US20080226677A1 - Recombinant virus vector for gene transfer into lymphoid cells - Google Patents

Recombinant virus vector for gene transfer into lymphoid cells Download PDF

Info

Publication number
US20080226677A1
US20080226677A1 US10/843,877 US84387704A US2008226677A1 US 20080226677 A1 US20080226677 A1 US 20080226677A1 US 84387704 A US84387704 A US 84387704A US 2008226677 A1 US2008226677 A1 US 2008226677A1
Authority
US
United States
Prior art keywords
gene
orf
region
flanking
region flanking
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/843,877
Other languages
English (en)
Inventor
Yasuko Mori
Kenjiro Tadagaki
Masaya Takemoto
Michiaki Takahashi
Koichi Yamanishi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY
Original Assignee
RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY filed Critical RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY
Assigned to RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY, THE reassignment RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAKA UNVERSITY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TAKAHASHI, MICHIAKI, YAMANISHI, KOICHI, MORI, YASUKO, TADAGAKI, KENJIRO, TAKEMOTO, MASAYA
Publication of US20080226677A1 publication Critical patent/US20080226677A1/en
Priority to US12/437,644 priority Critical patent/US7820436B2/en
Priority to US12/794,193 priority patent/US8148060B2/en
Priority to US13/214,137 priority patent/US20120129263A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/763—Herpes virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16511—Roseolovirus, e.g. human herpesvirus 6, 7
    • C12N2710/16532—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16511—Roseolovirus, e.g. human herpesvirus 6, 7
    • C12N2710/16541—Use of virus, viral particle or viral elements as a vector
    • C12N2710/16543—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/50—Vectors for producing vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2820/00—Vectors comprising a special origin of replication system
    • C12N2820/55—Vectors comprising a special origin of replication system from bacteria

Definitions

  • the present invention relates to a recombinant viral vector for introducing a desired gene into lymphoid cells, particularly a recombinant human herpes viral vector prepared using BAC ( E. coli artificial chromosome), and a pharmaceutical composition comprising such a viral vector. Further, the present invention relates to a vector comprising a human herpes viral genomic gene and a BAC vector sequence, and a cell containing such a vector. Further, the present invention relates to a method for producing a recombinant human herpesvirus. Further, the present invention relates to a nucleic acid cassette comprising a fragment capable of homologous recombination with a herpesvirus genome, and a BAC vector sequence.
  • lymphoid cells There has been a demand for the establishment of a technique for gene therapy with lymphoid cells in order to treat various diseases involving lymphoid cells, e.g., human immunodeficiency virus (HIV) infection.
  • HIV human immunodeficiency virus
  • no satisfactory vector system for introducing a desired gene into lymphoid cells has been developed.
  • Herpesvirus is a generic term referring to viruses of the family Herpesviridae. Both human herpesvirus 6 and 7 (HHV-6 and HHV-7) are double-stranded DNA viruses of the subfamily ⁇ Herpesviridae of the family Herpesviridae, which are responsible for exanthem subitum. (Yamanishi K. et al., “Identification of human herpesvirus 6 as a causal agent for exanthem subitum”, Lancet 1988; i: 1065-1067 and Tanaka K. et al., “Human herpesvirus 7: Another causal agent for roseola (exanthem subitum)”, J. Pediatr., 1994; 125: 1-5).
  • HHV-6 includes two strains, HHV-6A and HHV-6B.
  • HHV-6 causes a viral infectious disease which often occurs during infancy and induces sudden high fever and exanthema before and after the reduction of fever.
  • the prognosis of infected patients is generally good.
  • HHV-7 infection tends to occur later than HHV-6 infection (Tanaka K. et al., “Seroepidemiological study of human herpesvirus-6 and -7 in children of different ages and detection of these two viruses in throat swabs by polymerase chain reaction”, Journal of Medical Virology, 1996; 48:88-94). Therefore, exanthem subitum caused by HHV-7 is clinically experienced as secondary exanthem subitum.
  • a seroepidemiological study of HHV-6 and HHV-7 demonstrated that most children become positive for antibodies to HHV-6 and HHV-7 before the age of two or three. It has been reported that the in apparent infection rate is 20 to
  • HHV-7 is a herpesvirus which was newly found by Frankel et al. in 1990 when a cytopathic effect was observed during culturing of CD4 + T lymphoid cells of a healthy person's peripheral blood (Frankel N. et al., “Isolation of a new herpesvirus from human CD4 + T cells”, ProNAS USA, 87: 749-752, ProNAS USA, 87: 749-752, 1990). The virus was isolated from mononuclear cells of human peripheral blood. Both HHV-6 and -7 are CD4 + T lymphoid cell tropic viruses. HHV-7 infects T cells via a receptor CD4on the cell surface. HHV-7 can grow only in human T lymphoid cells. Therefore, HHV-7 is a virus which can be used for gene modification of human T lymphoid cells.
  • the HHV-7 genome is double-stranded DNA of about 145 kbp.
  • the whole base sequence has been determined by Nicholas et al. It is known that at least 101 genes are present on the genome (John N. et al., Journal of Virology, September 1996, 5975 to 5989).
  • HHV-7 virus have no adverse effect on healthy individuals. If a gene containing an antigenic determinant of various viruses (e.g., mumps) is incorporated into the viral genome of HHV-7 and is expressed by infected cells, HHV-7 is considered to be useful as a vaccine.
  • viruses e.g., mumps
  • the genotype of the virus is not changed as the virus is subcultured. Therefore, when the recombinant virus is used as a vaccine, it is necessary to stably supply a virus derived from a single recombinant genotype virus. For this purpose, a technique for producing a HHV-7 recombinant virus having a single genotype has been desired.
  • HHV-6A U1102 strain
  • HHV-7 MSO strains
  • the HHV-7 strain which binds a receptor CD4 of cells, exhibits satisfactory growth in SupT1 cells.
  • infection could not been established for SupT1/HIV cells.
  • HHV-6A strain infects SupT1 cells with HIV-persistent infection (SupT1/HIV) and exhibits clear CPE (Masao Yamada et al., “HIV Jizokukansen SupT1 Saibo heno HHV-6 oyobi -7 Choufukukannsen no Kokoromi (Attempt for HHV-6 and -7 Superinfection to HIV Persistent Infection Sup-T1 Cell)”, Title No. 122, Titles and Abstracts of the 7th Annual Meeting of the Japanese Society for AIDS Research, 1993, Tokyo).
  • An object of the present invention is to provide a recombinant viral vector for introducing a desired gene into lymphoid cells, particularly a recombinant human herpes viral vector prepared using a BAC ( E. coli artificial chromosome), and a pharmaceutical composition comprising such a viral vector.
  • Another object of the present invention is to provide a vector comprising a human herpes viral genomic gene and a BAC actor sequence, and a ell containing such a vector.
  • Still another object of the present invention is to provide a method for producing a recombinant human herpesvirus.
  • Even still another object of the present invention is to provide a nucleic acid cassette comprising a fragment capable of homologous recombination with a herpesvirus genome, and a BAC vector sequence.
  • the present invention provides recombinant HHV-7, and a production method thereof, e.g., a method for producing recombinant HHV-7 or HHV-6 from a single virus strain using a BAC ( E. coli artificial chromosome).
  • a production method thereof e.g., a method for producing recombinant HHV-7 or HHV-6 from a single virus strain using a BAC ( E. coli artificial chromosome).
  • An ideal HIV vaccine can provide complete and long-lasting protection for all types of HIV.
  • conventional inactivated HIV vaccines have advantages and disadvantages, some of which will be described below.
  • a method for producing a recombinant vaccine employs common techniques. However, since it is difficult to maintain immunogenicity (since immunogenicity is low), high antigenic load and frequent inoculation of an adjuvant are required. Safety is of the greatest concern.
  • a subunit vaccine containing either a native or recombinant subunit may be safe. However, such a subunit vaccine is limited because of the selection of a subunit and the low immunogenicity.
  • the present invention can realize an effect which cannot be obtained by conventional vaccines.
  • This effect is a function of prevention and treatment before and after HIV infection. This is achieved by the recombinant herpesvirus itself utilizing the same mechanism that HIV uses to bind to its target immune cell (CD4 + T cell).
  • HIV is integrated with the infected cell.
  • HIV attacks immune cells themselves which are usually activated by a vaccine.
  • gp120 binds to CD4.
  • CD4 is a receptor present on the surface of an immune cell (T cell) which HIV infects. CD4 can be said to be an entrance to the cell.
  • the growth of HIV can be suppressed by HHV-7 binding to the CD4 + cell surface or HHV-6 entering the cell.
  • the present invention provides a pharmaceutical composition for the prevention of HIV infection, and a pharmaceutical composition for the treatment of HIV infection.
  • the present inventors developed a method for producing a recombinant herpesvirus using a BAC vector sequence to complete the present invention.
  • the present invention provides the following.
  • a recombinant herpesvirus for gene transfer into lymphoid cells.
  • the recombinant herpesvirus of item 1 comprising BAC vector sequence.
  • the recombinant herpesvirus of item 4 wherein the non-essential region is the region flanking the ORF of gene U24, or the region flanking the ORF of gene U24a.
  • the recombinant herpesvirus of item 3 wherein the non-essential region is selected from the group consisting of the following regions of HHV-6A or HHV-6B:
  • the recombinant herpesvirus of item 3 wherein the herpesvirus genome is derived from HHV-6A U1102 strain or HHV-6B HST strain.
  • a pharmaceutical composition comprising the virus of item 1.
  • a vector comprising a human herpesvirus essential gene and a BAC vector sequence.
  • a cell comprising the vector of item 21.
  • a pharmaceutical composition comprising the virus of item 40.
  • a method to produce a recombinant herpesvirus comprising:
  • BAC vector sequence comprises at least two recombinant protein dependent recombinant sequences.
  • non-essential region is the region flanking the ORF of gene U24 of HHV-7, or the region flanking the ORF of gene U24a of HHV-7.
  • non-essential region is selected from the group consisting of the following regions of HHV-6:
  • non-essential region is the region flanking the ORF of gene U5 of HHV-6, or the region flanking the ORF of gene U8 of HHV-6.
  • herpesvirus genome is derived from HHV-6A U1102 strain or HHV-6B HST strain.
  • a pharmaceutical composition comprising the virus of item 61.
  • composition 63 The pharmaceutical composition of item 62, wherein the composition is in the form of vaccine.
  • a method to introduce a mutation into the vector of item 19, comprising:
  • a method to introduce a mutation into the vector of item 19, comprising:
  • a nucleic acid cassette comprising a first fragment which can recombine with herpesvirus genome in a bacterial cell, BAC vector sequence, and a second fragment which can recombine with herpesvirus genome in a bacterial cell,
  • nucleic acid cassette of item 66 wherein the first fragment and the second fragment are at least 1 kb.
  • nucleic acid cassette of item 66 wherein the first fragment and the second fragment are at least 80% identical with a herpesvirus genome sequence.
  • each of the first fragment and the second fragment are independently selected from the group consisting of the following regions of herpesvirus HHV-7 genome:
  • each of the first fragment and the second fragment is independently at least 80% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-7 genome:
  • each of the first fragment and the second fragment is independently at least 85% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-7 genome:
  • each of the first fragment and the second fragment is independently at least 90% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-7 genome:
  • each of the first fragment and the second fragment is independently at least 95% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-7 genome:
  • each of the first fragment and the second fragment are independently selected from the group consisting of the following regions of herpesvirus HHV-6 genome:
  • each of the first fragment and the second fragment is independently at least 80% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-6 genome:
  • each of the first fragment and the second fragment is independently at least 85% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-6 genome:
  • each of the first fragment and the second fragment is independently at least 90% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-6 genome:
  • each of the first fragment and the second fragment is independently at least 95% identical with the region selected from the group consisting of the following regions of herpesvirus HHV-6 genome:
  • each of the first fragment and the second fragment are independently from the region flanking the ORF of gene U24 of HHV-7, or the region flanking the ORF of gene U24a of HHV-7.
  • each of the first fragment and the second fragment are independently from the region flanking the ORF of gene U5 of HHV-6, or the region flanking the ORF of gene U8 of HHV-6.
  • nucleic acid cassette of item 88 wherein the selectable marker is a gene encoding green fluorescent protein.
  • nucleic acid cassette of item 66, wherein the herpesvirus genome is derived from HHV-7 KHR strain.
  • nucleic acid cassette of item 66 wherein the herpesvirus genome is derived from HHV-6A U1102 strain or HHV-6B HST strain.
  • nucleic acid cassette of item 66, wherein the BAC vector sequence comprises the sequence set forth in SEQ ID NO.: 401.
  • nucleic acid cassette of item 66 having a nucleic acid sequence set forth in SEQ ID NO.: 1.
  • a pharmaceutical composition for prevention, treatment, or prognosis of HIV comprising the recombinant herpesvirus of item 4.
  • a pharmaceutical composition for prevention of HIV comprising the recombinant herpesvirus of item 4.
  • a pharmaceutical composition for prevention, treatment, or prognosis of HIV comprising the recombinant herpesvirus of item 6.
  • a pharmaceutical composition for prevention of HIV comprising the recombinant herpesvirus of item 6.
  • the present invention provides a recombinant herpesvirus, and a production method thereof.
  • the present invention provides a method for producing a recombinant herpesvirus from a single viral strain using a BAC ( E. coli artificial chromosome), and a recombinant herpesvirus produced by the method.
  • the present invention provides a pharmaceutical composition comprising a recombinant herpesvirus.
  • the present invention provides a vector comprising a herpes viral genomic gene and a BAC vector sequence, and a cell containing such a vector, and a nucleic acid cassette comprising a fragment capable of homologous recombination with a herpesvirus genome, and a BAC vector sequence.
  • HHV-7 is known to have no adverse effect on healthy persons. Therefore, it is possible to select a protein, which is known to function as a vaccine, among various viral proteins, and incorporate it into recombinant HHV-7 in a manner such that the protein can be expressed. Thereby, a virus vaccine can be produced.
  • compositions for the prevention, treatment, and/or prognosis of HIV infection which comprises the recombinant HHV-7 and HHV-6 of the present invention.
  • FIG. 1 is a schematic diagram showing the insertion of a BAC vector into the HHV-7 genome.
  • FIG. 2 shows the expression of GFP introduced into host cells using the recombinant HHV-7 of the present invention.
  • the term “herpesvirus” includes all of HHV-6A, HHV-6B, and HHV-7, and both their wild-types and recombinant types unless otherwise mentioned.
  • the term “HHV-6” includes HHV-6A and HHV-6B, and both their wild-types and recombinant types unless otherwise mentioned.
  • essential gene in relation to herpesvirus refers to a gene which is essential for the growth of the herpesvirus.
  • non-essential gene in relation to herpesvirus refers to a gene which is not essential for the growth of the herpesvirus, and in the absence of which the herpesvirus can grow.
  • non-essential genes of human herpesvirus 7 include, but are not limited to: gene H1, gene DR1, gene DR2, gene H2, gene DR6, gene DR7, gene H3, gene H4, gene U2, gene U3, gene U4, gene U5/7, gene U8, gene U10, gene U12, gene U13, gene U15, gene U16, gene U17Ex, gene U17, gene U17a, gene U18, gene U19, gene U20, gene U21, gene U23, gene U24, gene U24a, gene U25, gene U26, gene U28, gene U32, gene U33, gene U34, gene U35, gene U36, gene U37, gene U40, gene U42, gene U44, gene U45, gene U46, gene U47, gene U49, gene U50, gene U51, gene U52, gene U55A, gene U55B, gene U58, gene U59, gene U62, gene U63, gene U64, gene U65, gene U67, gene U68, gene
  • a gene in a viral genome is an essential gene
  • the virus cannot grow in the absence of the gene. Therefore, by deleting an arbitrary gene in a viral genome and detecting the growth of the virus, it is possible to determine whether the gene is an essential gene or a non-essential gene.
  • a region within the ORF of the above-described non-essential gene and/or a region flanking the ORF can be used as a target for inserting a BAC vector.
  • a preferable target include, but are not limited to, a region within or flanking the ORF of gene U24, and a region within or flanking the ORF of gene U24a.
  • a region flanking the ORF of gene U24 and a region flanking the ORF of gene U24a are more preferable.
  • wildstrain in relation to herpesvirus refers to a herpesvirus strain which is not artificially modified and is isolated from the nature.
  • An example of a wild strain includes, but is not limited to, strain JI.
  • the nucleic acid sequence of strain JI is set forth in SEQ ID NO.: 1. The reading frame direction, the site on the genome, and the number of amino acid residues of a coded polypeptide of each ORF of strain JI are described below.
  • Reading frame Site on Number of amino ORF Name direction genome acid residues H1 5′ ⁇ 3′ direction 33 to 542 amino acid 1-170 DR1 5′ ⁇ 3′ direction 368 to 826 amino acid 1-153 DR2 5′ ⁇ 3′ direction 898 to 2100 amino acid 1-401 H2 5′ ⁇ 3′ direction 2267 to 2506 amino acid 1-80 DR6 5′ ⁇ 3′ direction 2562 to 3050 amino acid 1-163 DR7 5′ ⁇ 3′ direction 3122 to 3910 amino acid 1-263 H3 3′ ⁇ 5′ direction 3976 to 4224 amino acid 1-83 H4 3′ ⁇ 5′ direction 4449 to 4745 amino acid 1-99 U2 3′ ⁇ 5′ direction 6338 to 7417 amino acid 1-360 U3 3′ ⁇ 5′ direction 7578 to 8732 amino acid 1-385 U4 3′ ⁇ 5′ direction 8754 to 10382 amino acid 1-543 U5/7 3′ ⁇ 5′ direction 10407 to 13004 amino acid 1-866 U8 3′ ⁇ 5′ direction 13174 to 14262 amino acid 1-363 U
  • “5′ ⁇ 3′ direction” indicates that the ORF has the same direction as that of the nucleic acid sequence of SEQ ID NO.: 1.
  • “3′ ⁇ 5′ direction” indicates that the ORF has a reverse direction with respect to that of the nucleic acid sequence of SEQ ID NO.: 1.
  • Non-essential genes of HHV-7 Amino acid ORF residue length
  • non-essential genes of human herpesvirus 6 include, but are not limited to, gene LT1, gene DR1, gene DR2, gene DR3, gene DR4, gene DR5, gene DR6, gene DRHN1, gene DR7, gene DRHN2, gene DR8, gene LJ1, gene U1, gene U2, gene U3, gene U4, gene U5, gene U6, gene U7, gene U8, gene U9, gene U10, gene U12EX, gene U12, gene U13, gene U15, gene U16, gene U17, gene U18, gene U19, gene U20, gene U21, gene U22, gene U23, gene U24, gene U25, gene U26, gene U28, gene U32, gene U33, gene U34, gene U35, gene U36, gene U37, gene U40, gene U42, gene U44, gene U45, gene U46, gene U47, gene U49, gene U50, gene U51, gene U52, gene U55, gene U58, gene U59
  • a gene in a viral genome is an essential gene
  • the virus cannot grow in the absence of the gene. Therefore, by deleting an arbitrary gene in a viral genome and detecting the growth of the virus, it is possible to determine whether the gene is an essential gene or a non-essential gene.
  • a region within the ORF of the above-described non-essential gene and/or a region flanking the ORF can be used as a target for inserting a BAC vector.
  • a preferable target include, but are not limited to, a region within or flanking the ORF of gene U5, and a region within or flanking the ORF of gene U8.
  • a region flanking the ORF of gene U5 and a region flanking the ORF of gene U8 are more preferable.
  • wild strain in relation to HHV-6A refers to a HHV-6A strain which is not artificially modified and is isolated from the mature.
  • An example of a wild strain includes, but is not limited to, strain U1102.
  • the nucleic acid sequence of strain U1102 is set forth in SEQ ID NO.: 128. The reading frame direction, the site on the genome, and the number of amino acid residues of a coded polypeptide of each ORF of strain U1102 are described below.
  • “5′ ⁇ 3′ direction” indicates that the ORF has the same direction as that of the nucleic acid sequence of SEQ ID NO.: 128.
  • “3′ ⁇ 5′ direction” indicates that the ORF has a reverse direction with respect to that of the nucleic acid sequence of SEQ ID NO.: 128.
  • mutant strain refers to a herpesvirus strain which has a mutation due to mutagenesis, multiple subculturings or the like. Mutagenesis of a herpesvirus strain may be either random mutagenesis or site-specific mutagenesis.
  • non-essential genes which are considered to be of HHV-6B having substantially the same genome structure as that of HHV-6A, include, but are not limited to: gene LT1, gene DR1, gene DR2, gene DR3, gene DR4, gene DR5, gene DR6, gene DRHN1, gene DR7, gene DRHN2, gene DR8, gene LJ1, gene U1, gene U2, gene U3, gene U4, gene U5, gene U6, gene U7, gene U8, gene U9, gene U10, gene U12EX, gene U12, gene U13, gene U15, gene U16, gene U17, gene U18, gene U19, gene U20, gene U21, gene U22, gene U23, gene U24, gene U25, gene U26, gene U28, gene U32, gene U33, gene U34, gene U35, gene U36, gene U37, gene U40, gene U42, gene U44, gene U45, gene U46, gene U47, gene U49, gene U50, gene U51, gene U
  • a gene in a viral genome is an essential gene
  • the virus cannot grow in the absence of the gene. Therefore, by deleting an arbitrary gene in a viral genome and detecting the growth of the virus, it is possible to determine whether the gene is an essential gene or a non-essential gene.
  • a region within the ORF of the above-described non-essential gene and/or a region flanking the ORF can be used as a target for inserting a BAC vector.
  • a preferable target include, but are not limited to, a region within or flanking the ORF of gene U5, and a region within or flanking the ORF of gene U8.
  • a region flanking the ORF of gene U5 and a region flanking the ORF of gene U8 are more preferable.
  • wild strain in relation to HHV-6B refers to a HHV-6B strain which is not artificially modified and is isolated from the nature.
  • An sample of a wild strain includes, but is not limited to, strain HST.
  • the nucleic acid sequence of strain HST is set forth in SEQ ID NO.: 272. The reading frame direction, the site on the genome, and the number of amino acid residues of a coded polypeptide of each ORF of strain HST are described below.
  • “5′ ⁇ 3′ direction” indicates that the ORF has the same direction as that of the nucleic acid sequence of SEQ ID NO.: 272.
  • “3′ ⁇ 5′ direction” indicates that the ORF has a reverse direction with respect to that of the nucleic acid sequence of SEQ ID NO.: 272.
  • Non-essential gene of HHV-6 Amino acid residue ORF length U1102/HST Features LT1 112/115 DR1 97/88 US22 gene family DR2 620/647 US22 gene family DR3 192/200 DR4 100/ — DR5 145/ — DR6 103/103 US22 gene family DRHN1 _/169 DR7 363/212 US22 gene family, transcription activating agent DRHN2 _/156 DR8 110/244 LJ1 321/172 U1 123/151 U2 366/433 US22 gene family U3 373/386 US22 gene family U4 535/535 U5 444/443 U6 82/85 U7 342/374 US22 gene family U8 356/411 US22 gene family U9 104/104 U10 436/503 U12EX 347/353 U12 exon 1 U12 318/305 U12 exon 2, CC-chemokine receptor U13 106/107 U15 110/110 U16 143/143
  • a gene in a viral genome is an essential gene
  • the virus cannot grow in the absence of the gene. Therefore, by deleting an arbitrary gene in a viral genome and detecting the growth of the virus, it is possible to determine whether the gene is an essential gene or a non-essential gene.
  • wildstrain in relation to herpesvirus refers to a herpesvirus strain which is not artificially modified and is isolated from the nature.
  • mutant strain refers to a herpesvirus strain which has a mutation due to mutagenesis, multiple subculturings or the like. Mutagenesis of a herpesvirus strain may be either random mutagenesis or site-specific mutagenesis.
  • protein protein
  • polypeptide oligopeptide
  • peptide as used herein have the same meaning and refer to an amino acid polymer having any length.
  • nucleic acid refers to a nucleotide polymer having any length. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively-modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be produced by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
  • gene refers to an element defining a genetic trait.
  • a gene is typically arranged in a given sequence on a chromosome.
  • a gene which defines the primary structure of a protein is called a structural gene.
  • a gene which regulates the expression of a structural gene is called a regulatory gene.
  • “gene” may refer to “polynucleotide”, “oligonucleotide”, “nucleic acid”, and “nucleic acid molecule” and/or “protein”, “polypeptide”, “oligopeptide” and “peptide”.
  • open reading frame refers to a reading frame which is one of three frames obtained by sectioning the base sequence of a gene at intervals of three bases, and has a start codon and a certain length without a stop codon appearing partway, and has the possibility of actually coding a protein.
  • the entire base sequence of the genome of herpesvirus has been determined, identifying at least 101 genes.
  • Each of the genes is known to have an open reading frame (ORF).
  • region within an ORF in relation to a gene in a herpesvirus genome, refers to a region in which there are bases constituting the ORF in the gene within the herpesvirus genome.
  • region flanking an ORF in relation to a gene in a herpesvirus genome, refers to a region in which there are bases existing in the vicinity of the ORF in the gene within the herpesvirus genome, and which does not correspond to a region within the ORF of the gene or other genes.
  • the term “homology” of a gene refers to the proportion of identity between two or more gene sequences. Therefore, the greater the homology between two given genes, the greater the identity or similarity between their sequences. Whether or not two genes have homology is determined by comparing their sequences directly or by a hybridization method under stringent conditions. When two gene sequences are directly compared with each other, these genes have homology if the DNA sequences of the genes have representatively at least 50% identity, preferably at least 70% identity, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity with each other.
  • the term “expression” of a gene, a polynucleotide, a polypeptide, or the like indicates that the gene or the like is affected by a predetermined action in vivo to be changed into another form.
  • the term “expression” indicates that genes, polynucleotides, or the like are transcribed and translated into polypeptides.
  • genes may be transcribed into mRNA. More preferably, these polypeptides may have post-translational processing modifications.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
  • fragment refers to a polypeptide or polynucleotide having a sequence length ranging from 1 to n ⁇ 1 with respect to the full length of the reference polypeptide or polynucleotide (of length n).
  • the length of the fragment can be appropriately changed depending on the purpose.
  • the lower limit of the length of the fragment includes 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 or more nucleotides. Lengths represented by integers which are not herein specified (e.g., 11 and the like) may be appropriate as a lower limit.
  • the lower limit of the length of the fragment includes 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 or more nucleotides. Lengths represented by integers which are not herein specified (e.g., 11 and the like) may be appropriate as a lower limit.
  • a polypeptide encoded by a gene in a BAC vector may have at least one (e.g., one or several) amino acid substitution, addition, and/or deletion or at least one sugar chain substitution, addition, and/or deletion as long as they have substantially the same function as that of a corresponding naturally-occurring polypeptide.
  • sugar chain refers to a compound which is made up of a series of at least one sugar unit (a monosaccharide and/or its derivative). When two or more sugars unit are linked, the sugars unit are joined by dehydrocondensation due to glycosidic bonds.
  • sugar chain examples include, but are not limited to, polysaccharides contained in organisms (glucose, galactose, mannose, fucose, xylose, N-acetylglucosamine, N-acetylgalactosamine, sialic acid, and complexes and derivates thereof), and degraded polysaccharides, sugar chains degraded or induced from complex biological molecules (e.g., glycoproteins, proteoglycan, glycosaminoglycan, glycolipids, etc.), and the like. Therefore, the term “sugar chain” may be here in used interchangeably with “polysaccharide”, “carbohydrate”, and “hydrocarbon”. Unless otherwise specified, the term “sugar chain” as used herein includes both a sugar chain and a sugar chain-containing substance.
  • the resultant protein may still have a biological function similar to that of the original protein (e.g., a protein having an equivalent enzymatic activity).
  • the hydrophobicity index is preferably within ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5. It is understood in the art that such an amino acid substitution based on hydrophobicity is efficient.
  • a hydrophilicity index is also useful for modification of an amino acid sequence of the present invention. As described in U.S. Pat. No.
  • amino acid residues are given the following hydrophilicity indices: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0 ⁇ 1); glutamic acid (+3.0 ⁇ 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine ( ⁇ 0.4); proline ( ⁇ 0.5 ⁇ 1); alanine ( ⁇ 0.5); histidine ( ⁇ 0.5); cysteine ( ⁇ 1.0); methionine ( ⁇ 1.3); valine ( ⁇ 1.5); leucine ( ⁇ 1.8); isoleucine ( ⁇ 1.8); tyrosine ( ⁇ 2.3); phenylalanine ( ⁇ 2.5); and tryptophan ( ⁇ 3.4).
  • an amino acid may be substituted with another amino acid which has a similar hydrophilicity index and can still provide a biological equivalent.
  • the hydrophilicity index is preferably within ⁇ 2, more preferably ⁇ 1 aid even are preferably ⁇ 0.5.
  • conservative substitution refers to amino acid substitution in which a substituted amino acid and a substituting amino acid have similar hydrophilicity indices or/and hydrophobicity indices.
  • conservative substitution is carried out between amino acids having a hydrophilicity or hydrophobicity index of within ⁇ 2, preferably within ⁇ 1, and more preferably within ⁇ 0.5.
  • conservative substitution include, but are not limited to, substitutions within each of the following residue pairs: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine, which are well known to those skilled in the art.
  • the term “variant” refers to a substance, such as a polypeptide, polynucleotide, or the like, which differs partially from the original substance.
  • examples of such a variant include a substitution variant, an addition variant, a deletion variant, a truncated variant, an allelic variant, and the like.
  • examples of such a variant include, but are not limited to, a nucleotide or polypeptide having one or several substitutions, additions and/or deletions or a nucleotide or polypeptide having at least one substitution, addition and/or deletion.
  • allele refers to a genetic variant located at a locus identical to a corresponding gene, where the two genes are distinguished from each other.
  • allelic variant refers to a variant which has an allelic relationship with a given gene.
  • allelic variant ordinarily has a sequence the same as or highly similar to that of the corresponding allele, and ordinarily has almost the same biological activity, though it rarely has different biological activity.
  • spectrum homolog or “homolog” as used herein refers to one that has an amino acid or nucleotide homology with a given gene in a given species (preferably at least 60% homology, more preferably at least 80%, at least 85%, at least 90%, and at least 95% homology). A method for obtaining such a species homolog is clearly understood from the description of the present specification.
  • ortholog also called orthologous genes
  • orthologous genes refers to genes in different species derived from a common ancestry (due to speciation)
  • human and mouse ⁇ -hemoglobin genes are orthologs
  • the human ⁇ -hemoglobin gene and the human ⁇ -hemoglobin gene are paralogs (genes arising from gene duplication).
  • Orthologs are useful for estimation of molecular phylogenetic trees.
  • orthologs in different species may have a function similar to that of the original species. Therefore, orthologs of the present invention may be useful in the present invention.
  • conservatively modified variant applies to both amino acid and nucleic acid sequences.
  • conservatively modified variants refer to those nucleic acids which encode identical or essentially identical amino acid sequences.
  • the codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
  • the codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
  • the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • Such nucleic acid variations are “silent variations” which represent one species of conservatively modified variation.
  • Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.
  • such modification may be performed while avoiding substitution of cysteine which is an amino acid capable of largely affecting the higher-order structure of a polypeptide.
  • Examples of method for such modification of a base sequence include cleavage using a restriction enzyme or the like; ligation or the like by treatment using DNA polymerase, Klenow fragments, DNA ligase, or the like; and a site specific base substitution method using synthesized oligonucleotides (specific-site directed mutagenesis; Mark Zoller and Michael Smith, Methods in Enzymology, 100, 468-500 (1983)). Modification can be performed using methods ordinarily used in the field of molecular biology.
  • amino acid additions, deletions, or modifications can be performed in addition to amino acid substitutions.
  • Amino acid substitution(s) refers to the replacement of at least one amino acid of an original peptide chain with different amino acids, such as the replacement of 1 to 10 amino acids, preferably 1 to 5 amino acids, and more preferably 1 to 3 amino acids with different amino acids.
  • Amino acid addition(s) refers to the addition of at least one amino acid to an original peptide chain, such as the addition of 1 to 10 amino acids, preferably 1 to 5 amino acids, and more preferably 1 to 3 amino acids to an original peptide chain.
  • Amino acid deletion(s) refers to the deletion of at least one amino acid, such as the deletion of 1 to 10 amino acids, preferably 1 to 5 amino acids, and more preferably 1 to 3 amino acids.
  • Amino acid modification includes, but is not limited to, amidation, carboxylation, sulfation, halogenation, truncation, lipidation, alkylation, glycosylation, phosphorylation, hydroxylation, acylation (e.g., acetylation), and the like.
  • Amino acids to be substituted or added may be naturally-occurring or normaturally-occurring amino acids, or amino acid analogs. Naturally-occurring amino acids are preferable.
  • a nucleic acid form of a polypeptide refers to a nucleic acid molecule capable of expressing a protein form of the polypeptide.
  • This nucleic acid molecule may have a nucleic acid sequence, a part of which is deleted or substituted with another base, or alternatively, into which another nucleic acid sequence is inserted, as long as an expressed polypeptide has substantially the same activity as that of a naturally occurring polypeptide.
  • another nucleic acid may be linked to the 5′ end and/or the 3′ end of the nucleic acid molecule.
  • the nucleic acid molecule may be a nucleic acid molecule which is hybridizable to a gene encoding a polypeptide under stringent conditions and encodes a polypeptide having substantially the same function as that polypeptide.
  • a gene is known in the art and is available in the present invention.
  • Such a nucleic acid can be obtained by a well known PCR technique, or alternatively, can be chemically synthesized. These methods may be combined with, for example, site-specific mutagenesis, hybridization, or the like.
  • substitution, addition or deletion for a polypeptide or a polynucleotide refers to the substitution, addition or deletion of an amino acid or its substitute, or a nucleotide or its substitute, with respect to the original polypeptide of polynucleotide, respectively. This is achieved by techniques well known in the art, including a site-specific mutagenesis technique and the like.
  • a polypeptide or a polynucleotide may have any number (>0) of substitutions, additions, or deletions. The number can be as large as a variant having such a number of substitutions, additions or deletions which maintains an intended function. For example, such a number may be one or several, and preferably within 20% or 10% of the full length, or no more than 100, no more than 50, no more than 25, or the like.
  • polymers e.g., polypeptide structure
  • This structure is generally described in, for example, Alberts et al., Molecular Biology of the Cell (3rd Ed., 1994), and Cantor and Schimmel, Biophysical Chemistry Part I: The Conformation of Biological Macromolecules (1980).
  • General molecular biological techniques available in the present invention can be easily carried out by the those skilled in the art by referencing Ausubel F. A. et al. eds. (1988), Current Protocols in Molecular Biology, Wiley, New York, N.Y.; Sambrook J. et al., (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., or the like.
  • vector refers to an agent which can transfer a polynucleotide sequence of interest to a target cell.
  • examples of such a vector include vectors which are capable of self replication or capable of being incorporated into a chromosome with in host cells (e.g., prokaryotic cells, yeast, animal cells, plant cells, insect cells, whole animals, and whole plants), and contain a promoter at a site suitable for transcription of a polynucleotide of the present invention.
  • BAC vector refers to a plasmid which is produced using F plasmid of E. coli and a vector which can stably maintain and grow a large size DNA fragment of about 300 kb or more in bacteria, such as E. coli and the like.
  • the BAC vector contains at least a region essential for the replication of the BAC vector. Examples of such a region essential for replication include, but are not limited to, the replication origin of F plasmid (oriS) and variants thereof.
  • BAC vector sequence refers to a sequence comprising a sequence essential for the function of a BAC vector.
  • the BAC vector sequence may further comprise a “recombinant protein-dependent recombinant sequence” and/or a “selectable marker”.
  • homologous recombination includes both “recombinant protein-dependent recombination” and “recombinant protein-independent recombination”.
  • recombinant protein-dependent recombination refers to homologous recombination which occurs in the presence of a recombinant protein, but not in the absence of a recombinant protein.
  • recombinant protein-independent recombination refers to homologous recombination which occurs irrespective of the presence or absence of a recombinant protein.
  • the term “recombinant protein-dependent recombinant sequence” refers to a sequence which causes recombinant protein-dependent recombination.
  • the term “recombinant protein-independent recombinant sequence” refers to a sequence which causes recombinant protein-independent recombination.
  • the recombinant protein-dependent recombinant sequence causes recombination in the presence of a recombinant protein, but not in the absence of a recombinant protein.
  • a recombinant protein preferably acts specifically on a recombinant protein-dependent recombinant sequence, and does not act on sequences other than the recombinant protein-dependent recombinant sequence.
  • Examples of representative pairs of a recombinant protein-dependent recombinant sequence and a recombinant protein include, but are not limited to: a combination of a bacteriophage P1-derived loxP (locus of crossover of P1) sequence and a Cre (cyclization recombination) protein, a combination of Flp protein and FRT site, a combination of ⁇ C31 and attb or attP (Thorpe, Helena M.; Wilson, Stuart E.; Smith, Margaret C.
  • selectable marker refers to a gene which functions as an index for election of a host cell containing a BAC vector.
  • examples of a selectable marker include, but are not limited to, fluorescent markers, luminiscent markers, and drug selectable markers.
  • fluorescent marker is, but is not limited to, a gene encoding a fluorescent protein, such as a green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • luminiscent marker is, but is not limited to, a gene encoding a luminescent protein, such as luciferase.
  • a “drug selectable marker” is, but is not limited to, a gene encoding a protein selected from the group consisting of: dihydrofolate reductase gene, glutamine synthase gene, aspartic acid transaminase, metallothionein (MT), adenosine deaminase (ADA), adenosine deaminase (AMPD1, 2), xanthine-guanine-phosphoribosyl transferase, UMP synthase, P-glycoprotein, asparagine synthase, and ornithine decarboxylase.
  • dihydrofolate reductase gene glutamine synthase gene, aspartic acid transaminase, metallothionein (MT), adenosine deaminase (ADA), adenosine deaminase (AMPD1, 2), xanthine-guanine-phosphoribosyl transfer
  • Examples of a combination of a drug selectable marker and a drug include: a combination of dihydrofolate reductase gene (DHFR) and methotrexate (MTX), a combination of glutamine synthase (GS) gene and methionine sulfoximine (Msx), a combination of aspartic acid transaminase (AST) gene and N-phosphonacetyl-L-aspartate) (PALA), a combination of MT gene and cadmium (Cd2 + ), a combination of adenosine deaminase (ADA) gene and adenosine, alanosine, or 2′-deoxycoformycin, a combination of adenosine deaminase (AMPD1, 2) gene and adenine, azaserine, or coformycin, a combination of xanthine-guanine-phosphoribosyltransferase gene and mycophenolic acid, a combination of
  • the term “expression vector” refers to a nucleic acid sequence comprising a structural gene and a promoter for regulating expression thereof, and in addition, various regulatory elements in a state that allows them to operate within host cells.
  • the regulatory element may include, preferably, terminators, selectable markers such as drug-resistance genes (e.g., a kanamycin resistance gene, a hygromycin resistance gene, etc.), and enhancers.
  • drug-resistance genes e.g., a kanamycin resistance gene, a hygromycin resistance gene, etc.
  • enhancers enhancers.
  • the type of an organism (e.g., a plant) expression vector and the type of a regulatory element may vary depending on the host cell.
  • a plant expression vector for use in the present invention may further has a T-DNA region. A T-DNA region enhances the efficiency of gene transfer, especially when a plant is transformed using Agrobacterium.
  • the term “recombinant vector” refers to a vector which can transfer a polynucleotide sequence of interest to a target cell.
  • examples of such a vector include vectors which are capable of self replication or capable of being incorporated into a chromosome within host cells (e.g., prokaryotic cells, yeast, animal cells, plant cells, insect cells, whole animals, and whole plants), and contain a promoter at a site suitable for transcription of a polynucleotide of the present invention.
  • terminator refers to a sequence which is located downstream of a protein-encoding region of a gene and which is involved in the termination of transcription when DNA is transcribed into mRNA, and the addition of a poly A sequence. It is known that a terminator contributes to the stability of mRNA, and has an influence on the amount of gene expression. Examples of a terminator include, but are not limited to, terminators derived from mammals, the CaMV35S terminator, the terminator of the nopaline synthase gene (Tnos), the terminator of the tobacco PR1a gene, and the like.
  • promoter refers to a base sequence which determines the initiation site of transcription of a gene and is a DNA region which directly regulates the frequency of transcription. Transcription is started by RNA polymerase binding to a promoter.
  • a promoter region is usually located within about 2 kbp upstream of the first exon of a putative protein coding region. Therefore, it is possible to estimate a promoter region by predicting a protein coding region in a genomic base sequence using DNA analysis software.
  • a putative promoter region is usually located upstream of a structural gene, but depending on the structural gene, i.e., a putative promoter region may be located downstream of a structural gene. Preferably, a putative promoter region is located within about 2 kbp upstream of the translation initiation site of the first exon.
  • the term “constitutive” for expression of a promoter of the present invention refers to a character of the promoter that the promoter is expressed in a substantially constant amount in all tissues of an organism no matter whether the growth stage of the organism is a juvenile phase or a mature phase. Specifically, when Northern blotting analysis is performed under the same conditions as those described in examples of the present specification, expression is considered to be constitutive according to the definition of the present invention if substantially the same amount of expression is observed at the same or corresponding site at any time (e.g., two or more time points (e.g., day 5 and day 15)), for example. Constitutive promoters are considered to play a role in maintaining the homeostasis of organisms in a normal growth environment. These characters can be determined by extracting RNA from any portion of an organism and analyzing the expression amount of the RNA by Northern blotting or quantitating expressed proteins by Western blotting.
  • An “enhancer” may be used so as to enhance the expression efficiency of a gene of interest.
  • an enhancer region containing an upstream sequence within the SV40 promoter is preferable.
  • One or more enhancers may be used, or no enhancer may be used.
  • operatively linked indicates that a desired sequence is located such that expression (operation) thereof is under control of a transcription and translation regulatory sequence (e.g., a promoter, an enhancer, and the like) or a translation regulatory sequence.
  • a transcription and translation regulatory sequence e.g., a promoter, an enhancer, and the like
  • a promoter In order for a promoter to be operatively linked to a gene, typically, the promoter is located immediately upstream of the gene. A promoter is not necessarily adjacent to a structural gene.
  • transformation As used herein, the terms “transformation”, “transduction” and “transfection” are used interchangeably unless otherwise mentioned, and refers to introduction of a nucleic acid into host cells.
  • any technique for introducing DNA into host cells can be used, including various well-known techniques, such as, for example, the electroporation method, the particle gun method (gene gun), the calcium phosphate method, and the like.
  • transformant refers to the whole or a part of an organism, such as a cell, which is produced by transformation.
  • examples of a transformant include prokaryotic cells, yeast, animal cells, plant cells, insect cells and the like.
  • Transformants may be referred to as transformed cells, transformed tissue, transformed hosts, or the like, depending on the subject.
  • all of the forms are encompassed, however, a particular form may be specified in a particular context.
  • prokaryotic cells include prokaryotic cells of the genera Escherichia, Serratia, Bacillus, Brevibacterium, Corynebacterium, Microbacterium, Pseudomonas , and the like, e.g., Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Escherichia coli DH1, Escherichia coli MC1000, Escherichia coli KY3276, Escherichia coli W1485, Escherichia coli JM109, Escherichia coli HB101 , Escherichia coli No.
  • Escherichia coli W3110 Escherichia coli NY49, Escherichia coli BL21 (DE3), Escherichia coli BL21 (DE3) pLysS, Escherichia coli HMS174 (DE3), Escherichia coli HMS174 (DE3) pLysS, Serratia ficaria, Serratia fonticola, Serratia liquefaciens, Serratia marcescens, Bacillus subtilis, Bacillus amyloliquefaciens, Brevibacterium ammmoniagenes, Brevibacterium immariophilum ATCC14068, Brevibacterium saccharolyticum ATCC14066, Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC14067, Corynebacterium glutamicum ATCC13869, Corynebacterium acetoacidophilum ATCC13870, Microbacterium ammoniaphilum ATCC15354, Ps
  • animal cells include cord blood mononuclear cells, peripheral blood mononuclear cells, Sup-T1 cells, and the like.
  • animal is used herein in its broadest sense and refers to vertebrates and invertebrates (e.g., arthropods).
  • animals include, but are not limited to, any of the class Mammalia, the class Aves, the class Reptilia, the class Amphibia, the class Pisces, the class Insecta, the class Vermes, and the like.
  • tissue in relation to organisms refers to an aggregate of cells having substantially the same function. Therefore, a tissue may be a part of an organ. Organs usually have cells having the same function, and may have coexisting cells having slightly different functions. Therefore, as used herein, tissues may have various kinds of cells as long as a certain property is shared by the cells.
  • organ refers to a structure which has a single independent form and in which one or more tissues are associated together toperforma specific function.
  • organs include, but are not limited to, callus, root, stem, trunk, leaf, flower, seed, embryo bud, embryo, fruit, and the like.
  • organs include, but are not limited to, stomach, liver, intestine, pancreas, lung, airway, nose, heart, artery, vein, lymph node (lymphatic system), thymus, ovary, eye, ear, tongue, skin, and the like.
  • transgenic refers to incorporation of a specific gene into an organism (e.g., plants or animals (mice, etc.)) or such an organism having an incorporated gene.
  • the transgenic organisms can be produced by a microinjection method (a trace amount injection method), a viral vector method, an embryonic stem (E5) cell method, a sperm vector method, a chromosome fragment introducing method (transsomic method), an episome method, or the like.
  • a microinjection method a trace amount injection method
  • viral vector method a viral vector method
  • embryonic stem (E5) cell method a viral vector method
  • sperm vector method a chromosome fragment introducing method
  • episome method an episome method
  • screening refers to selection of a substance, a host cell, a virus, or the like having a given specific property of interest from a number of candidates using a specific operation/evaluation method. It will be understood that the present invention encompasses viruses having desired activity obtained by screening.
  • chip or “microchip” are used interchangeably to refer to a micro integrated circuit which has versatile functions and constitutes a portion of a system.
  • Examples of a chip include, but are not limited to, DNA chips, protein chips, and the like.
  • the term “array” refers to a substrate (e.g., a chip, etc.) which has a pattern of a composition containing at least one (e.g., 1000 or more, etc.) target substances (e.g., DNA, proteins, transfection mixtures, etc.), which are arrayed.
  • patterned substrates having a small size e.g., 10 ⁇ 10 mm, etc.
  • microarrays e.g., a patterned substrate having a larger size than that which is described above may be referred to as a microarray.
  • an array comprises a set of desired transfection mixtures fixed to a solid phase surface or a film thereof.
  • An array preferably comprises at least 10 2 antibodies of the same or different types, more preferably at least 10 3 , even more preferably at least 10 4 , and still even more preferably at least 10 5 . These antibodies are placed on a surface of up to 125 ⁇ 80 mm, more preferably 10 ⁇ 10 mm.
  • An array includes, but is not limited to, a 96-well microtiter plate, a 384-well microtiter plate, a microtiter plate the size of a glass slide, and the like.
  • a composition to be fixed may contain one or a plurality of types of target substances. Such a number of target substance types may be in the range of from one to the number of spots, including, without limitation, about 10, about 100, about 500, and about 1,000.
  • any number of target substances may be provided on a solid phase surface or film, typically including no more than 10 8 biological molecules per substrate, in another embodiment no more than 10 7 biological molecules, no more than 10 6 biological molecules, no more than 10 5 biological molecules, no more than 10 4 biological molecules, no more than 10 3 biological molecules, or no more than 10 2 biological molecules.
  • a composition containing more than 10 8 biological molecule target substances may be provided on a substrate.
  • the size of a substrate is preferably small.
  • the size of a spot of a composition containing target substances e.g., proteins such as antibodies
  • the minimum area of a substrate may be determined based on the number of biological molecules on a substrate.
  • spots of biological molecules may be provided on an array.
  • spot refers to a certain set of compositions containing target substances.
  • spotting refers to an act of preparing a spot of a composition containing a certain target substance on a substrate or plate. Spotting may be performed by any method, for example, pipetting or the like, or alternatively, using an automatic device. These methods are well known in the art.
  • the term “address” refers to a unique position on a substrate, which may be distinguished from other unique positions. Addresses are appropriately associated with spots. Addresses can have any distinguishable shape such that substances at each address may be distinguished from substances at other addresses (e.g., optically). A shape defining an address may be, for example, without limitation, a circle, an ellipse, a square, a rectangle, or an irregular shape. Therefore, the term “address” is used to indicate an abstract concept, while the term “spot” is used to indicate a specific concept. Unless it is necessary to distinguish them from each other, the terms “address” and “spot” may be herein used interchangeably.
  • each address particularly depends on the size of the substrate, the number of addresses on the substrate, the amount of a composition containing target substances and/or available reagents, the size of microparticles, and the level of resolution required for any method used for the array.
  • the size of each address may be, for example, in the range of from 1-2 nm to several centimeters, though the address may have any size suited to an array.
  • the spatial arrangement and shape which define an address are designed so that the microarray is suited to a particular application. Addresses may be densely arranged or sparsely distributed, or subgrouped into a desired pattern appropriate for a particular type of material to be analyzed.
  • support refers to a material which can carry cells, bacteria, viruses, polynucleotides, or polypeptides. Such a support may be made from any solid material which has a capability of binding to a biological molecule as used herein via covalent or noncovalent bond, or which may be induced to have such a capability.
  • a support comprises a portion for producing hydrophobic bonds.
  • a support may be formed of layers made of a plurality of materials.
  • a support may be made of an inorganic insulating material, such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, silicon nitride, or the like.
  • a support may be made of an organic material, such as polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene-acrylonitrile copolymer, acrylonitrile-butadiene-styrene copolymer, silicone resin, polyphenylene oxide, polysulfone, and the like.
  • nitrocellulose film, nylon film, PVDF film, or the like, which are used in blotting may be used as a material for a support.
  • the herpesvirus of the present invention can be used as an ingredient of a pharmaceutical composition for the treatment, prevention, and/or therapy of infectious diseases.
  • the term “effective amount” in relation to a drug refers to an amount which causes the drug to exhibit intended efficacy.
  • an effective amount corresponding to a smallest concentration may be referred to as a minimum effective amount.
  • a minimum effective amount is well known in the art.
  • the minimum effective amount of a drug has been determined or can be determined as appropriate by those skilled in the art. The determination of such an effective amount can be achieved by actual administration, use of an animal model, or the like. The present invention is also useful for the determination of such an effective amount.
  • the term “pharmaceutically acceptable carrier” refers to a material which is used for production of a pharmaceutical agent or an agricultural chemical (e.g., an animal drug), and has no adverse effect on effective ingredients.
  • a pharmaceutically acceptable carrier include, but are not limited to: antioxidants, preservatives, colorants, flavoring agents, diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, excipients, and/or agricultural or pharmaceutical adjuvants.
  • the type and amount of a pharmaceutical agent used in the treatment method of the present invention can be easily determined by those skilled in the art based on information obtained by the method of the present invention (e.g., information relating to a disease) in view of the purpose of use, the target disease (type, severity, etc.), the subject's age, size, sex, and case history, the morphology and type of a site of a subject of administration, or the like.
  • the frequency of subjecting a subject (patient) to the monitoring method of the present invention is also easily determined by those skilled in the art with respect to the purpose of use, the target disease (type, severity, etc.), the subject's age, size, sex, and case history, the progression of the therapy, and the like. Examples of the frequency of monitoring the state of a disease include once per day to once per several months (e.g., once per week to once per month). Preferably, monitoring is performed once per week to once per month with reference to the progression.
  • the term “instructions” refers to a description of the method of the present invention for a person who performs administration, such as a medical doctor, a patient, or the like. Instructions state when to administer a medicament of the present invention, such as immediately after or before radiation therapy (e.g., within 24 hours, etc.).
  • the instructions are prepared in accordance with a format defined by an authority of a country in which the present invention is practiced (e.g., Health, Labor and Welfare Ministry in Japan, Food and Drug Administration (FDA) in the U.S., and the like), explicitly describing that the instructions are approved by the authority.
  • the instructions are so-called package insert and are typically provided in paper media.
  • the instructions are not so limited and may be provided in the form of electronic media (e.g., web sites, electronic mails, and the like provided on the Internet).
  • two or more pharmaceutical agents may be used as required.
  • these agents may have similar properties or may be derived from similar origins, or alternatively, may have different properties or may be derived from different origins.
  • a method of the resent invention can be used to obtain information about the drug resistance level of a method of administering two or more pharmaceutical agents.
  • Micromachining is described in, for example, Campbell, S. A. (1996), The Science and Engineering of Microelectronic Fabrication, Oxford University Press; Zaut, P. V. (1996), Micromicroarray Fabrication: a Practical Guide to Semiconductor Processing, Semiconductor Services; Madou, M. J. (1997), Fundamentals of Microfabrication, CRC1 5 Press; Rai-Choudhury, P. (1997), Handbook of Microlithography, Micromachining & Microfabrication: Microlithography; and the like, the relevant portions of which are hereby incorporated by reference.
  • a recombinant herpesvirus contains a BAC vector sequence in its genome sequence.
  • a BAC vector sequence used herein preferably contains an origin of replication derived from F plasmid, or alternatively may contain any origin of replication other than an origin of replication derived from F plasmid, as long as it has a sequence of 300 kb or more and can be held and grown as a bacterial artificial sequence in bacterial cells.
  • the BAC vector of the present invention can be maintained and/or grow in bacterial host cells, preferably E.
  • a portion of the BAC vector is inserted into a non-essential region of a herpesvirus genome, so that it is possible to manipulate it as a BAC containing the herpesvirus genome.
  • the BAC containing the herpesvirus genome is introduced into a mammalian cell, the recombinant herpesvirus can be produced and grown.
  • a host cell for the recombinant herpesvirus any mammalian cell which can grow a wild-type herpesvirus strain can be used.
  • such a host cell is derived from a human, including, for example, but being not limited to, cord blood mononuclear cells, peripheral blood mononuclear cells, and SupT1 cells.
  • BAC vector containing a human herpesvirus can be produced by using a human herpesvirus (e.g., HHV-6A, HHV-6B, or HHV-7) genome and a BAC vector.
  • a human herpesvirus e.g., HHV-6A, HHV-6B, or HHV-7 genome and a BAC vector.
  • An example of the technique using homologous recombination is a technique using a nucleic acid having a linear BAC vector sequence linked with a sequence homologous to a human herpesvirus genome.
  • a method for producing a BAC vector comprising a human herpesvirus genome by using a nucleic acid having a linear BAC vector sequence linked with a sequence homologous to a human herpesvirus genome representatively comprises the steps of: (1) introducing the nucleic acid along with the human herpesvirus genome into appropriate hosts; (2) culturing the host cells to elicit homologous recombination between the homologous sequence linked with the linear BAC vector sequence and the human herpesvirus genome sequence; (3) screening the host cells for one which contains the human herpesvirus genome sequence having the BAC vector sequence incorporated due to the homologous recombination; (4) culturing the host cell and extracting a circular virus DNA.
  • Examples of a host cell used in the above-described method include, but are not limited to, cord blood mononuclear cells, peripheral blood mononuclear cells, and SupT1 cells.
  • Examples of a technique for introducing a BAC vector into mammalian hosts include, but are not limited to, the calcium phosphate method, the electroporation method, and the lipofection method.
  • the electroporation method of Amaxa or Bio-Rad By the electroporation method of Amaxa or Bio-Rad, a large amount of genes can be efficiently introduced into T cells.
  • the electroporation method of Amaxa is performed under the following conditions. For sample, cells are washed with cell wash buffer solution (RPMI-1640 medium without fetal calf serum) twice. Thereafter, the cells are suspended in electroporation buffer solution (Nucleofector solution supplied by the manufacture) 1 ⁇ l of plasmid DNA is added to the cell suspension, mixed well, and placed in a cuvette. Electroporation is performed at room temperature using an appropriate program.
  • a BAC containing a human herpesvirus genome using a human herpesvirus genome and a BAC sequence various methods, such as use of nucleic acid fragments obtained using restriction enzymes or the like, can be employed instead of homologous recombination.
  • non-essential regions in HHV-7 are ORF regions of gene U24, gene U24a, gene U25, and gene U26, or regions flanking these ORF's. This is because gene U24, gene U24a, gene U25, and gene U26 are contiguous non-essential genes on the HHV-7 genome, so that it is easy to design a nucleic acid for homologous recombination.
  • a BAC vector sequence used in the present invention preferably includes a recombinant protein-dependent recombinant sequence and/or a selectable marker.
  • the selectable marker sequence is a drug selectable marker and/or a gene encoding a green fluorescent protein. This is because the presence of a desired gene can be easily confirmed.
  • a vector used for production of the above-described virus and a method for producing the above-described virus are provided.
  • a pharmaceutical composition comprising the above-described virus and a pharmaceutical composition in the form of a vaccine are provided.
  • the recombinant human herpesvirus of the present invention can be used to introduce a desired antigen protein. Therefore, for example, when an antigen which is known to function as a vaccine is introduced, the vector of the present invention can be used as a vaccine vector.
  • a method for introducing mutation into a vector for producing a vaccine of the present invention comprises the steps of: introducing a vector into a bacterial host cell; introducing a plasmid vector containing a fragment consisting of a portion of a human herpesvirus genome into the bacterial host cell, wherein the fragment has at least one mutation; culturing the bacterial host cell; and isolating a vector having a AC vector sequence from the cultured bacterial host cell.
  • homologous recombination occurs between the vector for producing a vaccine of the present invention and the plasmid vector containing the fragment consisting of the portion of the human herpesvirus genome, in bacterial host cells.
  • the vector for producing the vaccine of the present invention has a mutation in the fragment consisting of the portion of the human herpesvirus genome.
  • the step of introducing the vector into bacterial host cells can be achieved by using various well-known methods, such as electroporation and the like.
  • the plasmid vector containing the fragment consisting of the portion of the human herpesvirus genome can be introduced into bacterial host cells.
  • a technique for introducing a mutation into the fragment a technique for introducing a mutation by using PCR is well known. For example, by using heat-resistant polymerase having no proofreading function, where one of the four nucleotides is in lower quantity, it is possible to introduce a mutation randomly.
  • PCR using a primer having a mutated base sequence, it is possible to introduce a desired mutation into a desired site.
  • the vector for producing the vaccine of the present invention has a mutation in the fragment consisting of the portion of the human herpesvirus genome.
  • various well-known techniques e.g., the alkaline method, etc.
  • commercially available kits can be used.
  • another method for introducing a mutation into a vector for producing the vaccine of the present invention comprises the steps of: introducing the vector into a bacterial host cell; introducing a first plasmid vector containing a first fragment consisting of a portion of a human herpesvirus genome into the bacterial host cell, wherein the first fragment has at least one mutation; introducing a second plasmid vector containing a second fragment consisting of a portion of the human herpesvirus genome into the bacterial host cell, wherein the second fragment has at least one mutation and the second fragment is different from the first fragment; culturing the bacterial host cell; and isolating a vector having a BAC vector sequence from the cultured bacterial host cell.
  • a nucleic acid cassette which may be used for producing the vaccine of the present invention.
  • the nucleic acid cassette preferably comprises a first fragment capable of homologous recombination with a human herpesvirus genome in a host cell, a BAC vector sequence, and a second fragment capable of homologous recombination with a human herpesvirus genome in the host cell, wherein the opposite ends of the BAC sequence are linked with the first fragment and second fragments, respectively.
  • the first fragment and the second fragment are preferably at least 1 kb, at least 1.5 kb, or at least 2 kb in length.
  • the first fragment and the second fragment preferably has at least 80% identity, at least 85,% identity, at least 90% identity, or at least 95% identity to the human herpesvirus genome sequence.
  • the first and second fragments are derived from different regions of the human herpesvirus genome.
  • the first and second fragments may be independently derived from a region flanking the ORF of gene U24 or a region flanking the ORF of gene U24a.
  • the BAC vector sequence comprises a recombinant protein-dependent recombinant sequence and/or a selectable marker in order to control homologous recombination and easily detect a desired gene.
  • the selectable marker may be either a drug selectable marker or a gene encoding a fluorescent protein (e.g., a green fluorescent protein, etc.).
  • the BAC vector sequence has a nucleic acid sequence set forth in SEQ ID NO.: 401.
  • the first and second fragments are independently derived from regions selected from the group consisting of the following regions of the HHV-7 genome, or independently have at least 80%, 85%, 90%, or 95% identity to regions selected from the group consisting of the following regions of the HHV-7 genome: a region within the ORF of gene H1, a region within the ORF of gene DR1, a region within the ORF of gene DR2, a region within the ORF of gene H2, a region within the ORF of gene DR6, a region within the ORF of gene DR7, a region within the ORF of gene H3, a region within the ORF of gene H4, a region within the ORF of gene U2, a region within the ORF of gene U3, a region within the ORF of gene U4, a region within the ORF of gene U5/7, a region within the ORF of gene U8, a region within the ORF of gene U10, a region within the ORF of gene U12, a
  • the first and second fragments are derived from different regions of the human herpesvirus genome.
  • the first and second fragments may be independently derived from a region flanking the ORF of gene U24 or a region flanking the ORF of gene U24a.
  • the BAC vector sequence comprises a recombinant protein-dependent recombinant sequence and/or a selectable marker in order to control homologous recombination and easily detect a desired gene.
  • the selectable marker may be either a drug selectable marker or a gene encoding a fluorescent protein (e.g., a green fluorescent protein, etc.).
  • the BAC vector sequence has a nucleic acid sequence set forth in SEQ ID NO.: 401.
  • a method of the present invention can be used to easily prepare a herpesvirus having a herpesvirus genome into which a foreign gene is introduced.
  • Such mutation introduction can be performed by using a method described below regarding, for example, HHV-7.
  • HHV-7-U21-27-BAC plasmid a plasmid containing the HHV-7 genome and a BAC vector sequence
  • a nucleic acid encoding a mutated foreign gene e.g., a shuttle vector or a PCR product
  • Homologous recombination is allowed to occur between HHV-7-U21-27-BAC plasmid and the shuttle vector or PCR product, so that a foreign gene mutation can be introduced into HHV-7-U21-27-BAC plasmid.
  • a transposon can be used to randomly introduce a mutation into a desired nucleic acid sequence.
  • the HHV-7-U21-27-BAC plasmid into which the foreign gene has been introduced can be easily selected and grown in E. coli .
  • the recombinant herpesvirus can be obtained (Markus Wagner, TRENDS in Microbiology, Vol. 10, No. 7, July 2002). Specific examples will be described below.
  • the shuttle vector and HHV-7-U21-27-BAC plasmid are allowed to recombine via a first homologous region to generate a cointegrate in which the shuttle vector is linked with HHV-7-U21-27-BAC plasmid.
  • the shuttle plasmid is removed.
  • the cointegrated portion is removed.
  • a modified HHV-7-U21-27-BAC plasmid having the foreign gene contained in the shuttle vector is obtained.
  • the probability that the second recombination event occurs in the second homologous region is substantially the same as the probability that the second recombination event occurs in the first homologous region.
  • HHV-7-U21-27-BAC plasmids are plasmids having the same sequence as that which has been used in the recombination, while about half thereof are plasmids having the foreign gene which has been introduced into the shuttle vector.
  • a linear DNA fragment is used to introduce a mutation into a circular HHV-7-U21-27-BAC molecule.
  • a selectable marker flanking a target sequence and a linear DNA fragment containing a homologous sequence are introduced along with HHV-7-U21-27-BAC into E. coli capable of homologous recombination.
  • E. coli capable of homologous recombination.
  • the linear DNA has a region homologous to HHV-7-U21-27-BAC plasmid on the opposite ends thereof. Homologous recombination occurs via the homologous region, thereby making it possible to introduce a desired sequence of the linear DNA fragment into HHV-7-U21-27-BAC.
  • RecET and red ⁇ exhibit homologous recombination via a homologous sequence having a length of about 25 to 50 nucleotides. Therefore, the recombination functions of recET and red ⁇ can be used more easily than recA-mediated homologous recombination.
  • transposon element to insert into a nucleic acid in E. coli.
  • a transposon element containing a desired foreign gene and HHV-7-U21-27-BAC are introduced into E. coli so that the transposon element is randomly inserted into HHV-7-U21-27-BAC.
  • HHV-7-U21-27-BAC having the inserted foreign gene is obtained.
  • the above-described method for preparing recombinant HHV-7 containing a foreign gene can be applied to HHV-6.
  • HIV infects CD4 + T cells It is known that HIV infection is prevented or healed by the treatment of CD4 + T cells with HHV-7 (Lusso et al., Proc. Natl. Acad. Sci. USA, vol. 91, 3872-3876, April 1994). This therapeutic effect is achieved by HHV-7 infecting CD4 + T cells via the CD4 receptor on the T cells. Therefore, recombinant HHV-7 which has infectious capacity to CD4 + T cells can be prepared by a method of the present invention and can be used for the prevention and/or therapy of HIV infection.
  • the HIV infection preventing effect of HHV-7 of the present invention can be measured by determining whether or not HHV-7 prevents the growth of HIV in target cells.
  • target cells used for measurement include, but are not limited to, peripheral blood mononuclear cells, CD4 + cells, SupT1 cells, and the like. More specifically, for example, measurement can be performed as follows.
  • Target cells are previously infected with HHV-7 at a multiplicity of infection (MOI) of 0.1, followed by culturing at 37° C. for 24 to 72 hours. Thereafter, HIV is added, followed by incubation for 30 minutes to 2 hours. Thereafter, the cells are well washed, and incubated again. After 4 days of incubation, HIV-derived antigens released in culture medium are quantitated.
  • MOI multiplicity of infection
  • As a control cells which have not been subjected to HHV-7 infection are infected with HIV under the same conditions, and antigens released into culture medium are measured.
  • An example of an HIV-derived antigen is, but is not limited to, p24.
  • the quantity of the antigen serves as an index of HIV growth. Therefore, if the antigen quantity is small compared to that of the control, the HIV infection preventing effect of HHV-7 is demonstrated.
  • the therapeutic effect on HIV infection of HHV-7 of the present invention can be measured by determining whether or not HHV-7 suppresses the growth ability of HIV in target cells.
  • target cells used for measurement include, but are not limited to, peripheral blood mononuclear cells, CD4 + cells, SupT1 cells, and the like. More specifically, for example, measurement can be performed as follows.
  • Target cells are coinfected with HIV and HHV-7 (MOI of 0.1 to 0.01). After coinfection, the infected cells are incubated for about 30 minutes to 2 hours. Thereafter, the cells are well washed, and incubated again. As a control, cells which have been subjected to HIV infection without HHV-7 infection are used. After 4 days of incubation, HIV-derived antigens in culture medium are quantitated.
  • An example of an HIV-derived antigen is, but is not limited to, p24. The quantity of the antigen serves as an index of HIV growth. Therefore, if the antigen quantity is small compared to that of the control, the HIV infection preventing effect of HHV-7 is demonstrated.
  • Recombinant HHV-7 or HHV-6 of the present invention can be used to treat HIV.
  • a silencer gene for a HIV gene is introduced into recombinant HHV-7, and the recombinant HHV-7 is administered into HIV patients.
  • CD4 + T cells infected with HIV are infected with recombinant HHV-7, the production of HIV is suppressed. As a result, a therapeutic effect is exhibited on HIV infection.
  • CMV cytomegalovirus
  • the present invention also provides methods of treatment and/or prevention of diseases or disorders (e.g., infectious diseases) by administration to a subject of an effective amount of a therapeutic/prophylactic agent.
  • a therapeutic/prophylactic agent is meant a composition of the present invention in combination with a pharmaceutically acceptable carrier type (e.g., a sterile carrier).
  • the therapeutic/prophylactic agent will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the therapeutic/prophylactic agent alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to those skilled in the art.
  • the “effective amount” for purposes herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of the therapeutic/prophylactic agent administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the cellular physiologically active material of the present invention.
  • the therapeutic/prophylactic agent is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may alsobe employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • the therapeutic/prophylactic agents can be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), or as an oral or nasal spray.
  • “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the therapeutic/prophylactic agents of the invention are also suitably administered by sustained-release systems. Suitable examples of sustained-release therapeutic/prophylactic agents are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), or as an oral or nasal spray.
  • “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the therapeutic/prophylactic agent is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the therapeutic/prophylactic agent.
  • the formulations are prepared by contacting the therapeutic/prophylactic agent uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
  • Any pharmaceutical used for therapeutic administration can be free from organisms and viruses other than a virus as an effective ingredient, i.e., sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic/prophylactic agents generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • Therapeutic/prophylactic agents ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous therapeutic/prophylactic agent solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized therapeutic/prophylactic agent using bacteriostatic Water-for-injection.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the therapeutic/prophylactic agents of the invention.
  • Associated with such container (s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the therapeutic/prophylactic agents may be employed in conjunction with other therapeutic compounds.
  • the therapeutic/prophylactic agents of the invention may be administered alone or in combination with other therapeutic/prophylactic agents.
  • the therapeutic/prophylactic agents of the invention may be administered alone or in combination with other therapeutic agents.
  • Therapeutic/prophylactic agents that may be administered in combination with the therapeutic/prophylactic agents of the invention include but not limited to, chemotherapeutic agents, antibiotics, steroidal and nonsteroidal anti-inflammatories, conventional immunotherapeutic agents, cytokines and/or growth factors.
  • Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual.
  • Administration “in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • the therapeutic/prophylactic agents of the invention are administered in combination with antiretroviral agents, nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
  • the therapeutic/prophylactic agents of the invention are administered in combination with an antibiotic agent.
  • Antibiotic agents that may be used include, but are not limited to, aminoglycoside antibiotics, polyene antibiotics, penicillin antibiotics, cephemantiboitics, peptide antibiotics, microride antibiotics, and tetracycline antibiotics.
  • the therapeutic/prophylactic agents of the invention are administered alone or in combination with an anti-inflammatory agent.
  • Anti-inflammatory agents that may be administered with the therapeutic/prophylactic agents of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxace
  • the therapeutic/prophylactic agent of the present invention is administered in combination with other therapeutic/prophylactic regimens (e.g., radiation therapy).
  • other therapeutic/prophylactic regimens e.g., radiation therapy
  • Plasmid PHA-2 used was kindly provided by Markus Wagner and Ulrich H. Koszinowski (Adler et al., (2000), J. Virol. 74: 6964-74)
  • a BAC vector was inserted into the center of a region of about 4000 bp extending over gene U21, gene U23, gene U24, gene U24a, gene U25, and gene U26. This is because the insertion of a foreign nucleic acid into such a non-essential region was expected to have no adverse effect on the replication of herpesvirus.
  • a scheme of inserting a BAC vector into the HHV-7 genome is schematically shown in FIG. 1 .
  • the genomic DNA of herpesvirus strain KHR was used as a template to amplify primers BAC7-E1 (ATGCGGCCGCGCGAGTGATAGGTACTTTCT) (SEQ ID NO.: 402) and BAC7-E2 (GCTTAATTAATATATAAGTCCTTCAATAGC) (SEQ ID NO.: 403), and primers BAC7-E3 (GCTTAATTAACATGCTCTGCAATGCAAGCC) (SEQ ID NO.: 404) and BAC7-E4 (ATGCGGCCGCAAATAGCCTTTGCTCATAGC) (SEQ ID NO.: 405).
  • the prepared plasmid pHA-2/HHV7-U21-27 contains a guanine phosphoribosyl transferase (gpt) gene as a selectable marker.
  • the BAC vector sequence is sandwiched between two loxP sequences. Therefore, the BAC vector sequence sandwiched between the loxP sequences can be efficiently removed by the action of Cre recombinase.
  • cells into which the plasmid containing the BAC vector sequence has been introduced can be easily confirmed by the fluorescence of a green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • the plasmid was digested with NotI for linearization.
  • Nucleofection unit (Amaxa) was used to transfect cord blood mononuclear cells cultured in a 25-cm 2 plastic flask with 1 ⁇ g of the linearized pHA-2/HHV7U21-27 by electroporation. One day after transfection, the transfected cells were infected with herpesvirus KHR strain.
  • the cytopathic effect (CPE) typical for herpesvirus was observed.
  • Some of the cells could be confirmed under a microscope to express the GFP.
  • the GFP-positive infected cells were cultured for 7 days, and then co-cultured with newly separated and cultured cord blood mononuclear cells for infection.
  • the proportion of cells expressing GFP was increased in the presence of mycophenolic acid and xanthine. This indicates that the BAC vector was inserted into the herpesvirus genome and a recombinant virus was produced ( FIG. 2 ).
  • a recombinant virus was enriched by selection using the gpt gene in combination with mycophenolic acid and xanthine.
  • the recombinant virus was used to infect SupT1 cells. After 6 hours, the cells were recovered and circular DNA was extracted from the cells.
  • the circular DNA collected from the SupT1 cells was introduced into E. coli .
  • the E. coli cells were disseminated on plates containing drugs. DNA was extracted from colonies which appeared on the plates. From the infected cells, circular virus DNA was extracted by Hirt's method (Hirt, (1967), J. M. Biol, 26: 365-9). The extracted DNA was introduced into E.
  • coli DH10B by theelectroporationmethod (0.1-cm cuvette, 2.5 kV) using the gene pulser (Bio-Rad) for transformation.
  • E., coli containing HHV-7U21-27-BAC was obtained by screening on agar containing 17 ⁇ g/ml chloramphenicol.
  • HHV-7U21-27-BAC was extracted from the bacteria using the NucleoBond PC 100 kit (Macherey-Nagel) in accordance with the protocol accompanying the kit.
  • the resultant two clones were digested with restriction enzyme EcoRI.
  • HHV-7U21-27-BAC DNA (1 ⁇ g) was introduced into cord blood mononuclear cells (5 ⁇ 10 6 to 10 7 ) cultured in a 25-cm 2 plastic flask by the electroporation method. Electroporation was conducted using the nucleofactor kit (Amaxa) using the program T-08 in accordance with its manual. After electroporation, the mononuclear cells having the introduced gene were cultured in medium containing PHA (phytohemagglutinin) for 3 to 7 days.
  • PHA phytohemagglutinin
  • cord blood mononuclear cells were recovered, and were co-cultured with cord blood mononuclear cells (5 ⁇ 10 6 to 10 7 ) which were newly stimulated with PHA.
  • the cells were cultured in PHA-free medium which contained drugs (MPA, xanthine). After coculturing, viral production was observed on day 2 to 3.
  • MPA xanthine
  • Recombinant adenovirus capable of expressing Cre recombinase (TanakaM. et al., J. Virol., 2003January; 77(2): 1382-1391) was kindly provided by Yasushi Kawaguchi of the Tokyo Medical and Dental University.
  • Cord blood mononuclear cells were infected with the recombinant adenovirus at a MOI of 100. After 2 hours of virus adsorption, the cells were washed with PBS ( ⁇ ), followed by culturing in RPMI medium containing 5% FCS. The cord blood mononuclear cells were superinfected with recombinant human herpesvirus 24 hours after infection with recombinant adenovirus.
  • a control experiment was conducted to confirm that the recombinant adenovirus expressed Cre recombinase and a BAC vector sequence was efficiently cut out from the HHV-7U21-27-BAC genome.
  • the result of DNA sequencing of the obtained human herpesvirus confirmed that a BAC vector sequence was cut from HHV-7U21-27-BAC.
  • HHV-7 KHR strain
  • the obtained recombinant herpesvirus are compared in terms of the growth ability in cord blood mononuclear cells or SupT1 cells using the Median tissue culture infectious dose (TCID50) method.
  • Cord blood mononuclear cells are infected with KHR strain and recombinant virus having the same titier, followed by culturing from day 0 to day 7. Thereafter, new cord blood mononuclear cells or SupT1 cells are infected with the viruses to compare the replication ability thereof.
  • the titer is measured by the TCID method.
  • the resultant recombinant human herpesvirus is confirmed to exhibit substantially the same replication ability as that of human herpesvirus KHR strain in vitro.
  • the method of the present invention is used to readily prepare a herpesvirus having a genome into which an HIV silencer gene (e.g., an antisense nucleic acid to an HIV gene) by steps described below.
  • an HIV silencer gene e.g., an antisense nucleic acid to an HIV gene
  • a shuttle vector is prepared, in which the NF ⁇ B/Sp1 site of the U3 site of LTR in HIV is operatively linked upstream of the HIV silencer gene, and a region flanking a non-essential gene of HHV-7 is linked to the opposite ends of the resultant sequence.
  • the shuttle vector and HHV-7U21-27-BAC plasmid (a plasmid containing the HHV-7 genome and a BAC vector sequence) are introduced into E. coli .
  • homologous recombination occurs between the HHV-7-U21-27-BAC plasmid and the shuttle vector in the E. coli to produce a cointegrate in which the foreign gene (HIV silencer gene) contained in the shuttle vector is introduced into the HHV-7U21-27-BAC plasmid.
  • the shuttle plasmid is removed.
  • the cointegrated portion is removed.
  • the second recombination event occurs via a first homologous region
  • a plasmid having the same sequence as that of HHV-7U21-27-BAC used in the recombination is generated.
  • a modified HHV-7U21-27-BAC plasmid having a foreign gene contained in the shuttle vector is obtained.
  • the probability that the second recombination event occurs in the second homologous region is substantially the same as the probability that the second recombination event occurs in the first homologous region. Therefore, about half of the resultant HHV-7-U21-27-BAC plasmids are plasmids having the same sequence as that which has been used in the recombination, while about half thereof are plasmids having the foreign gene which has been introduced into the shuttle vector.
  • the plasmid containing the HIV silencer is used to prepare a recombinant HHV-7 virus.
  • the recombinant virus can be used to treat HIV infection.
  • SupT1 cells are inoculated and cultured in 20 Roux bottles having a culture area of 210 cm 2 . After completion of culturing, the culture media containing the cells are frozen and thawed, followed by centrifugation at 3,000 rpm for 20 minutes at 4° C. The supernatant containing viruses released from the cells is collected, which is used as a live vaccine stock solution.
  • CD4 + T cells are isolated from the peripheral blood of healthy adults by negative immunological magnet selection using mouse monoclonal antibodies (e.g., Becton Dickinson) for CD8, CD14, CD19, CD20 and CD56, and anti-mouse IgG antiserum (e.g., Dynal, Great Neck, N.Y.).
  • the cells are stimulated with 1 ⁇ g/ml of purified phytohemagglutinin (e.g., Wellacome), followed by growth in the presence of 10 units/ml partially purified IL-2 (e.g., Boehringer Mannheim).
  • IL-2 e.g., Boehringer Mannheim
  • the HIV infection preventing effect of HHV-7 of the present invention can be measured by determining whether or not the HIV replication ability in CD4 + T cell is suppressed by HHV-7. More specifically, the following procedure is used.
  • CD4 + T cells (106) are infected with HHV-7 at a MOI of 0.01 to 0.1, followed by culturing at 37° C. for 48 hours. Thereafter, HIV (amount: 10 5 cpm of reverse transcriptase) is added, followed by incubation for 37 minutes to 1 hour. Thereafter, the cells are well washed, and incubated again in a 24-well plate. In the post-wash incubation, IL-2 (10 units/ml) is added to culture medium. After 4 days of incubation (cell survival rate: more than 80%), p24 protein released in culture medium is quantitated with ELISA.
  • HHV-7 As a control, cells which have not been subjected to HHV-7 infection are infected with HIV under the same conditions, and p24 protein released into culture medium are measured.
  • the quantity of p24 protein serves as an index of HIV replication. Therefore, if the quantity of p24 protein is small compared to that of the control, the HIV infection preventing effect of HHV-7 is demonstrated.
  • HHV-7 targets CD4 which is a target (entrance) of HIV for infection. Therefore, CD4 has been demonstrated to be able to be used for the prevention of HIV infection.
  • HHV-6 which is also a virus capable of infecting CD4 + T cells as with HHV-7 and HIV, has a target protein different from that of HHV-7 or HIV. Therefore, HHV-6 can be used as a gene therapy vector for HIV infection by, for example, introducing a gene suitable for therapy, such as a suicide gene or the like, into HIV infected cells. More specifically, the following technique can be used.
  • CD4 + T cells are prepared using the same method as described in Example 5. HIV is added to CD4 + T cells (106), followed by incubation at 37° C. for 1 hour. Thereafter, the cells are well washed. The HIV infected cells are infected with HHV-6 (recombinant HHV-6 virus laking a gene activating the LTR of HIV) at a MOI of 1. IL-2 (10 units/ml) is added to the culture medium, followed by incubation at 37° C. for 1 hour. After incubation, p24 protein released into the culture medium is quantitated with ELISA. As a control, cells which have not been subjected to HHV-6 treatment are used, and p24 protein released into culture medium is measured. The quantity of p24 protein serves as an index of HIV replication. Therefore, if the quantity of p24 protein is small compared to that of the control, the HIV infection preventing effect of HHV-6 is demonstrated.
  • HHV-6 recombinant HHV-6 virus laking
  • the present invention provides a method for producing a recombinant herpesvirus from a single virus strain using, for example, BAC ( E. coli artificial chromosome), and a recombinant herpesvirus produced by the method.
  • the present invention also provides a pharmaceutical composition comprising a recombinant herpesvirus.
  • the present invention provides a vector comprising a herpesvirus genomic gene and a BAC vector sequence, a cell containing such a vector, and a nucleic acid cassette comprising a fragment capable of homologous recombination with a herpesvirus genome, and a BAC vector sequence.
  • the present invention provides a pharmaceutical composition comprising a recombinant herpesvirus for the prevention and therapy of HIV infection.
  • SEQ ID NO.: 1 JI strain genome sequence SEQ ID NO.: 2, H1 5′ ⁇ 3′ direction 33 to 542 amino acid sequence of amino acids 1-170 SEQ ID NO.: 3, DR2 5′ ⁇ 3′ direction 898 to 2100 amino acid sequence of amino acids 1-401 SEQ ID NO.: 4, H2 5′ ⁇ 3′ direction 2267 to 2506 amino acid sequence of amino acids 1-80 SEQ ID NO.: 5, DR6 5′ ⁇ 3′ direction 2562 to 3050 amino acid sequence of amino acids 1-163 SEQ ID NO.: 6, DR7 5′ ⁇ 3′ direction 3122 to 3910 amino acid sequence of amino acids 1-263 SEQ ID NO.: 7, U10 5′ ⁇ 3′ direction 14608 to 15963 