (en) 2013-04-03 2021-02-23 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10964409B2 (en) 2013-10-04 2021-03-30 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11004537B2 (en) 2011-06-24 2021-05-11 Sequenom, Inc. Methods and processes for non invasive assessment of a genetic variation
US11001884B2 (en) 2011-10-06 2021-05-11 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11031095B2 (en) 2010-08-06 2021-06-08 Ariosa Diagnostics, Inc. Assay systems for determination of fetal copy number variation
US11072814B2 (en) 2014-12-12 2021-07-27 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11168370B2 (en) 2015-02-10 2021-11-09 The Chinese University Of Hong Kong Detecting mutations for cancer screening
US11200963B2 (en) 2016-07-27 2021-12-14 Sequenom, Inc. Genetic copy number alteration classifications
US11203786B2 (en) 2010-08-06 2021-12-21 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US11242569B2 (en) 2015-12-17 2022-02-08 Guardant Health, Inc. Methods to determine tumor gene copy number by analysis of cell-free DNA
US11261494B2 (en) * 2012-06-21 2022-03-01 The Chinese University Of Hong Kong Method of measuring a fractional concentration of tumor DNA
US11270781B2 (en) 2011-01-25 2022-03-08 Ariosa Diagnostics, Inc. Statistical analysis for non-invasive sex chromosome aneuploidy determination
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
US11525159B2 (en) 2018-07-03 2022-12-13 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US11525134B2 (en) 2017-10-27 2022-12-13 Juno Diagnostics, Inc. Devices, systems and methods for ultra-low volume liquid biopsy
US11694768B2 (en) 2017-01-24 2023-07-04 Sequenom, Inc. Methods and processes for assessment of genetic variations
US11697849B2 (en) 2012-01-20 2023-07-11 Sequenom, Inc. Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions
US11783911B2 (en) 2014-07-30 2023-10-10 Sequenom, Inc Methods and processes for non-invasive assessment of genetic variations
US11854666B2 (en) 2016-09-29 2023-12-26 Myriad Women's Health, Inc. Noninvasive prenatal screening using dynamic iterative depth optimization
US11913065B2 (en) 2012-09-04 2024-02-27 Guardent Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci

Families Citing this family (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9186685B2 (en) 2012-01-13 2015-11-17 The University Of British Columbia Multiple arm apparatus and methods for separation of particles
US8529744B2 (en) 2004-02-02 2013-09-10 Boreal Genomics Corp. Enrichment of nucleic acid targets
US8518228B2 (en) 2011-05-20 2013-08-27 The University Of British Columbia Systems and methods for enhanced SCODA
US10337054B2 (en) 2004-02-02 2019-07-02 Quantum-Si Incorporated Enrichment of nucleic acid targets
JP2007526823A (ja) 2004-02-02 2007-09-20 ザ ユニバーシティ オブ ブリティッシュ コロンビア 粒子を運動および濃縮させるためのスコダ泳動ならびに方法および装置
US8024128B2 (en) * 2004-09-07 2011-09-20 Gene Security Network, Inc. System and method for improving clinical decisions by aggregating, validating and analysing genetic and phenotypic data
US20070178501A1 (en) * 2005-12-06 2007-08-02 Matthew Rabinowitz System and method for integrating and validating genotypic, phenotypic and medical information into a database according to a standardized ontology
US20070027636A1 (en) * 2005-07-29 2007-02-01 Matthew Rabinowitz System and method for using genetic, phentoypic and clinical data to make predictions for clinical or lifestyle decisions
US8515679B2 (en) * 2005-12-06 2013-08-20 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
WO2009033178A1 (fr) 2007-09-07 2009-03-12 Fluidigm Corporation Détermination de la variation du nombre de copies, procédés et systèmes
US8475641B2 (en) 2008-02-01 2013-07-02 The University Of British Columbia Methods and apparatus for particle introduction and recovery
US8476013B2 (en) 2008-09-16 2013-07-02 Sequenom, Inc. Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US8962247B2 (en) * 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US8877028B2 (en) 2009-04-21 2014-11-04 The University Of British Columbia System and methods for detection of particles
ES2564656T3 (es) 2009-10-26 2016-03-28 Lifecodexx Ag Medios y métodos para el diagnóstico no invasivo de la aneuploidía cromosómica
WO2011087760A2 (fr) 2009-12-22 2011-07-21 Sequenom, Inc. Procédés et kits pour identifier une aneuploïdie
WO2011130880A1 (fr) * 2010-04-23 2011-10-27 深圳华大基因科技有限公司 Procédé de détection de l'aneuploïdie chromosomique fœtale
ES2552343T3 (es) * 2010-08-13 2015-11-27 Bgi Genomics Co., Ltd. Un procedimiento para el análisis de cromosomas de células
CA2809055A1 (fr) * 2010-08-24 2012-03-01 Biodx, Inc. Definition de cibles diagnostiques et therapeutiques d'adn foetal libre flottant conserve dans la circulation sanguine maternelle
CN102985561B (zh) * 2011-04-14 2015-04-01 维里纳塔健康公司 用于确定并且验证常见的和罕见的染色体非整倍性的归一化染色体
KR101974492B1 (ko) * 2011-07-26 2019-05-02 베리나타 헬스, 인코포레이티드 샘플 중 상이한 이수성의 존재 또는 부재를 결정하는 방법
ES2651612T3 (es) 2011-10-18 2018-01-29 Multiplicom Nv Diagnóstico de aneuploidía cromosómica fetal
WO2013060762A1 (fr) * 2011-10-25 2013-05-02 Roche Diagnostics Gmbh Méthode pour diagnostiquer une maladie basée sur la distribution de l'adn plasmatique
US9845552B2 (en) 2011-10-27 2017-12-19 Verinata Health, Inc. Set membership testers for aligning nucleic acid samples
KR101922129B1 (ko) 2011-12-05 2018-11-26 삼성전자주식회사 차세대 시퀀싱을 이용하여 획득된 유전 정보를 압축 및 압축해제하는 방법 및 장치
EP2826865B8 (fr) * 2012-01-20 2017-08-16 BGI Genomics Co., Ltd. Procédé et système pour déterminer s'il existe une variabilité du nombre de copies dans un génome échantillon, et support lisible par ordinateur
EP4155401A1 (fr) * 2012-03-02 2023-03-29 Sequenom, Inc. Méthodes et procédés d'évaluation non invasive de variations génétiques
US9892230B2 (en) 2012-03-08 2018-02-13 The Chinese University Of Hong Kong Size-based analysis of fetal or tumor DNA fraction in plasma
AU2013232123B2 (en) 2012-03-13 2014-10-30 The Chinese University Of Hong Kong Methods for analyzing massively parallel sequencing data for noninvasive prenatal diagnosis
EP4239081A3 (fr) * 2012-03-26 2023-11-08 The Johns Hopkins University Détection rapide d'aneuploïdie
EP2844773B1 (fr) 2012-05-04 2017-08-16 Boreal Genomics Corp. Analyse de biomarqueurs utilisant la scodaphorèse
CA2878979C (fr) 2012-07-13 2021-09-14 Sequenom, Inc. Procedes et compositions pour enrichissement base sur la methylation en acide nucleique foetal dans un echantillon maternel, utiles pour les diagnostics prenatals non invasifs
KR101890466B1 (ko) 2012-07-24 2018-08-21 내테라, 인코포레이티드 고도의 다중 ｐｃｒ 방법 및 조성물
TWI489305B (zh) * 2012-11-21 2015-06-21 Bgi Diagnosis Co Ltd 對胎兒遺傳異常的無創性檢測
WO2014168711A1 (fr) 2013-03-13 2014-10-16 Sequenom, Inc. Amorces pour analyse de la méthylation de l'adn
US9340835B2 (en) 2013-03-15 2016-05-17 Boreal Genomics Corp. Method for separating homoduplexed and heteroduplexed nucleic acids
US10017807B2 (en) * 2013-03-15 2018-07-10 Verinata Health, Inc. Generating cell-free DNA libraries directly from blood
WO2015006932A1 (fr) * 2013-07-17 2015-01-22 深圳华大基因科技有限公司 Procédé et dispositif de détection d'une aneuploïdie chromosomique
US10851414B2 (en) * 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
CN103525939B (zh) * 2013-10-28 2015-12-02 博奥生物集团有限公司 无创检测胎儿染色体非整倍体的方法和系统
EP3117011B1 (fr) 2014-03-13 2020-05-06 Sequenom, Inc. Méthodes et procédés d'évaluation non invasive de variations génétiques
WO2015181718A1 (fr) * 2014-05-26 2015-12-03 Ebios Futura S.R.L. Procédé de diagnostic prénatal
US20160026759A1 (en) * 2014-07-22 2016-01-28 Yourgene Bioscience Detecting Chromosomal Aneuploidy
WO2016015058A2 (fr) 2014-07-25 2016-01-28 University Of Washington Procédés de détermination de types de tissus et/ou de cellules permettant d'obtenir de l'adn sans cellules, et procédés d'identification d'une maladie ou d'un trouble les employant
US10395759B2 (en) 2015-05-18 2019-08-27 Regeneron Pharmaceuticals, Inc. Methods and systems for copy number variant detection
WO2016185284A1 (fr) 2015-05-20 2016-11-24 Boreal Genomics, Inc. Procédé pour isoler un acide nucléique cible à l'aide des protéines de liaison hétéroduplexes
WO2016189388A1 (fr) 2015-05-22 2016-12-01 Nipd Genetics Ltd Analyse parallèle multiplexée de régions génomiques ciblées pour des tests prénataux non invasifs
EP3118323A1 (fr) 2015-07-13 2017-01-18 Cartagenia N.V. Système et méthodologie pour l'analyse de données génomiques obtenues à partir d'un sujet
WO2017009372A2 (fr) 2015-07-13 2017-01-19 Cartagenia Nv Système et méthodologie pour l'analyse de données génomiques obtenues auprès d'un sujet
CA3014070C (fr) 2016-03-25 2023-03-14 Karius, Inc. Spike-ins d'acides nucleiques synthetiques
US10697008B2 (en) 2017-04-12 2020-06-30 Karius, Inc. Sample preparation methods, systems and compositions
US11342047B2 (en) 2017-04-21 2022-05-24 Illumina, Inc. Using cell-free DNA fragment size to detect tumor-associated variant
EP3649258B1 (fr) 2017-07-07 2022-05-04 Nipd Genetics Public Company Limited Analyse parallèle multiplexée enrichie en cible pour l'évaluation d'échantillons d'adn f tal
US20200157602A1 (en) 2017-07-07 2020-05-21 Nipd Genetics Public Company Limited Enrichment of targeted genomic regions for multiplexed parallel analysis
WO2019008167A1 (fr) 2017-07-07 2019-01-10 Nipd Genetics Public Company Limited Analyse parallèle multiplexée enrichie en cible pour évaluation du risque pour des troubles génétiques
WO2019008172A1 (fr) 2017-07-07 2019-01-10 Nipd Genetics Public Company Limited Analyse parallèle multiplexée enrichie en cible pour l'évaluation de biomarqueurs tumoraux
HUE055063T2 (hu) 2017-07-26 2021-10-28 Trisomytest S R O Eljárás magzati kromoszóma aneuploidia nem-invazív azonosítására születés elõtt anyai vérbõl Bayes-háló alapján
US11519024B2 (en) 2017-08-04 2022-12-06 Billiontoone, Inc. Homologous genomic regions for characterization associated with biological targets
CN111051511A (zh) 2017-08-04 2020-04-21 十亿至一公司 用于与生物靶相关的表征的靶相关分子
EP3662479A1 (fr) 2017-08-04 2020-06-10 Trisomytest, s.r.o. Procédé de détection prénatale non invasive d'anomalies chromosomiques du sexe du foetus et de détermination du sexe du foetus en vue d'une grossesse unique et d'une grossesse gémellaire
US11430543B2 (en) 2017-08-04 2022-08-30 Billiontoone, Inc. Sequencing output determination and analysis with target-associated molecules in quantification associated with biological targets
EP3735470B1 (fr) 2018-01-05 2023-11-22 BillionToOne, Inc. Modèles de contrôle de qualité pour garantir la validité d'essais à base d'un séquençage
JP2021520816A (ja) 2018-04-14 2021-08-26 ナテラ， インコーポレイテッド 循環腫瘍ｄｎａの個別化された検出を用いる癌検出およびモニタリングの方法
GB201810571D0 (en) 2018-06-27 2018-08-15 Cs Genetics Ltd Reagents and methods for the analysis of circulating microparticles
CA3118990A1 (fr) 2018-11-21 2020-05-28 Karius, Inc. Procedes, systemes et compositions de bibliotheque directe
WO2020131699A2 (fr) 2018-12-17 2020-06-25 Natera, Inc. Procédés d'analyse de cellules circulantes
CN109637586B (zh) * 2018-12-27 2020-11-17 北京优迅医学检验实验室有限公司 测序深度的矫正方法及装置
CN109628579B (zh) * 2019-01-13 2022-11-15 清华大学 一种确定生物体样本中染色体数量是否异常的检测方法
GB201909325D0 (en) 2019-06-28 2019-08-14 Cs Genetics Ltd Reagents and methods for analysis for microparticles
CN111755068B (zh) * 2020-06-19 2021-02-19 深圳吉因加医学检验实验室 基于测序数据识别肿瘤纯度和绝对拷贝数的方法及装置
AU2022261868A1 (en) 2021-04-22 2023-10-26 Natera, Inc. Methods for determining velocity of tumor growth
AU2022323972A1 (en) 2021-08-02 2024-01-25 Natera, Inc. Methods for detecting neoplasm in pregnant women
WO2023133131A1 (fr) 2022-01-04 2023-07-13 Natera, Inc. Procédés de détection et de suivi du cancer

Citations (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5296375A (en) * 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5486335A (en) * 1992-05-01 1996-01-23 Trustees Of The University Of Pennsylvania Analysis based on flow restriction
US5498392A (en) * 1992-05-01 1996-03-12 Trustees Of The University Of Pennsylvania Mesoscale polynucleotide amplification device and method
US5707799A (en) * 1994-09-30 1998-01-13 Abbott Laboratories Devices and methods utilizing arrays of structures for analyte capture
US5709943A (en) * 1995-05-04 1998-01-20 Minnesota Mining And Manufacturing Company Biological adsorption supports
US5715946A (en) * 1995-06-07 1998-02-10 Reichenbach; Steven H. Method and apparatus for sorting particles suspended in a fluid
US5726026A (en) * 1992-05-01 1998-03-10 Trustees Of The University Of Pennsylvania Mesoscale sample preparation device and systems for determination and processing of analytes
US5858649A (en) * 1992-07-17 1999-01-12 Aprogenex, Inc. Amplification of mRNA for distinguishing fetal cells in maternal blood
US5866345A (en) * 1992-05-01 1999-02-02 The Trustees Of The University Of Pennsylvania Apparatus for the detection of an analyte utilizing mesoscale flow systems
US5879883A (en) * 1991-10-03 1999-03-09 Indiana University Foundation Method for screening for alzheimer's disease
US6013188A (en) * 1996-06-07 2000-01-11 Immunivest Corporation Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force
US6176962B1 (en) * 1990-02-28 2001-01-23 Aclara Biosciences, Inc. Methods for fabricating enclosed microchannel structures
US6184043B1 (en) * 1992-09-14 2001-02-06 FODSTAD øYSTEIN Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations
US6186660B1 (en) * 1997-10-09 2001-02-13 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6197523B1 (en) * 1997-11-24 2001-03-06 Robert A. Levine Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood
US6200765B1 (en) * 1998-05-04 2001-03-13 Pacific Northwest Cancer Foundation Non-invasive methods to detect prostate cancer
US20020006621A1 (en) * 1989-11-13 2002-01-17 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
US20020009738A1 (en) * 2000-04-03 2002-01-24 Houghton Raymond L. Methods, compositions and kits for the detection and monitoring of breast cancer
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20020012931A1 (en) * 2000-03-27 2002-01-31 Waldman Scott A. High specificity marker detection
US6344326B1 (en) * 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
US20020016450A1 (en) * 1997-10-31 2002-02-07 Bbi Bioseq, Inc., A Masachusetts Corporation Pressure-enhanced extraction and purification
US20020019001A1 (en) * 1999-10-15 2002-02-14 Ventana Medical Systems, Inc. Method of detecting single gene copies in-situ
US20020028431A1 (en) * 1998-08-25 2002-03-07 Julien Jean-Claude Bisconte De Saint Process, device and reagent for cell separation
US6361958B1 (en) * 1999-11-12 2002-03-26 Motorola, Inc. Biochannel assay for hybridization with biomaterial
US20030004402A1 (en) * 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20030017514A1 (en) * 2001-06-02 2003-01-23 Katharina Pachmann Method for quantitative detection of vital epithelial tumor cells in a body fluid
US6511967B1 (en) * 1999-04-23 2003-01-28 The General Hospital Corporation Use of an internalizing transferrin receptor to image transgene expression
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US20030033091A1 (en) * 2001-04-20 2003-02-13 Sequenom, Inc. Systems and methods for testing a biological sample
US20030044388A1 (en) * 2001-08-31 2003-03-06 The Chinese University Of Hong Kong Methods for detecting DNA originating from different individuals
US6673541B1 (en) * 1998-09-18 2004-01-06 Micromet Ag DNA amplification of a single cell
US6674525B2 (en) * 2001-04-03 2004-01-06 Micronics, Inc. Split focusing cytometer
US20040005582A1 (en) * 2000-08-10 2004-01-08 Nanobiodynamics, Incorporated Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators
US20040009471A1 (en) * 2002-04-25 2004-01-15 Bo Cao Methods and kits for detecting a target cell
US20040018116A1 (en) * 2002-07-26 2004-01-29 Desmond Sean M. Microfluidic size-exclusion devices, systems, and methods
US6685841B2 (en) * 2001-02-14 2004-02-03 Gabriel P. Lopez Nanostructured devices for separation and analysis
US6689615B1 (en) * 2000-10-04 2004-02-10 James Murto Methods and devices for processing blood samples
US20040037470A1 (en) * 2002-08-23 2004-02-26 Simske Steven J. Systems and methods for processing text-based electronic documents
US20040043506A1 (en) * 2002-08-30 2004-03-04 Horst Haussecker Cascaded hydrodynamic focusing in microfluidic channels
US20040048360A1 (en) * 1999-08-26 2004-03-11 Caliper Technologies Corp. Microfluidic analytic detection assays, devices, and integrated systems
US20040053352A1 (en) * 1998-09-28 2004-03-18 Tianmei Ouyang Diagnostics based on tetrazolium compounds
US20050014208A1 (en) * 2001-09-06 2005-01-20 Alf-Andreas Krehan Method and kit for diagnosing or controlling the treatment of breast cancer
US20050019792A1 (en) * 2001-11-30 2005-01-27 Fluidigm Corporation Microfluidic device and methods of using same
US20050037388A1 (en) * 2001-06-22 2005-02-17 University Of Geneva Method for detecting diseases caused by chromosomal imbalances
US6858439B1 (en) * 1999-03-15 2005-02-22 Aviva Biosciences Compositions and methods for separation of moieties on chips
US20050042623A1 (en) * 2002-10-30 2005-02-24 Dana Ault-Riche Systems for capture and analysis of biological particles and methods using the systems
US20050042685A1 (en) * 2001-09-06 2005-02-24 Winfried Albert Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells
US20050049793A1 (en) * 2001-04-30 2005-03-03 Patrizia Paterlini-Brechot Prenatal diagnosis method on isolated foetal cell of maternal blood
US20050061962A1 (en) * 2003-07-31 2005-03-24 Arryx, Inc. Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components
US20050221341A1 (en) * 2003-10-22 2005-10-06 Shimkets Richard A Sequence-based karyotyping
US20060000772A1 (en) * 2002-11-29 2006-01-05 Toru Sano Separation apparatus and separation method
US20060008807A1 (en) * 2002-08-23 2006-01-12 O'hara Shawn M Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample
US20060008824A1 (en) * 2004-05-20 2006-01-12 Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US20060024756A1 (en) * 2002-02-14 2006-02-02 Arjan Tibbe Methods and algorithms for cell enumeration in low-cost cytometer
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20060051265A1 (en) * 2004-09-08 2006-03-09 Health Research, Inc. Apparatus and method for sorting microstructures in a fluid medium
US20060060767A1 (en) * 2001-04-27 2006-03-23 Wang Mark M Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles
US20070017633A1 (en) * 2005-03-23 2007-01-25 Tonkovich Anna L Surface features in microprocess technology
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026419A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US7171975B2 (en) * 2002-02-12 2007-02-06 Kionix, Inc. Fabrication of ultra-shallow channels for microfluidic devices and systems
US20070037172A1 (en) * 2005-08-11 2007-02-15 Chiu Daniel T Separation and concentration of biological cells and biological particles using a one-dimensional channel
US20070037173A1 (en) * 2005-08-12 2007-02-15 Allard Jeffrey W Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients
US20070037275A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20070042360A1 (en) * 2001-09-17 2007-02-22 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20070042339A1 (en) * 2003-08-08 2007-02-22 Massachusetts General Hospital Preservation of biomaterials with transported preservation agents
US20070042368A1 (en) * 2003-03-24 2007-02-22 Corixa Corporation Detection and monitoring of lung cancer
US20070042238A1 (en) * 2005-08-22 2007-02-22 Lg Electronics Inc. Fuel cell having water type radiating device
US20070048750A1 (en) * 2005-09-01 2007-03-01 National Health Research Institute Rapid efficacy assessment method for lung cancer therapy
US20070054287A1 (en) * 2005-05-31 2007-03-08 Applera Corporation Method for identifying medically important cell populations using micro rna as tissue specific biomarkers
US20070054268A1 (en) * 2002-09-05 2007-03-08 Robert Sutherland Methods of diagnosis and prognosis of ovarian cancer
US20070059680A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for cell enrichment
US20070059683A1 (en) * 2005-09-15 2007-03-15 Tom Barber Veterinary diagnostic system
US20070059718A1 (en) * 2005-09-15 2007-03-15 Mehmet Toner Systems and methods for enrichment of analytes
US20070059719A1 (en) * 2005-09-15 2007-03-15 Michael Grisham Business methods for prenatal Diagnosis
US20070059716A1 (en) * 2005-09-15 2007-03-15 Ulysses Balis Methods for detecting fetal abnormality
US20080020390A1 (en) * 2006-02-28 2008-01-24 Mitchell Aoy T Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms
US20080026390A1 (en) * 2006-06-14 2008-01-31 Roland Stoughton Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis
US20080023399A1 (en) * 2006-06-01 2008-01-31 Inglis David W Apparatus and method for continuous particle separation
US20080038733A1 (en) * 2006-03-28 2008-02-14 Baylor College Of Medicine Screening for down syndrome
US7332277B2 (en) * 2002-03-01 2008-02-19 Ravgen, Inc. Methods for detection of genetic disorders
US20080050739A1 (en) * 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US7476363B2 (en) * 2003-04-03 2009-01-13 Fluidigm Corporation Microfluidic devices and methods of using same
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US20090117538A1 (en) * 2003-12-01 2009-05-07 Hashimoto Shin-Ichi Methods for Obtaining Gene Tags
US7645576B2 (en) * 2005-03-18 2010-01-12 The Chinese University Of Hong Kong Method for the detection of chromosomal aneuploidies
US7655399B2 (en) * 2003-10-08 2010-02-02 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities

Family Cites Families (329)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4508625A (en) 1982-10-18 1985-04-02 Graham Marshall D Magnetic separation using chelated magnetic ions
US4675286A (en) 1985-01-28 1987-06-23 Aspen Diagnostics, Inc. Fetal cell separation and testing
US5164598A (en) 1985-08-05 1992-11-17 Biotrack Capillary flow device
US7115709B1 (en) 1986-01-16 2006-10-03 The Regents Of The University Of California Methods of staining target chromosomal DNA employing high complexity nucleic acid probes
US5721098A (en) 1986-01-16 1998-02-24 The Regents Of The University Of California Comparative genomic hybridization
US4789628A (en) 1986-06-16 1988-12-06 Vxr, Inc. Devices for carrying out ligand/anti-ligand assays, methods of using such devices and diagnostic reagents and kits incorporating such devices
US4971904A (en) 1987-06-26 1990-11-20 E. I. Du Pont De Nemours And Company Heterogeneous immunoassay
US4977078A (en) 1987-12-22 1990-12-11 Olympus Optical Co., Ltd. Plate substrate immunoassay device and method for performing a multi-test immunoassay on a specimen
CA1339210C (fr) 1988-05-31 1997-08-05 John Lewicki Techniques recombinantes pour la production de nouveaux natriuretiques et de peptides vasodilatateurs
US5215926A (en) 1988-06-03 1993-06-01 Cellpro, Inc. Procedure for designing efficient affinity cell separation processes
ATE161960T1 (de) 1988-12-06 1998-01-15 Flinders Technologies Pty Ltd Isolierung von fetalen zellen aus mütterlichem blut zur ausführung von pränataler diagnostik
CA1340565C (fr) 1989-06-29 1999-05-25 Thomas B. Okarma Dispositif et methode pour capter et recuperer des cellules
AU658132B2 (en) 1989-11-13 1995-04-06 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
US5770029A (en) 1996-07-30 1998-06-23 Soane Biosciences Integrated electrophoretic microdevices
US5153117A (en) 1990-03-27 1992-10-06 Genetype A.G. Fetal cell recovery method
CA2081203A1 (fr) 1990-04-23 1991-10-24 Ronald J. Berenson Methode permettant d'enrichir les cellules d'un foetus a partir du sang maternel
US5646001A (en) 1991-03-25 1997-07-08 Immunivest Corporation Affinity-binding separation and release of one or more selected subset of biological entities from a mixed population thereof
US5304487A (en) 1992-05-01 1994-04-19 Trustees Of The University Of Pennsylvania Fluid handling in mesoscale analytical devices
EP0637996B1 (fr) 1992-05-01 1997-07-23 The Trustees Of The University Of Pennsylvania Structures de detection micro-usinees
US6156270A (en) 1992-05-21 2000-12-05 Biosite Diagnostics, Inc. Diagnostic devices and apparatus for the controlled movement of reagents without membranes
US6143576A (en) 1992-05-21 2000-11-07 Biosite Diagnostics, Inc. Non-porous diagnostic devices for the controlled movement of reagents
WO1994003638A1 (fr) 1992-07-30 1994-02-17 Applied Biosystems, Inc. Methode de detection d'aneuploidie au moyen de repetitions courtes en tandem amplifiees
DE4244715C2 (de) 1992-08-26 1995-06-14 Kuebler Gmbh Dr Verfahren zur Herstellung individuum-spezifischer, gegen Tumorantigene gerichtete monoklonale Antikörper
US6953668B1 (en) 1992-11-05 2005-10-11 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen
EP1757694A3 (fr) 1992-11-05 2008-02-27 Sloan Kettering Institute For Cancer Research Antigene de membrane spécifique à la prostate
US5427663A (en) 1993-06-08 1995-06-27 British Technology Group Usa Inc. Microlithographic array for macromolecule and cell fractionation
US5556773A (en) 1993-08-06 1996-09-17 Yourno; Joseph Method and apparatus for nested polymerase chain reaction (PCR) with single closed reaction tubes
AU7921194A (en) 1993-09-27 1995-04-18 Oncor, Inc. Methods for detecting and analyzing individual rare cells in a population
US5432054A (en) 1994-01-31 1995-07-11 Applied Imaging Method for separating rare cells from a population of cells
US5798042A (en) 1994-03-07 1998-08-25 Regents Of The University Of California Microfabricated filter with specially constructed channel walls, and containment well and capsule constructed with such filters
NO180658C (no) 1994-03-10 1997-05-21 Oeystein Fodstad Fremgangsmåte og anordning for deteksjon av spesifikke målceller i spesialiserte eller blandede cellepopulasjoner og opplösninger som inneholder blandede cellepopulasjoner
US5962332A (en) 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
US5840502A (en) 1994-08-31 1998-11-24 Activated Cell Therapy, Inc. Methods for enriching specific cell-types by density gradient centrifugation
US5662813A (en) 1994-10-21 1997-09-02 Bioseparations, Inc. Method for separation of nucleated fetal erythrocytes from maternal blood samples
WO1996014934A1 (fr) 1994-11-14 1996-05-23 Trustees Of The University Of Pennsylvania Dispositif de preparation d'echantillons mesoechelle et systemes pour la determination et le traitement des analysats
US5750339A (en) 1994-11-30 1998-05-12 Thomas Jefferson University Methods for identifying fetal cells
DE69635801T2 (de) 1995-02-24 2006-11-02 Sloan-Kettering Institute For Cancer Research Prostataspezifisches membranes antigen und seine anwendungen
US5639669A (en) 1995-06-07 1997-06-17 Ledley; Robert Separation of fetal cells from maternal blood
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
DE19681033D2 (de) 1995-11-16 1999-03-18 Michael W Dahm Verfahren zur Quantifizierung von Tumorzellen in einer Körperflüssigkeit und dazu geeignete Testkits
US20030119724A1 (en) 1995-11-22 2003-06-26 Ts`O Paul O.P. Ligands to enhance cellular uptake of biomolecules
WO1997020563A1 (fr) 1995-11-22 1997-06-12 The Johns-Hopkins University Ligands servant a amplifier l'absorption cellulaire de biomolecules
US6718053B1 (en) 1996-11-27 2004-04-06 Chromavision Medical Systems, Inc. Method and apparatus for automated image analysis of biological specimens
NO961031D0 (no) 1996-03-13 1996-03-13 Det Norske Radiumshospital Tum Fremgangsmåte til å drepe uönskede målceller
US5972721A (en) 1996-03-14 1999-10-26 The United States Of America As Represented By The Secretary Of The Air Force Immunomagnetic assay system for clinical diagnosis and other purposes
CA2248981C (fr) 1996-03-15 2009-11-24 The Penn State Research Foundation Detection d'acide nucleique extracellulaire lie a des tumeurs dans le plasma ou le serum sanguin a l'aide d'essais d'amplification d'acide nucleique
US5891651A (en) 1996-03-29 1999-04-06 Mayo Foundation For Medical Education And Research Methods of recovering colorectal epithelial cells or fragments thereof from stool
US7297331B2 (en) 1996-04-03 2007-11-20 The Rogosin Institute Beads containing restricted cancer cells producing material suppressing cancer cell proliferation
EP0891550A1 (fr) 1996-04-05 1999-01-20 The Johns Hopkins University School Of Medicine Procede d'enrichissement de cellules rares
US6387707B1 (en) 1996-04-25 2002-05-14 Bioarray Solutions Array Cytometry
US6958245B2 (en) 1996-04-25 2005-10-25 Bioarray Solutions Ltd. Array cytometry
US6890426B2 (en) 1996-06-07 2005-05-10 Immunivest Corporation Magnetic separation apparatus and methods
NZ333346A (en) 1996-06-28 2000-03-27 Caliper Techn Corp High-throughput screening assay systems in microscale fluidic devices
IT1294964B1 (it) 1996-07-12 1999-04-23 Domenico Valerio Isolamento e cultura di cellule fetali dal sangue periferico materno
US6100029A (en) 1996-08-14 2000-08-08 Exact Laboratories, Inc. Methods for the detection of chromosomal aberrations
US6300077B1 (en) 1996-08-14 2001-10-09 Exact Sciences Corporation Methods for the detection of nucleic acids
AU4164597A (en) 1996-08-26 1998-03-19 Princeton University Reversibly sealable microstructure sorting devices
DE69709377T2 (de) 1996-09-04 2002-08-14 Scandinavian Micro Biodevices Mikrofliesssystem für die teilchenanalyse und trennung
GB9620209D0 (en) 1996-09-27 1996-11-13 Cemu Bioteknik Ab Method of sequencing DNA
NO308755B1 (no) 1996-12-20 2000-10-23 Iystein Fodstad FremgangsmÕte til karakterisering av unormale celler, anvendelse og sett for utførelse av fremgangsmÕten
US6235474B1 (en) 1996-12-30 2001-05-22 The Johns Hopkins University Methods and kits for diagnosing and determination of the predisposition for diseases
US6008007A (en) 1997-01-31 1999-12-28 Oncotech, Inc. Radiation resistance assay for predicting treatment response and clinical outcome
GB9704444D0 (en) 1997-03-04 1997-04-23 Isis Innovation Non-invasive prenatal diagnosis
US20010051341A1 (en) 1997-03-04 2001-12-13 Isis Innovation Limited Non-invasive prenatal diagnosis
US6623983B1 (en) 1997-03-25 2003-09-23 Immunivest Corporation Apparatus and methods for capture and analysis of particulate entities
US6391622B1 (en) 1997-04-04 2002-05-21 Caliper Technologies Corp. Closed-loop biochemical analyzers
WO1998046645A2 (fr) 1997-04-14 1998-10-22 Micromet Gesellschaft Für Biomedizinische Forschung Mbh Nouveau procede de production de recepteurs d'anti-antigenes humains et leur utilisation
US6066449A (en) 1997-04-15 2000-05-23 The Trustees Of Columbia University In The City Of New York Method of detecting metastatic thyroid cancer
US6143496A (en) 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
WO1998049344A1 (fr) 1997-04-28 1998-11-05 Lockheed Martin Energy Research Corporation Methode et appareil d'analyse d'acides nucleiques
US6632619B1 (en) 1997-05-16 2003-10-14 The Governors Of The University Of Alberta Microfluidic system and methods of use
US6156273A (en) 1997-05-27 2000-12-05 Purdue Research Corporation Separation columns and methods for manufacturing the improved separation columns
US6566101B1 (en) 1997-06-16 2003-05-20 Anthony P. Shuber Primer extension methods for detecting nucleic acids
US6294331B1 (en) 1997-08-08 2001-09-25 The United States Of America As Represented By The Department Of Health And Human Services Methods for assessing genetic and phenotypic markers by simultaneous multicolor visualization of chromogenic dyes using brightfield microscopy and spectral imaging
US6368871B1 (en) 1997-08-13 2002-04-09 Cepheid Non-planar microstructures for manipulation of fluid samples
US6540895B1 (en) 1997-09-23 2003-04-01 California Institute Of Technology Microfabricated cell sorter for chemical and biological materials
US5962234A (en) 1997-10-20 1999-10-05 Applied Imaging Corporation Use of anti-embryonic epsilon hemoglobin antibodies to identify fetal cells
US6120985A (en) 1997-10-31 2000-09-19 Bbi Bioseq, Inc. Pressure-enhanced extraction and purification
CA2253965C (fr) 1997-11-22 2003-01-21 Robert A. Levine Methode de detection, d'identification, de denombrement et de confirmaton de cellules cancereuses en circulation et\ou de cellules souches hematologiques dans le sang total
ATE469982T1 (de) 1998-02-04 2010-06-15 Life Technologies Corp Bestimmung des genotyps eines amplifikationsproduktes an mehreren allelen stellen
US20020172987A1 (en) 1998-02-12 2002-11-21 Terstappen Leon W.M.M. Methods and reagents for the rapid and efficient isolation of circulating cancer cells
JP2002503814A (ja) 1998-02-12 2002-02-05 イムニベスト・コーポレイション 循環ガン細胞の迅速かつ効率的な単離のための方法および試薬
WO1999044064A1 (fr) 1998-02-27 1999-09-02 Cli Oncology, Inc. Methode et compositions de detection differentielle de cellules tumorales et de cellules metastatiques
GB9805918D0 (en) 1998-03-19 1998-05-13 Nycomed Amersham Plc Sequencing by hybridisation
US20070092917A1 (en) 1998-05-01 2007-04-26 Isabelle Guyon Biomarkers for screening, predicting, and monitoring prostate disease
ATE530891T1 (de) 1998-05-22 2011-11-15 California Inst Of Techn Miniaturisierter zellsortierer
US6897073B2 (en) 1998-07-14 2005-05-24 Zyomyx, Inc. Non-specific binding resistant protein arrays and methods for making the same
US6576478B1 (en) 1998-07-14 2003-06-10 Zyomyx, Inc. Microdevices for high-throughput screening of biomolecules
US6245227B1 (en) 1998-09-17 2001-06-12 Kionix, Inc. Integrated monolithic microfabricated electrospray and liquid chromatography system and method
US6637463B1 (en) 1998-10-13 2003-10-28 Biomicro Systems, Inc. Multi-channel microfluidic system design with balanced fluid flow distribution
JP2002529704A (ja) 1998-10-29 2002-09-10 セル ワークス インコーポレイテッド 単一細胞の複数マーカー特徴付け
DE69939599D1 (de) 1998-12-16 2008-10-30 Novartis Vaccines & Diagnostic MENSCHLICHE CYCLIN-ABHÄNGIGE KINASE (hPNQALRE)
US6887693B2 (en) 1998-12-24 2005-05-03 Cepheid Device and method for lysing cells, spores, or microorganisms
GB9828785D0 (en) 1998-12-30 1999-02-17 Amersham Pharm Biotech Ab Sequencing systems
WO2000047998A1 (fr) 1999-02-10 2000-08-17 Cell Works Inc. Caracterisation de classes de cellules cancereuses circulantes isolees a partir de fluides corporels et methodes d'utilisation
AU3567900A (en) * 1999-03-30 2000-10-16 Solexa Ltd. Polynucleotide sequencing
US6942771B1 (en) 1999-04-21 2005-09-13 Clinical Micro Sensors, Inc. Microfluidic systems in the electrochemical detection of target analytes
US6994969B1 (en) 1999-04-30 2006-02-07 Methexis Genomics, N.V. Diagnostic sequencing by a combination of specific cleavage and mass spectrometry
US7166573B1 (en) 1999-05-28 2007-01-23 Ludwig Institute For Cancer Research Breast, gastric and prostate cancer associated antigens and uses therefor
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
US7192698B1 (en) 1999-08-17 2007-03-20 Purdue Research Foundation EphA2 as a diagnostic target for metastatic cancer
US6692952B1 (en) 1999-11-10 2004-02-17 Massachusetts Institute Of Technology Cell analysis and sorting apparatus for manipulation of cells
AU1592501A (en) 1999-11-10 2001-06-06 Massachusetts Institute Of Technology Cell analysis and sorting apparatus for manipulation of cells
US20060128006A1 (en) 1999-11-10 2006-06-15 Gerhardt Antimony L Hydrodynamic capture and release mechanisms for particle manipulation
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
WO2001037192A1 (fr) 1999-11-18 2001-05-25 Ikonisys, Inc. Procede et appareil, commandes par ordinateur, pour le diagnostic en fonction d'une cellule
WO2001051668A1 (fr) 2000-01-13 2001-07-19 Immunivest Corporation Echantillons ferrofluides
EP1257664A4 (fr) 2000-01-28 2006-04-05 Althea Technologies Inc Procedes d'analyse de l'expression genique
US20030170631A1 (en) 2000-04-03 2003-09-11 Corixa Corporation Methods, compositions and kits for the detection and monitoring of breast cancer
US7510834B2 (en) * 2000-04-13 2009-03-31 Hidetoshi Inoko Gene mapping method using microsatellite genetic polymorphism markers
US7641856B2 (en) 2004-05-14 2010-01-05 Honeywell International Inc. Portable sample analyzer with removable cartridge
US6984522B2 (en) 2000-08-03 2006-01-10 Regents Of The University Of Michigan Isolation and use of solid tumor stem cells
EP1309863A1 (fr) 2000-08-08 2003-05-14 Aviva Biosciences Corporation Techniques de manipulations de fragments dans des systemes microfluidiques
US6610499B1 (en) 2000-08-31 2003-08-26 The Regents Of The University Of California Capillary array and related methods
GB0021617D0 (en) 2000-09-02 2000-10-18 Imp College Innovations Ltd Diagnosis and treatment of cancer
JP5433840B2 (ja) 2000-09-09 2014-03-05 ザ・リサーチ・ファウンデーション・フォー・ザ・ステイト・ユニヴァーシティ・オブ・ニューヨーク 転移癌細胞を単離するための方法および組成物、ならびに癌の転移能の測定におけるその使用
US20020164825A1 (en) 2000-09-09 2002-11-07 Wen-Tien Chen Cell separation matrix
AU2001290879A1 (en) 2000-09-15 2002-03-26 California Institute Of Technology Microfabricated crossflow devices and methods
WO2002028523A2 (fr) 2000-09-30 2002-04-11 Aviva Biosciences Corporation Appareils comprenant plusieurs elements generateurs de forces et utilisations associees
CA2424996A1 (fr) 2000-10-09 2002-04-18 Aviva Biosciences Corporation Compositions et procedes de separation de fractions sur des puces
EP1328342A4 (fr) 2000-10-10 2006-03-15 Aviva Biosciences Corp Syst me biopuce int gr e pour la pr paration et l'analyse d' chantillons
US6664056B2 (en) 2000-10-17 2003-12-16 The Chinese University Of Hong Kong Non-invasive prenatal monitoring
WO2002055985A2 (fr) 2000-11-15 2002-07-18 Roche Diagnostics Corp Methodes et reactifs permettant d'identifier des cellules embryonnaires rares dans le systeme circulatoire maternel
US6495340B2 (en) 2000-11-28 2002-12-17 Medis El Ltd. Cell carrier grids
AU2002217980A1 (en) 2000-12-01 2002-06-11 Cell Works Inc. Conjugates of glycosylated/galactosylated peptide
US6770434B2 (en) 2000-12-29 2004-08-03 The Provost, Fellows And Scholars Of The College Of The Holy & Undivided Trinity Of Queen Elizabeth Near Dublin Biological assay method
US6993169B2 (en) 2001-01-11 2006-01-31 Trestle Corporation System and method for finding regions of interest for microscopic digital montage imaging
EP1388013B1 (fr) 2001-01-18 2007-07-11 The Regents Of The University Of Michigan Compositions et methodes destinees a l'utilisation de fragments de fibronectine dans le diagnostic du cancer
US20020110835A1 (en) 2001-02-13 2002-08-15 Rajan Kumar Microfluidic devices and methods
US6913697B2 (en) 2001-02-14 2005-07-05 Science & Technology Corporation @ Unm Nanostructured separation and analysis devices for biological membranes
GB0104690D0 (en) 2001-02-26 2001-04-11 Cytogenetic Dna Services Ltd Diagnostic test
US20050196785A1 (en) 2001-03-05 2005-09-08 California Institute Of Technology Combinational array for nucleic acid analysis
US20030190602A1 (en) 2001-03-12 2003-10-09 Monogen, Inc. Cell-based detection and differentiation of disease states
CN1554025A (zh) 2001-03-12 2004-12-08 Īŵ���ɷ����޹�˾ 患病状态的细胞为基础的检测和鉴别
US20020164816A1 (en) 2001-04-06 2002-11-07 California Institute Of Technology Microfluidic sample separation device
US6960437B2 (en) 2001-04-06 2005-11-01 California Institute Of Technology Nucleic acid amplification utilizing microfluidic devices
US7262030B2 (en) 2001-05-09 2007-08-28 Virginia Commonwealth University Multiple sequencible and ligatible structures for genomic analysis
US20020166760A1 (en) 2001-05-11 2002-11-14 Prentiss Mara G. Micromagentic systems and methods for microfluidics
US7118907B2 (en) 2001-06-06 2006-10-10 Li-Cor, Inc. Single molecule detection systems and methods
US7189507B2 (en) 2001-06-18 2007-03-13 Pdl Biopharma, Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
US7381535B2 (en) 2002-07-10 2008-06-03 The Board Of Trustees Of The Leland Stanford Junior Methods and compositions for detecting receptor-ligand interactions in single cells
US6783928B2 (en) 2001-07-17 2004-08-31 Georgi Hvichia Microstructures for cell proliferation assays and semen analysis
US7993908B2 (en) 2001-07-17 2011-08-09 Parsortix, Inc. Microstructure for particle and cell separation, identification, sorting, and manipulation
EP1425383A4 (fr) 2001-08-23 2005-11-09 Immunivest Corp Stabilisation de cellules et de specimens biologiques pour l'analyse
US7863012B2 (en) 2004-02-17 2011-01-04 Veridex, Llc Analysis of circulating tumor cells, fragments, and debris
AUPR749901A0 (en) 2001-09-06 2001-09-27 Monash University Method of identifying chromosomal abnormalities and prenatal diagnosis
EP1409745B1 (fr) 2001-09-06 2007-04-11 Adnagen AG Procede et necessaire destines au diagnostic ou au controle du traitement du cancer de l'intestin
US7202045B2 (en) 2001-09-19 2007-04-10 Regents Of The University Of Michigan Detection and treatment of cancers of the lung
WO2003025543A2 (fr) 2001-09-21 2003-03-27 The Regents Of The University Of California Methode de cytodiagnostic de stadification de neoplasie et de carcinome de cellules squameuses
US7166443B2 (en) 2001-10-11 2007-01-23 Aviva Biosciences Corporation Methods, compositions, and automated systems for separating rare cells from fluid samples
US8986944B2 (en) 2001-10-11 2015-03-24 Aviva Biosciences Corporation Methods and compositions for separating rare cells from fluid samples
US20030072682A1 (en) 2001-10-11 2003-04-17 Dan Kikinis Method and apparatus for performing biochemical testing in a microenvironment
US8980568B2 (en) 2001-10-11 2015-03-17 Aviva Biosciences Corporation Methods and compositions for detecting non-hematopoietic cells from a blood sample
WO2003031938A2 (fr) 2001-10-11 2003-04-17 Aviva Biosciences Corporation Methodes, compositions, et systemes automatises pour la separation des cellules rares provenant d'echantillons de fluides
US7262269B2 (en) 2001-10-26 2007-08-28 The Regents Of University Of California Method for screening combinational bead library; ligands for cancer cells
BR0213520A (pt) 2001-10-26 2006-05-23 Immunivest Corp método para diagnosticar a gravidade de uma doença em um indivìduo de teste, e, kit de teste para triagem de uma amostra de paciente quanto à presença de células cancerosas circulantes
US20030232350A1 (en) 2001-11-13 2003-12-18 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20050244843A1 (en) 2001-11-16 2005-11-03 Wen-Tien Chen Blood test prototypes and methods for the detection of circulating tumor and endothelial cells
CA2467248A1 (fr) 2001-11-20 2003-05-30 Exact Sciences Corporation Procedes et dispositifs de preparation automatisee d'echantillon
AU2002219137A1 (en) 2001-11-22 2003-06-10 Adnagen Ag Diagnosis kit, dna chip, and methods for diagnosing or supervising the treatment of testicular cancer
EP1463796B1 (fr) 2001-11-30 2013-01-09 Fluidigm Corporation Dispositif microfluidique et procedes d'utilisation de ce dernier
CN100468058C (zh) 2001-12-11 2009-03-11 株式会社奈特克 血细胞分离体系
WO2003060486A1 (fr) 2002-01-10 2003-07-24 Board Of Regents, The University Of Texas System Systeme de tri de flux et procedes associes
US7383134B2 (en) 2002-01-15 2008-06-03 Piper James R Method and/or system for analyzing biological samples using a computer system
AU2003216175A1 (en) 2002-02-04 2003-09-02 Colorado School Of Mines Laminar flow-based separations of colloidal and cellular particles
US7764821B2 (en) 2002-02-14 2010-07-27 Veridex, Llc Methods and algorithms for cell enumeration in a low-cost cytometer
US7893248B2 (en) * 2002-02-20 2011-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
EP2258872B1 (fr) 2002-03-13 2013-08-14 Genomic Health, Inc. Profilage de l'expression génétique dans des tissus de tumeurs prélevées par biopsie
US7223371B2 (en) 2002-03-14 2007-05-29 Micronics, Inc. Microfluidic channel network device
US7214427B2 (en) 2002-03-21 2007-05-08 Aviva Biosciences Corporation Composite beads comprising magnetizable substance and electro-conductive substance
US7312085B2 (en) 2002-04-01 2007-12-25 Fluidigm Corporation Microfluidic particle-analysis systems
US20040241707A1 (en) 2002-04-01 2004-12-02 Gao Chun L. Enhanced diagnostic potential of prostate-specific antigen expressing cells
AU2003234459A1 (en) 2002-05-03 2003-11-17 Immunivest Corporation Device and method for analytical cell imaging
US20070178478A1 (en) 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
US7442506B2 (en) 2002-05-08 2008-10-28 Ravgen, Inc. Methods for detection of genetic disorders
US7727720B2 (en) 2002-05-08 2010-06-01 Ravgen, Inc. Methods for detection of genetic disorders
US7272252B2 (en) 2002-06-12 2007-09-18 Clarient, Inc. Automated system for combining bright field and fluorescent microscopy
US7220594B2 (en) 2002-07-08 2007-05-22 Innovative Micro Technology Method and apparatus for sorting particles with a MEMS device
US6838056B2 (en) 2002-07-08 2005-01-04 Innovative Micro Technology Method and apparatus for sorting biological cells with a MEMS device
US7229838B2 (en) 2002-07-08 2007-06-12 Innovative Micro Technology MEMS actuator and method of manufacture for MEMS particle sorting device
US7252976B2 (en) 2002-08-28 2007-08-07 Board Of Regents The University Of Texas System Quantitative RT-PCR to AC133 to diagnose cancer and monitor angiogenic activity in a cell sample
AU2003273921A1 (en) 2002-09-27 2004-04-19 Oridis Biomed Forschungs-Und Entwicklungs Gmbh Polypeptides and nucleic acids encoding these and their use for the prevention,diagnosis or treatment of liver disorders and epithelial cancer
ES2375724T3 (es) 2002-09-27 2012-03-05 The General Hospital Corporation Dispositivo microflu�?dico para seperación de células y sus usos.
WO2004037374A2 (fr) 2002-10-23 2004-05-06 The Trustees Of Princeton University Procede de separation continue de particules faisant appel a des reseaux d'obstacles alignes de maniere asymetrique par rapport a des champs
US6811385B2 (en) 2002-10-31 2004-11-02 Hewlett-Packard Development Company, L.P. Acoustic micro-pump
AU2002952696A0 (en) 2002-11-14 2002-11-28 Genomics Research Partners Pty Ltd Status determination
US7704687B2 (en) 2002-11-15 2010-04-27 The Johns Hopkins University Digital karyotyping
DE10259703A1 (de) 2002-12-19 2004-07-08 Ivonex Gmbh Trennungsverfahren
CN101245376A (zh) 2003-01-17 2008-08-20 香港中文大学 作为妊娠相关病症的诊断标志物的循环mRNA
US6746503B1 (en) 2003-01-30 2004-06-08 The Regents Of The University Of California Precision gap particle separator
WO2004077021A2 (fr) 2003-02-27 2004-09-10 Lesko Stephen A Evaluation normalisee de l'efficacite therapeutique fondee sur des marqueurs biologiques cellulaires
CA2516795C (fr) 2003-02-27 2013-01-15 Immunivest Corporation Cellules tumorales circulantes (ctc) : evaluation precoce du delai avant progression, de la survie et de la reponse au traitement chez les patientes atteintes d'un cancer metastatique
WO2004078999A1 (fr) 2003-03-05 2004-09-16 Genetic Technologies Limited Identification d'adn foetal et de marqueurs de cellule foetale dans du plasma ou du serum maternel
EP1606417A2 (fr) 2003-03-07 2005-12-21 Rubicon Genomics Inc. Immortalisation d'adn in vitro et amplification genomique complete a l'aide de bibliotheques generees a partir d'adn fragmente de maniere aleatoire
DE10313201A1 (de) 2003-03-21 2004-10-07 Steag Microparts Gmbh Mikrostrukturierte Trennvorrichtung und mikrofluidisches Verfahren zum Abtrennen von flüssigen Bestandteilen aus einer Flüssigkeit, die Partikel enthält
AU2003901671A0 (en) 2003-04-02 2003-05-01 The University Of Adelaide Comparative genomic hybridization
AU2004228678A1 (en) 2003-04-03 2004-10-21 Fluidigm Corp. Microfluidic devices and methods of using same
US20050145496A1 (en) 2003-04-03 2005-07-07 Federico Goodsaid Thermal reaction device and method for using the same
WO2004087757A2 (fr) 2003-04-03 2004-10-14 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Produits therapeutiques a capacite amelioree d'immunomodulation de fonctions cellulaires
US7604965B2 (en) 2003-04-03 2009-10-20 Fluidigm Corporation Thermal reaction device and method for using the same
US7319010B2 (en) 2003-05-12 2008-01-15 The Regents Of The University Of Michigan Detection and treatment of cancers of the colon
US20070105105A1 (en) 2003-05-23 2007-05-10 Mount Sinai School Of Medicine Of New York University Surrogate cell gene expression signatures for evaluating the physical state of a subject
US20070160503A1 (en) 2003-06-13 2007-07-12 Palaniappan Sethu Microfluidic systems for size based removal of red blood cells and platelets from blood
WO2005010147A2 (fr) 2003-06-13 2005-02-03 The General Hospital Corporation Dispositif et procede permettant de mettre en contact des volumes de fluide par picolitre
US20070092881A1 (en) 2003-07-10 2007-04-26 Central Institute For Experimental Animals Gene markers of tumor metastasis
US7461048B2 (en) 2003-07-21 2008-12-02 Aureon Laboratories, Inc. Systems and methods for treating, diagnosing and predicting the occurrence of a medical condition
US20070059785A1 (en) 2003-08-15 2007-03-15 Smithkline Beecham Corporation Biomarkers in cancer
CA2536360C (fr) 2003-08-28 2013-08-06 Celula, Inc. Procedes et appareil pour le tri de cellules mettant en oeuvre un commutateur optique dans un reseau de canaux microfluidiques
EP1664077B1 (fr) 2003-09-05 2016-04-13 Trustees of Boston University Procede de diagnostic prenatal non effractif
US20070178458A1 (en) 2003-09-05 2007-08-02 O'brien Philippa Methods of diagnosis and prognosis of ovarian cancer II
US20070092444A1 (en) 2003-09-11 2007-04-26 The Uab Research Foundation Inhibition of inward sodium currents in cancer
CA2539108A1 (fr) 2003-09-18 2005-03-31 Immunivest Corporation Systeme d'analyse et de preparation d'echantillon programmable independamment de l'operateur
US20070202109A1 (en) 2003-09-24 2007-08-30 Oncotherapy Science, Inc. Method Of Diagnosing Breast Cancer
ATE435301T1 (de) 2003-10-16 2009-07-15 Sequenom Inc Nicht invasiver nachweis fötaler genetischer merkmale
US8062849B2 (en) 2003-10-28 2011-11-22 The Johns Hopkins University Quantitative multiplex methylation-specific PCR
AU2004286845A1 (en) * 2003-10-30 2005-05-19 Tufts-New England Medical Center Prenatal diagnosis using cell-free fetal DNA in amniotic fluid
WO2005043121A2 (fr) 2003-10-31 2005-05-12 Vitatex, Inc. Prototypes d'analyses sanguines et methodes de detection de cellules tumorales et endotheliales
WO2005047532A1 (fr) 2003-11-17 2005-05-26 Gribbles Molecular Science Pty Ltd Procede ameliore permettant de realiser des analyses genetiques sur des echantillons cellulaires de l'appareil reproducteur
WO2005049168A2 (fr) 2003-11-17 2005-06-02 Immunivest Corporation Procede et appareil de pre-enrichissement et d'extraction de cellules de sang total densifie
WO2005056838A1 (fr) 2003-12-08 2005-06-23 The Clinic For Special Children Association de polymorphismes tspyl avec le syndrome siddt
US7999071B2 (en) 2003-12-12 2011-08-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Human cytotoxic T-lymphoctye epitope and its agonist eptiope from the non-variable number of tandem repeat sequence of MUC-1
US20050147977A1 (en) 2003-12-29 2005-07-07 Tae-Woong Koo Methods and compositions for nucleic acid detection and sequence analysis
EP1561507A1 (fr) 2004-01-27 2005-08-10 Future Diagnostics B.V. Système pour caractériser un fluide, dispositif microfluidique pour caractériser ou analyser les composants de concentrations, une méthode de caractériser ou d'analyser de telles concentrations et un dispositif de mesure
US7910353B2 (en) 2004-02-13 2011-03-22 Signature Genomic Laboratories Methods and apparatuses for achieving precision genetic diagnoses
US20050181353A1 (en) 2004-02-17 2005-08-18 Rao Galla C. Stabilization of cells and biological specimens for analysis
US20050191636A1 (en) 2004-03-01 2005-09-01 Biocept, Inc. Detection of STRP, such as fragile X syndrome
US20070077578A1 (en) 2004-03-02 2007-04-05 Primagen Holding B.V. Diagnosis of (a risk of ) disease and monitoring of therapy
WO2005084380A2 (fr) 2004-03-03 2005-09-15 The General Hospital Corporation Systeme de distribution de solution diluee
AU2005218622A1 (en) 2004-03-03 2005-09-15 Living Microsystems Magnetic device for isolation of cells and biomolecules in a microfluidic environment
WO2005085861A2 (fr) 2004-03-03 2005-09-15 Oridis Biomed Forschungs- Und Entwicklungs Gmbh Acides nucleiques et polypeptides codes destines a etre utilises dans des troubles hepatiques et du cancer epithelial
US20060121624A1 (en) 2004-03-03 2006-06-08 Huang Lotien R Methods and systems for fluid delivery
WO2005091418A2 (fr) 2004-03-23 2005-09-29 Amminex A/S Utilisation d'un dispositif de stockage d'ammoniac dans la production d'energie
US7390388B2 (en) 2004-03-25 2008-06-24 Hewlett-Packard Development Company, L.P. Method of sorting cells on a biodevice
WO2005098046A2 (fr) 2004-04-01 2005-10-20 Immunivest Corporation Methodes de determination de biomarqueurs specifiques de cellules
EP1781809A1 (fr) 2004-04-08 2007-05-09 BRAUCH, Hiltrud Polymorphismes ercc2
US20050282196A1 (en) 2004-04-30 2005-12-22 Jose Costa Methods and compositions for cancer diagnosis
WO2005109238A2 (fr) 2004-05-03 2005-11-17 Cygene Laboratories, Inc. Procede et systeme d'investigation anonyme etendue basee sur des faits et d'etablissement de rapports a base de faits et d'acces selectif aux resultats et rapports
US7468249B2 (en) 2004-05-05 2008-12-23 Biocept, Inc. Detection of chromosomal disorders
US20050287611A1 (en) 2004-05-07 2005-12-29 Nugent C T Iv MHC bridging system for detecting CTL-mediated lysis of antigen presenting cells
WO2005116264A2 (fr) 2004-05-24 2005-12-08 Immunivest Corporation Analyse sanguine pour surveiller les changements genetiques du cancer evolutif par enrichissement immunomagnetique et hybridation in situ par fluorescence (fish)
US7709194B2 (en) 2004-06-04 2010-05-04 The Chinese University Of Hong Kong Marker for prenatal diagnosis and monitoring
EP1607485A1 (fr) 2004-06-14 2005-12-21 Institut National De La Sante Et De La Recherche Medicale (Inserm) Méthode de quantification de l'isoforme VEGF121 dans un échantillon biologique.
DE102004036285A1 (de) 2004-07-27 2006-02-16 Advalytix Ag Verfahren zum Bestimmen der Häufigkeit von Sequenzen einer Probe
US7820382B2 (en) 2004-08-03 2010-10-26 Bauer A Robert Method for the early detection of breast cancer, lung cancer, pancreatic cancer and colon polyps, growths and cancers as well as other gastrointestinal disease conditions and the preoperative and postoperative monitoring of transplanted organs from the donor and in the recipient and their associated conditions related and unrelated to the organ transplantation
WO2006043181A2 (fr) 2004-08-04 2006-04-27 Spinx, Inc. Dispositifs et procedes d'interfacage de dispositifs microfluidiques avec des dispositifs de manipulation de fluides
JP5537771B2 (ja) 2004-08-17 2014-07-02 ベリデックス・リミテッド・ライアビリティ・カンパニー 循環する希少細胞の分析用の画像診断機器
WO2006041453A1 (fr) 2004-09-30 2006-04-20 Immunivest Corporation Cellules tumorales circulantes (ctc): evaluation de l'apoptose chez les patients presentant un cancer de la prostate
ES2301268B1 (es) 2004-10-25 2009-05-01 Centro De Investigacion Biomolecular Aplicada Salamanca, S.L. Empleo del gen slug, o de sus productos de replicacion, transcripcion o expresion, en la identificacion, diagnostico, prevencion o tratamiento de la diseminacion del cancer y/o desarrollo de metastasis.
US20060094109A1 (en) 2004-11-02 2006-05-04 Immunivest Corporation Device and method for analytical cell imaging
US20060246575A1 (en) 2005-01-13 2006-11-02 Micronics, Inc. Microfluidic rare cell detection device
US8158410B2 (en) 2005-01-18 2012-04-17 Biocept, Inc. Recovery of rare cells using a microchannel apparatus with patterned posts
US20060252087A1 (en) 2005-01-18 2006-11-09 Biocept, Inc. Recovery of rare cells using a microchannel apparatus with patterned posts
KR20070116585A (ko) 2005-01-18 2007-12-10 바이오셉트 인코포레이티드 패턴화된 포스트를 갖는 마이크로채널을 이용하는 세포분리법
US20060205057A1 (en) 2005-02-18 2006-09-14 Wayner Danial D M Microfluidic microarray with high surface area active regions
WO2007024264A2 (fr) 2005-02-23 2007-03-01 Bioimagene, Inc. Procede et systeme de quantification simultanee, a base d'images numeriques et independante du tissu du noyau, du cytoplasme et de la membrane
US8383357B2 (en) 2005-03-16 2013-02-26 OSI Pharmaceuticals, LLC Biological markers predictive of anti-cancer response to epidermal growth factor receptor kinase inhibitors
EP2612928A3 (fr) 2005-03-18 2013-09-11 The Chinese University Of Hong Kong Marqueurs pour le diagnostic et la surveillance prénatale
FR2883488B1 (fr) 2005-03-24 2010-12-10 Inst Nat Sante Rech Med Procede et dispositif pour separer par filtration verticale des particules biologiques contenues dans un liquide
WO2006108087A2 (fr) 2005-04-05 2006-10-12 Cellpoint Diagnostics Dispositifs et procedes permettant d'enrichir et de modifier des cellules tumorales circulantes et d'autres particules
US20060223178A1 (en) 2005-04-05 2006-10-05 Tom Barber Devices and methods for magnetic enrichment of cells and other particles
GB0509500D0 (en) 2005-05-10 2005-06-15 Revealcyte Method of fetal cell enrichment
WO2007044091A2 (fr) 2005-06-02 2007-04-19 Fluidigm Corporation Analyse utilisant des dispositifs de separation microfluidiques
AU2006256374A1 (en) * 2005-06-08 2006-12-14 Compugen Ltd. Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis
AU2006259583A1 (en) 2005-06-13 2006-12-28 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
WO2007001259A1 (fr) * 2005-06-16 2007-01-04 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Methodes et materiels utilises pour identifier des variantes polymorphes, diagnostiquer des predispositions a des pathologies et traiter des maladies
US7901950B2 (en) 2005-08-12 2011-03-08 Veridex, Llc Method for assessing disease states by profile analysis of isolated circulating endothelial cells
AU2006281569A1 (en) 2005-08-17 2007-02-22 Medexis S.A. Composition and method for determination of CK19 expression
CA2620936A1 (fr) 2005-09-01 2007-03-08 Precision Therapeutics, Inc. Tests de chimiosensibilite faisant appel a des cellules tumorales presentant des caracteristiques phenotypiques persistantes
US20070104717A1 (en) 2005-09-12 2007-05-10 Regents Of The University Of Michigan Compositions and methods for detecting and treating cancer
ES2363757T3 (es) 2005-09-15 2011-08-16 Val-Chum, S.E.C. Procedimientos de diagnóstico del cáncer de ovarios.
US20070059781A1 (en) 2005-09-15 2007-03-15 Ravi Kapur System for size based separation and analysis
US20070059774A1 (en) 2005-09-15 2007-03-15 Michael Grisham Kits for Prenatal Testing
WO2007035744A1 (fr) 2005-09-20 2007-03-29 Osi Pharmaceuticals, Inc. Marqueurs biologiques predictifs d'une reaction anticancereuse aux inhibiteurs kinase du recepteur du facteur de croissance 1 analogue a l'insuline
EP1946114A4 (fr) 2005-09-21 2010-05-26 Ccc Diagnostics Llc Procedures de test diagnostique exhaustives pour chimiotherapies anticancereuses personnalisees
US20110059069A1 (en) 2005-09-22 2011-03-10 Biogen Idec Ma Inc Gapr-1 Methods
GB0519405D0 (en) 2005-09-23 2005-11-02 Univ Aberdeen Cancer therapy prognosis and target
AU2006297033B2 (en) 2005-09-27 2011-09-08 University Of Saskatchewan Use of N-myristoyltransferase on non-tumor tissue for cancer diagnosis
EP1770171A1 (fr) 2005-09-29 2007-04-04 Universität Zu Köln Micro-réseau d'ADN pour la rapide détection de Candida albicans dans des échantillons de sang.
WO2007041610A2 (fr) 2005-09-30 2007-04-12 National Jewish Medical And Research Center Genes et proteines associes a l'angiogenese et leurs utilisations
US20070202106A1 (en) 2005-10-06 2007-08-30 Baylor Research Institute Compositions and methods for the treatment of cancer
US8343756B2 (en) 2005-10-07 2013-01-01 The General Hospital Corporation Devices and methods for cell manipulation
WO2007048076A2 (fr) 2005-10-21 2007-04-26 The General Hospital Corporation Procede de diagnostic et de pronostic du cancer
WO2007050495A2 (fr) 2005-10-26 2007-05-03 Children's Medical Center Corporation Methode permettant de pronostiquer une reponse a un anti-egfr
JP5129149B2 (ja) 2005-10-31 2013-01-23 ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン 癌を処置および診断するための組成物および方法
US20100062426A1 (en) 2005-11-03 2010-03-11 O'hara Shawn Mark AGR2 and TFF3 Regulation in the Diagnosis and Treatment of Cancer
WO2007056560A2 (fr) 2005-11-09 2007-05-18 Chemimage Corporation Systeme et procede d'analyse cytologique par imagerie spectroscopique raman
US20070122856A1 (en) 2005-11-10 2007-05-31 Aurelium Biopharma Inc. Tissue diagnostics for ovarian cancer
EP1951906B1 (fr) 2005-11-10 2010-12-22 Bristol-Myers Squibb Pharma Company Moésine, cavéoline 1 et protéine 1 associée à yes en tant que marqueurs prédictifs de la réponse au dasatinib dans les cancers du sein
EP1962892A4 (fr) 2005-11-22 2011-10-12 Univ South Florida Inhibition de la proliferation de cellules
US20070238094A1 (en) 2005-12-09 2007-10-11 Baylor Research Institute Diagnosis, prognosis and monitoring of disease progression of systemic lupus erythematosus through blood leukocyte microarray analysis
US7566573B2 (en) 2005-12-19 2009-07-28 Idexx Laboratories, Inc. Dual standard curve immunoassay
US20090311664A1 (en) 2005-12-22 2009-12-17 Yuman Fong Method for Detection of Cancer Cells Using Virus
WO2007079250A2 (fr) 2005-12-29 2007-07-12 Cellpoint Diagnostics, Inc. Dispositifs et procedes d'enrichissement et de modification de cellules tumorales circulantes et d'autres particules
EP1803822A1 (fr) 2005-12-30 2007-07-04 Adnagen AG Procédé pour la caractérisation individuelle de molécules cibles thérapeutiques, et leur utilisation
US20090215084A1 (en) 2006-01-05 2009-08-27 Mayo Foundation For Medical Education And Research B7-h1 and b7-h4 in cancer
US20100015642A1 (en) 2006-01-05 2010-01-21 Kwon Eugene D B7-h1 and survivin in cancer
WO2007080583A2 (fr) 2006-01-10 2007-07-19 Applied Spectral Imaging Ltd. Procédés et systèmes pour analyser des échantillons biologiques
US20070160974A1 (en) 2006-01-10 2007-07-12 South Eastern Sydney And Illawarra Area Health Service Human embryonic stem cell clones
US7842465B2 (en) 2006-01-17 2010-11-30 Palo Alto Research Center Incorporated Immunocytostaining methods for enhanced dye ratio discrimination in rare event detection
US7548145B2 (en) 2006-01-19 2009-06-16 Innovative Micro Technology Hysteretic MEMS thermal device and method of manufacture
WO2007082379A2 (fr) 2006-01-20 2007-07-26 Mcgill University Procede d'identification de cellules sensibles à cd40
EP1989329A2 (fr) 2006-01-25 2008-11-12 Board of Regents, The University of Texas System Detection et diagnostic de cancers lies au tabagisme
WO2007089911A2 (fr) 2006-01-30 2007-08-09 The Scripps Research Institute procedes de detection de cellules tumorales circulantes et procedes de diagnostic de cancer chez un sujet mammalien
AU2007211251A1 (en) 2006-01-31 2007-08-09 Georgetown University Method to detect breast cancer cells
US7888017B2 (en) * 2006-02-02 2011-02-15 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
WO2007092713A2 (fr) 2006-02-02 2007-08-16 Trustees Of The University Of Pennsylvania Système microfluidique et procédé d'analyse de l'expression génique dans des échantillons contenant des cellules et procédé de détection d'une maladie
JP2009526770A (ja) 2006-02-09 2009-07-23 マイクロメット アクツィエン ゲゼルシャフト 転移性乳癌の治療
EP1818413A1 (fr) 2006-02-10 2007-08-15 Fundacion para la Investigacion Clinica y Molecular del Cancer de Pulmon Méthode de détermination du devenir du carcinome pulmonaire non à petites cellules selon le polymorphisme XRCC3
WO2007098427A2 (fr) 2006-02-18 2007-08-30 Michael Strathmann Séquençage à multiplexage massif
EP1991662B1 (fr) 2006-02-21 2018-02-07 The Trustees Of Princeton University Activation à rendement élevé de surfaces polymériques pour une liaison par covalence de molécules
AU2007221234A1 (en) 2006-02-24 2007-09-07 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Extracellular matrix/metastasis modifer genes for the prevention or inhibition of metastasis or growth of tumor and for characterization of tumor
EP1832661A1 (fr) 2006-03-09 2007-09-12 Adnagen AG Méthode de stadification individuelle des maladies tumorales
US8337755B2 (en) 2006-03-13 2012-12-25 Veridex, Llc Operator independent programmable sample preparation and analysis system
WO2007126938A2 (fr) 2006-03-30 2007-11-08 Albert Einstein College Of Medicine Of Yeshiva University Marqueur d'anormalies chromosomiques
US8058055B2 (en) * 2006-04-07 2011-11-15 Agilent Technologies, Inc. High resolution chromosomal mapping
US7901884B2 (en) 2006-05-03 2011-03-08 The Chinese University Of Hong Kong Markers for prenatal diagnosis and monitoring
US7754428B2 (en) 2006-05-03 2010-07-13 The Chinese University Of Hong Kong Fetal methylation markers
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
WO2008111990A1 (fr) 2006-06-14 2008-09-18 Cellpoint Diagnostics, Inc. Analyse de cellules rares par division d'échantillon et utilisation de marqueurs d'adn
EP2589668A1 (fr) 2006-06-14 2013-05-08 Verinata Health, Inc Analyse de cellules rares utilisant la division d'échantillons et les marqueurs d'ADN
US20080070792A1 (en) 2006-06-14 2008-03-20 Roland Stoughton Use of highly parallel snp genotyping for fetal diagnosis
CA2655269A1 (fr) 2006-06-16 2007-12-21 Sequenom, Inc. Procedes et compositions destines a l'amplification, la detection et la quantification d'acide nucleique issu d'un echantillon
GB0616045D0 (en) 2006-08-11 2006-09-20 Univ Bristol Blood cell separation
WO2008098142A2 (fr) 2007-02-08 2008-08-14 Sequenom, Inc. Tests a base d'acide nucléique destinés au typage rhd, à la détermination du sexe et la quantification d'acide nucléique
US20100112590A1 (en) * 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US20090053719A1 (en) 2007-08-03 2009-02-26 The Chinese University Of Hong Kong Analysis of nucleic acids by digital pcr
AU2009226083A1 (en) * 2008-03-19 2009-09-24 Existence Genetics Llc Genetic analysis
SI2334812T1 (sl) 2008-09-20 2017-05-31 The Board of Trustees of the Leland Stanford Junior University Office of the General Counsel Building 170 Neinvazivna diagnoza fetalne anevploidije s sekvenciranjem

Patent Citations (101)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US20040018509A1 (en) * 1989-11-13 2004-01-29 Bianchi Diana W. Non-invasive method for isolation and detection of fetal DNA
US20070015171A1 (en) * 1989-11-13 2007-01-18 The Children's Hospital Non-invasive method for isolation and detection of fetal DNA
US20060051775A1 (en) * 1989-11-13 2006-03-09 The Children's Hospital Non-invasive method for isolation and detection of fetal DNA
US20020006621A1 (en) * 1989-11-13 2002-01-17 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
US6176962B1 (en) * 1990-02-28 2001-01-23 Aclara Biosciences, Inc. Methods for fabricating enclosed microchannel structures
US5879883A (en) * 1991-10-03 1999-03-09 Indiana University Foundation Method for screening for alzheimer's disease
US5498392A (en) * 1992-05-01 1996-03-12 Trustees Of The University Of Pennsylvania Mesoscale polynucleotide amplification device and method
US5866345A (en) * 1992-05-01 1999-02-02 The Trustees Of The University Of Pennsylvania Apparatus for the detection of an analyte utilizing mesoscale flow systems
US5296375A (en) * 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5726026A (en) * 1992-05-01 1998-03-10 Trustees Of The University Of Pennsylvania Mesoscale sample preparation device and systems for determination and processing of analytes
US5486335A (en) * 1992-05-01 1996-01-23 Trustees Of The University Of Pennsylvania Analysis based on flow restriction
US5858649A (en) * 1992-07-17 1999-01-12 Aprogenex, Inc. Amplification of mRNA for distinguishing fetal cells in maternal blood
US6184043B1 (en) * 1992-09-14 2001-02-06 FODSTAD øYSTEIN Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations
US5707799A (en) * 1994-09-30 1998-01-13 Abbott Laboratories Devices and methods utilizing arrays of structures for analyte capture
US5709943A (en) * 1995-05-04 1998-01-20 Minnesota Mining And Manufacturing Company Biological adsorption supports
US5715946A (en) * 1995-06-07 1998-02-10 Reichenbach; Steven H. Method and apparatus for sorting particles suspended in a fluid
US6013188A (en) * 1996-06-07 2000-01-11 Immunivest Corporation Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force
US6344326B1 (en) * 1996-07-30 2002-02-05 Aclara Bio Sciences, Inc. Microfluidic method for nucleic acid purification and processing
US6186660B1 (en) * 1997-10-09 2001-02-13 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US6517234B1 (en) * 1997-10-09 2003-02-11 Caliper Technologies Corp. Microfluidic systems incorporating varied channel dimensions
US20020016450A1 (en) * 1997-10-31 2002-02-07 Bbi Bioseq, Inc., A Masachusetts Corporation Pressure-enhanced extraction and purification
US6197523B1 (en) * 1997-11-24 2001-03-06 Robert A. Levine Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood
US6200765B1 (en) * 1998-05-04 2001-03-13 Pacific Northwest Cancer Foundation Non-invasive methods to detect prostate cancer
US20020028431A1 (en) * 1998-08-25 2002-03-07 Julien Jean-Claude Bisconte De Saint Process, device and reagent for cell separation
US6673541B1 (en) * 1998-09-18 2004-01-06 Micromet Ag DNA amplification of a single cell
US20040053352A1 (en) * 1998-09-28 2004-03-18 Tianmei Ouyang Diagnostics based on tetrazolium compounds
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US6858439B1 (en) * 1999-03-15 2005-02-22 Aviva Biosciences Compositions and methods for separation of moieties on chips
US6511967B1 (en) * 1999-04-23 2003-01-28 The General Hospital Corporation Use of an internalizing transferrin receptor to image transgene expression
US20040048360A1 (en) * 1999-08-26 2004-03-11 Caliper Technologies Corp. Microfluidic analytic detection assays, devices, and integrated systems
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20020019001A1 (en) * 1999-10-15 2002-02-14 Ventana Medical Systems, Inc. Method of detecting single gene copies in-situ
US6361958B1 (en) * 1999-11-12 2002-03-26 Motorola, Inc. Biochannel assay for hybridization with biomaterial
US20020012931A1 (en) * 2000-03-27 2002-01-31 Waldman Scott A. High specificity marker detection
US20020009738A1 (en) * 2000-04-03 2002-01-24 Houghton Raymond L. Methods, compositions and kits for the detection and monitoring of breast cancer
US20030004402A1 (en) * 2000-07-18 2003-01-02 Hitt Ben A. Process for discriminating between biological states based on hidden patterns from biological data
US20040005582A1 (en) * 2000-08-10 2004-01-08 Nanobiodynamics, Incorporated Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators
US6689615B1 (en) * 2000-10-04 2004-02-10 James Murto Methods and devices for processing blood samples
US6685841B2 (en) * 2001-02-14 2004-02-03 Gabriel P. Lopez Nanostructured devices for separation and analysis
US6674525B2 (en) * 2001-04-03 2004-01-06 Micronics, Inc. Split focusing cytometer
US20030033091A1 (en) * 2001-04-20 2003-02-13 Sequenom, Inc. Systems and methods for testing a biological sample
US20070037273A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20070037275A1 (en) * 2001-04-25 2007-02-15 Michael Shuler Devices and methods for pharmacokinetic-based cell culture system
US20060060767A1 (en) * 2001-04-27 2006-03-23 Wang Mark M Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles
US20050049793A1 (en) * 2001-04-30 2005-03-03 Patrizia Paterlini-Brechot Prenatal diagnosis method on isolated foetal cell of maternal blood
US20030017514A1 (en) * 2001-06-02 2003-01-23 Katharina Pachmann Method for quantitative detection of vital epithelial tumor cells in a body fluid
US20050037388A1 (en) * 2001-06-22 2005-02-17 University Of Geneva Method for detecting diseases caused by chromosomal imbalances
US20030044388A1 (en) * 2001-08-31 2003-03-06 The Chinese University Of Hong Kong Methods for detecting DNA originating from different individuals
US20050042685A1 (en) * 2001-09-06 2005-02-24 Winfried Albert Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells
US20050014208A1 (en) * 2001-09-06 2005-01-20 Alf-Andreas Krehan Method and kit for diagnosing or controlling the treatment of breast cancer
US20070042360A1 (en) * 2001-09-17 2007-02-22 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
US20050019792A1 (en) * 2001-11-30 2005-01-27 Fluidigm Corporation Microfluidic device and methods of using same
US7171975B2 (en) * 2002-02-12 2007-02-06 Kionix, Inc. Fabrication of ultra-shallow channels for microfluidic devices and systems
US20060024756A1 (en) * 2002-02-14 2006-02-02 Arjan Tibbe Methods and algorithms for cell enumeration in low-cost cytometer
US7332277B2 (en) * 2002-03-01 2008-02-19 Ravgen, Inc. Methods for detection of genetic disorders
US20040009471A1 (en) * 2002-04-25 2004-01-15 Bo Cao Methods and kits for detecting a target cell
US20040018116A1 (en) * 2002-07-26 2004-01-29 Desmond Sean M. Microfluidic size-exclusion devices, systems, and methods
US20060008807A1 (en) * 2002-08-23 2006-01-12 O'hara Shawn M Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample
US20040037470A1 (en) * 2002-08-23 2004-02-26 Simske Steven J. Systems and methods for processing text-based electronic documents
US20040043506A1 (en) * 2002-08-30 2004-03-04 Horst Haussecker Cascaded hydrodynamic focusing in microfluidic channels
US20070054268A1 (en) * 2002-09-05 2007-03-08 Robert Sutherland Methods of diagnosis and prognosis of ovarian cancer
US20050042623A1 (en) * 2002-10-30 2005-02-24 Dana Ault-Riche Systems for capture and analysis of biological particles and methods using the systems
US20060000772A1 (en) * 2002-11-29 2006-01-05 Toru Sano Separation apparatus and separation method
US20070042368A1 (en) * 2003-03-24 2007-02-22 Corixa Corporation Detection and monitoring of lung cancer
US7476363B2 (en) * 2003-04-03 2009-01-13 Fluidigm Corporation Microfluidic devices and methods of using same
US20050061962A1 (en) * 2003-07-31 2005-03-24 Arryx, Inc. Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components
US20070042339A1 (en) * 2003-08-08 2007-02-22 Massachusetts General Hospital Preservation of biomaterials with transported preservation agents
US7655399B2 (en) * 2003-10-08 2010-02-02 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
US20050221341A1 (en) * 2003-10-22 2005-10-06 Shimkets Richard A Sequence-based karyotyping
US20090117538A1 (en) * 2003-12-01 2009-05-07 Hashimoto Shin-Ichi Methods for Obtaining Gene Tags
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20060008824A1 (en) * 2004-05-20 2006-01-12 Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US20060051265A1 (en) * 2004-09-08 2006-03-09 Health Research, Inc. Apparatus and method for sorting microstructures in a fluid medium
US7645576B2 (en) * 2005-03-18 2010-01-12 The Chinese University Of Hong Kong Method for the detection of chromosomal aneuploidies
US20070017633A1 (en) * 2005-03-23 2007-01-25 Tonkovich Anna L Surface features in microprocess technology
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US20070054287A1 (en) * 2005-05-31 2007-03-08 Applera Corporation Method for identifying medically important cell populations using micro rna as tissue specific biomarkers
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026419A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026418A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070037172A1 (en) * 2005-08-11 2007-02-15 Chiu Daniel T Separation and concentration of biological cells and biological particles using a one-dimensional channel
US20070037173A1 (en) * 2005-08-12 2007-02-15 Allard Jeffrey W Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients
US20070042238A1 (en) * 2005-08-22 2007-02-22 Lg Electronics Inc. Fuel cell having water type radiating device
US20070048750A1 (en) * 2005-09-01 2007-03-01 National Health Research Institute Rapid efficacy assessment method for lung cancer therapy
US20070059680A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for cell enrichment
US20070059719A1 (en) * 2005-09-15 2007-03-15 Michael Grisham Business methods for prenatal Diagnosis
US20070059716A1 (en) * 2005-09-15 2007-03-15 Ulysses Balis Methods for detecting fetal abnormality
US20070059718A1 (en) * 2005-09-15 2007-03-15 Mehmet Toner Systems and methods for enrichment of analytes
US20070059683A1 (en) * 2005-09-15 2007-03-15 Tom Barber Veterinary diagnostic system
US20080020390A1 (en) * 2006-02-28 2008-01-24 Mitchell Aoy T Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms
US20080038733A1 (en) * 2006-03-28 2008-02-14 Baylor College Of Medicine Screening for down syndrome
US20080023399A1 (en) * 2006-06-01 2008-01-31 Inglis David W Apparatus and method for continuous particle separation
US20080050739A1 (en) * 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US20080026390A1 (en) * 2006-06-14 2008-01-31 Roland Stoughton Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Dohm et al., Nucleic Acids Research, 2008, Vol. 36, pages 1-10. *
Huse et al., Genome Biology, 2007, Vol. 8, pages 1-9. *
Zhang, CT et al. A novel method to calculate the G+C content of genomic sequences. 2001 J. Biomol Struct Dyn Vol 2 abstract only *

Cited By (289)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100216153A1 (en) * 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US10260096B2 (en) 2005-07-29 2019-04-16 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10227652B2 (en) 2005-07-29 2019-03-12 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10266893B2 (en) 2005-07-29 2019-04-23 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10392664B2 (en) 2005-07-29 2019-08-27 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10597724B2 (en) 2005-11-26 2020-03-24 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9695477B2 (en) 2005-11-26 2017-07-04 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9430611B2 (en) 2005-11-26 2016-08-30 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US8682592B2 (en) 2005-11-26 2014-03-25 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10240202B2 (en) 2005-11-26 2019-03-26 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10711309B2 (en) 2005-11-26 2020-07-14 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US11306359B2 (en) 2005-11-26 2022-04-19 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US20100256013A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US8008018B2 (en) 2006-02-02 2011-08-30 The Board Of Trustees Of The Leland Stanford Junior University Determination of fetal aneuploidies by massively parallel DNA sequencing
US20100255492A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US11692225B2 (en) 2006-02-02 2023-07-04 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US20100255493A1 (en) * 2006-02-02 2010-10-07 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US20100124751A1 (en) * 2006-02-02 2010-05-20 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US8293470B2 (en) 2006-02-02 2012-10-23 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US10072295B2 (en) 2006-02-02 2018-09-11 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digtal analysis
US20100124752A1 (en) * 2006-02-02 2010-05-20 The Board Of Trustees Of The Leland Stanford Junior University Non-Invasive Fetal Genetic Screening by Digital Analysis
US9777329B2 (en) 2006-02-02 2017-10-03 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US9441273B2 (en) 2006-02-02 2016-09-13 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US9777328B2 (en) 2006-02-02 2017-10-03 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive fetal genetic screening by digital analysis
US10591391B2 (en) 2006-06-14 2020-03-17 Verinata Health, Inc. Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US10041119B2 (en) 2006-06-14 2018-08-07 Verinata Health, Inc. Methods for the diagnosis of fetal abnormalities
US11781187B2 (en) 2006-06-14 2023-10-10 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US8372584B2 (en) 2006-06-14 2013-02-12 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US8168389B2 (en) 2006-06-14 2012-05-01 The General Hospital Corporation Fetal cell analysis using sample splitting
US10155984B2 (en) 2006-06-14 2018-12-18 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US11674176B2 (en) 2006-06-14 2023-06-13 Verinata Health, Inc Fetal aneuploidy detection by sequencing
US10435751B2 (en) 2006-06-14 2019-10-08 Verinata Health, Inc. Methods for the diagnosis of fetal abnormalities
US10704090B2 (en) 2006-06-14 2020-07-07 Verinata Health, Inc. Fetal aneuploidy detection by sequencing
US9347100B2 (en) 2006-06-14 2016-05-24 Gpb Scientific, Llc Rare cell analysis using sample splitting and DNA tags
US9273355B2 (en) 2006-06-14 2016-03-01 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US20080138809A1 (en) * 2006-06-14 2008-06-12 Ravi Kapur Methods for the Diagnosis of Fetal Abnormalities
US9017942B2 (en) 2006-06-14 2015-04-28 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US11261492B2 (en) 2006-06-14 2022-03-01 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US20100112590A1 (en) * 2007-07-23 2010-05-06 The Chinese University Of Hong Kong Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment
US9121069B2 (en) 2007-07-23 2015-09-01 The Chinese University Of Hong Kong Diagnosing cancer using genomic sequencing
US11142799B2 (en) 2007-07-23 2021-10-12 The Chinese University Of Hong Kong Detecting chromosomal aberrations associated with cancer using genomic sequencing
US9051616B2 (en) 2007-07-23 2015-06-09 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US8972202B2 (en) 2007-07-23 2015-03-03 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US20090029377A1 (en) * 2007-07-23 2009-01-29 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing
US8442774B2 (en) 2007-07-23 2013-05-14 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using paired end
US10619214B2 (en) 2007-07-23 2020-04-14 The Chinese University Of Hong Kong Detecting genetic aberrations associated with cancer using genomic sequencing
US20110033862A1 (en) * 2008-02-19 2011-02-10 Gene Security Network, Inc. Methods for cell genotyping
US20110092763A1 (en) * 2008-05-27 2011-04-21 Gene Security Network, Inc. Methods for Embryo Characterization and Comparison
US9639657B2 (en) 2008-08-04 2017-05-02 Natera, Inc. Methods for allele calling and ploidy calling
US20110178719A1 (en) * 2008-08-04 2011-07-21 Gene Security Network, Inc. Methods for Allele Calling and Ploidy Calling
US10669585B2 (en) 2008-09-20 2020-06-02 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US20100304978A1 (en) * 2009-01-26 2010-12-02 David Xingfei Deng Methods and compositions for identifying a fetal cell
US10216896B2 (en) 2009-09-30 2019-02-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US9228234B2 (en) 2009-09-30 2016-01-05 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10061889B2 (en) 2009-09-30 2018-08-28 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10522242B2 (en) 2009-09-30 2019-12-31 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10061890B2 (en) 2009-09-30 2018-08-28 Natera, Inc. Methods for non-invasive prenatal ploidy calling
EP3260555A1 (fr) 2010-01-19 2017-12-27 Verinata Health, Inc Nouveau protocole de préparation de bibliothèques de séquençage
US11286520B2 (en) 2010-01-19 2022-03-29 Verinata Health, Inc. Method for determining copy number variations
US10612096B2 (en) 2010-01-19 2020-04-07 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
WO2011091046A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Identification de cellules polymorphes dans des mélanges d'adn génomique par séquençage du génome entier
US10662474B2 (en) 2010-01-19 2020-05-26 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing
US10482993B2 (en) 2010-01-19 2019-11-19 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US20110201507A1 (en) * 2010-01-19 2011-08-18 Rava Richard P Sequencing methods and compositions for prenatal diagnoses
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
US9657342B2 (en) 2010-01-19 2017-05-23 Verinata Health, Inc. Sequencing methods for prenatal diagnoses
US20110224087A1 (en) * 2010-01-19 2011-09-15 Stephen Quake Simultaneous determination of aneuploidy and fetal fraction
US20110230358A1 (en) * 2010-01-19 2011-09-22 Artemis Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
EP3006573A1 (fr) 2010-01-19 2016-04-13 Verinata Health, Inc Procédés de détermination de fraction d'acides nucléiques foetaux dans d'échantillons maternels
US9260745B2 (en) * 2010-01-19 2016-02-16 Verinata Health, Inc. Detecting and classifying copy number variation
US9493828B2 (en) 2010-01-19 2016-11-15 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US11697846B2 (en) 2010-01-19 2023-07-11 Verinata Health, Inc. Detecting and classifying copy number variation
US20200219588A1 (en) * 2010-01-19 2020-07-09 Verinata Health, Inc. Detecting and classifying copy number variation
US10415089B2 (en) 2010-01-19 2019-09-17 Verinata Health, Inc. Detecting and classifying copy number variation
US10586610B2 (en) 2010-01-19 2020-03-10 Verinata Health, Inc. Detecting and classifying copy number variation
EP4074838A1 (fr) 2010-01-19 2022-10-19 Verinata Health, Inc. Nouveau protocole de préparation de bibliothèques de séquençage
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US11875899B2 (en) 2010-01-19 2024-01-16 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
EP3878973A1 (fr) 2010-01-19 2021-09-15 Verinata Health, Inc. Procédés de détermination de fraction d'acides nucléiques f taux dans d'échantillons maternels
EP3492601A1 (fr) 2010-01-19 2019-06-05 Verinata Health, Inc Nouveau protocole de préparation de bibliothèques de séquençage
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
WO2011090556A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Procédés pour déterminer une fraction d'acide nucléique fœtal dans des échantillons maternels
WO2011090559A1 (fr) 2010-01-19 2011-07-28 Verinata Health, Inc. Méthodes de séquençage et compositions de diagnostic prénatal
US11130995B2 (en) 2010-01-19 2021-09-28 Verinata Health, Inc. Simultaneous determination of aneuploidy and fetal fraction
US20130029852A1 (en) * 2010-01-19 2013-01-31 Verinata Health, Inc. Detecting and classifying copy number variation
US10941442B2 (en) 2010-01-19 2021-03-09 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US11884975B2 (en) 2010-01-19 2024-01-30 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
EP3382037A1 (fr) 2010-01-19 2018-10-03 Verinata Health, Inc Procédés de détermination de fraction d'acides nucléiques f taux dans d'échantillons maternels
US10718020B2 (en) 2010-01-23 2020-07-21 Verinata Health, Inc. Methods of fetal abnormality detection
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
US9493831B2 (en) 2010-01-23 2016-11-15 Verinata Health, Inc. Methods of fetal abnormality detection
US11286530B2 (en) 2010-05-18 2022-03-29 Natera, Inc. Methods for simultaneous amplification of target loci
US9163282B2 (en) 2010-05-18 2015-10-20 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11525162B2 (en) 2010-05-18 2022-12-13 Natera, Inc. Methods for simultaneous amplification of target loci
US10557172B2 (en) 2010-05-18 2020-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US10174369B2 (en) 2010-05-18 2019-01-08 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11111545B2 (en) 2010-05-18 2021-09-07 Natera, Inc. Methods for simultaneous amplification of target loci
US11746376B2 (en) 2010-05-18 2023-09-05 Natera, Inc. Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
US10538814B2 (en) 2010-05-18 2020-01-21 Natera, Inc. Methods for simultaneous amplification of target loci
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10113196B2 (en) 2010-05-18 2018-10-30 Natera, Inc. Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping
US10526658B2 (en) 2010-05-18 2020-01-07 Natera, Inc. Methods for simultaneous amplification of target loci
US8825412B2 (en) 2010-05-18 2014-09-02 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11519035B2 (en) * 2010-05-18 2022-12-06 Natera, Inc. Methods for simultaneous amplification of target loci
US8949036B2 (en) 2010-05-18 2015-02-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10793912B2 (en) 2010-05-18 2020-10-06 Natera, Inc. Methods for simultaneous amplification of target loci
US9334541B2 (en) 2010-05-18 2016-05-10 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10017812B2 (en) 2010-05-18 2018-07-10 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10774380B2 (en) 2010-05-18 2020-09-15 Natera, Inc. Methods for multiplex PCR amplification of target loci in a nucleic acid sample
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci
US10731220B2 (en) 2010-05-18 2020-08-04 Natera, Inc. Methods for simultaneous amplification of target loci
US10590482B2 (en) 2010-05-18 2020-03-17 Natera, Inc. Amplification of cell-free DNA using nested PCR
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11482300B2 (en) 2010-05-18 2022-10-25 Natera, Inc. Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA
US10597723B2 (en) 2010-05-18 2020-03-24 Natera, Inc. Methods for simultaneous amplification of target loci
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11306357B2 (en) 2010-05-18 2022-04-19 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11312996B2 (en) 2010-05-18 2022-04-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10655180B2 (en) 2010-05-18 2020-05-19 Natera, Inc. Methods for simultaneous amplification of target loci
US9567639B2 (en) 2010-08-06 2017-02-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US9890421B2 (en) 2010-08-06 2018-02-13 Ariosa Diagnostics, Inc. Assay systems for genetic analysis
US11203786B2 (en) 2010-08-06 2021-12-21 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US10131937B2 (en) 2010-08-06 2018-11-20 Ariosa Diagnostics, Inc. Assay systems for genetic analysis
US10308981B2 (en) 2010-08-06 2019-06-04 Ariosa Diagnostics, Inc. Assay systems for determination of source contribution in a sample
US10233496B2 (en) 2010-08-06 2019-03-19 Ariosa Diagnostics, Inc. Ligation-based detection of genetic variants
US11031095B2 (en) 2010-08-06 2021-06-08 Ariosa Diagnostics, Inc. Assay systems for determination of fetal copy number variation
US10533223B2 (en) 2010-08-06 2020-01-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US10131951B2 (en) 2010-08-06 2018-11-20 Ariosa Diagnostics, Inc. Assay systems for genetic analysis
US10167508B2 (en) 2010-08-06 2019-01-01 Ariosa Diagnostics, Inc. Detection of genetic abnormalities
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
WO2012078792A2 (fr) 2010-12-07 2012-06-14 Stanford University Détermination non invasive de l'héritage foetal des haplotypes parentaux à l'échelle du génome
US11270781B2 (en) 2011-01-25 2022-03-08 Ariosa Diagnostics, Inc. Statistical analysis for non-invasive sex chromosome aneuploidy determination
US10131947B2 (en) 2011-01-25 2018-11-20 Ariosa Diagnostics, Inc. Noninvasive detection of fetal aneuploidy in egg donor pregnancies
US11441185B2 (en) 2011-01-25 2022-09-13 Roche Molecular Systems, Inc. Noninvasive detection of fetal aneuploidy in egg donor pregnancies
US8756020B2 (en) 2011-01-25 2014-06-17 Ariosa Diagnostics, Inc. Enhanced risk probabilities using biomolecule estimations
US10718024B2 (en) 2011-01-25 2020-07-21 Ariosa Diagnostics, Inc. Risk calculation for evaluation of fetal aneuploidy
US8700338B2 (en) 2011-01-25 2014-04-15 Ariosa Diagnosis, Inc. Risk calculation for evaluation of fetal aneuploidy
US10718019B2 (en) 2011-01-25 2020-07-21 Ariosa Diagnostics, Inc. Risk calculation for evaluation of fetal aneuploidy
JP2018061514A (ja) * 2011-04-12 2018-04-19 ベリナタ ヘルス インコーポレイテッド 多型カウントを用いたゲノム画分の分析
US10658070B2 (en) 2011-04-12 2020-05-19 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9885080B2 (en) * 2011-05-31 2018-02-06 Berry Genomics Co., Ltd. Kit, a device and a method for detecting copy number of fetal chromosomes or tumor cell chromosomes
US20130130921A1 (en) * 2011-05-31 2013-05-23 Berry Genomics Co., Ltd. Kit, a Device and a Method for Detecting Copy Number of Fetal Chromosomes or Tumor Cell Chromosomes
US11004537B2 (en) 2011-06-24 2021-05-11 Sequenom, Inc. Methods and processes for non invasive assessment of a genetic variation
US9547748B2 (en) 2011-06-29 2017-01-17 Bgi Health Service Co., Ltd. Method for determining fetal chromosomal abnormality
US11289176B2 (en) 2011-09-07 2022-03-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
US8712697B2 (en) 2011-09-07 2014-04-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
US10847250B2 (en) 2011-09-07 2020-11-24 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
US20140228226A1 (en) * 2011-09-21 2014-08-14 Bgi Health Service Co., Ltd. Method and system for determining chromosome aneuploidy of single cell
US10424394B2 (en) 2011-10-06 2019-09-24 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10196681B2 (en) 2011-10-06 2019-02-05 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
JP2017099419A (ja) * 2011-10-06 2017-06-08 セクエノム， インコーポレイテッド 遺伝的変異の非侵襲的評価のための方法およびプロセス
US11001884B2 (en) 2011-10-06 2021-05-11 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11492659B2 (en) 2011-10-06 2022-11-08 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11560586B2 (en) 2011-10-06 2023-01-24 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9984198B2 (en) 2011-10-06 2018-05-29 Sequenom, Inc. Reducing sequence read count error in assessment of complex genetic variations
US10323268B2 (en) 2011-10-06 2019-06-18 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
JP2017073144A (ja) * 2011-10-06 2017-04-13 セクエノム， インコーポレイテッド 遺伝的変異の非侵襲的評価のための方法およびプロセス
US11437121B2 (en) 2011-10-06 2022-09-06 Sequenom, Inc. Methods and processes for non-invasive detection of a microduplication or a microdeletion with reduced sequence read count error
US9367663B2 (en) * 2011-10-06 2016-06-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US8688388B2 (en) * 2011-10-11 2014-04-01 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10214775B2 (en) 2011-12-07 2019-02-26 Chronix Biomedical Prostate cancer associated circulating nucleic acid biomarkers
WO2013086352A1 (fr) * 2011-12-07 2013-06-13 Chronix Biomedical Biomarqueurs pour acides nucléiques circulants associés au cancer de la prostate prostate cancer associated circulating nucleic acid biomarkers
US20140336075A1 (en) * 2011-12-17 2014-11-13 Bgi Diagnosis Co., Ltd. Method and system for determinining whether genome is abnormal
US11697849B2 (en) 2012-01-20 2023-07-11 Sequenom, Inc. Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions
CN108485940A (zh) * 2012-04-12 2018-09-04 维里纳塔健康公司 拷贝数变异的检测和分类
CN103374518A (zh) * 2012-04-12 2013-10-30 维里纳塔健康公司 拷贝数变异的检测和分类
US11404142B2 (en) 2012-05-21 2022-08-02 Roche Molecular Systems, Inc. Processes for calculating phased fetal genomic sequences
US11306354B2 (en) 2012-05-21 2022-04-19 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US10289800B2 (en) 2012-05-21 2019-05-14 Ariosa Diagnostics, Inc. Processes for calculating phased fetal genomic sequences
US11261494B2 (en) * 2012-06-21 2022-03-01 The Chinese University Of Hong Kong Method of measuring a fractional concentration of tumor DNA
US10497461B2 (en) 2012-06-22 2019-12-03 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9206417B2 (en) 2012-07-19 2015-12-08 Ariosa Diagnostics, Inc. Multiplexed sequential ligation-based detection of genetic variants
US9624490B2 (en) 2012-07-19 2017-04-18 Ariosa Diagnostics, Inc. Multiplexed sequential ligation-based detection of genetic variants
US10793916B2 (en) 2012-09-04 2020-10-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10683556B2 (en) 2012-09-04 2020-06-16 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10947600B2 (en) 2012-09-04 2021-03-16 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11434523B2 (en) 2012-09-04 2022-09-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10961592B2 (en) 2012-09-04 2021-03-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10894974B2 (en) 2012-09-04 2021-01-19 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10995376B1 (en) 2012-09-04 2021-05-04 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10738364B2 (en) 2012-09-04 2020-08-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11001899B1 (en) 2012-09-04 2021-05-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10501810B2 (en) 2012-09-04 2019-12-10 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11773453B2 (en) 2012-09-04 2023-10-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10501808B2 (en) 2012-09-04 2019-12-10 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10822663B2 (en) 2012-09-04 2020-11-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11913065B2 (en) 2012-09-04 2024-02-27 Guardent Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10457995B2 (en) 2012-09-04 2019-10-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876172B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10837063B2 (en) 2012-09-04 2020-11-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876171B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11879158B2 (en) 2012-09-04 2024-01-23 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11319597B2 (en) 2012-09-04 2022-05-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876152B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10494678B2 (en) 2012-09-04 2019-12-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11319598B2 (en) 2012-09-04 2022-05-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10482994B2 (en) 2012-10-04 2019-11-19 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10504613B2 (en) 2012-12-20 2019-12-10 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10643738B2 (en) 2013-01-10 2020-05-05 The Chinese University Of Hong Kong Noninvasive prenatal molecular karyotyping from maternal plasma
US11923046B2 (en) 2013-01-10 2024-03-05 The Chinese University Of Hong Kong Noninvasive prenatal molecular karyotyping from maternal plasma
US10497462B2 (en) 2013-01-25 2019-12-03 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
EP2948886B1 (fr) * 2013-01-25 2023-08-23 Sequenom, Inc. Procédés et processus d'évaluation non invasive de variations génétiques
EP2948886A2 (fr) * 2013-01-25 2015-12-02 Sequenom, Inc. Procédés et processus d'évaluation non invasive de variations génétiques
KR101614471B1 (ko) * 2013-02-28 2016-04-21 주식회사 테라젠이텍스 유전체 서열분석을 이용한 태아 염색체 이수성의 진단 방법 및 장치
US9994897B2 (en) 2013-03-08 2018-06-12 Ariosa Diagnostics, Inc. Non-invasive fetal sex determination
US10930368B2 (en) 2013-04-03 2021-02-23 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11462298B2 (en) 2013-05-24 2022-10-04 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10699800B2 (en) 2013-05-24 2020-06-30 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10622094B2 (en) 2013-06-21 2020-04-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9499870B2 (en) 2013-09-27 2016-11-22 Natera, Inc. Cell free DNA diagnostic testing standards
US10577655B2 (en) 2013-09-27 2020-03-03 Natera, Inc. Cell free DNA diagnostic testing standards
US10964409B2 (en) 2013-10-04 2021-03-30 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11929146B2 (en) 2013-10-07 2024-03-12 Sequenom, Inc. Systems for non-invasive assessment of chromosome alterations using changes in subsequence mappability
US10438691B2 (en) 2013-10-07 2019-10-08 Sequenom, Inc. Non-invasive assessment of chromosome alterations using change in subsequence mappability
US10741269B2 (en) 2013-10-21 2020-08-11 Verinata Health, Inc. Method for improving the sensitivity of detection in determining copy number variations
US11434531B2 (en) 2013-12-28 2022-09-06 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10801063B2 (en) 2013-12-28 2020-10-13 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11767555B2 (en) 2013-12-28 2023-09-26 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11767556B2 (en) 2013-12-28 2023-09-26 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10883139B2 (en) 2013-12-28 2021-01-05 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11959139B2 (en) 2013-12-28 2024-04-16 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11149307B2 (en) 2013-12-28 2021-10-19 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11118221B2 (en) 2013-12-28 2021-09-14 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11149306B2 (en) 2013-12-28 2021-10-19 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11667967B2 (en) 2013-12-28 2023-06-06 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11649491B2 (en) 2013-12-28 2023-05-16 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11639526B2 (en) 2013-12-28 2023-05-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11639525B2 (en) 2013-12-28 2023-05-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10889858B2 (en) 2013-12-28 2021-01-12 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10982265B2 (en) 2014-03-05 2021-04-20 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11667959B2 (en) 2014-03-05 2023-06-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10704086B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11447813B2 (en) 2014-03-05 2022-09-20 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10704085B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11091797B2 (en) 2014-03-05 2021-08-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10870880B2 (en) 2014-03-05 2020-12-22 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11091796B2 (en) 2014-03-05 2021-08-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11486008B2 (en) 2014-04-21 2022-11-01 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11390916B2 (en) 2014-04-21 2022-07-19 Natera, Inc. Methods for simultaneous amplification of target loci
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US10597708B2 (en) 2014-04-21 2020-03-24 Natera, Inc. Methods for simultaneous amplifications of target loci
US10597709B2 (en) 2014-04-21 2020-03-24 Natera, Inc. Methods for simultaneous amplification of target loci
US11319596B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11319595B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10179937B2 (en) 2014-04-21 2019-01-15 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11371100B2 (en) 2014-04-21 2022-06-28 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11530454B2 (en) 2014-04-21 2022-12-20 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10351906B2 (en) 2014-04-21 2019-07-16 Natera, Inc. Methods for simultaneous amplification of target loci
US11414709B2 (en) 2014-04-21 2022-08-16 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11408037B2 (en) 2014-04-21 2022-08-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10318704B2 (en) 2014-05-30 2019-06-11 Verinata Health, Inc. Detecting fetal sub-chromosomal aneuploidies
US11783911B2 (en) 2014-07-30 2023-10-10 Sequenom, Inc Methods and processes for non-invasive assessment of genetic variations
US11072814B2 (en) 2014-12-12 2021-07-27 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
US10364467B2 (en) 2015-01-13 2019-07-30 The Chinese University Of Hong Kong Using size and number aberrations in plasma DNA for detecting cancer
US11168370B2 (en) 2015-02-10 2021-11-09 The Chinese University Of Hong Kong Detecting mutations for cancer screening
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11242569B2 (en) 2015-12-17 2022-02-08 Guardant Health, Inc. Methods to determine tumor gene copy number by analysis of cell-free DNA
US11430541B2 (en) 2016-02-03 2022-08-30 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
US10095831B2 (en) 2016-02-03 2018-10-09 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
CN113096726A (zh) * 2016-02-03 2021-07-09 维里纳塔健康公司 使用无细胞dna片段尺寸以确定拷贝数变异
US11200963B2 (en) 2016-07-27 2021-12-14 Sequenom, Inc. Genetic copy number alteration classifications
US11854666B2 (en) 2016-09-29 2023-12-26 Myriad Women's Health, Inc. Noninvasive prenatal screening using dynamic iterative depth optimization
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11519028B2 (en) 2016-12-07 2022-12-06 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US10533219B2 (en) 2016-12-07 2020-01-14 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11530442B2 (en) 2016-12-07 2022-12-20 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US10577650B2 (en) 2016-12-07 2020-03-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11694768B2 (en) 2017-01-24 2023-07-04 Sequenom, Inc. Methods and processes for assessment of genetic variations
US10894976B2 (en) 2017-02-21 2021-01-19 Natera, Inc. Compositions, methods, and kits for isolating nucleic acids
US11525134B2 (en) 2017-10-27 2022-12-13 Juno Diagnostics, Inc. Devices, systems and methods for ultra-low volume liquid biopsy
US11525159B2 (en) 2018-07-03 2022-12-13 Natera, Inc. Methods for detection of donor-derived cell-free DNA
CN111627498A (zh) * 2020-05-21 2020-09-04 北京吉因加医学检验实验室有限公司 一种测序数据gc偏向性校正的方法及其装置

Also Published As

Publication number Publication date
CA3069077A1 (fr) 2010-03-25
PT2334812T (pt) 2017-03-29
SI2334812T1 (sl) 2017-05-31
DK2562268T3 (en) 2017-03-27
EP2334812A2 (fr) 2011-06-22
PT2562268T (pt) 2017-03-29
US8195415B2 (en) 2012-06-05
CY1118757T1 (el) 2017-07-12
US20140051583A1 (en) 2014-02-20
HRP20170437T1 (hr) 2017-06-02
CA2737643A1 (fr) 2010-03-25
US9404157B2 (en) 2016-08-02
US20140329691A1 (en) 2014-11-06
PL2334812T3 (pl) 2017-06-30
DK2334812T3 (en) 2017-03-27
CA2737643C (fr) 2020-10-06
IL243655A (en) 2017-03-30
EP3378951B1 (fr) 2020-05-13
LT2562268T (lt) 2017-04-25
IL211794A0 (en) 2011-06-30
WO2010033578A3 (fr) 2010-05-14
US20170029890A1 (en) 2017-02-02
CA3069082A1 (fr) 2010-03-25
US20100138165A1 (en) 2010-06-03
CA3069081A1 (fr) 2010-03-25
AU2009293354B2 (en) 2015-01-29
EP2952589A1 (fr) 2015-12-09
PL2562268T3 (pl) 2017-06-30
LT2334812T (lt) 2017-04-25
EP2334812A4 (fr) 2013-02-27
EP2562268A1 (fr) 2013-02-27
US20120208710A1 (en) 2012-08-16
EP3378951A1 (fr) 2018-09-26
EP2952589B1 (fr) 2018-02-14
EP3751005A2 (fr) 2020-12-16
US9353414B2 (en) 2016-05-31
CA3069082C (fr) 2022-03-22
SI2562268T1 (sl) 2017-05-31
AU2009293354A1 (en) 2010-03-25
SG10201500567VA (en) 2015-04-29
US8682594B2 (en) 2014-03-25
HUE031848T2 (en) 2017-08-28
CY1118802T1 (el) 2018-01-10
US10669585B2 (en) 2020-06-02
US20200270700A1 (en) 2020-08-27
ES2620294T3 (es) 2017-06-28
WO2010033578A2 (fr) 2010-03-25
HRP20170435T1 (hr) 2017-06-02
US20110246083A1 (en) 2011-10-06
HK1217354A1 (zh) 2017-01-06
HUE031849T2 (en) 2017-08-28
EP3751005A3 (fr) 2021-02-24
CA3069081C (fr) 2023-05-23
CA3069077C (fr) 2022-03-22
EP2334812B1 (fr) 2016-12-21
EP2562268B1 (fr) 2016-12-21
ES2620012T3 (es) 2017-06-27
US20110319272A1 (en) 2011-12-29
US8296076B2 (en) 2012-10-23
IL211794A (en) 2016-02-29

Similar Documents

Publication Publication Date Title
US20200270700A1 (en) Noninvasive diagnosis of fetal aneuploidy by sequencing
EP3529377B1 (fr) Évaluation de l'âge gestationnel par méthylation et profilage de taille d'adn plasmatique maternel
AU2021200569B2 (en) Noninvasive diagnosis of fetal aneuploidy by sequencing

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FAN, HEI MUN CHRISTINA;QUAKE, STEPHEN R.;SIGNING DATES FROM 20090917 TO 20091027;REEL/FRAME:023455/0526

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:STANFORD UNIVERSITY;REEL/FRAME:023838/0136

Effective date: 20100119

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION