US20100112575A1 - Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing - Google Patents
Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing Download PDFInfo
- Publication number
- US20100112575A1 US20100112575A1 US12/560,708 US56070809A US2010112575A1 US 20100112575 A1 US20100112575 A1 US 20100112575A1 US 56070809 A US56070809 A US 56070809A US 2010112575 A1 US2010112575 A1 US 2010112575A1
- Authority
- US
- United States
- Prior art keywords
- chromosome
- dna
- sequence
- sequencing
- fetal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/38—Pediatrics
- G01N2800/385—Congenital anomalies
- G01N2800/387—Down syndrome; Trisomy 18; Trisomy 13
Definitions
- the present invention relates to the field of molecular diagnostics, and more particularly to the field of prenatal genetic diagnosis.
- Fetal aneuploidy and other chromosomal aberrations affect 9 out of 1000 live births (1).
- the gold standard for diagnosing chromosomal abnormalities is karyotyping of fetal cells obtained via invasive procedures such as chorionic villus sampling and amniocentesis. These procedures impose small but potentially significant risks to both the fetus and the mother (2).
- Non-invasive screening of fetal aneuploidy using maternal serum markers and ultrasound are available but have limited reliability (3-5). There is therefore a desire to develop non-invasive genetic tests for fetal chromosomal abnormalities.
- sequence tag refers to a relatively short (e.g., 15-100) nucleic acid sequence that can be used to identify a certain larger sequence, e.g., be mapped to a chromosome or genomic region or gene. These can be ESTs or expressed sequence tags obtained from mRNA.
- Venter et al. “The sequence of the human genome,” Science, 2001 Feb. 16; 291(5507):1304-51 discloses the sequence of the human genome, which information is publicly available from NCBI.
- Another reference genomic sequence is a current NCBI build as obtained from the UCSC genome gateway.
- Wheeler et al. “The complete genome of an individual by massively parallel DNA sequencing,” Nature, 2008 Apr. 17; 452(7189):872-6 discloses the DNA sequence of a diploid genome of a single individual, James D. Watson, sequenced to 7.4-fold redundancy in two months using massively parallel sequencing in picolitre-size reaction vessels. Comparison of the sequence to the reference genome led to the identification of 3.3 million single nucleotide polymorphisms, of which 10,654 cause amino-acid substitution within the coding sequence.
- the present invention comprises a method for analyzing a maternal sample, e.g., from peripheral blood. It is not invasive into the fetal space, as is amniocentesis or chorionic villi sampling.
- fetal DNA which is present in the maternal plasma is used.
- the fetal DNA is in one aspect of the invention enriched due to the bias in the method towards shorter DNA fragments, which tend to be fetal DNA.
- the method is independent of any sequence difference between the maternal and fetal genome.
- the DNA obtained preferably from a peripheral blood draw, is a mixture of fetal and maternal DNA.
- the DNA obtained is at least partially sequenced, in a method which gives a large number of short reads.
- This method does not require the sequence differentiation of fetal versus maternal DNA, because the summed contribution of both maternal and fetal sequences in a particular chromosome or chromosome portion will be different as between an intact, diploid chromosome and an aberrant chromosome, i.e., with an extra copy, missing portion or the like. In other words, the method does not rely on a priori sequence information that would distinguish fetal DNA from maternal DNA.
- the abnormal distribution of a fetal chromosome or portion of a chromosome i.e., a gross deletion or insertion
- the median count of autosomal values i.e., number of sequence tags per autosome
- the term “chromosome portion” is used herein to denote either an entire chromosome or a significant fragment of a chromosome. For example, moderate Down syndrome has been associated with partial trisomy 21q22.2 ⁇ qter.
- the present method can be applied to arbitrarily small fractions of fetal DNA. It has been demonstrated to be accurate down to 6% fetal DNA concentration. Exemplified below is the successful use of shotgun sequencing and mapping of DNA to detect fetal trisomy 21 (Down syndrome), trisomy 18 (Edward syndrome), and trisomy 13 (Patau syndrome), carried out non-invasively using cell-free fetal DNA in maternal plasma. This forms the basis of a universal, polymorphism-independent non-invasive diagnostic test for fetal aneuploidy. The sequence data also allowed us to characterize plasma DNA in unprecedented detail, suggesting that it is enriched for nucleosome bound fragments. The method may also be employed so that the sequence data obtained may be further analyzed to obtain information regarding polymorphisms and mutations.
- the present invention comprises, in certain aspects, a method of testing for an abnormal distribution of a specified chromosome portion in a mixed sample of normally and abnormally distributed chromosome portions obtained from a single subject, such as a mixture of fetal and maternal DNA in a maternal plasma sample.
- a method of testing for an abnormal distribution of a specified chromosome portion in a mixed sample of normally and abnormally distributed chromosome portions obtained from a single subject such as a mixture of fetal and maternal DNA in a maternal plasma sample.
- One carries out sequence determinations on the DNA fragments in the sample, obtaining sequences from multiple chromosome portions of the mixed sample to obtain a number of sequence tags of sufficient length of determined sequence to be assigned to a chromosome location within a genome and of sufficient number to reflect abnormal distribution.
- Using a reference sequence one assigns the sequence tags to their corresponding chromosomes including at least the specified chromosome by comparing the sequence to reference genomic sequence.
- the present method also involves correcting for nonuniform distribution sequence tags to different chromosomal portions.
- a number of windows of defined length are created along a chromosome, the windows being on the order of kilobases in length, whereby a number of sequence tags will fall into many of the windows and the windows covering each entire chromosome in question, with exceptions for non-informative regions, e.g., centromere regions and repetitive regions.
- Various average numbers i.e., median values, are calculated for different windows and compared.
- the present invention may comprise a computer programmed to analyze sequence data obtained from a mixture of maternal and fetal chromosomal DNA.
- Each autosome (chr. 1-22) is computationally segmented into contiguous, non-overlapping windows. (A sliding window could also be used).
- Each window is of sufficient length to contain a significant number of reads (sequence tags, having about 20-100 by of sequence) and not still have a number of windows per chromosome.
- a window will be between 10 kb and 100 kb, more typically between 40 and 60 kb. There would, then, for example, accordingly be approximately between 3,000 and 100,000 windows per chromosome.
- Windows may vary widely in the number of sequence tags that they contain, based on location (e.g., near a centromere or repeating region) or G/C content, as explained below.
- the median (i.e., middle value in the set) count per window for each chromosome is selected; then the median of the autosomal values is used to account for differences in total number of sequence tags obtained for different chromosomes and distinguish interchromosomal variation from sequencing bias from aneuploidy.
- This mapping method may also be applied to discern partial deletions or insertions in a chromosome.
- the present method also provides a method for correcting for bias resulting from G/C content. For example, some the Solexa sequencing method was found to produce more sequence tags from fragments with increased G/C content. By assigning a weight to each sequence tag based on the G/C content of a window in which the read falls.
- the window for GC calculation is preferably smaller than the window for sequence tag density calculation.
- FIG. 1 is a scatter plot graph showing sequence tag densities from eighteen samples, having five different genotypes, as indicated in the figure legend. Fetal aneuploidy is detectable by the over-representation of the affected chromosome in maternal blood.
- FIG. 1A shows sequence tag density relative to the corresponding value of genomic DNA control; chromosomes are ordered by increasing G/C content.
- the samples shown as indicated, are plasma from a woman bearing a T21 fetus; plasma from a woman bearing a T18 fetus; plasma from a normal adult male; plasma from a woman bearing a normal fetus; plasma from a woman bearing a T13 fetus.
- FIG. 1B is a detail from FIG. 1A , showing chromosome 21 sequence tag density relative to the median chromosome 21 sequence tag density of the normal cases. Note that the values of 3 disomy 21 cases overlap at 1.0. The dashed line represents the upper boundary of the 99% confidence interval constructed from all disomy 21 samples.
- the chromosomes are listed in FIG. 1A in order of G/C content, from low to high. This figure suggests that one would prefer to use as a reference chromosome in the mixed sample with a mid level of G/C content, as it can be seen that the data there are more tightly grouped.
- FIG. 1B represents an enlargement of the chromosome 21 data.
- FIG. 2 is a scatter plot graph showing fetal DNA fraction and gestational age.
- the fraction of fetal DNA in maternal plasma correlates with gestational age.
- Fetal DNA fraction was estimated by three different ways: 1. From the additional amount of chromosomes 13, 18, and 21 sequences for T13, T18, and T21 cases respectively. 2. From the depletion in amount of chromosome X sequences for male cases. 3. From the amount of chromosome Y sequences present for male cases. The horizontal dashed line represents the estimated minimum fetal DNA fraction required for the detection of aneuploidy. For each sample, the values of fetal DNA fraction calculated from the data of different chromosomes were averaged.
- FIG. 2 suggests that the present method may be employed at a very early stage of pregnancy. The data were obtained from the 10-week stage and later because that is the earliest stage at which chorionic villi sampling is done. (Amniocentesis is done later). From the level of the confidence interval, one would expect to obtain meaningful data as early as 4 weeks gestational age, or possibly earlier.
- FIG. 3 is a histogram showing size distribution of maternal and fetal DNA in maternal plasma. It shows the size distribution of total and chromosome Y specific fragments obtained from 454 sequencing of maternal plasma DNA from a normal male pregnancy. The distribution is normalized to sum to 1. The numbers of total reads and reads mapped to the Y-chromosome are 144992 and 178 respectively. Inset: Cumulative fetal DNA fraction as a function of sequenced fragment size. The error bars correspond to the standard error of the fraction estimated assuming the error of the counts of sequenced fragments follow Poisson statistics.
- FIG. 4 is a pair of line graphs showing distribution of sequence tags around transcription start sites (TSS) of ReSeq genes on all autosomes and chromosome X from plasma DNA sample of a normal male pregnancy (top, FIG. 4A ) and randomly sheared genomic DNA control (bottom, FIG. 4B ).
- TSS transcription start sites
- the number of tags within each 5 bp window was counted within ⁇ 1000 bp region around each TSS, taking into account the strand each sequence tag mapped to.
- the counts from all transcription start sites for each 5 bp window were summed and normalized to the median count among the 400 windows. A moving average was used to smooth the data.
- a peak in the sense strand represents the beginning of a nucleosome, while a peak in the anti-sense strand represents the end of a nucleosome.
- a peak in the anti-sense strand represents the end of a nucleosome.
- five well-positioned nucleosomes are observed downstream of transcription start sites and are represented as grey ovals. The number below within each oval represents the distance in base pairs between adjacent peaks in the sense and anti-sense strands, corresponding to the size of the inferred nucleosome. No obvious pattern is observed for the genomic DNA control.
- FIG. 5A is a scatter plot graph showing the mean sequence tag density for each chromosome of all samples, including cell-free plasma DNA from pregnant women and male donor, as well as genomic DNA control from male donor, is plotted above. Exceptions are chromosomes 13, 18 and 21, where cell-free DNA samples from women carrying aneuploid fetuses are excluded. The error bars represent standard deviation. The chromosomes are ordered by their G/C content. G/C content of each chromosome relative to the genome-wide value (41%) is also plotted.
- FIG. 5B is a scatter plot of mean sequence tag density for each chromosome versus G/C content of the chromosome. The correlation coefficient is 0.927, and the correlation is statistically significant (p ⁇ 10 ⁇ 9 ).
- FIG. 5C is a scatter plot of the standard deviation of sequence tag density of each chromosome versus G/C content of the chromosome.
- the correlation coefficient between standard deviation of sequence tag density and the absolute deviation of chromosomal G/C content from the genome-wide G/C content is 0.963, and the correlation is statistically significant (p ⁇ 10-12).
- FIG. 6 is a scatter plot graph showing percent difference of chromosome X sequence tag density of all samples as compared to the median chromosome X sequence tag density of all female pregnancies. All male pregnancies show under-representation of chromosome X.
- FIG. 7 is a scatter plot graph showing a comparison of the estimation of fetal DNA fraction for cell-free DNA samples from 12 male pregnancies using sequencing data from chromosomes X and Y.
- the dashed line represents a simple linear regression line, with a slope of 0.85.
- FIG. 8 is a line graph showing length distribution of sequenced fragments from maternal cell-free plasma DNA sample of a normal male pregnancy at 1 bp resolution. Sequencing was done on the 454/Roche platform. Reads that have at least 90% mapping to the human genome with greater than or equal to 90% accuracy are retained, totaling 144992 reads. Y-axis represents the number of reads obtained. The median length is 177 bp while the mean length is 180 bp.
- FIG. 9 is a schematic illustrating how sequence tag distribution is used to detect the over and under-representation of any chromosome, i.e., a trisomy (over representation) or a missing chromosome (typically an X or Y chromosome, since missing autosomes are generally lethal).
- a trisomy over representation
- a missing chromosome typically an X or Y chromosome, since missing autosomes are generally lethal
- the normalized sequence tag density for chromosome 1 would be M1/N; for chromosome 22 it would be M22/N. Close examination of panel A, for example would show that towards the zero end of the chromosome, this procedure obtained about 175 reads per 50 kb window. In the middle, near the centromere, there were no reads, because this portion of the chromosome is ill defined in the human genome library.
- the normalized sequence tag density of each chromosome is M/N (e.g., chr 1:M1/N; chr 22:M22/N). Such normalization is necessary to compare different patient samples since the total number of sequence tags (thus, the sequence tag density) for each patient sample is different (the total number of sequence tags fluctuates between ⁇ 8 to ⁇ 12 million).
- the analysis thus flows from frequency of reads per coordinate (A and C) to # reads per window (B and D) to a combination of all chromosomes.
- FIG. 10 is a scatter plot graph showing data from different samples, as in FIG. 1 , except that bias for G/C sampling has been eliminated.
- FIG. 11 is a scatter plot graph showing the weight given to different sequence samples according to percentage of G/C content, with lower weight given to samples with a higher G/C content.
- G/C content ranges from about 30% to about 70%; weight can range over a factor of about 3.
- FIG. 12 is a scatter plot graph which illustrates results of selected patients as indicated on the x axis, and, for each patient, a distribution of chromosome representation on the Y axis, as deviating from a representative t statistic, indicated as zero.
- FIG. 13 is a scatter plot graph showing the minimum fetal DNA percentage of which over- or under-representation of a chromosome could be detected with a 99.9% confidence level for chromosomes 21, 18, 13 and Chr. X, and a value for all other chromosomes.
- FIG. 14 is a scatter plot graph showing a linear relationship between log10 of minimum fetal DNA percentage that is needed versus log10 of the number of reads required.
- Sequence tag density means the normalized value of sequence tags for a defined window of a sequence on a chromosome (in a preferred embodiment the window is about 50 kb), where the sequence tag density is used for comparing different samples and for subsequent analysis.
- a “sequence tag” is a DNA sequence of sufficient length that it may be assigned specifically to one of chromosomes 1-22, X or Y. It does not necessarily need to be, but may be non-repetitive within a single chromosome. A certain, small degree of mismatch (0-1) may be allowed to account for minor polymorphisms that may exist between the reference genome and the individual genomes (maternal and fetal) being mapped. The value of the sequence tag density is normalized within a sample.
- sequence tag density as calculated in this way would ideally be about 1 for a disomic chromosome.
- sequence tag densities can vary according to sequencing artifacts, most notably G/C bias; this is corrected as described. This method does not require the use of an external standard, but, rather, provides an internal reference, derived from al of the sequence tags (genomic sequences), which may be, for example, a single chromosome or a calculated value from all autosomes.
- T21 means trisomy 21.
- T18 means trisomy 18.
- T13 means trisomy 13.
- Aneuploidy is used in a general sense to mean the presence or absence of an entire chromosome, as well as the presence of partial chromosomal duplications or deletions or kilobase or greater size, as opposed to genetic mutations or polymorphisms where sequence differences exist.
- Massively parallel sequencing means techniques for sequencing millions of fragments of nucleic acids, e.g., using attachment of randomly fragmented genomic DNA to a planar, optically transparent surface and solid phase amplification to create a high density sequencing flow cell with millions of clusters, each containing ⁇ 1,000 copies of template per sq. cM. These templates are sequenced using four-color DNA sequencing-by-synthesis technology. See, products offered by Illumina, Inc., San Diego, Calif. In the present work, sequences were obtained, as described below, with an Illumina/Solexa 1G Genome Analyzer. The Solexa/Illumina method referred to below relies on the attachment of randomly fragmented genomic DNA to a planar, optically transparent surface.
- the plasma DNA does not need to be sheared. Attached DNA fragments are extended and bridge amplified to create an ultra-high density sequencing flow cell with ⁇ 50 million clusters, each containing ⁇ 1,000 copies of the same template. These templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. This novel approach ensures high accuracy and true base-by-base sequencing, eliminating sequence-context specific errors and enabling sequencing through homopolymers and repetitive sequences.
- High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Short sequence reads are aligned against a reference genome and genetic differences are called using specially developed data analysis pipeline software.
- Solexa's oligonucleotide adapters are ligated onto the fragments, yielding a fully-representative genomic library of DNA templates without cloning.
- Single molecule clonal amplification involves six steps: Template hybridization, template amplification, linearization, blocking 3′ ends, denaturation and primer hybridization.
- Solexa's Sequencing-by-Synthesis utilizes four proprietary nucleotides possessing reversible fluorophore and termination properties. Each sequencing cycle occurs in the presence of all four nucleotides.
- the presently used sequencing is preferably carried out without a preamplification or cloning step, but may be combined with amplification-based methods in a microfluidic chip having reaction chambers for both PCR and microscopic template-based sequencing. Only about 30 by of random sequence information are needed to identify a sequence as belonging to a specific human chromosome. Longer sequences can uniquely identify more particular targets. In the present case, a large number of 25 bp reads were obtained, and due to the large number of reads obtained, the 50% specificity enabled sufficient sequence tag representation.
- the complexity of the system lies primarily in the sample preparation and in the microfabricated, massively parallel platform, which contains 1.6 million picoliter-sized reactors in a 6.4-cm 2 slide.
- Sample preparation starts with fragmentation of the genomic DNA, followed by the attachment of adaptor sequences to the ends of the DNA pieces.
- the adaptors allow the DNA fragments to bind to tiny beads (around 28 ⁇ in diameter). This is done under conditions that allow only one piece of DNA to bind to each bead.
- the beads are encased in droplets of oil that contain all of the reactants needed to amplify the DNA using a standard tool called the polymerase chain reaction.
- the oil droplets form part of an emulsion so that each bead is kept apart from its neighbor, ensuring the amplification is uncontaminated.
- each bead ends up with roughly 10 million copies of its initial DNA fragment.
- the DNA-template-carrying beads are loaded into the picoliter reactor wells—each well having space for just one bead.
- the technique uses a sequencing-by-synthesis method developed by Uhlen and colleagues, in which DNA complementary to each template strand is synthesized.
- the nucleotide bases used for sequencing release a chemical group as the base forms a bond with the growing DNA chain, and this group drives a light-emitting reaction in the presence of specific enzymes and luciferin. Sequential washes of each of the four possible nucleotides are run over the plate, and a detector senses which of the wells emit light with each wash to determine the sequence of the growing strand. This method has been adopted commercially by 454 Life Sciences.
- Non-invasive prenatal diagnosis of aneuploidy has been a challenging problem because fetal DNA constitutes a small percentage of total DNA in maternal blood (13) and intact fetal cells are even rarer (6, 7, 9, 31, 32).
- fetal DNA constitutes a small percentage of total DNA in maternal blood (13) and intact fetal cells are even rarer (6, 7, 9, 31, 32).
- By directly sequencing maternal plasma DNA we could detect fetal trisomy 21 as early as 14th week of gestation.
- Using cell-free DNA instead of intact cells allows one to avoid complexities associated with microchimerism and foreign cells that might have colonized the mother; these cells occur at such low numbers that their contribution to the cell-free DNA is negligible (33, 34).
- cell-free fetal DNA clears from the blood to undetectable levels within a few hours of delivery and therefore is not carried forward from one pregnancy to the next (
- Rare forms of aneuploidy caused by unbalanced translocations and partial duplication of a chromosome are in principle detectable by the approach of shotgun sequencing, since the density of sequence tags in the triplicated region of the chromosome would be higher than the rest of the chromosome. Detecting incomplete aneuploidy caused by mosaicism is also possible in principle but may be more challenging, since it depends not only on the concentration of fetal DNA in maternal plasma but also the degree of fetal mosaicism. Further studies are required to determine the effectiveness of shotgun sequencing in detecting these rare forms of aneuploidy.
- the present method is applicable to large chromosomal deletions, such as 5p-Syndrome (five p minus), also known as Cat Cry Syndrome or Cri du Chat Syndrome.
- 5p-Syndrome is characterized at birth by a high-pitched cry, low birth weight, poor muscle tone, microcephaly, and potential medical complications.
- amenable disorders addressed by the present methods are p-, monosomy 9P, otherwise known as Alfi's Syndrome or 9P-, 22q11.2 deletion syndrome, Emanuel Syndrome, also known in the medical literature as the Supernumerary Der(22) Syndrome, trisomy 22, Unbalanced 11/22 Translocation or partial trisomy 11/22, Microdeletion and Microduplication at 16p11.2, which is associated with autism, and other deletions or imbalances, including those that are presently unknown.
- Mapping shotgun sequence information i.e., sequence information from a fragment whose physical genomic position is unknown
- Plasma DNA samples used in this study were obtained about 15 to 30 minutes after amniocentesis or chorionic villus sampling. Since these invasive procedures disrupt the interface between the placenta and maternal circulation, there have been discussions whether the amount of fetal DNA in maternal blood might increase following invasive procedures. Neither of the studies to date have observed a significant effect (41, 42).
- the average fetal DNA fraction estimated from sequencing data is higher than the values estimated from digital PCR data by an average factor of two (p ⁇ 0.005, paired t-test on all male pregnancies that have complete set of data).
- One possible explanation for this is that the PCR step during Solexa library preparation preferentially amplifies shorter fragments, which others have found to be enriched for fetal DNA (22, 23). Our own measurements of length distribution on one sample do not support this explanation, but nor can we reject it at this point. It should also be pointed out that using the sequence tags we find some variation of fetal fraction even in the same sample depending on which chromosome we use to make the calculation ( FIG. 7 , Table 1).
- nucleosome occupancy throughout the eukaryotic genome is not necessarily uniform and depends on factors such as function, expression, or sequence of the region (30, 43), the representation of sequences from different loci in cell-free maternal plasma may not be equal, as one usually expects in genomic DNA extracted from intact cells.
- the quantity of a particular locus may not be representative of the quantity of the entire chromosome and care must be taken when one designs assays for measuring gene dosage in cell-free maternal plasma DNA that target only a few loci.
- Shotgun sequencing can potentially reveal many more previously unknown features of cell-free nucleic acids such as plasma mRNA distributions, as well as epigenetic features of plasma DNA such as DNA methylation and histone modification, in fields including perinatology, oncology and transplantation, thereby improving our understanding of the basic biology of pregnancy, early human development and disease.
- sequencing equipment was used in the present illustrative examples, namely the Solexa/Illumina sequencing platform and the 454/Roche platform. It will be apparent to those skilled in the art that a number of different sequencing methods and variations can be used.
- One sequencing method that can be used to advantage in the present methods involves paired end sequencing. Fluorescently labeled sequencing primers could be used to simultaneously sequence both strands of a dsDNA template, as described e.g., in Wiemann et al. ( Anal. Biochem. 224: 117 [1995 ]; Anal. Biochem. 234: 166 [1996].
- Paired End reads are approximately 84-nucleotide DNA fragments that have a 44-mer adaptor sequence in the middle flanked by a 20-mer sequence on each side.
- the two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest.
- paired end reads By using paired end reads in the present method, one may obtain more sequence information from a given plasma DNA fragment, and, significantly, one may also obtain sequence information from both ends of the fragment.
- the fragment is mapped to the human genome as explained here elsewhere. After mapping both ends, one may deduce the length of the starting fragment. Since fetal DNA is known to be shorter than maternal DNA fragments circulating in plasma, one may use this information about the length of the DNA fragment to effectively increase the weight given to sequences obtained from shorter (e.g., about 300 by or less) DNA fragments. Methods for weighting are given below.
- Another method for increasing sensitivity to fetal DNA is to focus on certain regions within the human genome.
- Other microdeletions and microduplications are set forth in Table 1 of US 2005/0181410, published Aug. 18, 2005 under the title “Methods and apparatuses for achieving precision genetic diagnosis.”
- sequence-based methodologies such as sequencing by array, or capture beads with specific genomic sequences used as capture probes.
- sequence-based methodologies such as sequencing by array, or capture beads with specific genomic sequences used as capture probes.
- the use of a sequencing array can be implemented as described in Chetverin et al., “Oligonucleotide arrays: new concepts and possibilities,” Biotechnology (N Y). 1994 November; 12(11):1093-9, as well as Rothberg, US 2002/0012930 A1 entitled “Method of Sequencing a Nucleic Acid,” and Reeve et al., “Sequencing by Hybridization,” U.S. Pat. No. 6,399,364.
- the target nucleic acid to be sequenced may be genomic DNA, cDNA or RNA.
- the sample is rendered single stranded and captured under hybridizing conditions with a number of single stranded probes which are catalogued by bar coding or by physical separation in an array.
- Emulsion PCR as used in the 454 system, the SOLiD system, and Polonator (Dover Systems) and others may also be used, where capture is directed to specific target sequences, e.g., genome sequences mapping uniquely to chromosome 21 or other chromosome of interest, or to a chromosome region such as 15q11 (Prader-Willi syndrome), or excessive CGG repeats in the FMR1 gene (fragile X syndrome).
- the subsequencing method is in one aspect contrary to conventional massively parallel sequencing methodologies, which seek to obtain all of the sequence information in a sample.
- This alternative method selectively ignores certain sequence information by using a sequencing method which selectively captures sample molecules containing certain predefined sequences.
- the method proceeds as described below, where one obtains a large number of sequence reads from one or more reference chromosomes, which are compared to a large number of reads obtained from a chromosome of interest, after accounting for variations arising from chromosomal length, G/C content, repeat sequences and the like.
- the present methods involve analyzing sequence data in a defined chromosomal sliding “window,” such as contiguous, nonoverlapping 50 Kb regions spread across a chromosome.
- Partial trisomies of 13q, 8p (8p23.1), 7q, distal 6p, 5p, 3q (3q25.1), 2q, 1q (1q42.1 and 1q21-qter), partial Xpand monosomy 4q35.1 have been reported, among others.
- partial duplications of the long arm of chromosome 18 can result in Edwards syndrome in the case of a duplication of 18q21.1-qter (See, Mewar et al., “Clinical and molecular evaluation of four patients with partial duplications of the long arm of chromosome 18 ,” Am J Hum Genet. 1993 December; 53(6):1269-78).
- Plasma of DNA Input DNA* Tags P1 Plasma DNA ⁇ 47XX +21 35 1.6 761 8.0 8206694 P2 Plasma DNA ⁇ 47XY +21 18 1.4 585 5.2 7751384 P6 Plasma DNA ⁇ 47XX +21 14 1.6 410 4.3 6699183 P7 Plasma DNA ⁇ 47XY +21 18 2.2 266 3.8 8324473 P14 Plasma DNA ⁇ 47XX +21 23 3.2 57 1.2 8924944 P17 Plasma DNA ⁇ 47XX +21 16 2.3 210 3.2 11599833 P19 Plasma DNA ⁇ 46XY 18 3.2 333 7.0 7305417 P20 Plasma DNA ⁇ 47XY +21 18 1.3 408 3.6 11454876 P23 Plasma DNA ⁇ 46XY 10 1.6 258 2.7 11851612 P26 Plasma DNA ⁇ 46XY 13 3.0 340 6.7 1147
- the amount of DNA is in Plasma (cell equivalent/ml plasma)*.
- the approximate amount of input DNA is that use for Sequencing Library Construction (ng).
- ng Sequencing Library Construction
- each sample represents a different patient, e.g., P1 in the first row.
- the total number of sequence tags varied but was frequently was in the 10 million range, using the Solexa technology.
- the 454 technology used for P25 and P13 gave a lower number of reads.
- the median count per 50 kb window for each chromosome was selected.
- the median of the autosomal values i.e., 22 chromosomes
- the inter-chromosomal variation within each sample was also consistent among all samples (including genomic DNA control).
- the mean sequence tag density of each chromosome correlates with the G/C content of the chromosome (p ⁇ 10 ⁇ 9 ) ( FIG. 5A , 5 B).
- the standard deviation of sequence tag density for each chromosome also correlates with the absolute degree of deviation in chromosomal G/C content from the genome-wide G/C content (p ⁇ 10 ⁇ 12 ) ( FIG. 5A , 5 C).
- chromosome 21 sequence tag density for all 9 T21 pregnancies is clearly separated from that of pregnancies bearing disomy 21 fetuses (p ⁇ 10 ⁇ 5 ), Student's t-test) ( FIGS. 1A and 1B ).
- the coverage of chromosome 21 for T21 cases is about ⁇ 4-18% higher (average ⁇ 11%) than that of the disomy 21 cases.
- sequence tag density of chromosome 21 for T21 cases should be (1+ ⁇ /2) of that of disomy 21 pregnancies, where ⁇ is the fraction of total plasma DNA originating from the fetus, such increase in chromosome 21 coverage in T21 cases corresponds to a fetal DNA fraction of ⁇ 8% ⁇ 35% (average ⁇ 23%) (Table 1, FIG. 2 ).
- ⁇ is the fraction of total plasma DNA originating from the fetus
- Plasma DNA of pregnant women carrying T18 fetuses (2 cases) and a T13 fetus (1 case) were also directly sequenced. Over-representation was observed for chromosome 18 and chromosome 13 in T18 and T13 cases respectively ( FIG. 1A ). While there were not enough positive samples to measure a representative distribution, it is encouraging that all of these three positives are outliers from the distribution of disomy values. The T18 are large outliers and are clearly statistically significant (p ⁇ 10 ⁇ 7 ), while the statistical significance of the single T13 case is marginal (p ⁇ 0.05). Fetal DNA fraction was also calculated from the over-represented chromosome as described above ( FIG. 2 , Table 1).
- the fraction of fetal DNA in maternal cell-free plasma DNA is usually determined by comparing the amount of fetal specific locus (such as the SRY locus on chromosome Y in male pregnancies) to that of a locus on any autosome that is common to both the mother and the fetus using quantitative real-time PCR (13, 22, 23).
- fetal specific locus such as the SRY locus on chromosome Y in male pregnancies
- We applied a similar duplex assay on a digital PCR platform see Methods to compare the counts of the SRY locus and a locus on chromosome 1 in male pregnancies. SRY locus was not detectable in any plasma DNA samples from female pregnancies.
- digital PCR that for the majority samples, fetal DNA constituted ⁇ 10% of total DNA in maternal plasma (Table 2), agreeing with previously reported values (13).
- the percentage of fetal DNA among total cell-free DNA in maternal plasma can also be calculated from the density of sequence tags of the sex chromosomes for male pregnancies.
- sequence tag density of chromosome Y of plasma DNA from male pregnancies we estimated fetal DNA percentage to be on average ⁇ 19% (range: 4-44%) for all male pregnancies (Table 2, above, FIG. 2 ).
- sequence tag density of chromosome X in male pregnancies should be (1 ⁇ e/2) of that of female pregnancies, where e is fetal DNA fraction.
- nucleosome positioning around transcription start sites.
- Experimental data from yeast and human have suggested that nucleosomes are depleted in promoters upstream of transcription start sites and nucleosomes are well-positioned near transcription start sites (27-30).
- a peak in the sense strand represents the beginning of a nucleosome while a peak in the antisense strand represents the end.
- sequence tag numbers are treated statistically based on data from the reference human genome. That is, for example, sequence tags from fragments with higher GC content may be overrepresented, and suggest an aneuploidy where none exists.
- the sequence tag information itself may not be informative, since only a small portion of the fragment ordinarily will be sequenced, while it is the overall G/C content of the fragment that causes the bias.
- a method described in detail in Examples 8 and 10, for correcting for this bias, and this method may facilitate analysis of samples which otherwise would not produce statistically significant results.
- This method for correcting for G/C bias of sequence reads from massively parallel sequencing of a genome, comprises the step of dividing the genome into a number of windows within each chromosome and calculating the G/C content of each window. These windows need not be the same as the windows used for calculating sequence tag density; they may be on the order of 10 kb-30 kb in length, for example. One then calculates the relationship between sequence coverage and G/C content of each window by determining a number of reads per a given window and a G/C content of that window. The G/C content of each window is known from the human genome reference sequence. Certain windows will be ignored, i.e., with no reads or no G/C content.
- Microfluidic digital PCR was used to quantify the amount of total and fetal DNA using Taqman assays targeting at the EIF2C1 locus on chromosome 1 (Forward: 5′ GTTCGGCTTTCACCAGTCT 3′ (SEQ ID NO: 1); Reverse: 5′ CTCCATAGCTCTCCCCACTC 3′ (SEQ ID NO: 2); Probe: 5′ HEX-GCCCTGCCATGTGGAAGAT-BHQ1 3′ (SEQ ID NO: 3); amplicon size: 81 bp) and the SRY locus on chromosome Y (Forward: 5′ CGCTTAACATAGCAGAAGCA 3′ (SEQ ID NO: 4); Reverse: 5′ AGTTTCGAACTCTGGCACCT 3′ (SEQ ID NO: 5); Probe: 5′ FAM-TGTCGCACTCTCCTTGTTTTTGACA-BHQ1 3′ (SEQ ID NO: 6); amplicon size: 84 bp) respectively.
- a Taqman assay targeting at DYS14 (Forward: 5′ ATCGTCCATTTCCAGAATCA 3′ (SEQ ID NO: 6); Reverse: 5′ GTTGACAGCCGTGGAATC 3′ (SEQ ID NO: 7); Probe: 5′ FAM-TGCCACAGACTGAACTGAATGATTTTC-BHQ1 3′ (SEQ ID NO: 8); amplicon size: 84 bp), a multi-copy locus on chromosome Y, was used for the initial determination of fetal sex from cell-free plasma DNA with traditional real-time PCR.
- PCR reactions were performed with 1 ⁇ iQ Supermix (Bio-Rad), 0.1% Tween-20 (microfluidic digital PCR only), 300 nM primers, and 150 nM probes.
- the PCR thermal cycling protocol was 95 C for 10 min, followed by 40 cycles of 95 C for 15 s and 60 C for 1 min. Primers and probes were purchased form IDT.
- a total of 19 cell-free plasma DNA samples including 18 from pregnant women and 1 from a male blood donor, and genomic DNA sample from whole blood of the same male donor, were sequenced on the Solexa/Illumina platform. ⁇ 1 to 8 ng of DNA fragments extracted from 1.3 to 5.6 ml cell-free plasma was used for sequencing library preparation (Table 1). Library preparation was carried out according to manufacturer's protocol with slight modifications. Because cell-free plasma DNA was fragmented in nature, no further fragmentation by nebulization or sonication was done on plasma DNA samples.
- Genomic DNA from male donor's whole blood was sonicated (Misonix XL-2020) (24 cycles of 30 s sonication and 90 s pause), yielding fragments with size between 50 and 400 bp, with a peak at 150 bp. ⁇ 2 ng of the sonicated genomic DNA was used for library preparation. Briefly, DNA samples were blunt ended and ligated to universal adaptors. The amount of adaptors used for ligation was 500 times less than written on the manufacturer's protocol. 18 cycles of PCR were performed to enrich for fragments with adaptors using primers complementary to the adaptors.
- the size distributions of the sequencing libraries were analyzed with DNA 1000 Kit on the 2100 Bioanalyzer (Agilent) and quantified with microfluidic digital PCR (Fluidigm). The libraries were then sequenced using the Solexa 1G Genome Analyzer according to manufacturer's instructions.
- Cell-free plasma DNA from a pregnant woman carrying a normal male fetus was also sequenced on the 454/Roche platform. Fragments of DNA extracted from 5.6 ml of cell-free plasma (equivalent to ⁇ 4.9 ng of DNA) were used for sequencing library preparation.
- the sequencing library was prepared according to manufacturer's protocol, except that no nebulization was performed on the sample and quantification was done with microfluidic digital PCR instead of capillary electrophoresis.
- the library was then sequenced on the 454 Genome Sequencer FLX System according to manufacturer's instructions.
- Electropherograms of Solexa sequencing libraries were prepared from cell-free plasma DNA obtained from 18 pregnant women and 1 male donor. Solexa library prepared from sonicated whole blood genomic DNA from the male donor was also examined. For libraries prepared from cell-free DNA, all had peaks at average 261 bp (range: 256-264 bp). The actual peak size of DNA fragments in plasma DNA is ⁇ 168 bp (after removal of Solexa universal adaptor (92 bp)). This corresponds to the size of a chromatosome.
- Solexa sequencing produced 36 to 50 bp reads.
- the first 25 bp of each read was mapped to the human genome build 36 (hg18) using ELAND from the Solexa data analysis pipeline.
- the reads that were uniquely mapped to the human genome having at most 1 mismatch were retained for analysis.
- a sliding window of 50 kb was applied across each chromosome, except in regions of assembly gaps and microsatellites, and the number of sequence tags falling within each window was counted and the median value was chosen to be the representative of the chromosome.
- chromosome X fetal DNA was estimated as 2*(1 ⁇ x), where x was the ratio of chromosome X sequence tag density of each male pregnancy to the median chromosome X sequence tag density of all female pregnancies.
- chromosome Y fetal DNA fraction was estimated as the ratio of chromosome Y sequence tag density of each male pregnancy to that of male donor plasma DNA. Because a small number of chromosome Y sequences were detected in female pregnancies, we only considered sequence tags falling within transcribed regions on chromosome Y and subtracted the median number of tags in female pregnancies from all samples; this amounted to a correction of a few percent.
- a confidence interval gives an estimated range of values, which is likely to include an unknown population parameter, the estimated range being calculated from a given set of sample data. (Definition taken from Valerie J. Easton and John H. McColl's Statistics Glossary v1.1)
- sequence tags that mapped uniquely to the human genome with at most 1 mismatch (on average ⁇ 5 million) for analysis.
- the distribution of reads across each chromosome was examined. Because the distribution of sequence tags across each chromosome was non-uniform (possibly technical artifacts), we divided the length of each chromosome into non-overlapping sliding window with a fixed width (in this particular analysis, a 50 kbp window was used), skipping regions of genome assembly gaps and regions with known microsatellite repeats.
- the width of the window is should be large enough such that there are a sufficient number of sequence tags in each window, and should be small enough such that there are sufficient number of windows to form a distribution.
- the window width can be reduced.
- the number of sequence tags in each window was counted.
- the distribution of the number of sequence tags per 50 kb for each chromosome was examined.
- the median value of the number of sequence tags per 50 kb (or ‘sequence tag density’) for each chromosome was chosen in order to suppress the effects of any under- or over-represented regions within the chromosome. Because the total number of sequence tags obtained for each sample was different, in order to compare among samples, we normalized each chromosomal sequence tag density value (except chromosome Y) by the median sequence tag density among all autosomes (non-sex chromosomes).
- reads were aligned to the human genome build 36 (hg18, see hyper text transfer protocol (http) genome.ucsc.edu/cgi-bin/hgGateway) using the 454 Reference Mapper. Reads having accuracy of greater than or equal to 90% and coverage (i.e., fraction of read mapped) greater than or equal to 90% were retained for analysis. To study the size distribution of total and fetal DNA, the number of retained reads falling within each 10 bp window between 50 bp to 330 bp was counted.
- the number of reads falling within different size ranges may be studied, i.e., reads of between 50-60 bp, 60-70 bp, 70-80 bp, etc., up to about 320-330 bp, which is around the maximum read length obtained.
- TSS transcription start sites
- the distribution of sequence tags around transcription start sites (TSS) of RefSeq genes were analyzed (data not shown). The plots were similar to FIG. 4 . Each plot represented the distribution for each plasma DNA or gDNA sample. Data are obtained from three different sequencing runs (P1, P6, P52, P53, P26, P40, P42 were sequenced together; male genomic DNA, male plasma DNA, P2, P7, P14, P19, P31 were sequenced together; P17, P20, P23, P57, P59, P64 were sequenced together). The second batch of samples suffers greater G/C bias as observed from inter- and intra-chromosomal variation. Their distributions around TSS have similar trends with more tags at the TSS.
- Digital PCR is the amplification of single DNA molecule.
- DNA sample is diluted and distributed across multiple compartments such that on average there is less than 1 copy of DNA per compartment.
- a compartment displaying fluorescence at the end of a PCR represents the presence of at least one DNA molecule.
- the count of positive compartments from the microfluidic digital PCR chip of each assay is converted to the most probable count according to the method described in the supporting information of the following reference: Warren L, Bryder D, Weissman I L, Quake S R (2006) Transcription factor profiling in individual hematopoietic progenitors by digital RT-PCR. Proc Nat Acad Sci, 103: 17807-12.
- x be the ratio of ChrX sequence tag density of male to female pregnancies.
- the denominator of this ratio is taken to be the median sequence tag density of all female pregnancies.
- Fetal DNA fraction ⁇ (sequence tag density of ChrY in maternal plasma/sequence tag density of ChrY in male plasma)
- x be the ratio of trisomic chromosome sequence counts (or sequence tag density) of trisomic to disomic pregnancies.
- the denominator of this ratio is taken to be the median sequence tag density of all disomic pregnancies.
- This example shows a refinement of results indicating sequences mapping to different chromosomes and permitting the determination of the count of different chromosomes or regions thereof. That is, the results as shown in FIG. 1A may be corrected to eliminate the variations in sequence tag density shown for chromosomes higher in G/C content, shown towards the right of the Figure. This spread of values results from sequencing bias in the method used, where a greater number of reads tend to be obtained depending on G/C content.
- the results of the method of this example are shown in FIG. 10 .
- FIG. 10 is an overlay which shows the results from a number of different samples, as indicated in the legend.
- chromosome sequence tag densities can be seen as significantly above a median sequence tag density; disomic chromosomes are clustered about a line running along a density value of about 1.
- results from chromosome 19 far right, highest in G/C content
- Samples (such as P13 in the present study) which could not have been unambiguously interpreted now may be. Since G/C content is the opposite of A/T content, the present method will correct for both. Either G/C bias or A/T bias can result from different sequencing methods.
- an arbitrary window of known human genomic DNA sequence is chosen for determining G/C content of different reads.
- the window can be much smaller e.g., 10 kb or 5 kb, but a size of 20 kb makes computation easier.
- b Calculate the relationship between sequence coverage and G/C content. Assign weight to each read according to G/C content. For each sample, the number of read per 20 kb bin is counted. The number of read is plotted against G/C content. The average number of read is calculated for every 0.1% G/C content, ignoring bins with no reads, bins with zero G/C percent, and bins with over-abundant reads. The reciprocal of the average number of reads for a particular G/C percent relative to the global median number of read is calculated as the weight. Each read is then assigned a weight depending on the G/C percent of the 20 kb window it falls into.
- FIG. 12 illustrates the results of an analysis of patients P13, P19, P31, P23, P26, P40, P42, P1, P2, P6, P7, P14, P17, P20, P52, P53, P57, P59 and P64, with their respective karyotypes indicated, as in Table 1, above.
- the dotted line shows the 99% confidence interval, and outliers may be quickly identified. It may be seen by looking below the line that male fetuses have less chromosome X (solid triangles). An exception is P19, where it is believed that there were not enough total reads for this analysis.
- Step 1 Calculate at statistic for each chromosome relative to all other chromosome in a sample.
- Each t statistic tells the value of each chromosome median relative to other chromosomes, taking into account the number of reads mapped to each chromosome (since the variation of the median scales with the number of reads).
- the present analyses yielded about 5 million reads per sample. Although one may obtain 3-10 million reads per sample, these are short reads, typically only about 20-100 bp, so one has actually only sequenced, for example about 300 million of the 3 billion by in the human genome.
- Step 2 Calculate the average t statistic matrix by averaging the values from all samples with disomic chromosomes.
- Each patient sample data is placed in at matrix, where the row is chr1 to chr22, and the column is also chr1 to chr22.
- Each cell represents the t value when comparing the chromosomes in the corresponding row and column (i.e., position (2,1) in the matrix is the t-value of when testing chr2 and chr1) the diagonal of the matrix is 0 and the matrix is symmetric.
- the number of reads mapping to a chromosome is compared individually to each of chr1-22.
- Step 3 Subtract the average t statistic matrix from the t statistic matrix of each patient sample. For each chromosome, the median of the difference in t statistic is selected as the representative value.
- the t statistic for 99% confidence for large number of samples is 3.09. Any chromosome with a representative t statistic outside ⁇ 3.09 to 3.09 is determined as non-disomic.
- FIG. 13 and FIG. 14 show results obtained from 19 patient plasma DNA samples, 1 donor plasma DNA sample, and duplicate runs of a donor gDNA sample. It is estimated in FIG. 13 that the minimum fetal DNA % of which over-representation of chr21 can be detected at the best sampling rate ( ⁇ 70k reads mapped to chr21) is ⁇ 6%. (indicated by solid lines in FIG. 13 ). The lines are drawn between about 0.7 ⁇ 10 5 reads and 6% fetal DNA concentration. It can be expected that higher numbers of reads (not exemplified here) the needed fetal DNA percentage will drop, probably to about 4%.
- FIG. 14 the data from FIG. 13 are presented in a logarithmic scale. This shows that the minimum required fetal DNA concentration scales linearly with the number of reads in a square root relationship (slope of ⁇ 0.5).
- y 2 ⁇ y 1 is the difference in means (or amount of over- or under-representation of a particular chromosome) to be measured;
- s is the standard deviation of the number of reads per 50 kb in a particular chromosome;
- the 99.9% confidence interval of the median for each chromosome is estimated from bootstrapping 5000 samples from the 50 kb read distribution data using the percentile method.
- the half width of the confidence interval is estimated as 0.5*confidence interval.
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/560,708 US20100112575A1 (en) | 2008-09-20 | 2009-09-16 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
US12/696,509 US8195415B2 (en) | 2008-09-20 | 2010-01-29 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/102,717 US8682594B2 (en) | 2008-09-20 | 2011-05-06 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/218,317 US20110319272A1 (en) | 2008-09-20 | 2011-08-25 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
US13/452,083 US8296076B2 (en) | 2008-09-20 | 2012-04-20 | Noninvasive diagnosis of fetal aneuoploidy by sequencing |
US13/921,881 US9404157B2 (en) | 2008-09-20 | 2013-06-19 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US14/168,714 US9353414B2 (en) | 2008-09-20 | 2014-01-30 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US15/195,135 US10669585B2 (en) | 2008-09-20 | 2016-06-28 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US16/852,663 US20200270700A1 (en) | 2008-09-20 | 2020-04-20 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US9875808P | 2008-09-20 | 2008-09-20 | |
US12/560,708 US20100112575A1 (en) | 2008-09-20 | 2009-09-16 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/696,509 Division US8195415B2 (en) | 2008-09-20 | 2010-01-29 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/218,317 Continuation US20110319272A1 (en) | 2008-09-20 | 2011-08-25 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
Publications (1)
Publication Number | Publication Date |
---|---|
US20100112575A1 true US20100112575A1 (en) | 2010-05-06 |
Family
ID=42040105
Family Applications (9)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/560,708 Abandoned US20100112575A1 (en) | 2008-09-20 | 2009-09-16 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
US12/696,509 Active US8195415B2 (en) | 2008-09-20 | 2010-01-29 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/102,717 Active US8682594B2 (en) | 2008-09-20 | 2011-05-06 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/218,317 Abandoned US20110319272A1 (en) | 2008-09-20 | 2011-08-25 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
US13/452,083 Active US8296076B2 (en) | 2008-09-20 | 2012-04-20 | Noninvasive diagnosis of fetal aneuoploidy by sequencing |
US13/921,881 Active US9404157B2 (en) | 2008-09-20 | 2013-06-19 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US14/168,714 Active US9353414B2 (en) | 2008-09-20 | 2014-01-30 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US15/195,135 Active 2029-09-29 US10669585B2 (en) | 2008-09-20 | 2016-06-28 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US16/852,663 Pending US20200270700A1 (en) | 2008-09-20 | 2020-04-20 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
Family Applications After (8)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/696,509 Active US8195415B2 (en) | 2008-09-20 | 2010-01-29 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/102,717 Active US8682594B2 (en) | 2008-09-20 | 2011-05-06 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US13/218,317 Abandoned US20110319272A1 (en) | 2008-09-20 | 2011-08-25 | Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing |
US13/452,083 Active US8296076B2 (en) | 2008-09-20 | 2012-04-20 | Noninvasive diagnosis of fetal aneuoploidy by sequencing |
US13/921,881 Active US9404157B2 (en) | 2008-09-20 | 2013-06-19 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US14/168,714 Active US9353414B2 (en) | 2008-09-20 | 2014-01-30 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US15/195,135 Active 2029-09-29 US10669585B2 (en) | 2008-09-20 | 2016-06-28 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US16/852,663 Pending US20200270700A1 (en) | 2008-09-20 | 2020-04-20 | Noninvasive diagnosis of fetal aneuploidy by sequencing |
Country Status (17)
Country | Link |
---|---|
US (9) | US20100112575A1 (fr) |
EP (5) | EP3751005A3 (fr) |
AU (1) | AU2009293354B2 (fr) |
CA (4) | CA3069082C (fr) |
CY (2) | CY1118802T1 (fr) |
DK (2) | DK2562268T3 (fr) |
ES (2) | ES2620294T3 (fr) |
HK (1) | HK1217354A1 (fr) |
HR (2) | HRP20170435T1 (fr) |
HU (2) | HUE031849T2 (fr) |
IL (2) | IL211794A (fr) |
LT (2) | LT2562268T (fr) |
PL (2) | PL2334812T3 (fr) |
PT (2) | PT2562268T (fr) |
SG (1) | SG10201500567VA (fr) |
SI (2) | SI2334812T1 (fr) |
WO (1) | WO2010033578A2 (fr) |
Cited By (117)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080138809A1 (en) * | 2006-06-14 | 2008-06-12 | Ravi Kapur | Methods for the Diagnosis of Fetal Abnormalities |
US20090029377A1 (en) * | 2007-07-23 | 2009-01-29 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
US20100112590A1 (en) * | 2007-07-23 | 2010-05-06 | The Chinese University Of Hong Kong | Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment |
US20100124752A1 (en) * | 2006-02-02 | 2010-05-20 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US20100216153A1 (en) * | 2004-02-27 | 2010-08-26 | Helicos Biosciences Corporation | Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities |
US20100304978A1 (en) * | 2009-01-26 | 2010-12-02 | David Xingfei Deng | Methods and compositions for identifying a fetal cell |
US20110033862A1 (en) * | 2008-02-19 | 2011-02-10 | Gene Security Network, Inc. | Methods for cell genotyping |
US20110092763A1 (en) * | 2008-05-27 | 2011-04-21 | Gene Security Network, Inc. | Methods for Embryo Characterization and Comparison |
US20110178719A1 (en) * | 2008-08-04 | 2011-07-21 | Gene Security Network, Inc. | Methods for Allele Calling and Ploidy Calling |
WO2011090559A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Méthodes de séquençage et compositions de diagnostic prénatal |
WO2011090556A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Procédés pour déterminer une fraction d'acide nucléique fœtal dans des échantillons maternels |
WO2011091046A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Identification de cellules polymorphes dans des mélanges d'adn génomique par séquençage du génome entier |
US8168389B2 (en) | 2006-06-14 | 2012-05-01 | The General Hospital Corporation | Fetal cell analysis using sample splitting |
WO2012078792A2 (fr) | 2010-12-07 | 2012-06-14 | Stanford University | Détermination non invasive de l'héritage foetal des haplotypes parentaux à l'échelle du génome |
US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US20130029852A1 (en) * | 2010-01-19 | 2013-01-31 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US20130130921A1 (en) * | 2011-05-31 | 2013-05-23 | Berry Genomics Co., Ltd. | Kit, a Device and a Method for Detecting Copy Number of Fetal Chromosomes or Tumor Cell Chromosomes |
WO2013086352A1 (fr) * | 2011-12-07 | 2013-06-13 | Chronix Biomedical | Biomarqueurs pour acides nucléiques circulants associés au cancer de la prostate prostate cancer associated circulating nucleic acid biomarkers |
US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
CN103374518A (zh) * | 2012-04-12 | 2013-10-30 | 维里纳塔健康公司 | 拷贝数变异的检测和分类 |
US8682592B2 (en) | 2005-11-26 | 2014-03-25 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US8688388B2 (en) * | 2011-10-11 | 2014-04-01 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US8700338B2 (en) | 2011-01-25 | 2014-04-15 | Ariosa Diagnosis, Inc. | Risk calculation for evaluation of fetal aneuploidy |
US8712697B2 (en) | 2011-09-07 | 2014-04-29 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
US8756020B2 (en) | 2011-01-25 | 2014-06-17 | Ariosa Diagnostics, Inc. | Enhanced risk probabilities using biomolecule estimations |
US20140228226A1 (en) * | 2011-09-21 | 2014-08-14 | Bgi Health Service Co., Ltd. | Method and system for determining chromosome aneuploidy of single cell |
US8825412B2 (en) | 2010-05-18 | 2014-09-02 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US20140336075A1 (en) * | 2011-12-17 | 2014-11-13 | Bgi Diagnosis Co., Ltd. | Method and system for determinining whether genome is abnormal |
US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
US9163282B2 (en) | 2010-05-18 | 2015-10-20 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
EP2948886A2 (fr) * | 2013-01-25 | 2015-12-02 | Sequenom, Inc. | Procédés et processus d'évaluation non invasive de variations génétiques |
US9206417B2 (en) | 2012-07-19 | 2015-12-08 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
US9228234B2 (en) | 2009-09-30 | 2016-01-05 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
KR101614471B1 (ko) * | 2013-02-28 | 2016-04-21 | 주식회사 테라젠이텍스 | 유전체 서열분석을 이용한 태아 염색체 이수성의 진단 방법 및 장치 |
US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9367663B2 (en) * | 2011-10-06 | 2016-06-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9424392B2 (en) | 2005-11-26 | 2016-08-23 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
US9499870B2 (en) | 2013-09-27 | 2016-11-22 | Natera, Inc. | Cell free DNA diagnostic testing standards |
US9547748B2 (en) | 2011-06-29 | 2017-01-17 | Bgi Health Service Co., Ltd. | Method for determining fetal chromosomal abnormality |
US9567639B2 (en) | 2010-08-06 | 2017-02-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
JP2017073144A (ja) * | 2011-10-06 | 2017-04-13 | セクエノム, インコーポレイテッド | 遺伝的変異の非侵襲的評価のための方法およびプロセス |
US9677118B2 (en) | 2014-04-21 | 2017-06-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US9890421B2 (en) | 2010-08-06 | 2018-02-13 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
US9984198B2 (en) | 2011-10-06 | 2018-05-29 | Sequenom, Inc. | Reducing sequence read count error in assessment of complex genetic variations |
US9994897B2 (en) | 2013-03-08 | 2018-06-12 | Ariosa Diagnostics, Inc. | Non-invasive fetal sex determination |
US10011870B2 (en) | 2016-12-07 | 2018-07-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US10081839B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10083273B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10095831B2 (en) | 2016-02-03 | 2018-10-09 | Verinata Health, Inc. | Using cell-free DNA fragment size to determine copy number variations |
US10113196B2 (en) | 2010-05-18 | 2018-10-30 | Natera, Inc. | Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping |
US10131951B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
US10131947B2 (en) | 2011-01-25 | 2018-11-20 | Ariosa Diagnostics, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
US10167508B2 (en) | 2010-08-06 | 2019-01-01 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities |
US10179937B2 (en) | 2014-04-21 | 2019-01-15 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US10196681B2 (en) | 2011-10-06 | 2019-02-05 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10233496B2 (en) | 2010-08-06 | 2019-03-19 | Ariosa Diagnostics, Inc. | Ligation-based detection of genetic variants |
US10262755B2 (en) | 2014-04-21 | 2019-04-16 | Natera, Inc. | Detecting cancer mutations and aneuploidy in chromosomal segments |
US10289800B2 (en) | 2012-05-21 | 2019-05-14 | Ariosa Diagnostics, Inc. | Processes for calculating phased fetal genomic sequences |
US10318704B2 (en) | 2014-05-30 | 2019-06-11 | Verinata Health, Inc. | Detecting fetal sub-chromosomal aneuploidies |
US10316362B2 (en) | 2010-05-18 | 2019-06-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10364467B2 (en) | 2015-01-13 | 2019-07-30 | The Chinese University Of Hong Kong | Using size and number aberrations in plasma DNA for detecting cancer |
US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US10424394B2 (en) | 2011-10-06 | 2019-09-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10438691B2 (en) | 2013-10-07 | 2019-10-08 | Sequenom, Inc. | Non-invasive assessment of chromosome alterations using change in subsequence mappability |
US10457995B2 (en) | 2012-09-04 | 2019-10-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10482994B2 (en) | 2012-10-04 | 2019-11-19 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10497461B2 (en) | 2012-06-22 | 2019-12-03 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10504613B2 (en) | 2012-12-20 | 2019-12-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10526658B2 (en) | 2010-05-18 | 2020-01-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10533223B2 (en) | 2010-08-06 | 2020-01-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
US10577655B2 (en) | 2013-09-27 | 2020-03-03 | Natera, Inc. | Cell free DNA diagnostic testing standards |
US10591391B2 (en) | 2006-06-14 | 2020-03-17 | Verinata Health, Inc. | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
US10622094B2 (en) | 2013-06-21 | 2020-04-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10643738B2 (en) | 2013-01-10 | 2020-05-05 | The Chinese University Of Hong Kong | Noninvasive prenatal molecular karyotyping from maternal plasma |
US10669585B2 (en) | 2008-09-20 | 2020-06-02 | The Board Of Trustees Of The Leland Stanford Junior University | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US10699800B2 (en) | 2013-05-24 | 2020-06-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10704086B2 (en) | 2014-03-05 | 2020-07-07 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10704090B2 (en) | 2006-06-14 | 2020-07-07 | Verinata Health, Inc. | Fetal aneuploidy detection by sequencing |
US10741269B2 (en) | 2013-10-21 | 2020-08-11 | Verinata Health, Inc. | Method for improving the sensitivity of detection in determining copy number variations |
CN111627498A (zh) * | 2020-05-21 | 2020-09-04 | 北京吉因加医学检验实验室有限公司 | 一种测序数据gc偏向性校正的方法及其装置 |
US10801063B2 (en) | 2013-12-28 | 2020-10-13 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US10894976B2 (en) | 2017-02-21 | 2021-01-19 | Natera, Inc. | Compositions, methods, and kits for isolating nucleic acids |
US10894974B2 (en) | 2012-09-04 | 2021-01-19 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10930368B2 (en) | 2013-04-03 | 2021-02-23 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10964409B2 (en) | 2013-10-04 | 2021-03-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11004537B2 (en) | 2011-06-24 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non invasive assessment of a genetic variation |
US11001884B2 (en) | 2011-10-06 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11031095B2 (en) | 2010-08-06 | 2021-06-08 | Ariosa Diagnostics, Inc. | Assay systems for determination of fetal copy number variation |
US11072814B2 (en) | 2014-12-12 | 2021-07-27 | Verinata Health, Inc. | Using cell-free DNA fragment size to determine copy number variations |
US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11168370B2 (en) | 2015-02-10 | 2021-11-09 | The Chinese University Of Hong Kong | Detecting mutations for cancer screening |
US11200963B2 (en) | 2016-07-27 | 2021-12-14 | Sequenom, Inc. | Genetic copy number alteration classifications |
US11203786B2 (en) | 2010-08-06 | 2021-12-21 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
US11242569B2 (en) | 2015-12-17 | 2022-02-08 | Guardant Health, Inc. | Methods to determine tumor gene copy number by analysis of cell-free DNA |
US11261494B2 (en) * | 2012-06-21 | 2022-03-01 | The Chinese University Of Hong Kong | Method of measuring a fractional concentration of tumor DNA |
US11270781B2 (en) | 2011-01-25 | 2022-03-08 | Ariosa Diagnostics, Inc. | Statistical analysis for non-invasive sex chromosome aneuploidy determination |
US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
US11525159B2 (en) | 2018-07-03 | 2022-12-13 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
US11525134B2 (en) | 2017-10-27 | 2022-12-13 | Juno Diagnostics, Inc. | Devices, systems and methods for ultra-low volume liquid biopsy |
US11694768B2 (en) | 2017-01-24 | 2023-07-04 | Sequenom, Inc. | Methods and processes for assessment of genetic variations |
US11697849B2 (en) | 2012-01-20 | 2023-07-11 | Sequenom, Inc. | Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions |
US11783911B2 (en) | 2014-07-30 | 2023-10-10 | Sequenom, Inc | Methods and processes for non-invasive assessment of genetic variations |
US11854666B2 (en) | 2016-09-29 | 2023-12-26 | Myriad Women's Health, Inc. | Noninvasive prenatal screening using dynamic iterative depth optimization |
US11913065B2 (en) | 2012-09-04 | 2024-02-27 | Guardent Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
Families Citing this family (73)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9186685B2 (en) | 2012-01-13 | 2015-11-17 | The University Of British Columbia | Multiple arm apparatus and methods for separation of particles |
US8529744B2 (en) | 2004-02-02 | 2013-09-10 | Boreal Genomics Corp. | Enrichment of nucleic acid targets |
US8518228B2 (en) | 2011-05-20 | 2013-08-27 | The University Of British Columbia | Systems and methods for enhanced SCODA |
US10337054B2 (en) | 2004-02-02 | 2019-07-02 | Quantum-Si Incorporated | Enrichment of nucleic acid targets |
JP2007526823A (ja) | 2004-02-02 | 2007-09-20 | ザ ユニバーシティ オブ ブリティッシュ コロンビア | 粒子を運動および濃縮させるためのスコダ泳動ならびに方法および装置 |
US8024128B2 (en) * | 2004-09-07 | 2011-09-20 | Gene Security Network, Inc. | System and method for improving clinical decisions by aggregating, validating and analysing genetic and phenotypic data |
US20070178501A1 (en) * | 2005-12-06 | 2007-08-02 | Matthew Rabinowitz | System and method for integrating and validating genotypic, phenotypic and medical information into a database according to a standardized ontology |
US20070027636A1 (en) * | 2005-07-29 | 2007-02-01 | Matthew Rabinowitz | System and method for using genetic, phentoypic and clinical data to make predictions for clinical or lifestyle decisions |
US8515679B2 (en) * | 2005-12-06 | 2013-08-20 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
WO2009033178A1 (fr) | 2007-09-07 | 2009-03-12 | Fluidigm Corporation | Détermination de la variation du nombre de copies, procédés et systèmes |
US8475641B2 (en) | 2008-02-01 | 2013-07-02 | The University Of British Columbia | Methods and apparatus for particle introduction and recovery |
US8476013B2 (en) | 2008-09-16 | 2013-07-02 | Sequenom, Inc. | Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
US8962247B2 (en) * | 2008-09-16 | 2015-02-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
US8877028B2 (en) | 2009-04-21 | 2014-11-04 | The University Of British Columbia | System and methods for detection of particles |
ES2564656T3 (es) | 2009-10-26 | 2016-03-28 | Lifecodexx Ag | Medios y métodos para el diagnóstico no invasivo de la aneuploidía cromosómica |
WO2011087760A2 (fr) | 2009-12-22 | 2011-07-21 | Sequenom, Inc. | Procédés et kits pour identifier une aneuploïdie |
WO2011130880A1 (fr) * | 2010-04-23 | 2011-10-27 | 深圳华大基因科技有限公司 | Procédé de détection de l'aneuploïdie chromosomique fœtale |
ES2552343T3 (es) * | 2010-08-13 | 2015-11-27 | Bgi Genomics Co., Ltd. | Un procedimiento para el análisis de cromosomas de células |
CA2809055A1 (fr) * | 2010-08-24 | 2012-03-01 | Biodx, Inc. | Definition de cibles diagnostiques et therapeutiques d'adn foetal libre flottant conserve dans la circulation sanguine maternelle |
CN102985561B (zh) * | 2011-04-14 | 2015-04-01 | 维里纳塔健康公司 | 用于确定并且验证常见的和罕见的染色体非整倍性的归一化染色体 |
KR101974492B1 (ko) * | 2011-07-26 | 2019-05-02 | 베리나타 헬스, 인코포레이티드 | 샘플 중 상이한 이수성의 존재 또는 부재를 결정하는 방법 |
ES2651612T3 (es) | 2011-10-18 | 2018-01-29 | Multiplicom Nv | Diagnóstico de aneuploidía cromosómica fetal |
WO2013060762A1 (fr) * | 2011-10-25 | 2013-05-02 | Roche Diagnostics Gmbh | Méthode pour diagnostiquer une maladie basée sur la distribution de l'adn plasmatique |
US9845552B2 (en) | 2011-10-27 | 2017-12-19 | Verinata Health, Inc. | Set membership testers for aligning nucleic acid samples |
KR101922129B1 (ko) | 2011-12-05 | 2018-11-26 | 삼성전자주식회사 | 차세대 시퀀싱을 이용하여 획득된 유전 정보를 압축 및 압축해제하는 방법 및 장치 |
EP2826865B8 (fr) * | 2012-01-20 | 2017-08-16 | BGI Genomics Co., Ltd. | Procédé et système pour déterminer s'il existe une variabilité du nombre de copies dans un génome échantillon, et support lisible par ordinateur |
EP4155401A1 (fr) * | 2012-03-02 | 2023-03-29 | Sequenom, Inc. | Méthodes et procédés d'évaluation non invasive de variations génétiques |
US9892230B2 (en) | 2012-03-08 | 2018-02-13 | The Chinese University Of Hong Kong | Size-based analysis of fetal or tumor DNA fraction in plasma |
AU2013232123B2 (en) | 2012-03-13 | 2014-10-30 | The Chinese University Of Hong Kong | Methods for analyzing massively parallel sequencing data for noninvasive prenatal diagnosis |
EP4239081A3 (fr) * | 2012-03-26 | 2023-11-08 | The Johns Hopkins University | Détection rapide d'aneuploïdie |
EP2844773B1 (fr) | 2012-05-04 | 2017-08-16 | Boreal Genomics Corp. | Analyse de biomarqueurs utilisant la scodaphorèse |
CA2878979C (fr) | 2012-07-13 | 2021-09-14 | Sequenom, Inc. | Procedes et compositions pour enrichissement base sur la methylation en acide nucleique foetal dans un echantillon maternel, utiles pour les diagnostics prenatals non invasifs |
KR101890466B1 (ko) | 2012-07-24 | 2018-08-21 | 내테라, 인코포레이티드 | 고도의 다중 pcr 방법 및 조성물 |
TWI489305B (zh) * | 2012-11-21 | 2015-06-21 | Bgi Diagnosis Co Ltd | 對胎兒遺傳異常的無創性檢測 |
WO2014168711A1 (fr) | 2013-03-13 | 2014-10-16 | Sequenom, Inc. | Amorces pour analyse de la méthylation de l'adn |
US9340835B2 (en) | 2013-03-15 | 2016-05-17 | Boreal Genomics Corp. | Method for separating homoduplexed and heteroduplexed nucleic acids |
US10017807B2 (en) * | 2013-03-15 | 2018-07-10 | Verinata Health, Inc. | Generating cell-free DNA libraries directly from blood |
WO2015006932A1 (fr) * | 2013-07-17 | 2015-01-22 | 深圳华大基因科技有限公司 | Procédé et dispositif de détection d'une aneuploïdie chromosomique |
US10851414B2 (en) * | 2013-10-18 | 2020-12-01 | Good Start Genetics, Inc. | Methods for determining carrier status |
CN103525939B (zh) * | 2013-10-28 | 2015-12-02 | 博奥生物集团有限公司 | 无创检测胎儿染色体非整倍体的方法和系统 |
EP3117011B1 (fr) | 2014-03-13 | 2020-05-06 | Sequenom, Inc. | Méthodes et procédés d'évaluation non invasive de variations génétiques |
WO2015181718A1 (fr) * | 2014-05-26 | 2015-12-03 | Ebios Futura S.R.L. | Procédé de diagnostic prénatal |
US20160026759A1 (en) * | 2014-07-22 | 2016-01-28 | Yourgene Bioscience | Detecting Chromosomal Aneuploidy |
WO2016015058A2 (fr) | 2014-07-25 | 2016-01-28 | University Of Washington | Procédés de détermination de types de tissus et/ou de cellules permettant d'obtenir de l'adn sans cellules, et procédés d'identification d'une maladie ou d'un trouble les employant |
US10395759B2 (en) | 2015-05-18 | 2019-08-27 | Regeneron Pharmaceuticals, Inc. | Methods and systems for copy number variant detection |
WO2016185284A1 (fr) | 2015-05-20 | 2016-11-24 | Boreal Genomics, Inc. | Procédé pour isoler un acide nucléique cible à l'aide des protéines de liaison hétéroduplexes |
WO2016189388A1 (fr) | 2015-05-22 | 2016-12-01 | Nipd Genetics Ltd | Analyse parallèle multiplexée de régions génomiques ciblées pour des tests prénataux non invasifs |
EP3118323A1 (fr) | 2015-07-13 | 2017-01-18 | Cartagenia N.V. | Système et méthodologie pour l'analyse de données génomiques obtenues à partir d'un sujet |
WO2017009372A2 (fr) | 2015-07-13 | 2017-01-19 | Cartagenia Nv | Système et méthodologie pour l'analyse de données génomiques obtenues auprès d'un sujet |
CA3014070C (fr) | 2016-03-25 | 2023-03-14 | Karius, Inc. | Spike-ins d'acides nucleiques synthetiques |
US10697008B2 (en) | 2017-04-12 | 2020-06-30 | Karius, Inc. | Sample preparation methods, systems and compositions |
US11342047B2 (en) | 2017-04-21 | 2022-05-24 | Illumina, Inc. | Using cell-free DNA fragment size to detect tumor-associated variant |
EP3649258B1 (fr) | 2017-07-07 | 2022-05-04 | Nipd Genetics Public Company Limited | Analyse parallèle multiplexée enrichie en cible pour l'évaluation d'échantillons d'adn f tal |
US20200157602A1 (en) | 2017-07-07 | 2020-05-21 | Nipd Genetics Public Company Limited | Enrichment of targeted genomic regions for multiplexed parallel analysis |
WO2019008167A1 (fr) | 2017-07-07 | 2019-01-10 | Nipd Genetics Public Company Limited | Analyse parallèle multiplexée enrichie en cible pour évaluation du risque pour des troubles génétiques |
WO2019008172A1 (fr) | 2017-07-07 | 2019-01-10 | Nipd Genetics Public Company Limited | Analyse parallèle multiplexée enrichie en cible pour l'évaluation de biomarqueurs tumoraux |
HUE055063T2 (hu) | 2017-07-26 | 2021-10-28 | Trisomytest S R O | Eljárás magzati kromoszóma aneuploidia nem-invazív azonosítására születés elõtt anyai vérbõl Bayes-háló alapján |
US11519024B2 (en) | 2017-08-04 | 2022-12-06 | Billiontoone, Inc. | Homologous genomic regions for characterization associated with biological targets |
CN111051511A (zh) | 2017-08-04 | 2020-04-21 | 十亿至一公司 | 用于与生物靶相关的表征的靶相关分子 |
EP3662479A1 (fr) | 2017-08-04 | 2020-06-10 | Trisomytest, s.r.o. | Procédé de détection prénatale non invasive d'anomalies chromosomiques du sexe du foetus et de détermination du sexe du foetus en vue d'une grossesse unique et d'une grossesse gémellaire |
US11430543B2 (en) | 2017-08-04 | 2022-08-30 | Billiontoone, Inc. | Sequencing output determination and analysis with target-associated molecules in quantification associated with biological targets |
EP3735470B1 (fr) | 2018-01-05 | 2023-11-22 | BillionToOne, Inc. | Modèles de contrôle de qualité pour garantir la validité d'essais à base d'un séquençage |
JP2021520816A (ja) | 2018-04-14 | 2021-08-26 | ナテラ, インコーポレイテッド | 循環腫瘍dnaの個別化された検出を用いる癌検出およびモニタリングの方法 |
GB201810571D0 (en) | 2018-06-27 | 2018-08-15 | Cs Genetics Ltd | Reagents and methods for the analysis of circulating microparticles |
CA3118990A1 (fr) | 2018-11-21 | 2020-05-28 | Karius, Inc. | Procedes, systemes et compositions de bibliotheque directe |
WO2020131699A2 (fr) | 2018-12-17 | 2020-06-25 | Natera, Inc. | Procédés d'analyse de cellules circulantes |
CN109637586B (zh) * | 2018-12-27 | 2020-11-17 | 北京优迅医学检验实验室有限公司 | 测序深度的矫正方法及装置 |
CN109628579B (zh) * | 2019-01-13 | 2022-11-15 | 清华大学 | 一种确定生物体样本中染色体数量是否异常的检测方法 |
GB201909325D0 (en) | 2019-06-28 | 2019-08-14 | Cs Genetics Ltd | Reagents and methods for analysis for microparticles |
CN111755068B (zh) * | 2020-06-19 | 2021-02-19 | 深圳吉因加医学检验实验室 | 基于测序数据识别肿瘤纯度和绝对拷贝数的方法及装置 |
AU2022261868A1 (en) | 2021-04-22 | 2023-10-26 | Natera, Inc. | Methods for determining velocity of tumor growth |
AU2022323972A1 (en) | 2021-08-02 | 2024-01-25 | Natera, Inc. | Methods for detecting neoplasm in pregnant women |
WO2023133131A1 (fr) | 2022-01-04 | 2023-07-13 | Natera, Inc. | Procédés de détection et de suivi du cancer |
Citations (96)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4800159A (en) * | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
US5296375A (en) * | 1992-05-01 | 1994-03-22 | Trustees Of The University Of Pennsylvania | Mesoscale sperm handling devices |
US5486335A (en) * | 1992-05-01 | 1996-01-23 | Trustees Of The University Of Pennsylvania | Analysis based on flow restriction |
US5498392A (en) * | 1992-05-01 | 1996-03-12 | Trustees Of The University Of Pennsylvania | Mesoscale polynucleotide amplification device and method |
US5707799A (en) * | 1994-09-30 | 1998-01-13 | Abbott Laboratories | Devices and methods utilizing arrays of structures for analyte capture |
US5709943A (en) * | 1995-05-04 | 1998-01-20 | Minnesota Mining And Manufacturing Company | Biological adsorption supports |
US5715946A (en) * | 1995-06-07 | 1998-02-10 | Reichenbach; Steven H. | Method and apparatus for sorting particles suspended in a fluid |
US5726026A (en) * | 1992-05-01 | 1998-03-10 | Trustees Of The University Of Pennsylvania | Mesoscale sample preparation device and systems for determination and processing of analytes |
US5858649A (en) * | 1992-07-17 | 1999-01-12 | Aprogenex, Inc. | Amplification of mRNA for distinguishing fetal cells in maternal blood |
US5866345A (en) * | 1992-05-01 | 1999-02-02 | The Trustees Of The University Of Pennsylvania | Apparatus for the detection of an analyte utilizing mesoscale flow systems |
US5879883A (en) * | 1991-10-03 | 1999-03-09 | Indiana University Foundation | Method for screening for alzheimer's disease |
US6013188A (en) * | 1996-06-07 | 2000-01-11 | Immunivest Corporation | Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force |
US6176962B1 (en) * | 1990-02-28 | 2001-01-23 | Aclara Biosciences, Inc. | Methods for fabricating enclosed microchannel structures |
US6184043B1 (en) * | 1992-09-14 | 2001-02-06 | FODSTAD øYSTEIN | Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations |
US6186660B1 (en) * | 1997-10-09 | 2001-02-13 | Caliper Technologies Corp. | Microfluidic systems incorporating varied channel dimensions |
US6197523B1 (en) * | 1997-11-24 | 2001-03-06 | Robert A. Levine | Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood |
US6200765B1 (en) * | 1998-05-04 | 2001-03-13 | Pacific Northwest Cancer Foundation | Non-invasive methods to detect prostate cancer |
US20020006621A1 (en) * | 1989-11-13 | 2002-01-17 | Children's Medical Center Corporation | Non-invasive method for isolation and detection of fetal DNA |
US20020009738A1 (en) * | 2000-04-03 | 2002-01-24 | Houghton Raymond L. | Methods, compositions and kits for the detection and monitoring of breast cancer |
US20020012930A1 (en) * | 1999-09-16 | 2002-01-31 | Rothberg Jonathan M. | Method of sequencing a nucleic acid |
US20020012931A1 (en) * | 2000-03-27 | 2002-01-31 | Waldman Scott A. | High specificity marker detection |
US6344326B1 (en) * | 1996-07-30 | 2002-02-05 | Aclara Bio Sciences, Inc. | Microfluidic method for nucleic acid purification and processing |
US20020016450A1 (en) * | 1997-10-31 | 2002-02-07 | Bbi Bioseq, Inc., A Masachusetts Corporation | Pressure-enhanced extraction and purification |
US20020019001A1 (en) * | 1999-10-15 | 2002-02-14 | Ventana Medical Systems, Inc. | Method of detecting single gene copies in-situ |
US20020028431A1 (en) * | 1998-08-25 | 2002-03-07 | Julien Jean-Claude Bisconte De Saint | Process, device and reagent for cell separation |
US6361958B1 (en) * | 1999-11-12 | 2002-03-26 | Motorola, Inc. | Biochannel assay for hybridization with biomaterial |
US20030004402A1 (en) * | 2000-07-18 | 2003-01-02 | Hitt Ben A. | Process for discriminating between biological states based on hidden patterns from biological data |
US20030017514A1 (en) * | 2001-06-02 | 2003-01-23 | Katharina Pachmann | Method for quantitative detection of vital epithelial tumor cells in a body fluid |
US6511967B1 (en) * | 1999-04-23 | 2003-01-28 | The General Hospital Corporation | Use of an internalizing transferrin receptor to image transgene expression |
US20030022207A1 (en) * | 1998-10-16 | 2003-01-30 | Solexa, Ltd. | Arrayed polynucleotides and their use in genome analysis |
US20030033091A1 (en) * | 2001-04-20 | 2003-02-13 | Sequenom, Inc. | Systems and methods for testing a biological sample |
US20030044388A1 (en) * | 2001-08-31 | 2003-03-06 | The Chinese University Of Hong Kong | Methods for detecting DNA originating from different individuals |
US6673541B1 (en) * | 1998-09-18 | 2004-01-06 | Micromet Ag | DNA amplification of a single cell |
US6674525B2 (en) * | 2001-04-03 | 2004-01-06 | Micronics, Inc. | Split focusing cytometer |
US20040005582A1 (en) * | 2000-08-10 | 2004-01-08 | Nanobiodynamics, Incorporated | Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators |
US20040009471A1 (en) * | 2002-04-25 | 2004-01-15 | Bo Cao | Methods and kits for detecting a target cell |
US20040018116A1 (en) * | 2002-07-26 | 2004-01-29 | Desmond Sean M. | Microfluidic size-exclusion devices, systems, and methods |
US6685841B2 (en) * | 2001-02-14 | 2004-02-03 | Gabriel P. Lopez | Nanostructured devices for separation and analysis |
US6689615B1 (en) * | 2000-10-04 | 2004-02-10 | James Murto | Methods and devices for processing blood samples |
US20040037470A1 (en) * | 2002-08-23 | 2004-02-26 | Simske Steven J. | Systems and methods for processing text-based electronic documents |
US20040043506A1 (en) * | 2002-08-30 | 2004-03-04 | Horst Haussecker | Cascaded hydrodynamic focusing in microfluidic channels |
US20040048360A1 (en) * | 1999-08-26 | 2004-03-11 | Caliper Technologies Corp. | Microfluidic analytic detection assays, devices, and integrated systems |
US20040053352A1 (en) * | 1998-09-28 | 2004-03-18 | Tianmei Ouyang | Diagnostics based on tetrazolium compounds |
US20050014208A1 (en) * | 2001-09-06 | 2005-01-20 | Alf-Andreas Krehan | Method and kit for diagnosing or controlling the treatment of breast cancer |
US20050019792A1 (en) * | 2001-11-30 | 2005-01-27 | Fluidigm Corporation | Microfluidic device and methods of using same |
US20050037388A1 (en) * | 2001-06-22 | 2005-02-17 | University Of Geneva | Method for detecting diseases caused by chromosomal imbalances |
US6858439B1 (en) * | 1999-03-15 | 2005-02-22 | Aviva Biosciences | Compositions and methods for separation of moieties on chips |
US20050042623A1 (en) * | 2002-10-30 | 2005-02-24 | Dana Ault-Riche | Systems for capture and analysis of biological particles and methods using the systems |
US20050042685A1 (en) * | 2001-09-06 | 2005-02-24 | Winfried Albert | Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells |
US20050049793A1 (en) * | 2001-04-30 | 2005-03-03 | Patrizia Paterlini-Brechot | Prenatal diagnosis method on isolated foetal cell of maternal blood |
US20050061962A1 (en) * | 2003-07-31 | 2005-03-24 | Arryx, Inc. | Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components |
US20050221341A1 (en) * | 2003-10-22 | 2005-10-06 | Shimkets Richard A | Sequence-based karyotyping |
US20060000772A1 (en) * | 2002-11-29 | 2006-01-05 | Toru Sano | Separation apparatus and separation method |
US20060008807A1 (en) * | 2002-08-23 | 2006-01-12 | O'hara Shawn M | Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample |
US20060008824A1 (en) * | 2004-05-20 | 2006-01-12 | Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
US20060024756A1 (en) * | 2002-02-14 | 2006-02-02 | Arjan Tibbe | Methods and algorithms for cell enumeration in low-cost cytometer |
US20060046258A1 (en) * | 2004-02-27 | 2006-03-02 | Lapidus Stanley N | Applications of single molecule sequencing |
US20060051265A1 (en) * | 2004-09-08 | 2006-03-09 | Health Research, Inc. | Apparatus and method for sorting microstructures in a fluid medium |
US20060060767A1 (en) * | 2001-04-27 | 2006-03-23 | Wang Mark M | Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles |
US20070017633A1 (en) * | 2005-03-23 | 2007-01-25 | Tonkovich Anna L | Surface features in microprocess technology |
US20070026415A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026418A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026381A1 (en) * | 2005-04-05 | 2007-02-01 | Huang Lotien R | Devices and methods for enrichment and alteration of cells and other particles |
US20070026417A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026413A1 (en) * | 2005-07-29 | 2007-02-01 | Mehmet Toner | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026419A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026416A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026469A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026414A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US7171975B2 (en) * | 2002-02-12 | 2007-02-06 | Kionix, Inc. | Fabrication of ultra-shallow channels for microfluidic devices and systems |
US20070037172A1 (en) * | 2005-08-11 | 2007-02-15 | Chiu Daniel T | Separation and concentration of biological cells and biological particles using a one-dimensional channel |
US20070037173A1 (en) * | 2005-08-12 | 2007-02-15 | Allard Jeffrey W | Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients |
US20070037275A1 (en) * | 2001-04-25 | 2007-02-15 | Michael Shuler | Devices and methods for pharmacokinetic-based cell culture system |
US20070042360A1 (en) * | 2001-09-17 | 2007-02-22 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer |
US20070042339A1 (en) * | 2003-08-08 | 2007-02-22 | Massachusetts General Hospital | Preservation of biomaterials with transported preservation agents |
US20070042368A1 (en) * | 2003-03-24 | 2007-02-22 | Corixa Corporation | Detection and monitoring of lung cancer |
US20070042238A1 (en) * | 2005-08-22 | 2007-02-22 | Lg Electronics Inc. | Fuel cell having water type radiating device |
US20070048750A1 (en) * | 2005-09-01 | 2007-03-01 | National Health Research Institute | Rapid efficacy assessment method for lung cancer therapy |
US20070054287A1 (en) * | 2005-05-31 | 2007-03-08 | Applera Corporation | Method for identifying medically important cell populations using micro rna as tissue specific biomarkers |
US20070054268A1 (en) * | 2002-09-05 | 2007-03-08 | Robert Sutherland | Methods of diagnosis and prognosis of ovarian cancer |
US20070059680A1 (en) * | 2005-09-15 | 2007-03-15 | Ravi Kapur | System for cell enrichment |
US20070059683A1 (en) * | 2005-09-15 | 2007-03-15 | Tom Barber | Veterinary diagnostic system |
US20070059718A1 (en) * | 2005-09-15 | 2007-03-15 | Mehmet Toner | Systems and methods for enrichment of analytes |
US20070059719A1 (en) * | 2005-09-15 | 2007-03-15 | Michael Grisham | Business methods for prenatal Diagnosis |
US20070059716A1 (en) * | 2005-09-15 | 2007-03-15 | Ulysses Balis | Methods for detecting fetal abnormality |
US20080020390A1 (en) * | 2006-02-28 | 2008-01-24 | Mitchell Aoy T | Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms |
US20080026390A1 (en) * | 2006-06-14 | 2008-01-31 | Roland Stoughton | Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis |
US20080023399A1 (en) * | 2006-06-01 | 2008-01-31 | Inglis David W | Apparatus and method for continuous particle separation |
US20080038733A1 (en) * | 2006-03-28 | 2008-02-14 | Baylor College Of Medicine | Screening for down syndrome |
US7332277B2 (en) * | 2002-03-01 | 2008-02-19 | Ravgen, Inc. | Methods for detection of genetic disorders |
US20080050739A1 (en) * | 2006-06-14 | 2008-02-28 | Roland Stoughton | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
US7476363B2 (en) * | 2003-04-03 | 2009-01-13 | Fluidigm Corporation | Microfluidic devices and methods of using same |
US20090029377A1 (en) * | 2007-07-23 | 2009-01-29 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
US20090117538A1 (en) * | 2003-12-01 | 2009-05-07 | Hashimoto Shin-Ichi | Methods for Obtaining Gene Tags |
US7645576B2 (en) * | 2005-03-18 | 2010-01-12 | The Chinese University Of Hong Kong | Method for the detection of chromosomal aneuploidies |
US7655399B2 (en) * | 2003-10-08 | 2010-02-02 | Trustees Of Boston University | Methods for prenatal diagnosis of chromosomal abnormalities |
Family Cites Families (329)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4508625A (en) | 1982-10-18 | 1985-04-02 | Graham Marshall D | Magnetic separation using chelated magnetic ions |
US4675286A (en) | 1985-01-28 | 1987-06-23 | Aspen Diagnostics, Inc. | Fetal cell separation and testing |
US5164598A (en) | 1985-08-05 | 1992-11-17 | Biotrack | Capillary flow device |
US7115709B1 (en) | 1986-01-16 | 2006-10-03 | The Regents Of The University Of California | Methods of staining target chromosomal DNA employing high complexity nucleic acid probes |
US5721098A (en) | 1986-01-16 | 1998-02-24 | The Regents Of The University Of California | Comparative genomic hybridization |
US4789628A (en) | 1986-06-16 | 1988-12-06 | Vxr, Inc. | Devices for carrying out ligand/anti-ligand assays, methods of using such devices and diagnostic reagents and kits incorporating such devices |
US4971904A (en) | 1987-06-26 | 1990-11-20 | E. I. Du Pont De Nemours And Company | Heterogeneous immunoassay |
US4977078A (en) | 1987-12-22 | 1990-12-11 | Olympus Optical Co., Ltd. | Plate substrate immunoassay device and method for performing a multi-test immunoassay on a specimen |
CA1339210C (fr) | 1988-05-31 | 1997-08-05 | John Lewicki | Techniques recombinantes pour la production de nouveaux natriuretiques et de peptides vasodilatateurs |
US5215926A (en) | 1988-06-03 | 1993-06-01 | Cellpro, Inc. | Procedure for designing efficient affinity cell separation processes |
ATE161960T1 (de) | 1988-12-06 | 1998-01-15 | Flinders Technologies Pty Ltd | Isolierung von fetalen zellen aus mütterlichem blut zur ausführung von pränataler diagnostik |
CA1340565C (fr) | 1989-06-29 | 1999-05-25 | Thomas B. Okarma | Dispositif et methode pour capter et recuperer des cellules |
AU658132B2 (en) | 1989-11-13 | 1995-04-06 | Children's Medical Center Corporation | Non-invasive method for isolation and detection of fetal DNA |
US5770029A (en) | 1996-07-30 | 1998-06-23 | Soane Biosciences | Integrated electrophoretic microdevices |
US5153117A (en) | 1990-03-27 | 1992-10-06 | Genetype A.G. | Fetal cell recovery method |
CA2081203A1 (fr) | 1990-04-23 | 1991-10-24 | Ronald J. Berenson | Methode permettant d'enrichir les cellules d'un foetus a partir du sang maternel |
US5646001A (en) | 1991-03-25 | 1997-07-08 | Immunivest Corporation | Affinity-binding separation and release of one or more selected subset of biological entities from a mixed population thereof |
US5304487A (en) | 1992-05-01 | 1994-04-19 | Trustees Of The University Of Pennsylvania | Fluid handling in mesoscale analytical devices |
EP0637996B1 (fr) | 1992-05-01 | 1997-07-23 | The Trustees Of The University Of Pennsylvania | Structures de detection micro-usinees |
US6156270A (en) | 1992-05-21 | 2000-12-05 | Biosite Diagnostics, Inc. | Diagnostic devices and apparatus for the controlled movement of reagents without membranes |
US6143576A (en) | 1992-05-21 | 2000-11-07 | Biosite Diagnostics, Inc. | Non-porous diagnostic devices for the controlled movement of reagents |
WO1994003638A1 (fr) | 1992-07-30 | 1994-02-17 | Applied Biosystems, Inc. | Methode de detection d'aneuploidie au moyen de repetitions courtes en tandem amplifiees |
DE4244715C2 (de) | 1992-08-26 | 1995-06-14 | Kuebler Gmbh Dr | Verfahren zur Herstellung individuum-spezifischer, gegen Tumorantigene gerichtete monoklonale Antikörper |
US6953668B1 (en) | 1992-11-05 | 2005-10-11 | Sloan-Kettering Institute For Cancer Research | Prostate-specific membrane antigen |
EP1757694A3 (fr) | 1992-11-05 | 2008-02-27 | Sloan Kettering Institute For Cancer Research | Antigene de membrane spécifique à la prostate |
US5427663A (en) | 1993-06-08 | 1995-06-27 | British Technology Group Usa Inc. | Microlithographic array for macromolecule and cell fractionation |
US5556773A (en) | 1993-08-06 | 1996-09-17 | Yourno; Joseph | Method and apparatus for nested polymerase chain reaction (PCR) with single closed reaction tubes |
AU7921194A (en) | 1993-09-27 | 1995-04-18 | Oncor, Inc. | Methods for detecting and analyzing individual rare cells in a population |
US5432054A (en) | 1994-01-31 | 1995-07-11 | Applied Imaging | Method for separating rare cells from a population of cells |
US5798042A (en) | 1994-03-07 | 1998-08-25 | Regents Of The University Of California | Microfabricated filter with specially constructed channel walls, and containment well and capsule constructed with such filters |
NO180658C (no) | 1994-03-10 | 1997-05-21 | Oeystein Fodstad | Fremgangsmåte og anordning for deteksjon av spesifikke målceller i spesialiserte eller blandede cellepopulasjoner og opplösninger som inneholder blandede cellepopulasjoner |
US5962332A (en) | 1994-03-17 | 1999-10-05 | University Of Massachusetts | Detection of trinucleotide repeats by in situ hybridization |
US5840502A (en) | 1994-08-31 | 1998-11-24 | Activated Cell Therapy, Inc. | Methods for enriching specific cell-types by density gradient centrifugation |
US5662813A (en) | 1994-10-21 | 1997-09-02 | Bioseparations, Inc. | Method for separation of nucleated fetal erythrocytes from maternal blood samples |
WO1996014934A1 (fr) | 1994-11-14 | 1996-05-23 | Trustees Of The University Of Pennsylvania | Dispositif de preparation d'echantillons mesoechelle et systemes pour la determination et le traitement des analysats |
US5750339A (en) | 1994-11-30 | 1998-05-12 | Thomas Jefferson University | Methods for identifying fetal cells |
DE69635801T2 (de) | 1995-02-24 | 2006-11-02 | Sloan-Kettering Institute For Cancer Research | Prostataspezifisches membranes antigen und seine anwendungen |
US5639669A (en) | 1995-06-07 | 1997-06-17 | Ledley; Robert | Separation of fetal cells from maternal blood |
US5856174A (en) | 1995-06-29 | 1999-01-05 | Affymetrix, Inc. | Integrated nucleic acid diagnostic device |
DE19681033D2 (de) | 1995-11-16 | 1999-03-18 | Michael W Dahm | Verfahren zur Quantifizierung von Tumorzellen in einer Körperflüssigkeit und dazu geeignete Testkits |
US20030119724A1 (en) | 1995-11-22 | 2003-06-26 | Ts`O Paul O.P. | Ligands to enhance cellular uptake of biomolecules |
WO1997020563A1 (fr) | 1995-11-22 | 1997-06-12 | The Johns-Hopkins University | Ligands servant a amplifier l'absorption cellulaire de biomolecules |
US6718053B1 (en) | 1996-11-27 | 2004-04-06 | Chromavision Medical Systems, Inc. | Method and apparatus for automated image analysis of biological specimens |
NO961031D0 (no) | 1996-03-13 | 1996-03-13 | Det Norske Radiumshospital Tum | Fremgangsmåte til å drepe uönskede målceller |
US5972721A (en) | 1996-03-14 | 1999-10-26 | The United States Of America As Represented By The Secretary Of The Air Force | Immunomagnetic assay system for clinical diagnosis and other purposes |
CA2248981C (fr) | 1996-03-15 | 2009-11-24 | The Penn State Research Foundation | Detection d'acide nucleique extracellulaire lie a des tumeurs dans le plasma ou le serum sanguin a l'aide d'essais d'amplification d'acide nucleique |
US5891651A (en) | 1996-03-29 | 1999-04-06 | Mayo Foundation For Medical Education And Research | Methods of recovering colorectal epithelial cells or fragments thereof from stool |
US7297331B2 (en) | 1996-04-03 | 2007-11-20 | The Rogosin Institute | Beads containing restricted cancer cells producing material suppressing cancer cell proliferation |
EP0891550A1 (fr) | 1996-04-05 | 1999-01-20 | The Johns Hopkins University School Of Medicine | Procede d'enrichissement de cellules rares |
US6387707B1 (en) | 1996-04-25 | 2002-05-14 | Bioarray Solutions | Array Cytometry |
US6958245B2 (en) | 1996-04-25 | 2005-10-25 | Bioarray Solutions Ltd. | Array cytometry |
US6890426B2 (en) | 1996-06-07 | 2005-05-10 | Immunivest Corporation | Magnetic separation apparatus and methods |
NZ333346A (en) | 1996-06-28 | 2000-03-27 | Caliper Techn Corp | High-throughput screening assay systems in microscale fluidic devices |
IT1294964B1 (it) | 1996-07-12 | 1999-04-23 | Domenico Valerio | Isolamento e cultura di cellule fetali dal sangue periferico materno |
US6100029A (en) | 1996-08-14 | 2000-08-08 | Exact Laboratories, Inc. | Methods for the detection of chromosomal aberrations |
US6300077B1 (en) | 1996-08-14 | 2001-10-09 | Exact Sciences Corporation | Methods for the detection of nucleic acids |
AU4164597A (en) | 1996-08-26 | 1998-03-19 | Princeton University | Reversibly sealable microstructure sorting devices |
DE69709377T2 (de) | 1996-09-04 | 2002-08-14 | Scandinavian Micro Biodevices | Mikrofliesssystem für die teilchenanalyse und trennung |
GB9620209D0 (en) | 1996-09-27 | 1996-11-13 | Cemu Bioteknik Ab | Method of sequencing DNA |
NO308755B1 (no) | 1996-12-20 | 2000-10-23 | Iystein Fodstad | FremgangsmÕte til karakterisering av unormale celler, anvendelse og sett for utførelse av fremgangsmÕten |
US6235474B1 (en) | 1996-12-30 | 2001-05-22 | The Johns Hopkins University | Methods and kits for diagnosing and determination of the predisposition for diseases |
US6008007A (en) | 1997-01-31 | 1999-12-28 | Oncotech, Inc. | Radiation resistance assay for predicting treatment response and clinical outcome |
GB9704444D0 (en) | 1997-03-04 | 1997-04-23 | Isis Innovation | Non-invasive prenatal diagnosis |
US20010051341A1 (en) | 1997-03-04 | 2001-12-13 | Isis Innovation Limited | Non-invasive prenatal diagnosis |
US6623983B1 (en) | 1997-03-25 | 2003-09-23 | Immunivest Corporation | Apparatus and methods for capture and analysis of particulate entities |
US6391622B1 (en) | 1997-04-04 | 2002-05-21 | Caliper Technologies Corp. | Closed-loop biochemical analyzers |
WO1998046645A2 (fr) | 1997-04-14 | 1998-10-22 | Micromet Gesellschaft Für Biomedizinische Forschung Mbh | Nouveau procede de production de recepteurs d'anti-antigenes humains et leur utilisation |
US6066449A (en) | 1997-04-15 | 2000-05-23 | The Trustees Of Columbia University In The City Of New York | Method of detecting metastatic thyroid cancer |
US6143496A (en) | 1997-04-17 | 2000-11-07 | Cytonix Corporation | Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly |
WO1998049344A1 (fr) | 1997-04-28 | 1998-11-05 | Lockheed Martin Energy Research Corporation | Methode et appareil d'analyse d'acides nucleiques |
US6632619B1 (en) | 1997-05-16 | 2003-10-14 | The Governors Of The University Of Alberta | Microfluidic system and methods of use |
US6156273A (en) | 1997-05-27 | 2000-12-05 | Purdue Research Corporation | Separation columns and methods for manufacturing the improved separation columns |
US6566101B1 (en) | 1997-06-16 | 2003-05-20 | Anthony P. Shuber | Primer extension methods for detecting nucleic acids |
US6294331B1 (en) | 1997-08-08 | 2001-09-25 | The United States Of America As Represented By The Department Of Health And Human Services | Methods for assessing genetic and phenotypic markers by simultaneous multicolor visualization of chromogenic dyes using brightfield microscopy and spectral imaging |
US6368871B1 (en) | 1997-08-13 | 2002-04-09 | Cepheid | Non-planar microstructures for manipulation of fluid samples |
US6540895B1 (en) | 1997-09-23 | 2003-04-01 | California Institute Of Technology | Microfabricated cell sorter for chemical and biological materials |
US5962234A (en) | 1997-10-20 | 1999-10-05 | Applied Imaging Corporation | Use of anti-embryonic epsilon hemoglobin antibodies to identify fetal cells |
US6120985A (en) | 1997-10-31 | 2000-09-19 | Bbi Bioseq, Inc. | Pressure-enhanced extraction and purification |
CA2253965C (fr) | 1997-11-22 | 2003-01-21 | Robert A. Levine | Methode de detection, d'identification, de denombrement et de confirmaton de cellules cancereuses en circulation et\ou de cellules souches hematologiques dans le sang total |
ATE469982T1 (de) | 1998-02-04 | 2010-06-15 | Life Technologies Corp | Bestimmung des genotyps eines amplifikationsproduktes an mehreren allelen stellen |
US20020172987A1 (en) | 1998-02-12 | 2002-11-21 | Terstappen Leon W.M.M. | Methods and reagents for the rapid and efficient isolation of circulating cancer cells |
JP2002503814A (ja) | 1998-02-12 | 2002-02-05 | イムニベスト・コーポレイション | 循環ガン細胞の迅速かつ効率的な単離のための方法および試薬 |
WO1999044064A1 (fr) | 1998-02-27 | 1999-09-02 | Cli Oncology, Inc. | Methode et compositions de detection differentielle de cellules tumorales et de cellules metastatiques |
GB9805918D0 (en) | 1998-03-19 | 1998-05-13 | Nycomed Amersham Plc | Sequencing by hybridisation |
US20070092917A1 (en) | 1998-05-01 | 2007-04-26 | Isabelle Guyon | Biomarkers for screening, predicting, and monitoring prostate disease |
ATE530891T1 (de) | 1998-05-22 | 2011-11-15 | California Inst Of Techn | Miniaturisierter zellsortierer |
US6897073B2 (en) | 1998-07-14 | 2005-05-24 | Zyomyx, Inc. | Non-specific binding resistant protein arrays and methods for making the same |
US6576478B1 (en) | 1998-07-14 | 2003-06-10 | Zyomyx, Inc. | Microdevices for high-throughput screening of biomolecules |
US6245227B1 (en) | 1998-09-17 | 2001-06-12 | Kionix, Inc. | Integrated monolithic microfabricated electrospray and liquid chromatography system and method |
US6637463B1 (en) | 1998-10-13 | 2003-10-28 | Biomicro Systems, Inc. | Multi-channel microfluidic system design with balanced fluid flow distribution |
JP2002529704A (ja) | 1998-10-29 | 2002-09-10 | セル ワークス インコーポレイテッド | 単一細胞の複数マーカー特徴付け |
DE69939599D1 (de) | 1998-12-16 | 2008-10-30 | Novartis Vaccines & Diagnostic | MENSCHLICHE CYCLIN-ABHÄNGIGE KINASE (hPNQALRE) |
US6887693B2 (en) | 1998-12-24 | 2005-05-03 | Cepheid | Device and method for lysing cells, spores, or microorganisms |
GB9828785D0 (en) | 1998-12-30 | 1999-02-17 | Amersham Pharm Biotech Ab | Sequencing systems |
WO2000047998A1 (fr) | 1999-02-10 | 2000-08-17 | Cell Works Inc. | Caracterisation de classes de cellules cancereuses circulantes isolees a partir de fluides corporels et methodes d'utilisation |
AU3567900A (en) * | 1999-03-30 | 2000-10-16 | Solexa Ltd. | Polynucleotide sequencing |
US6942771B1 (en) | 1999-04-21 | 2005-09-13 | Clinical Micro Sensors, Inc. | Microfluidic systems in the electrochemical detection of target analytes |
US6994969B1 (en) | 1999-04-30 | 2006-02-07 | Methexis Genomics, N.V. | Diagnostic sequencing by a combination of specific cleavage and mass spectrometry |
US7166573B1 (en) | 1999-05-28 | 2007-01-23 | Ludwig Institute For Cancer Research | Breast, gastric and prostate cancer associated antigens and uses therefor |
US6818395B1 (en) | 1999-06-28 | 2004-11-16 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
US6440706B1 (en) | 1999-08-02 | 2002-08-27 | Johns Hopkins University | Digital amplification |
US7192698B1 (en) | 1999-08-17 | 2007-03-20 | Purdue Research Foundation | EphA2 as a diagnostic target for metastatic cancer |
US6692952B1 (en) | 1999-11-10 | 2004-02-17 | Massachusetts Institute Of Technology | Cell analysis and sorting apparatus for manipulation of cells |
AU1592501A (en) | 1999-11-10 | 2001-06-06 | Massachusetts Institute Of Technology | Cell analysis and sorting apparatus for manipulation of cells |
US20060128006A1 (en) | 1999-11-10 | 2006-06-15 | Gerhardt Antimony L | Hydrodynamic capture and release mechanisms for particle manipulation |
US6875619B2 (en) | 1999-11-12 | 2005-04-05 | Motorola, Inc. | Microfluidic devices comprising biochannels |
WO2001037192A1 (fr) | 1999-11-18 | 2001-05-25 | Ikonisys, Inc. | Procede et appareil, commandes par ordinateur, pour le diagnostic en fonction d'une cellule |
WO2001051668A1 (fr) | 2000-01-13 | 2001-07-19 | Immunivest Corporation | Echantillons ferrofluides |
EP1257664A4 (fr) | 2000-01-28 | 2006-04-05 | Althea Technologies Inc | Procedes d'analyse de l'expression genique |
US20030170631A1 (en) | 2000-04-03 | 2003-09-11 | Corixa Corporation | Methods, compositions and kits for the detection and monitoring of breast cancer |
US7510834B2 (en) * | 2000-04-13 | 2009-03-31 | Hidetoshi Inoko | Gene mapping method using microsatellite genetic polymorphism markers |
US7641856B2 (en) | 2004-05-14 | 2010-01-05 | Honeywell International Inc. | Portable sample analyzer with removable cartridge |
US6984522B2 (en) | 2000-08-03 | 2006-01-10 | Regents Of The University Of Michigan | Isolation and use of solid tumor stem cells |
EP1309863A1 (fr) | 2000-08-08 | 2003-05-14 | Aviva Biosciences Corporation | Techniques de manipulations de fragments dans des systemes microfluidiques |
US6610499B1 (en) | 2000-08-31 | 2003-08-26 | The Regents Of The University Of California | Capillary array and related methods |
GB0021617D0 (en) | 2000-09-02 | 2000-10-18 | Imp College Innovations Ltd | Diagnosis and treatment of cancer |
JP5433840B2 (ja) | 2000-09-09 | 2014-03-05 | ザ・リサーチ・ファウンデーション・フォー・ザ・ステイト・ユニヴァーシティ・オブ・ニューヨーク | 転移癌細胞を単離するための方法および組成物、ならびに癌の転移能の測定におけるその使用 |
US20020164825A1 (en) | 2000-09-09 | 2002-11-07 | Wen-Tien Chen | Cell separation matrix |
AU2001290879A1 (en) | 2000-09-15 | 2002-03-26 | California Institute Of Technology | Microfabricated crossflow devices and methods |
WO2002028523A2 (fr) | 2000-09-30 | 2002-04-11 | Aviva Biosciences Corporation | Appareils comprenant plusieurs elements generateurs de forces et utilisations associees |
CA2424996A1 (fr) | 2000-10-09 | 2002-04-18 | Aviva Biosciences Corporation | Compositions et procedes de separation de fractions sur des puces |
EP1328342A4 (fr) | 2000-10-10 | 2006-03-15 | Aviva Biosciences Corp | Syst me biopuce int gr e pour la pr paration et l'analyse d' chantillons |
US6664056B2 (en) | 2000-10-17 | 2003-12-16 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
WO2002055985A2 (fr) | 2000-11-15 | 2002-07-18 | Roche Diagnostics Corp | Methodes et reactifs permettant d'identifier des cellules embryonnaires rares dans le systeme circulatoire maternel |
US6495340B2 (en) | 2000-11-28 | 2002-12-17 | Medis El Ltd. | Cell carrier grids |
AU2002217980A1 (en) | 2000-12-01 | 2002-06-11 | Cell Works Inc. | Conjugates of glycosylated/galactosylated peptide |
US6770434B2 (en) | 2000-12-29 | 2004-08-03 | The Provost, Fellows And Scholars Of The College Of The Holy & Undivided Trinity Of Queen Elizabeth Near Dublin | Biological assay method |
US6993169B2 (en) | 2001-01-11 | 2006-01-31 | Trestle Corporation | System and method for finding regions of interest for microscopic digital montage imaging |
EP1388013B1 (fr) | 2001-01-18 | 2007-07-11 | The Regents Of The University Of Michigan | Compositions et methodes destinees a l'utilisation de fragments de fibronectine dans le diagnostic du cancer |
US20020110835A1 (en) | 2001-02-13 | 2002-08-15 | Rajan Kumar | Microfluidic devices and methods |
US6913697B2 (en) | 2001-02-14 | 2005-07-05 | Science & Technology Corporation @ Unm | Nanostructured separation and analysis devices for biological membranes |
GB0104690D0 (en) | 2001-02-26 | 2001-04-11 | Cytogenetic Dna Services Ltd | Diagnostic test |
US20050196785A1 (en) | 2001-03-05 | 2005-09-08 | California Institute Of Technology | Combinational array for nucleic acid analysis |
US20030190602A1 (en) | 2001-03-12 | 2003-10-09 | Monogen, Inc. | Cell-based detection and differentiation of disease states |
CN1554025A (zh) | 2001-03-12 | 2004-12-08 | Īŵ���ɷ�����˾ | 患病状态的细胞为基础的检测和鉴别 |
US20020164816A1 (en) | 2001-04-06 | 2002-11-07 | California Institute Of Technology | Microfluidic sample separation device |
US6960437B2 (en) | 2001-04-06 | 2005-11-01 | California Institute Of Technology | Nucleic acid amplification utilizing microfluidic devices |
US7262030B2 (en) | 2001-05-09 | 2007-08-28 | Virginia Commonwealth University | Multiple sequencible and ligatible structures for genomic analysis |
US20020166760A1 (en) | 2001-05-11 | 2002-11-14 | Prentiss Mara G. | Micromagentic systems and methods for microfluidics |
US7118907B2 (en) | 2001-06-06 | 2006-10-10 | Li-Cor, Inc. | Single molecule detection systems and methods |
US7189507B2 (en) | 2001-06-18 | 2007-03-13 | Pdl Biopharma, Inc. | Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer |
US7381535B2 (en) | 2002-07-10 | 2008-06-03 | The Board Of Trustees Of The Leland Stanford Junior | Methods and compositions for detecting receptor-ligand interactions in single cells |
US6783928B2 (en) | 2001-07-17 | 2004-08-31 | Georgi Hvichia | Microstructures for cell proliferation assays and semen analysis |
US7993908B2 (en) | 2001-07-17 | 2011-08-09 | Parsortix, Inc. | Microstructure for particle and cell separation, identification, sorting, and manipulation |
EP1425383A4 (fr) | 2001-08-23 | 2005-11-09 | Immunivest Corp | Stabilisation de cellules et de specimens biologiques pour l'analyse |
US7863012B2 (en) | 2004-02-17 | 2011-01-04 | Veridex, Llc | Analysis of circulating tumor cells, fragments, and debris |
AUPR749901A0 (en) | 2001-09-06 | 2001-09-27 | Monash University | Method of identifying chromosomal abnormalities and prenatal diagnosis |
EP1409745B1 (fr) | 2001-09-06 | 2007-04-11 | Adnagen AG | Procede et necessaire destines au diagnostic ou au controle du traitement du cancer de l'intestin |
US7202045B2 (en) | 2001-09-19 | 2007-04-10 | Regents Of The University Of Michigan | Detection and treatment of cancers of the lung |
WO2003025543A2 (fr) | 2001-09-21 | 2003-03-27 | The Regents Of The University Of California | Methode de cytodiagnostic de stadification de neoplasie et de carcinome de cellules squameuses |
US7166443B2 (en) | 2001-10-11 | 2007-01-23 | Aviva Biosciences Corporation | Methods, compositions, and automated systems for separating rare cells from fluid samples |
US8986944B2 (en) | 2001-10-11 | 2015-03-24 | Aviva Biosciences Corporation | Methods and compositions for separating rare cells from fluid samples |
US20030072682A1 (en) | 2001-10-11 | 2003-04-17 | Dan Kikinis | Method and apparatus for performing biochemical testing in a microenvironment |
US8980568B2 (en) | 2001-10-11 | 2015-03-17 | Aviva Biosciences Corporation | Methods and compositions for detecting non-hematopoietic cells from a blood sample |
WO2003031938A2 (fr) | 2001-10-11 | 2003-04-17 | Aviva Biosciences Corporation | Methodes, compositions, et systemes automatises pour la separation des cellules rares provenant d'echantillons de fluides |
US7262269B2 (en) | 2001-10-26 | 2007-08-28 | The Regents Of University Of California | Method for screening combinational bead library; ligands for cancer cells |
BR0213520A (pt) | 2001-10-26 | 2006-05-23 | Immunivest Corp | método para diagnosticar a gravidade de uma doença em um indivìduo de teste, e, kit de teste para triagem de uma amostra de paciente quanto à presença de células cancerosas circulantes |
US20030232350A1 (en) | 2001-11-13 | 2003-12-18 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer |
US20050244843A1 (en) | 2001-11-16 | 2005-11-03 | Wen-Tien Chen | Blood test prototypes and methods for the detection of circulating tumor and endothelial cells |
CA2467248A1 (fr) | 2001-11-20 | 2003-05-30 | Exact Sciences Corporation | Procedes et dispositifs de preparation automatisee d'echantillon |
AU2002219137A1 (en) | 2001-11-22 | 2003-06-10 | Adnagen Ag | Diagnosis kit, dna chip, and methods for diagnosing or supervising the treatment of testicular cancer |
EP1463796B1 (fr) | 2001-11-30 | 2013-01-09 | Fluidigm Corporation | Dispositif microfluidique et procedes d'utilisation de ce dernier |
CN100468058C (zh) | 2001-12-11 | 2009-03-11 | 株式会社奈特克 | 血细胞分离体系 |
WO2003060486A1 (fr) | 2002-01-10 | 2003-07-24 | Board Of Regents, The University Of Texas System | Systeme de tri de flux et procedes associes |
US7383134B2 (en) | 2002-01-15 | 2008-06-03 | Piper James R | Method and/or system for analyzing biological samples using a computer system |
AU2003216175A1 (en) | 2002-02-04 | 2003-09-02 | Colorado School Of Mines | Laminar flow-based separations of colloidal and cellular particles |
US7764821B2 (en) | 2002-02-14 | 2010-07-27 | Veridex, Llc | Methods and algorithms for cell enumeration in a low-cost cytometer |
US7893248B2 (en) * | 2002-02-20 | 2011-02-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA) |
EP2258872B1 (fr) | 2002-03-13 | 2013-08-14 | Genomic Health, Inc. | Profilage de l'expression génétique dans des tissus de tumeurs prélevées par biopsie |
US7223371B2 (en) | 2002-03-14 | 2007-05-29 | Micronics, Inc. | Microfluidic channel network device |
US7214427B2 (en) | 2002-03-21 | 2007-05-08 | Aviva Biosciences Corporation | Composite beads comprising magnetizable substance and electro-conductive substance |
US7312085B2 (en) | 2002-04-01 | 2007-12-25 | Fluidigm Corporation | Microfluidic particle-analysis systems |
US20040241707A1 (en) | 2002-04-01 | 2004-12-02 | Gao Chun L. | Enhanced diagnostic potential of prostate-specific antigen expressing cells |
AU2003234459A1 (en) | 2002-05-03 | 2003-11-17 | Immunivest Corporation | Device and method for analytical cell imaging |
US20070178478A1 (en) | 2002-05-08 | 2007-08-02 | Dhallan Ravinder S | Methods for detection of genetic disorders |
US7442506B2 (en) | 2002-05-08 | 2008-10-28 | Ravgen, Inc. | Methods for detection of genetic disorders |
US7727720B2 (en) | 2002-05-08 | 2010-06-01 | Ravgen, Inc. | Methods for detection of genetic disorders |
US7272252B2 (en) | 2002-06-12 | 2007-09-18 | Clarient, Inc. | Automated system for combining bright field and fluorescent microscopy |
US7220594B2 (en) | 2002-07-08 | 2007-05-22 | Innovative Micro Technology | Method and apparatus for sorting particles with a MEMS device |
US6838056B2 (en) | 2002-07-08 | 2005-01-04 | Innovative Micro Technology | Method and apparatus for sorting biological cells with a MEMS device |
US7229838B2 (en) | 2002-07-08 | 2007-06-12 | Innovative Micro Technology | MEMS actuator and method of manufacture for MEMS particle sorting device |
US7252976B2 (en) | 2002-08-28 | 2007-08-07 | Board Of Regents The University Of Texas System | Quantitative RT-PCR to AC133 to diagnose cancer and monitor angiogenic activity in a cell sample |
AU2003273921A1 (en) | 2002-09-27 | 2004-04-19 | Oridis Biomed Forschungs-Und Entwicklungs Gmbh | Polypeptides and nucleic acids encoding these and their use for the prevention,diagnosis or treatment of liver disorders and epithelial cancer |
ES2375724T3 (es) | 2002-09-27 | 2012-03-05 | The General Hospital Corporation | Dispositivo microflu�?dico para seperación de células y sus usos. |
WO2004037374A2 (fr) | 2002-10-23 | 2004-05-06 | The Trustees Of Princeton University | Procede de separation continue de particules faisant appel a des reseaux d'obstacles alignes de maniere asymetrique par rapport a des champs |
US6811385B2 (en) | 2002-10-31 | 2004-11-02 | Hewlett-Packard Development Company, L.P. | Acoustic micro-pump |
AU2002952696A0 (en) | 2002-11-14 | 2002-11-28 | Genomics Research Partners Pty Ltd | Status determination |
US7704687B2 (en) | 2002-11-15 | 2010-04-27 | The Johns Hopkins University | Digital karyotyping |
DE10259703A1 (de) | 2002-12-19 | 2004-07-08 | Ivonex Gmbh | Trennungsverfahren |
CN101245376A (zh) | 2003-01-17 | 2008-08-20 | 香港中文大学 | 作为妊娠相关病症的诊断标志物的循环mRNA |
US6746503B1 (en) | 2003-01-30 | 2004-06-08 | The Regents Of The University Of California | Precision gap particle separator |
WO2004077021A2 (fr) | 2003-02-27 | 2004-09-10 | Lesko Stephen A | Evaluation normalisee de l'efficacite therapeutique fondee sur des marqueurs biologiques cellulaires |
CA2516795C (fr) | 2003-02-27 | 2013-01-15 | Immunivest Corporation | Cellules tumorales circulantes (ctc) : evaluation precoce du delai avant progression, de la survie et de la reponse au traitement chez les patientes atteintes d'un cancer metastatique |
WO2004078999A1 (fr) | 2003-03-05 | 2004-09-16 | Genetic Technologies Limited | Identification d'adn foetal et de marqueurs de cellule foetale dans du plasma ou du serum maternel |
EP1606417A2 (fr) | 2003-03-07 | 2005-12-21 | Rubicon Genomics Inc. | Immortalisation d'adn in vitro et amplification genomique complete a l'aide de bibliotheques generees a partir d'adn fragmente de maniere aleatoire |
DE10313201A1 (de) | 2003-03-21 | 2004-10-07 | Steag Microparts Gmbh | Mikrostrukturierte Trennvorrichtung und mikrofluidisches Verfahren zum Abtrennen von flüssigen Bestandteilen aus einer Flüssigkeit, die Partikel enthält |
AU2003901671A0 (en) | 2003-04-02 | 2003-05-01 | The University Of Adelaide | Comparative genomic hybridization |
AU2004228678A1 (en) | 2003-04-03 | 2004-10-21 | Fluidigm Corp. | Microfluidic devices and methods of using same |
US20050145496A1 (en) | 2003-04-03 | 2005-07-07 | Federico Goodsaid | Thermal reaction device and method for using the same |
WO2004087757A2 (fr) | 2003-04-03 | 2004-10-14 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Produits therapeutiques a capacite amelioree d'immunomodulation de fonctions cellulaires |
US7604965B2 (en) | 2003-04-03 | 2009-10-20 | Fluidigm Corporation | Thermal reaction device and method for using the same |
US7319010B2 (en) | 2003-05-12 | 2008-01-15 | The Regents Of The University Of Michigan | Detection and treatment of cancers of the colon |
US20070105105A1 (en) | 2003-05-23 | 2007-05-10 | Mount Sinai School Of Medicine Of New York University | Surrogate cell gene expression signatures for evaluating the physical state of a subject |
US20070160503A1 (en) | 2003-06-13 | 2007-07-12 | Palaniappan Sethu | Microfluidic systems for size based removal of red blood cells and platelets from blood |
WO2005010147A2 (fr) | 2003-06-13 | 2005-02-03 | The General Hospital Corporation | Dispositif et procede permettant de mettre en contact des volumes de fluide par picolitre |
US20070092881A1 (en) | 2003-07-10 | 2007-04-26 | Central Institute For Experimental Animals | Gene markers of tumor metastasis |
US7461048B2 (en) | 2003-07-21 | 2008-12-02 | Aureon Laboratories, Inc. | Systems and methods for treating, diagnosing and predicting the occurrence of a medical condition |
US20070059785A1 (en) | 2003-08-15 | 2007-03-15 | Smithkline Beecham Corporation | Biomarkers in cancer |
CA2536360C (fr) | 2003-08-28 | 2013-08-06 | Celula, Inc. | Procedes et appareil pour le tri de cellules mettant en oeuvre un commutateur optique dans un reseau de canaux microfluidiques |
EP1664077B1 (fr) | 2003-09-05 | 2016-04-13 | Trustees of Boston University | Procede de diagnostic prenatal non effractif |
US20070178458A1 (en) | 2003-09-05 | 2007-08-02 | O'brien Philippa | Methods of diagnosis and prognosis of ovarian cancer II |
US20070092444A1 (en) | 2003-09-11 | 2007-04-26 | The Uab Research Foundation | Inhibition of inward sodium currents in cancer |
CA2539108A1 (fr) | 2003-09-18 | 2005-03-31 | Immunivest Corporation | Systeme d'analyse et de preparation d'echantillon programmable independamment de l'operateur |
US20070202109A1 (en) | 2003-09-24 | 2007-08-30 | Oncotherapy Science, Inc. | Method Of Diagnosing Breast Cancer |
ATE435301T1 (de) | 2003-10-16 | 2009-07-15 | Sequenom Inc | Nicht invasiver nachweis fötaler genetischer merkmale |
US8062849B2 (en) | 2003-10-28 | 2011-11-22 | The Johns Hopkins University | Quantitative multiplex methylation-specific PCR |
AU2004286845A1 (en) * | 2003-10-30 | 2005-05-19 | Tufts-New England Medical Center | Prenatal diagnosis using cell-free fetal DNA in amniotic fluid |
WO2005043121A2 (fr) | 2003-10-31 | 2005-05-12 | Vitatex, Inc. | Prototypes d'analyses sanguines et methodes de detection de cellules tumorales et endotheliales |
WO2005047532A1 (fr) | 2003-11-17 | 2005-05-26 | Gribbles Molecular Science Pty Ltd | Procede ameliore permettant de realiser des analyses genetiques sur des echantillons cellulaires de l'appareil reproducteur |
WO2005049168A2 (fr) | 2003-11-17 | 2005-06-02 | Immunivest Corporation | Procede et appareil de pre-enrichissement et d'extraction de cellules de sang total densifie |
WO2005056838A1 (fr) | 2003-12-08 | 2005-06-23 | The Clinic For Special Children | Association de polymorphismes tspyl avec le syndrome siddt |
US7999071B2 (en) | 2003-12-12 | 2011-08-16 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Human cytotoxic T-lymphoctye epitope and its agonist eptiope from the non-variable number of tandem repeat sequence of MUC-1 |
US20050147977A1 (en) | 2003-12-29 | 2005-07-07 | Tae-Woong Koo | Methods and compositions for nucleic acid detection and sequence analysis |
EP1561507A1 (fr) | 2004-01-27 | 2005-08-10 | Future Diagnostics B.V. | Système pour caractériser un fluide, dispositif microfluidique pour caractériser ou analyser les composants de concentrations, une méthode de caractériser ou d'analyser de telles concentrations et un dispositif de mesure |
US7910353B2 (en) | 2004-02-13 | 2011-03-22 | Signature Genomic Laboratories | Methods and apparatuses for achieving precision genetic diagnoses |
US20050181353A1 (en) | 2004-02-17 | 2005-08-18 | Rao Galla C. | Stabilization of cells and biological specimens for analysis |
US20050191636A1 (en) | 2004-03-01 | 2005-09-01 | Biocept, Inc. | Detection of STRP, such as fragile X syndrome |
US20070077578A1 (en) | 2004-03-02 | 2007-04-05 | Primagen Holding B.V. | Diagnosis of (a risk of ) disease and monitoring of therapy |
WO2005084380A2 (fr) | 2004-03-03 | 2005-09-15 | The General Hospital Corporation | Systeme de distribution de solution diluee |
AU2005218622A1 (en) | 2004-03-03 | 2005-09-15 | Living Microsystems | Magnetic device for isolation of cells and biomolecules in a microfluidic environment |
WO2005085861A2 (fr) | 2004-03-03 | 2005-09-15 | Oridis Biomed Forschungs- Und Entwicklungs Gmbh | Acides nucleiques et polypeptides codes destines a etre utilises dans des troubles hepatiques et du cancer epithelial |
US20060121624A1 (en) | 2004-03-03 | 2006-06-08 | Huang Lotien R | Methods and systems for fluid delivery |
WO2005091418A2 (fr) | 2004-03-23 | 2005-09-29 | Amminex A/S | Utilisation d'un dispositif de stockage d'ammoniac dans la production d'energie |
US7390388B2 (en) | 2004-03-25 | 2008-06-24 | Hewlett-Packard Development Company, L.P. | Method of sorting cells on a biodevice |
WO2005098046A2 (fr) | 2004-04-01 | 2005-10-20 | Immunivest Corporation | Methodes de determination de biomarqueurs specifiques de cellules |
EP1781809A1 (fr) | 2004-04-08 | 2007-05-09 | BRAUCH, Hiltrud | Polymorphismes ercc2 |
US20050282196A1 (en) | 2004-04-30 | 2005-12-22 | Jose Costa | Methods and compositions for cancer diagnosis |
WO2005109238A2 (fr) | 2004-05-03 | 2005-11-17 | Cygene Laboratories, Inc. | Procede et systeme d'investigation anonyme etendue basee sur des faits et d'etablissement de rapports a base de faits et d'acces selectif aux resultats et rapports |
US7468249B2 (en) | 2004-05-05 | 2008-12-23 | Biocept, Inc. | Detection of chromosomal disorders |
US20050287611A1 (en) | 2004-05-07 | 2005-12-29 | Nugent C T Iv | MHC bridging system for detecting CTL-mediated lysis of antigen presenting cells |
WO2005116264A2 (fr) | 2004-05-24 | 2005-12-08 | Immunivest Corporation | Analyse sanguine pour surveiller les changements genetiques du cancer evolutif par enrichissement immunomagnetique et hybridation in situ par fluorescence (fish) |
US7709194B2 (en) | 2004-06-04 | 2010-05-04 | The Chinese University Of Hong Kong | Marker for prenatal diagnosis and monitoring |
EP1607485A1 (fr) | 2004-06-14 | 2005-12-21 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Méthode de quantification de l'isoforme VEGF121 dans un échantillon biologique. |
DE102004036285A1 (de) | 2004-07-27 | 2006-02-16 | Advalytix Ag | Verfahren zum Bestimmen der Häufigkeit von Sequenzen einer Probe |
US7820382B2 (en) | 2004-08-03 | 2010-10-26 | Bauer A Robert | Method for the early detection of breast cancer, lung cancer, pancreatic cancer and colon polyps, growths and cancers as well as other gastrointestinal disease conditions and the preoperative and postoperative monitoring of transplanted organs from the donor and in the recipient and their associated conditions related and unrelated to the organ transplantation |
WO2006043181A2 (fr) | 2004-08-04 | 2006-04-27 | Spinx, Inc. | Dispositifs et procedes d'interfacage de dispositifs microfluidiques avec des dispositifs de manipulation de fluides |
JP5537771B2 (ja) | 2004-08-17 | 2014-07-02 | ベリデックス・リミテッド・ライアビリティ・カンパニー | 循環する希少細胞の分析用の画像診断機器 |
WO2006041453A1 (fr) | 2004-09-30 | 2006-04-20 | Immunivest Corporation | Cellules tumorales circulantes (ctc): evaluation de l'apoptose chez les patients presentant un cancer de la prostate |
ES2301268B1 (es) | 2004-10-25 | 2009-05-01 | Centro De Investigacion Biomolecular Aplicada Salamanca, S.L. | Empleo del gen slug, o de sus productos de replicacion, transcripcion o expresion, en la identificacion, diagnostico, prevencion o tratamiento de la diseminacion del cancer y/o desarrollo de metastasis. |
US20060094109A1 (en) | 2004-11-02 | 2006-05-04 | Immunivest Corporation | Device and method for analytical cell imaging |
US20060246575A1 (en) | 2005-01-13 | 2006-11-02 | Micronics, Inc. | Microfluidic rare cell detection device |
US8158410B2 (en) | 2005-01-18 | 2012-04-17 | Biocept, Inc. | Recovery of rare cells using a microchannel apparatus with patterned posts |
US20060252087A1 (en) | 2005-01-18 | 2006-11-09 | Biocept, Inc. | Recovery of rare cells using a microchannel apparatus with patterned posts |
KR20070116585A (ko) | 2005-01-18 | 2007-12-10 | 바이오셉트 인코포레이티드 | 패턴화된 포스트를 갖는 마이크로채널을 이용하는 세포분리법 |
US20060205057A1 (en) | 2005-02-18 | 2006-09-14 | Wayner Danial D M | Microfluidic microarray with high surface area active regions |
WO2007024264A2 (fr) | 2005-02-23 | 2007-03-01 | Bioimagene, Inc. | Procede et systeme de quantification simultanee, a base d'images numeriques et independante du tissu du noyau, du cytoplasme et de la membrane |
US8383357B2 (en) | 2005-03-16 | 2013-02-26 | OSI Pharmaceuticals, LLC | Biological markers predictive of anti-cancer response to epidermal growth factor receptor kinase inhibitors |
EP2612928A3 (fr) | 2005-03-18 | 2013-09-11 | The Chinese University Of Hong Kong | Marqueurs pour le diagnostic et la surveillance prénatale |
FR2883488B1 (fr) | 2005-03-24 | 2010-12-10 | Inst Nat Sante Rech Med | Procede et dispositif pour separer par filtration verticale des particules biologiques contenues dans un liquide |
WO2006108087A2 (fr) | 2005-04-05 | 2006-10-12 | Cellpoint Diagnostics | Dispositifs et procedes permettant d'enrichir et de modifier des cellules tumorales circulantes et d'autres particules |
US20060223178A1 (en) | 2005-04-05 | 2006-10-05 | Tom Barber | Devices and methods for magnetic enrichment of cells and other particles |
GB0509500D0 (en) | 2005-05-10 | 2005-06-15 | Revealcyte | Method of fetal cell enrichment |
WO2007044091A2 (fr) | 2005-06-02 | 2007-04-19 | Fluidigm Corporation | Analyse utilisant des dispositifs de separation microfluidiques |
AU2006256374A1 (en) * | 2005-06-08 | 2006-12-14 | Compugen Ltd. | Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis |
AU2006259583A1 (en) | 2005-06-13 | 2006-12-28 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
WO2007001259A1 (fr) * | 2005-06-16 | 2007-01-04 | Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Methodes et materiels utilises pour identifier des variantes polymorphes, diagnostiquer des predispositions a des pathologies et traiter des maladies |
US7901950B2 (en) | 2005-08-12 | 2011-03-08 | Veridex, Llc | Method for assessing disease states by profile analysis of isolated circulating endothelial cells |
AU2006281569A1 (en) | 2005-08-17 | 2007-02-22 | Medexis S.A. | Composition and method for determination of CK19 expression |
CA2620936A1 (fr) | 2005-09-01 | 2007-03-08 | Precision Therapeutics, Inc. | Tests de chimiosensibilite faisant appel a des cellules tumorales presentant des caracteristiques phenotypiques persistantes |
US20070104717A1 (en) | 2005-09-12 | 2007-05-10 | Regents Of The University Of Michigan | Compositions and methods for detecting and treating cancer |
ES2363757T3 (es) | 2005-09-15 | 2011-08-16 | Val-Chum, S.E.C. | Procedimientos de diagnóstico del cáncer de ovarios. |
US20070059781A1 (en) | 2005-09-15 | 2007-03-15 | Ravi Kapur | System for size based separation and analysis |
US20070059774A1 (en) | 2005-09-15 | 2007-03-15 | Michael Grisham | Kits for Prenatal Testing |
WO2007035744A1 (fr) | 2005-09-20 | 2007-03-29 | Osi Pharmaceuticals, Inc. | Marqueurs biologiques predictifs d'une reaction anticancereuse aux inhibiteurs kinase du recepteur du facteur de croissance 1 analogue a l'insuline |
EP1946114A4 (fr) | 2005-09-21 | 2010-05-26 | Ccc Diagnostics Llc | Procedures de test diagnostique exhaustives pour chimiotherapies anticancereuses personnalisees |
US20110059069A1 (en) | 2005-09-22 | 2011-03-10 | Biogen Idec Ma Inc | Gapr-1 Methods |
GB0519405D0 (en) | 2005-09-23 | 2005-11-02 | Univ Aberdeen | Cancer therapy prognosis and target |
AU2006297033B2 (en) | 2005-09-27 | 2011-09-08 | University Of Saskatchewan | Use of N-myristoyltransferase on non-tumor tissue for cancer diagnosis |
EP1770171A1 (fr) | 2005-09-29 | 2007-04-04 | Universität Zu Köln | Micro-réseau d'ADN pour la rapide détection de Candida albicans dans des échantillons de sang. |
WO2007041610A2 (fr) | 2005-09-30 | 2007-04-12 | National Jewish Medical And Research Center | Genes et proteines associes a l'angiogenese et leurs utilisations |
US20070202106A1 (en) | 2005-10-06 | 2007-08-30 | Baylor Research Institute | Compositions and methods for the treatment of cancer |
US8343756B2 (en) | 2005-10-07 | 2013-01-01 | The General Hospital Corporation | Devices and methods for cell manipulation |
WO2007048076A2 (fr) | 2005-10-21 | 2007-04-26 | The General Hospital Corporation | Procede de diagnostic et de pronostic du cancer |
WO2007050495A2 (fr) | 2005-10-26 | 2007-05-03 | Children's Medical Center Corporation | Methode permettant de pronostiquer une reponse a un anti-egfr |
JP5129149B2 (ja) | 2005-10-31 | 2013-01-23 | ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン | 癌を処置および診断するための組成物および方法 |
US20100062426A1 (en) | 2005-11-03 | 2010-03-11 | O'hara Shawn Mark | AGR2 and TFF3 Regulation in the Diagnosis and Treatment of Cancer |
WO2007056560A2 (fr) | 2005-11-09 | 2007-05-18 | Chemimage Corporation | Systeme et procede d'analyse cytologique par imagerie spectroscopique raman |
US20070122856A1 (en) | 2005-11-10 | 2007-05-31 | Aurelium Biopharma Inc. | Tissue diagnostics for ovarian cancer |
EP1951906B1 (fr) | 2005-11-10 | 2010-12-22 | Bristol-Myers Squibb Pharma Company | Moésine, cavéoline 1 et protéine 1 associée à yes en tant que marqueurs prédictifs de la réponse au dasatinib dans les cancers du sein |
EP1962892A4 (fr) | 2005-11-22 | 2011-10-12 | Univ South Florida | Inhibition de la proliferation de cellules |
US20070238094A1 (en) | 2005-12-09 | 2007-10-11 | Baylor Research Institute | Diagnosis, prognosis and monitoring of disease progression of systemic lupus erythematosus through blood leukocyte microarray analysis |
US7566573B2 (en) | 2005-12-19 | 2009-07-28 | Idexx Laboratories, Inc. | Dual standard curve immunoassay |
US20090311664A1 (en) | 2005-12-22 | 2009-12-17 | Yuman Fong | Method for Detection of Cancer Cells Using Virus |
WO2007079250A2 (fr) | 2005-12-29 | 2007-07-12 | Cellpoint Diagnostics, Inc. | Dispositifs et procedes d'enrichissement et de modification de cellules tumorales circulantes et d'autres particules |
EP1803822A1 (fr) | 2005-12-30 | 2007-07-04 | Adnagen AG | Procédé pour la caractérisation individuelle de molécules cibles thérapeutiques, et leur utilisation |
US20090215084A1 (en) | 2006-01-05 | 2009-08-27 | Mayo Foundation For Medical Education And Research | B7-h1 and b7-h4 in cancer |
US20100015642A1 (en) | 2006-01-05 | 2010-01-21 | Kwon Eugene D | B7-h1 and survivin in cancer |
WO2007080583A2 (fr) | 2006-01-10 | 2007-07-19 | Applied Spectral Imaging Ltd. | Procédés et systèmes pour analyser des échantillons biologiques |
US20070160974A1 (en) | 2006-01-10 | 2007-07-12 | South Eastern Sydney And Illawarra Area Health Service | Human embryonic stem cell clones |
US7842465B2 (en) | 2006-01-17 | 2010-11-30 | Palo Alto Research Center Incorporated | Immunocytostaining methods for enhanced dye ratio discrimination in rare event detection |
US7548145B2 (en) | 2006-01-19 | 2009-06-16 | Innovative Micro Technology | Hysteretic MEMS thermal device and method of manufacture |
WO2007082379A2 (fr) | 2006-01-20 | 2007-07-26 | Mcgill University | Procede d'identification de cellules sensibles à cd40 |
EP1989329A2 (fr) | 2006-01-25 | 2008-11-12 | Board of Regents, The University of Texas System | Detection et diagnostic de cancers lies au tabagisme |
WO2007089911A2 (fr) | 2006-01-30 | 2007-08-09 | The Scripps Research Institute | procedes de detection de cellules tumorales circulantes et procedes de diagnostic de cancer chez un sujet mammalien |
AU2007211251A1 (en) | 2006-01-31 | 2007-08-09 | Georgetown University | Method to detect breast cancer cells |
US7888017B2 (en) * | 2006-02-02 | 2011-02-15 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
WO2007092713A2 (fr) | 2006-02-02 | 2007-08-16 | Trustees Of The University Of Pennsylvania | Système microfluidique et procédé d'analyse de l'expression génique dans des échantillons contenant des cellules et procédé de détection d'une maladie |
JP2009526770A (ja) | 2006-02-09 | 2009-07-23 | マイクロメット アクツィエン ゲゼルシャフト | 転移性乳癌の治療 |
EP1818413A1 (fr) | 2006-02-10 | 2007-08-15 | Fundacion para la Investigacion Clinica y Molecular del Cancer de Pulmon | Méthode de détermination du devenir du carcinome pulmonaire non à petites cellules selon le polymorphisme XRCC3 |
WO2007098427A2 (fr) | 2006-02-18 | 2007-08-30 | Michael Strathmann | Séquençage à multiplexage massif |
EP1991662B1 (fr) | 2006-02-21 | 2018-02-07 | The Trustees Of Princeton University | Activation à rendement élevé de surfaces polymériques pour une liaison par covalence de molécules |
AU2007221234A1 (en) | 2006-02-24 | 2007-09-07 | Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Extracellular matrix/metastasis modifer genes for the prevention or inhibition of metastasis or growth of tumor and for characterization of tumor |
EP1832661A1 (fr) | 2006-03-09 | 2007-09-12 | Adnagen AG | Méthode de stadification individuelle des maladies tumorales |
US8337755B2 (en) | 2006-03-13 | 2012-12-25 | Veridex, Llc | Operator independent programmable sample preparation and analysis system |
WO2007126938A2 (fr) | 2006-03-30 | 2007-11-08 | Albert Einstein College Of Medicine Of Yeshiva University | Marqueur d'anormalies chromosomiques |
US8058055B2 (en) * | 2006-04-07 | 2011-11-15 | Agilent Technologies, Inc. | High resolution chromosomal mapping |
US7901884B2 (en) | 2006-05-03 | 2011-03-08 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis and monitoring |
US7754428B2 (en) | 2006-05-03 | 2010-07-13 | The Chinese University Of Hong Kong | Fetal methylation markers |
US8137912B2 (en) | 2006-06-14 | 2012-03-20 | The General Hospital Corporation | Methods for the diagnosis of fetal abnormalities |
WO2008111990A1 (fr) | 2006-06-14 | 2008-09-18 | Cellpoint Diagnostics, Inc. | Analyse de cellules rares par division d'échantillon et utilisation de marqueurs d'adn |
EP2589668A1 (fr) | 2006-06-14 | 2013-05-08 | Verinata Health, Inc | Analyse de cellules rares utilisant la division d'échantillons et les marqueurs d'ADN |
US20080070792A1 (en) | 2006-06-14 | 2008-03-20 | Roland Stoughton | Use of highly parallel snp genotyping for fetal diagnosis |
CA2655269A1 (fr) | 2006-06-16 | 2007-12-21 | Sequenom, Inc. | Procedes et compositions destines a l'amplification, la detection et la quantification d'acide nucleique issu d'un echantillon |
GB0616045D0 (en) | 2006-08-11 | 2006-09-20 | Univ Bristol | Blood cell separation |
WO2008098142A2 (fr) | 2007-02-08 | 2008-08-14 | Sequenom, Inc. | Tests a base d'acide nucléique destinés au typage rhd, à la détermination du sexe et la quantification d'acide nucléique |
US20100112590A1 (en) * | 2007-07-23 | 2010-05-06 | The Chinese University Of Hong Kong | Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment |
US20090053719A1 (en) | 2007-08-03 | 2009-02-26 | The Chinese University Of Hong Kong | Analysis of nucleic acids by digital pcr |
AU2009226083A1 (en) * | 2008-03-19 | 2009-09-24 | Existence Genetics Llc | Genetic analysis |
SI2334812T1 (sl) | 2008-09-20 | 2017-05-31 | The Board of Trustees of the Leland Stanford Junior University Office of the General Counsel Building 170 | Neinvazivna diagnoza fetalne anevploidije s sekvenciranjem |
-
2009
- 2009-09-16 SI SI200931631A patent/SI2334812T1/sl unknown
- 2009-09-16 ES ES12183946.8T patent/ES2620294T3/es active Active
- 2009-09-16 EP EP20174078.4A patent/EP3751005A3/fr active Pending
- 2009-09-16 EP EP18156359.4A patent/EP3378951B1/fr active Active
- 2009-09-16 LT LTEP12183946.8T patent/LT2562268T/lt unknown
- 2009-09-16 PL PL09815105T patent/PL2334812T3/pl unknown
- 2009-09-16 AU AU2009293354A patent/AU2009293354B2/en active Active
- 2009-09-16 SI SI200931632A patent/SI2562268T1/sl unknown
- 2009-09-16 PT PT121839468T patent/PT2562268T/pt unknown
- 2009-09-16 EP EP15175622.8A patent/EP2952589B1/fr active Active
- 2009-09-16 CA CA3069082A patent/CA3069082C/fr active Active
- 2009-09-16 PT PT98151053T patent/PT2334812T/pt unknown
- 2009-09-16 LT LTEP09815105.3T patent/LT2334812T/lt unknown
- 2009-09-16 EP EP12183946.8A patent/EP2562268B1/fr active Active
- 2009-09-16 WO PCT/US2009/057136 patent/WO2010033578A2/fr active Application Filing
- 2009-09-16 CA CA3069081A patent/CA3069081C/fr active Active
- 2009-09-16 CA CA2737643A patent/CA2737643C/fr active Active
- 2009-09-16 EP EP09815105.3A patent/EP2334812B1/fr active Active
- 2009-09-16 HU HUE12183946A patent/HUE031849T2/en unknown
- 2009-09-16 PL PL12183946T patent/PL2562268T3/pl unknown
- 2009-09-16 US US12/560,708 patent/US20100112575A1/en not_active Abandoned
- 2009-09-16 DK DK12183946.8T patent/DK2562268T3/en active
- 2009-09-16 SG SG10201500567VA patent/SG10201500567VA/en unknown
- 2009-09-16 HU HUE09815105A patent/HUE031848T2/en unknown
- 2009-09-16 DK DK09815105.3T patent/DK2334812T3/en active
- 2009-09-16 CA CA3069077A patent/CA3069077C/fr active Active
- 2009-09-16 ES ES09815105.3T patent/ES2620012T3/es active Active
-
2010
- 2010-01-29 US US12/696,509 patent/US8195415B2/en active Active
-
2011
- 2011-03-17 IL IL211794A patent/IL211794A/en active IP Right Grant
- 2011-05-06 US US13/102,717 patent/US8682594B2/en active Active
- 2011-08-25 US US13/218,317 patent/US20110319272A1/en not_active Abandoned
-
2012
- 2012-04-20 US US13/452,083 patent/US8296076B2/en active Active
-
2013
- 2013-06-19 US US13/921,881 patent/US9404157B2/en active Active
-
2014
- 2014-01-30 US US14/168,714 patent/US9353414B2/en active Active
-
2016
- 2016-01-18 IL IL243655A patent/IL243655A/en active IP Right Grant
- 2016-05-10 HK HK16105339.1A patent/HK1217354A1/zh unknown
- 2016-06-28 US US15/195,135 patent/US10669585B2/en active Active
-
2017
- 2017-03-16 CY CY20171100339T patent/CY1118802T1/el unknown
- 2017-03-17 HR HRP20170435TT patent/HRP20170435T1/hr unknown
- 2017-03-17 HR HRP20170437TT patent/HRP20170437T1/hr unknown
- 2017-03-20 CY CY20171100354T patent/CY1118757T1/el unknown
-
2020
- 2020-04-20 US US16/852,663 patent/US20200270700A1/en active Pending
Patent Citations (101)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4800159A (en) * | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
US20040018509A1 (en) * | 1989-11-13 | 2004-01-29 | Bianchi Diana W. | Non-invasive method for isolation and detection of fetal DNA |
US20070015171A1 (en) * | 1989-11-13 | 2007-01-18 | The Children's Hospital | Non-invasive method for isolation and detection of fetal DNA |
US20060051775A1 (en) * | 1989-11-13 | 2006-03-09 | The Children's Hospital | Non-invasive method for isolation and detection of fetal DNA |
US20020006621A1 (en) * | 1989-11-13 | 2002-01-17 | Children's Medical Center Corporation | Non-invasive method for isolation and detection of fetal DNA |
US6176962B1 (en) * | 1990-02-28 | 2001-01-23 | Aclara Biosciences, Inc. | Methods for fabricating enclosed microchannel structures |
US5879883A (en) * | 1991-10-03 | 1999-03-09 | Indiana University Foundation | Method for screening for alzheimer's disease |
US5498392A (en) * | 1992-05-01 | 1996-03-12 | Trustees Of The University Of Pennsylvania | Mesoscale polynucleotide amplification device and method |
US5866345A (en) * | 1992-05-01 | 1999-02-02 | The Trustees Of The University Of Pennsylvania | Apparatus for the detection of an analyte utilizing mesoscale flow systems |
US5296375A (en) * | 1992-05-01 | 1994-03-22 | Trustees Of The University Of Pennsylvania | Mesoscale sperm handling devices |
US5726026A (en) * | 1992-05-01 | 1998-03-10 | Trustees Of The University Of Pennsylvania | Mesoscale sample preparation device and systems for determination and processing of analytes |
US5486335A (en) * | 1992-05-01 | 1996-01-23 | Trustees Of The University Of Pennsylvania | Analysis based on flow restriction |
US5858649A (en) * | 1992-07-17 | 1999-01-12 | Aprogenex, Inc. | Amplification of mRNA for distinguishing fetal cells in maternal blood |
US6184043B1 (en) * | 1992-09-14 | 2001-02-06 | FODSTAD øYSTEIN | Method for detection of specific target cells in specialized or mixed cell population and solutions containing mixed cell populations |
US5707799A (en) * | 1994-09-30 | 1998-01-13 | Abbott Laboratories | Devices and methods utilizing arrays of structures for analyte capture |
US5709943A (en) * | 1995-05-04 | 1998-01-20 | Minnesota Mining And Manufacturing Company | Biological adsorption supports |
US5715946A (en) * | 1995-06-07 | 1998-02-10 | Reichenbach; Steven H. | Method and apparatus for sorting particles suspended in a fluid |
US6013188A (en) * | 1996-06-07 | 2000-01-11 | Immunivest Corporation | Methods for biological substance analysis employing internal magnetic gradients separation and an externally-applied transport force |
US6344326B1 (en) * | 1996-07-30 | 2002-02-05 | Aclara Bio Sciences, Inc. | Microfluidic method for nucleic acid purification and processing |
US6186660B1 (en) * | 1997-10-09 | 2001-02-13 | Caliper Technologies Corp. | Microfluidic systems incorporating varied channel dimensions |
US6517234B1 (en) * | 1997-10-09 | 2003-02-11 | Caliper Technologies Corp. | Microfluidic systems incorporating varied channel dimensions |
US20020016450A1 (en) * | 1997-10-31 | 2002-02-07 | Bbi Bioseq, Inc., A Masachusetts Corporation | Pressure-enhanced extraction and purification |
US6197523B1 (en) * | 1997-11-24 | 2001-03-06 | Robert A. Levine | Method for the detection, identification, enumeration and confirmation of circulating cancer and/or hematologic progenitor cells in whole blood |
US6200765B1 (en) * | 1998-05-04 | 2001-03-13 | Pacific Northwest Cancer Foundation | Non-invasive methods to detect prostate cancer |
US20020028431A1 (en) * | 1998-08-25 | 2002-03-07 | Julien Jean-Claude Bisconte De Saint | Process, device and reagent for cell separation |
US6673541B1 (en) * | 1998-09-18 | 2004-01-06 | Micromet Ag | DNA amplification of a single cell |
US20040053352A1 (en) * | 1998-09-28 | 2004-03-18 | Tianmei Ouyang | Diagnostics based on tetrazolium compounds |
US20030022207A1 (en) * | 1998-10-16 | 2003-01-30 | Solexa, Ltd. | Arrayed polynucleotides and their use in genome analysis |
US6858439B1 (en) * | 1999-03-15 | 2005-02-22 | Aviva Biosciences | Compositions and methods for separation of moieties on chips |
US6511967B1 (en) * | 1999-04-23 | 2003-01-28 | The General Hospital Corporation | Use of an internalizing transferrin receptor to image transgene expression |
US20040048360A1 (en) * | 1999-08-26 | 2004-03-11 | Caliper Technologies Corp. | Microfluidic analytic detection assays, devices, and integrated systems |
US20020012930A1 (en) * | 1999-09-16 | 2002-01-31 | Rothberg Jonathan M. | Method of sequencing a nucleic acid |
US20020019001A1 (en) * | 1999-10-15 | 2002-02-14 | Ventana Medical Systems, Inc. | Method of detecting single gene copies in-situ |
US6361958B1 (en) * | 1999-11-12 | 2002-03-26 | Motorola, Inc. | Biochannel assay for hybridization with biomaterial |
US20020012931A1 (en) * | 2000-03-27 | 2002-01-31 | Waldman Scott A. | High specificity marker detection |
US20020009738A1 (en) * | 2000-04-03 | 2002-01-24 | Houghton Raymond L. | Methods, compositions and kits for the detection and monitoring of breast cancer |
US20030004402A1 (en) * | 2000-07-18 | 2003-01-02 | Hitt Ben A. | Process for discriminating between biological states based on hidden patterns from biological data |
US20040005582A1 (en) * | 2000-08-10 | 2004-01-08 | Nanobiodynamics, Incorporated | Biospecific desorption microflow systems and methods for studying biospecific interactions and their modulators |
US6689615B1 (en) * | 2000-10-04 | 2004-02-10 | James Murto | Methods and devices for processing blood samples |
US6685841B2 (en) * | 2001-02-14 | 2004-02-03 | Gabriel P. Lopez | Nanostructured devices for separation and analysis |
US6674525B2 (en) * | 2001-04-03 | 2004-01-06 | Micronics, Inc. | Split focusing cytometer |
US20030033091A1 (en) * | 2001-04-20 | 2003-02-13 | Sequenom, Inc. | Systems and methods for testing a biological sample |
US20070037273A1 (en) * | 2001-04-25 | 2007-02-15 | Michael Shuler | Devices and methods for pharmacokinetic-based cell culture system |
US20070037275A1 (en) * | 2001-04-25 | 2007-02-15 | Michael Shuler | Devices and methods for pharmacokinetic-based cell culture system |
US20060060767A1 (en) * | 2001-04-27 | 2006-03-23 | Wang Mark M | Methods and apparatus for use of optical forces for identification, characterization and/or sorting of particles |
US20050049793A1 (en) * | 2001-04-30 | 2005-03-03 | Patrizia Paterlini-Brechot | Prenatal diagnosis method on isolated foetal cell of maternal blood |
US20030017514A1 (en) * | 2001-06-02 | 2003-01-23 | Katharina Pachmann | Method for quantitative detection of vital epithelial tumor cells in a body fluid |
US20050037388A1 (en) * | 2001-06-22 | 2005-02-17 | University Of Geneva | Method for detecting diseases caused by chromosomal imbalances |
US20030044388A1 (en) * | 2001-08-31 | 2003-03-06 | The Chinese University Of Hong Kong | Methods for detecting DNA originating from different individuals |
US20050042685A1 (en) * | 2001-09-06 | 2005-02-24 | Winfried Albert | Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells |
US20050014208A1 (en) * | 2001-09-06 | 2005-01-20 | Alf-Andreas Krehan | Method and kit for diagnosing or controlling the treatment of breast cancer |
US20070042360A1 (en) * | 2001-09-17 | 2007-02-22 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer |
US20050019792A1 (en) * | 2001-11-30 | 2005-01-27 | Fluidigm Corporation | Microfluidic device and methods of using same |
US7171975B2 (en) * | 2002-02-12 | 2007-02-06 | Kionix, Inc. | Fabrication of ultra-shallow channels for microfluidic devices and systems |
US20060024756A1 (en) * | 2002-02-14 | 2006-02-02 | Arjan Tibbe | Methods and algorithms for cell enumeration in low-cost cytometer |
US7332277B2 (en) * | 2002-03-01 | 2008-02-19 | Ravgen, Inc. | Methods for detection of genetic disorders |
US20040009471A1 (en) * | 2002-04-25 | 2004-01-15 | Bo Cao | Methods and kits for detecting a target cell |
US20040018116A1 (en) * | 2002-07-26 | 2004-01-29 | Desmond Sean M. | Microfluidic size-exclusion devices, systems, and methods |
US20060008807A1 (en) * | 2002-08-23 | 2006-01-12 | O'hara Shawn M | Multiparameter analysis of comprehensive nucleic acids and morphological features on the same sample |
US20040037470A1 (en) * | 2002-08-23 | 2004-02-26 | Simske Steven J. | Systems and methods for processing text-based electronic documents |
US20040043506A1 (en) * | 2002-08-30 | 2004-03-04 | Horst Haussecker | Cascaded hydrodynamic focusing in microfluidic channels |
US20070054268A1 (en) * | 2002-09-05 | 2007-03-08 | Robert Sutherland | Methods of diagnosis and prognosis of ovarian cancer |
US20050042623A1 (en) * | 2002-10-30 | 2005-02-24 | Dana Ault-Riche | Systems for capture and analysis of biological particles and methods using the systems |
US20060000772A1 (en) * | 2002-11-29 | 2006-01-05 | Toru Sano | Separation apparatus and separation method |
US20070042368A1 (en) * | 2003-03-24 | 2007-02-22 | Corixa Corporation | Detection and monitoring of lung cancer |
US7476363B2 (en) * | 2003-04-03 | 2009-01-13 | Fluidigm Corporation | Microfluidic devices and methods of using same |
US20050061962A1 (en) * | 2003-07-31 | 2005-03-24 | Arryx, Inc. | Multiple laminar flow-based rate zonal or isopycnic separation with holographic optical trapping of blood cells and other static components |
US20070042339A1 (en) * | 2003-08-08 | 2007-02-22 | Massachusetts General Hospital | Preservation of biomaterials with transported preservation agents |
US7655399B2 (en) * | 2003-10-08 | 2010-02-02 | Trustees Of Boston University | Methods for prenatal diagnosis of chromosomal abnormalities |
US20050221341A1 (en) * | 2003-10-22 | 2005-10-06 | Shimkets Richard A | Sequence-based karyotyping |
US20090117538A1 (en) * | 2003-12-01 | 2009-05-07 | Hashimoto Shin-Ichi | Methods for Obtaining Gene Tags |
US20060046258A1 (en) * | 2004-02-27 | 2006-03-02 | Lapidus Stanley N | Applications of single molecule sequencing |
US20060008824A1 (en) * | 2004-05-20 | 2006-01-12 | Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
US20060051265A1 (en) * | 2004-09-08 | 2006-03-09 | Health Research, Inc. | Apparatus and method for sorting microstructures in a fluid medium |
US7645576B2 (en) * | 2005-03-18 | 2010-01-12 | The Chinese University Of Hong Kong | Method for the detection of chromosomal aneuploidies |
US20070017633A1 (en) * | 2005-03-23 | 2007-01-25 | Tonkovich Anna L | Surface features in microprocess technology |
US20070026381A1 (en) * | 2005-04-05 | 2007-02-01 | Huang Lotien R | Devices and methods for enrichment and alteration of cells and other particles |
US20070054287A1 (en) * | 2005-05-31 | 2007-03-08 | Applera Corporation | Method for identifying medically important cell populations using micro rna as tissue specific biomarkers |
US20070026415A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026414A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026469A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026416A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026419A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026413A1 (en) * | 2005-07-29 | 2007-02-01 | Mehmet Toner | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026417A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070026418A1 (en) * | 2005-07-29 | 2007-02-01 | Martin Fuchs | Devices and methods for enrichment and alteration of circulating tumor cells and other particles |
US20070037172A1 (en) * | 2005-08-11 | 2007-02-15 | Chiu Daniel T | Separation and concentration of biological cells and biological particles using a one-dimensional channel |
US20070037173A1 (en) * | 2005-08-12 | 2007-02-15 | Allard Jeffrey W | Circulating tumor cells (CTC's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients |
US20070042238A1 (en) * | 2005-08-22 | 2007-02-22 | Lg Electronics Inc. | Fuel cell having water type radiating device |
US20070048750A1 (en) * | 2005-09-01 | 2007-03-01 | National Health Research Institute | Rapid efficacy assessment method for lung cancer therapy |
US20070059680A1 (en) * | 2005-09-15 | 2007-03-15 | Ravi Kapur | System for cell enrichment |
US20070059719A1 (en) * | 2005-09-15 | 2007-03-15 | Michael Grisham | Business methods for prenatal Diagnosis |
US20070059716A1 (en) * | 2005-09-15 | 2007-03-15 | Ulysses Balis | Methods for detecting fetal abnormality |
US20070059718A1 (en) * | 2005-09-15 | 2007-03-15 | Mehmet Toner | Systems and methods for enrichment of analytes |
US20070059683A1 (en) * | 2005-09-15 | 2007-03-15 | Tom Barber | Veterinary diagnostic system |
US20080020390A1 (en) * | 2006-02-28 | 2008-01-24 | Mitchell Aoy T | Detecting fetal chromosomal abnormalities using tandem single nucleotide polymorphisms |
US20080038733A1 (en) * | 2006-03-28 | 2008-02-14 | Baylor College Of Medicine | Screening for down syndrome |
US20080023399A1 (en) * | 2006-06-01 | 2008-01-31 | Inglis David W | Apparatus and method for continuous particle separation |
US20080050739A1 (en) * | 2006-06-14 | 2008-02-28 | Roland Stoughton | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
US20080026390A1 (en) * | 2006-06-14 | 2008-01-31 | Roland Stoughton | Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis |
US20090029377A1 (en) * | 2007-07-23 | 2009-01-29 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
Non-Patent Citations (3)
Title |
---|
Dohm et al., Nucleic Acids Research, 2008, Vol. 36, pages 1-10. * |
Huse et al., Genome Biology, 2007, Vol. 8, pages 1-9. * |
Zhang, CT et al. A novel method to calculate the G+C content of genomic sequences. 2001 J. Biomol Struct Dyn Vol 2 abstract only * |
Cited By (289)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100216153A1 (en) * | 2004-02-27 | 2010-08-26 | Helicos Biosciences Corporation | Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities |
US10081839B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10260096B2 (en) | 2005-07-29 | 2019-04-16 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10227652B2 (en) | 2005-07-29 | 2019-03-12 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US10266893B2 (en) | 2005-07-29 | 2019-04-23 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10392664B2 (en) | 2005-07-29 | 2019-08-27 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10083273B2 (en) | 2005-07-29 | 2018-09-25 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US10597724B2 (en) | 2005-11-26 | 2020-03-24 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US9695477B2 (en) | 2005-11-26 | 2017-07-04 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US9430611B2 (en) | 2005-11-26 | 2016-08-30 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US8682592B2 (en) | 2005-11-26 | 2014-03-25 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US9424392B2 (en) | 2005-11-26 | 2016-08-23 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US10240202B2 (en) | 2005-11-26 | 2019-03-26 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US10711309B2 (en) | 2005-11-26 | 2020-07-14 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US20100256013A1 (en) * | 2006-02-02 | 2010-10-07 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US8008018B2 (en) | 2006-02-02 | 2011-08-30 | The Board Of Trustees Of The Leland Stanford Junior University | Determination of fetal aneuploidies by massively parallel DNA sequencing |
US20100255492A1 (en) * | 2006-02-02 | 2010-10-07 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US11692225B2 (en) | 2006-02-02 | 2023-07-04 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
US20100255493A1 (en) * | 2006-02-02 | 2010-10-07 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US20100124751A1 (en) * | 2006-02-02 | 2010-05-20 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US8293470B2 (en) | 2006-02-02 | 2012-10-23 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
US10072295B2 (en) | 2006-02-02 | 2018-09-11 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digtal analysis |
US20100124752A1 (en) * | 2006-02-02 | 2010-05-20 | The Board Of Trustees Of The Leland Stanford Junior University | Non-Invasive Fetal Genetic Screening by Digital Analysis |
US9777329B2 (en) | 2006-02-02 | 2017-10-03 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
US9441273B2 (en) | 2006-02-02 | 2016-09-13 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
US9777328B2 (en) | 2006-02-02 | 2017-10-03 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive fetal genetic screening by digital analysis |
US10591391B2 (en) | 2006-06-14 | 2020-03-17 | Verinata Health, Inc. | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
US10041119B2 (en) | 2006-06-14 | 2018-08-07 | Verinata Health, Inc. | Methods for the diagnosis of fetal abnormalities |
US11781187B2 (en) | 2006-06-14 | 2023-10-10 | The General Hospital Corporation | Rare cell analysis using sample splitting and DNA tags |
US8372584B2 (en) | 2006-06-14 | 2013-02-12 | The General Hospital Corporation | Rare cell analysis using sample splitting and DNA tags |
US8168389B2 (en) | 2006-06-14 | 2012-05-01 | The General Hospital Corporation | Fetal cell analysis using sample splitting |
US10155984B2 (en) | 2006-06-14 | 2018-12-18 | The General Hospital Corporation | Rare cell analysis using sample splitting and DNA tags |
US8137912B2 (en) | 2006-06-14 | 2012-03-20 | The General Hospital Corporation | Methods for the diagnosis of fetal abnormalities |
US11674176B2 (en) | 2006-06-14 | 2023-06-13 | Verinata Health, Inc | Fetal aneuploidy detection by sequencing |
US10435751B2 (en) | 2006-06-14 | 2019-10-08 | Verinata Health, Inc. | Methods for the diagnosis of fetal abnormalities |
US10704090B2 (en) | 2006-06-14 | 2020-07-07 | Verinata Health, Inc. | Fetal aneuploidy detection by sequencing |
US9347100B2 (en) | 2006-06-14 | 2016-05-24 | Gpb Scientific, Llc | Rare cell analysis using sample splitting and DNA tags |
US9273355B2 (en) | 2006-06-14 | 2016-03-01 | The General Hospital Corporation | Rare cell analysis using sample splitting and DNA tags |
US20080138809A1 (en) * | 2006-06-14 | 2008-06-12 | Ravi Kapur | Methods for the Diagnosis of Fetal Abnormalities |
US9017942B2 (en) | 2006-06-14 | 2015-04-28 | The General Hospital Corporation | Rare cell analysis using sample splitting and DNA tags |
US11261492B2 (en) | 2006-06-14 | 2022-03-01 | The General Hospital Corporation | Methods for the diagnosis of fetal abnormalities |
US20100112590A1 (en) * | 2007-07-23 | 2010-05-06 | The Chinese University Of Hong Kong | Diagnosing Fetal Chromosomal Aneuploidy Using Genomic Sequencing With Enrichment |
US9121069B2 (en) | 2007-07-23 | 2015-09-01 | The Chinese University Of Hong Kong | Diagnosing cancer using genomic sequencing |
US11142799B2 (en) | 2007-07-23 | 2021-10-12 | The Chinese University Of Hong Kong | Detecting chromosomal aberrations associated with cancer using genomic sequencing |
US9051616B2 (en) | 2007-07-23 | 2015-06-09 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
US8972202B2 (en) | 2007-07-23 | 2015-03-03 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
US20090029377A1 (en) * | 2007-07-23 | 2009-01-29 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using massively parallel genomic sequencing |
US8442774B2 (en) | 2007-07-23 | 2013-05-14 | The Chinese University Of Hong Kong | Diagnosing fetal chromosomal aneuploidy using paired end |
US10619214B2 (en) | 2007-07-23 | 2020-04-14 | The Chinese University Of Hong Kong | Detecting genetic aberrations associated with cancer using genomic sequencing |
US20110033862A1 (en) * | 2008-02-19 | 2011-02-10 | Gene Security Network, Inc. | Methods for cell genotyping |
US20110092763A1 (en) * | 2008-05-27 | 2011-04-21 | Gene Security Network, Inc. | Methods for Embryo Characterization and Comparison |
US9639657B2 (en) | 2008-08-04 | 2017-05-02 | Natera, Inc. | Methods for allele calling and ploidy calling |
US20110178719A1 (en) * | 2008-08-04 | 2011-07-21 | Gene Security Network, Inc. | Methods for Allele Calling and Ploidy Calling |
US10669585B2 (en) | 2008-09-20 | 2020-06-02 | The Board Of Trustees Of The Leland Stanford Junior University | Noninvasive diagnosis of fetal aneuploidy by sequencing |
US20100304978A1 (en) * | 2009-01-26 | 2010-12-02 | David Xingfei Deng | Methods and compositions for identifying a fetal cell |
US10216896B2 (en) | 2009-09-30 | 2019-02-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US9228234B2 (en) | 2009-09-30 | 2016-01-05 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10061889B2 (en) | 2009-09-30 | 2018-08-28 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10522242B2 (en) | 2009-09-30 | 2019-12-31 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10061890B2 (en) | 2009-09-30 | 2018-08-28 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
EP3260555A1 (fr) | 2010-01-19 | 2017-12-27 | Verinata Health, Inc | Nouveau protocole de préparation de bibliothèques de séquençage |
US11286520B2 (en) | 2010-01-19 | 2022-03-29 | Verinata Health, Inc. | Method for determining copy number variations |
US10612096B2 (en) | 2010-01-19 | 2020-04-07 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
WO2011091046A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Identification de cellules polymorphes dans des mélanges d'adn génomique par séquençage du génome entier |
US10662474B2 (en) | 2010-01-19 | 2020-05-26 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing |
US10482993B2 (en) | 2010-01-19 | 2019-11-19 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US20110201507A1 (en) * | 2010-01-19 | 2011-08-18 | Rava Richard P | Sequencing methods and compositions for prenatal diagnoses |
US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9657342B2 (en) | 2010-01-19 | 2017-05-23 | Verinata Health, Inc. | Sequencing methods for prenatal diagnoses |
US20110224087A1 (en) * | 2010-01-19 | 2011-09-15 | Stephen Quake | Simultaneous determination of aneuploidy and fetal fraction |
US20110230358A1 (en) * | 2010-01-19 | 2011-09-22 | Artemis Health, Inc. | Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing |
EP3006573A1 (fr) | 2010-01-19 | 2016-04-13 | Verinata Health, Inc | Procédés de détermination de fraction d'acides nucléiques foetaux dans d'échantillons maternels |
US9260745B2 (en) * | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9493828B2 (en) | 2010-01-19 | 2016-11-15 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
US11697846B2 (en) | 2010-01-19 | 2023-07-11 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US20200219588A1 (en) * | 2010-01-19 | 2020-07-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US10415089B2 (en) | 2010-01-19 | 2019-09-17 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US10586610B2 (en) | 2010-01-19 | 2020-03-10 | Verinata Health, Inc. | Detecting and classifying copy number variation |
EP4074838A1 (fr) | 2010-01-19 | 2022-10-19 | Verinata Health, Inc. | Nouveau protocole de préparation de bibliothèques de séquençage |
US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US11875899B2 (en) | 2010-01-19 | 2024-01-16 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
EP3878973A1 (fr) | 2010-01-19 | 2021-09-15 | Verinata Health, Inc. | Procédés de détermination de fraction d'acides nucléiques f taux dans d'échantillons maternels |
EP3492601A1 (fr) | 2010-01-19 | 2019-06-05 | Verinata Health, Inc | Nouveau protocole de préparation de bibliothèques de séquençage |
US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
WO2011090556A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Procédés pour déterminer une fraction d'acide nucléique fœtal dans des échantillons maternels |
WO2011090559A1 (fr) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Méthodes de séquençage et compositions de diagnostic prénatal |
US11130995B2 (en) | 2010-01-19 | 2021-09-28 | Verinata Health, Inc. | Simultaneous determination of aneuploidy and fetal fraction |
US20130029852A1 (en) * | 2010-01-19 | 2013-01-31 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US10941442B2 (en) | 2010-01-19 | 2021-03-09 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
US11884975B2 (en) | 2010-01-19 | 2024-01-30 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
EP3382037A1 (fr) | 2010-01-19 | 2018-10-03 | Verinata Health, Inc | Procédés de détermination de fraction d'acides nucléiques f taux dans d'échantillons maternels |
US10718020B2 (en) | 2010-01-23 | 2020-07-21 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US9493831B2 (en) | 2010-01-23 | 2016-11-15 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US9163282B2 (en) | 2010-05-18 | 2015-10-20 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11525162B2 (en) | 2010-05-18 | 2022-12-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10557172B2 (en) | 2010-05-18 | 2020-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10174369B2 (en) | 2010-05-18 | 2019-01-08 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11746376B2 (en) | 2010-05-18 | 2023-09-05 | Natera, Inc. | Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR |
US10538814B2 (en) | 2010-05-18 | 2020-01-21 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10113196B2 (en) | 2010-05-18 | 2018-10-30 | Natera, Inc. | Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping |
US10526658B2 (en) | 2010-05-18 | 2020-01-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US8825412B2 (en) | 2010-05-18 | 2014-09-02 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11519035B2 (en) * | 2010-05-18 | 2022-12-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US8949036B2 (en) | 2010-05-18 | 2015-02-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10793912B2 (en) | 2010-05-18 | 2020-10-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US9334541B2 (en) | 2010-05-18 | 2016-05-10 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10017812B2 (en) | 2010-05-18 | 2018-07-10 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10774380B2 (en) | 2010-05-18 | 2020-09-15 | Natera, Inc. | Methods for multiplex PCR amplification of target loci in a nucleic acid sample |
US10316362B2 (en) | 2010-05-18 | 2019-06-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10731220B2 (en) | 2010-05-18 | 2020-08-04 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10590482B2 (en) | 2010-05-18 | 2020-03-17 | Natera, Inc. | Amplification of cell-free DNA using nested PCR |
US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11482300B2 (en) | 2010-05-18 | 2022-10-25 | Natera, Inc. | Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA |
US10597723B2 (en) | 2010-05-18 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
US11306357B2 (en) | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
US11312996B2 (en) | 2010-05-18 | 2022-04-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US10655180B2 (en) | 2010-05-18 | 2020-05-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US9567639B2 (en) | 2010-08-06 | 2017-02-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
US9890421B2 (en) | 2010-08-06 | 2018-02-13 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
US11203786B2 (en) | 2010-08-06 | 2021-12-21 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
US10131937B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
US10308981B2 (en) | 2010-08-06 | 2019-06-04 | Ariosa Diagnostics, Inc. | Assay systems for determination of source contribution in a sample |
US10233496B2 (en) | 2010-08-06 | 2019-03-19 | Ariosa Diagnostics, Inc. | Ligation-based detection of genetic variants |
US11031095B2 (en) | 2010-08-06 | 2021-06-08 | Ariosa Diagnostics, Inc. | Assay systems for determination of fetal copy number variation |
US10533223B2 (en) | 2010-08-06 | 2020-01-14 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
US10131951B2 (en) | 2010-08-06 | 2018-11-20 | Ariosa Diagnostics, Inc. | Assay systems for genetic analysis |
US10167508B2 (en) | 2010-08-06 | 2019-01-01 | Ariosa Diagnostics, Inc. | Detection of genetic abnormalities |
US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
WO2012078792A2 (fr) | 2010-12-07 | 2012-06-14 | Stanford University | Détermination non invasive de l'héritage foetal des haplotypes parentaux à l'échelle du génome |
US11270781B2 (en) | 2011-01-25 | 2022-03-08 | Ariosa Diagnostics, Inc. | Statistical analysis for non-invasive sex chromosome aneuploidy determination |
US10131947B2 (en) | 2011-01-25 | 2018-11-20 | Ariosa Diagnostics, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
US11441185B2 (en) | 2011-01-25 | 2022-09-13 | Roche Molecular Systems, Inc. | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
US8756020B2 (en) | 2011-01-25 | 2014-06-17 | Ariosa Diagnostics, Inc. | Enhanced risk probabilities using biomolecule estimations |
US10718024B2 (en) | 2011-01-25 | 2020-07-21 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
US8700338B2 (en) | 2011-01-25 | 2014-04-15 | Ariosa Diagnosis, Inc. | Risk calculation for evaluation of fetal aneuploidy |
US10718019B2 (en) | 2011-01-25 | 2020-07-21 | Ariosa Diagnostics, Inc. | Risk calculation for evaluation of fetal aneuploidy |
JP2018061514A (ja) * | 2011-04-12 | 2018-04-19 | ベリナタ ヘルス インコーポレイテッド | 多型カウントを用いたゲノム画分の分析 |
US10658070B2 (en) | 2011-04-12 | 2020-05-19 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9885080B2 (en) * | 2011-05-31 | 2018-02-06 | Berry Genomics Co., Ltd. | Kit, a device and a method for detecting copy number of fetal chromosomes or tumor cell chromosomes |
US20130130921A1 (en) * | 2011-05-31 | 2013-05-23 | Berry Genomics Co., Ltd. | Kit, a Device and a Method for Detecting Copy Number of Fetal Chromosomes or Tumor Cell Chromosomes |
US11004537B2 (en) | 2011-06-24 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non invasive assessment of a genetic variation |
US9547748B2 (en) | 2011-06-29 | 2017-01-17 | Bgi Health Service Co., Ltd. | Method for determining fetal chromosomal abnormality |
US11289176B2 (en) | 2011-09-07 | 2022-03-29 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
US8712697B2 (en) | 2011-09-07 | 2014-04-29 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
US10847250B2 (en) | 2011-09-07 | 2020-11-24 | Ariosa Diagnostics, Inc. | Determination of copy number variations using binomial probability calculations |
US20140228226A1 (en) * | 2011-09-21 | 2014-08-14 | Bgi Health Service Co., Ltd. | Method and system for determining chromosome aneuploidy of single cell |
US10424394B2 (en) | 2011-10-06 | 2019-09-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10196681B2 (en) | 2011-10-06 | 2019-02-05 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
JP2017099419A (ja) * | 2011-10-06 | 2017-06-08 | セクエノム, インコーポレイテッド | 遺伝的変異の非侵襲的評価のための方法およびプロセス |
US11001884B2 (en) | 2011-10-06 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11492659B2 (en) | 2011-10-06 | 2022-11-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11560586B2 (en) | 2011-10-06 | 2023-01-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9984198B2 (en) | 2011-10-06 | 2018-05-29 | Sequenom, Inc. | Reducing sequence read count error in assessment of complex genetic variations |
US10323268B2 (en) | 2011-10-06 | 2019-06-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
JP2017073144A (ja) * | 2011-10-06 | 2017-04-13 | セクエノム, インコーポレイテッド | 遺伝的変異の非侵襲的評価のための方法およびプロセス |
US11437121B2 (en) | 2011-10-06 | 2022-09-06 | Sequenom, Inc. | Methods and processes for non-invasive detection of a microduplication or a microdeletion with reduced sequence read count error |
US9367663B2 (en) * | 2011-10-06 | 2016-06-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US8688388B2 (en) * | 2011-10-11 | 2014-04-01 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10214775B2 (en) | 2011-12-07 | 2019-02-26 | Chronix Biomedical | Prostate cancer associated circulating nucleic acid biomarkers |
WO2013086352A1 (fr) * | 2011-12-07 | 2013-06-13 | Chronix Biomedical | Biomarqueurs pour acides nucléiques circulants associés au cancer de la prostate prostate cancer associated circulating nucleic acid biomarkers |
US20140336075A1 (en) * | 2011-12-17 | 2014-11-13 | Bgi Diagnosis Co., Ltd. | Method and system for determinining whether genome is abnormal |
US11697849B2 (en) | 2012-01-20 | 2023-07-11 | Sequenom, Inc. | Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions |
CN108485940A (zh) * | 2012-04-12 | 2018-09-04 | 维里纳塔健康公司 | 拷贝数变异的检测和分类 |
CN103374518A (zh) * | 2012-04-12 | 2013-10-30 | 维里纳塔健康公司 | 拷贝数变异的检测和分类 |
US11404142B2 (en) | 2012-05-21 | 2022-08-02 | Roche Molecular Systems, Inc. | Processes for calculating phased fetal genomic sequences |
US11306354B2 (en) | 2012-05-21 | 2022-04-19 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
US10289800B2 (en) | 2012-05-21 | 2019-05-14 | Ariosa Diagnostics, Inc. | Processes for calculating phased fetal genomic sequences |
US11261494B2 (en) * | 2012-06-21 | 2022-03-01 | The Chinese University Of Hong Kong | Method of measuring a fractional concentration of tumor DNA |
US10497461B2 (en) | 2012-06-22 | 2019-12-03 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9206417B2 (en) | 2012-07-19 | 2015-12-08 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
US9624490B2 (en) | 2012-07-19 | 2017-04-18 | Ariosa Diagnostics, Inc. | Multiplexed sequential ligation-based detection of genetic variants |
US10793916B2 (en) | 2012-09-04 | 2020-10-06 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10683556B2 (en) | 2012-09-04 | 2020-06-16 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10947600B2 (en) | 2012-09-04 | 2021-03-16 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11434523B2 (en) | 2012-09-04 | 2022-09-06 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10961592B2 (en) | 2012-09-04 | 2021-03-30 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10894974B2 (en) | 2012-09-04 | 2021-01-19 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10995376B1 (en) | 2012-09-04 | 2021-05-04 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10738364B2 (en) | 2012-09-04 | 2020-08-11 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11001899B1 (en) | 2012-09-04 | 2021-05-11 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10501810B2 (en) | 2012-09-04 | 2019-12-10 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11773453B2 (en) | 2012-09-04 | 2023-10-03 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10501808B2 (en) | 2012-09-04 | 2019-12-10 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10822663B2 (en) | 2012-09-04 | 2020-11-03 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11913065B2 (en) | 2012-09-04 | 2024-02-27 | Guardent Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10457995B2 (en) | 2012-09-04 | 2019-10-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10876172B2 (en) | 2012-09-04 | 2020-12-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10837063B2 (en) | 2012-09-04 | 2020-11-17 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10876171B2 (en) | 2012-09-04 | 2020-12-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11879158B2 (en) | 2012-09-04 | 2024-01-23 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11319597B2 (en) | 2012-09-04 | 2022-05-03 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10876152B2 (en) | 2012-09-04 | 2020-12-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10494678B2 (en) | 2012-09-04 | 2019-12-03 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11319598B2 (en) | 2012-09-04 | 2022-05-03 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10482994B2 (en) | 2012-10-04 | 2019-11-19 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10504613B2 (en) | 2012-12-20 | 2019-12-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10643738B2 (en) | 2013-01-10 | 2020-05-05 | The Chinese University Of Hong Kong | Noninvasive prenatal molecular karyotyping from maternal plasma |
US11923046B2 (en) | 2013-01-10 | 2024-03-05 | The Chinese University Of Hong Kong | Noninvasive prenatal molecular karyotyping from maternal plasma |
US10497462B2 (en) | 2013-01-25 | 2019-12-03 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
EP2948886B1 (fr) * | 2013-01-25 | 2023-08-23 | Sequenom, Inc. | Procédés et processus d'évaluation non invasive de variations génétiques |
EP2948886A2 (fr) * | 2013-01-25 | 2015-12-02 | Sequenom, Inc. | Procédés et processus d'évaluation non invasive de variations génétiques |
KR101614471B1 (ko) * | 2013-02-28 | 2016-04-21 | 주식회사 테라젠이텍스 | 유전체 서열분석을 이용한 태아 염색체 이수성의 진단 방법 및 장치 |
US9994897B2 (en) | 2013-03-08 | 2018-06-12 | Ariosa Diagnostics, Inc. | Non-invasive fetal sex determination |
US10930368B2 (en) | 2013-04-03 | 2021-02-23 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11462298B2 (en) | 2013-05-24 | 2022-10-04 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10699800B2 (en) | 2013-05-24 | 2020-06-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10622094B2 (en) | 2013-06-21 | 2020-04-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9499870B2 (en) | 2013-09-27 | 2016-11-22 | Natera, Inc. | Cell free DNA diagnostic testing standards |
US10577655B2 (en) | 2013-09-27 | 2020-03-03 | Natera, Inc. | Cell free DNA diagnostic testing standards |
US10964409B2 (en) | 2013-10-04 | 2021-03-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11929146B2 (en) | 2013-10-07 | 2024-03-12 | Sequenom, Inc. | Systems for non-invasive assessment of chromosome alterations using changes in subsequence mappability |
US10438691B2 (en) | 2013-10-07 | 2019-10-08 | Sequenom, Inc. | Non-invasive assessment of chromosome alterations using change in subsequence mappability |
US10741269B2 (en) | 2013-10-21 | 2020-08-11 | Verinata Health, Inc. | Method for improving the sensitivity of detection in determining copy number variations |
US11434531B2 (en) | 2013-12-28 | 2022-09-06 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US10801063B2 (en) | 2013-12-28 | 2020-10-13 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11767555B2 (en) | 2013-12-28 | 2023-09-26 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11767556B2 (en) | 2013-12-28 | 2023-09-26 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US10883139B2 (en) | 2013-12-28 | 2021-01-05 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11959139B2 (en) | 2013-12-28 | 2024-04-16 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11149307B2 (en) | 2013-12-28 | 2021-10-19 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11118221B2 (en) | 2013-12-28 | 2021-09-14 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11149306B2 (en) | 2013-12-28 | 2021-10-19 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11667967B2 (en) | 2013-12-28 | 2023-06-06 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11649491B2 (en) | 2013-12-28 | 2023-05-16 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11639526B2 (en) | 2013-12-28 | 2023-05-02 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US11639525B2 (en) | 2013-12-28 | 2023-05-02 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US10889858B2 (en) | 2013-12-28 | 2021-01-12 | Guardant Health, Inc. | Methods and systems for detecting genetic variants |
US10982265B2 (en) | 2014-03-05 | 2021-04-20 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11667959B2 (en) | 2014-03-05 | 2023-06-06 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10704086B2 (en) | 2014-03-05 | 2020-07-07 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11447813B2 (en) | 2014-03-05 | 2022-09-20 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10704085B2 (en) | 2014-03-05 | 2020-07-07 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11091797B2 (en) | 2014-03-05 | 2021-08-17 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10870880B2 (en) | 2014-03-05 | 2020-12-22 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11091796B2 (en) | 2014-03-05 | 2021-08-17 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11486008B2 (en) | 2014-04-21 | 2022-11-01 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US9677118B2 (en) | 2014-04-21 | 2017-06-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10597708B2 (en) | 2014-04-21 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplifications of target loci |
US10597709B2 (en) | 2014-04-21 | 2020-03-24 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11319595B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US10179937B2 (en) | 2014-04-21 | 2019-01-15 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11371100B2 (en) | 2014-04-21 | 2022-06-28 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11530454B2 (en) | 2014-04-21 | 2022-12-20 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US10262755B2 (en) | 2014-04-21 | 2019-04-16 | Natera, Inc. | Detecting cancer mutations and aneuploidy in chromosomal segments |
US10351906B2 (en) | 2014-04-21 | 2019-07-16 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11414709B2 (en) | 2014-04-21 | 2022-08-16 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11408037B2 (en) | 2014-04-21 | 2022-08-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US10318704B2 (en) | 2014-05-30 | 2019-06-11 | Verinata Health, Inc. | Detecting fetal sub-chromosomal aneuploidies |
US11783911B2 (en) | 2014-07-30 | 2023-10-10 | Sequenom, Inc | Methods and processes for non-invasive assessment of genetic variations |
US11072814B2 (en) | 2014-12-12 | 2021-07-27 | Verinata Health, Inc. | Using cell-free DNA fragment size to determine copy number variations |
US10364467B2 (en) | 2015-01-13 | 2019-07-30 | The Chinese University Of Hong Kong | Using size and number aberrations in plasma DNA for detecting cancer |
US11168370B2 (en) | 2015-02-10 | 2021-11-09 | The Chinese University Of Hong Kong | Detecting mutations for cancer screening |
US11946101B2 (en) | 2015-05-11 | 2024-04-02 | Natera, Inc. | Methods and compositions for determining ploidy |
US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
US11242569B2 (en) | 2015-12-17 | 2022-02-08 | Guardant Health, Inc. | Methods to determine tumor gene copy number by analysis of cell-free DNA |
US11430541B2 (en) | 2016-02-03 | 2022-08-30 | Verinata Health, Inc. | Using cell-free DNA fragment size to determine copy number variations |
US10095831B2 (en) | 2016-02-03 | 2018-10-09 | Verinata Health, Inc. | Using cell-free DNA fragment size to determine copy number variations |
CN113096726A (zh) * | 2016-02-03 | 2021-07-09 | 维里纳塔健康公司 | 使用无细胞dna片段尺寸以确定拷贝数变异 |
US11200963B2 (en) | 2016-07-27 | 2021-12-14 | Sequenom, Inc. | Genetic copy number alteration classifications |
US11854666B2 (en) | 2016-09-29 | 2023-12-26 | Myriad Women's Health, Inc. | Noninvasive prenatal screening using dynamic iterative depth optimization |
US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
US10011870B2 (en) | 2016-12-07 | 2018-07-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US10533219B2 (en) | 2016-12-07 | 2020-01-14 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US11530442B2 (en) | 2016-12-07 | 2022-12-20 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US10577650B2 (en) | 2016-12-07 | 2020-03-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US11694768B2 (en) | 2017-01-24 | 2023-07-04 | Sequenom, Inc. | Methods and processes for assessment of genetic variations |
US10894976B2 (en) | 2017-02-21 | 2021-01-19 | Natera, Inc. | Compositions, methods, and kits for isolating nucleic acids |
US11525134B2 (en) | 2017-10-27 | 2022-12-13 | Juno Diagnostics, Inc. | Devices, systems and methods for ultra-low volume liquid biopsy |
US11525159B2 (en) | 2018-07-03 | 2022-12-13 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
CN111627498A (zh) * | 2020-05-21 | 2020-09-04 | 北京吉因加医学检验实验室有限公司 | 一种测序数据gc偏向性校正的方法及其装置 |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20200270700A1 (en) | Noninvasive diagnosis of fetal aneuploidy by sequencing | |
EP3529377B1 (fr) | Évaluation de l'âge gestationnel par méthylation et profilage de taille d'adn plasmatique maternel | |
AU2021200569B2 (en) | Noninvasive diagnosis of fetal aneuploidy by sequencing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FAN, HEI MUN CHRISTINA;QUAKE, STEPHEN R.;SIGNING DATES FROM 20090917 TO 20091027;REEL/FRAME:023455/0526 |
|
AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF Free format text: CONFIRMATORY LICENSE;ASSIGNOR:STANFORD UNIVERSITY;REEL/FRAME:023838/0136 Effective date: 20100119 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |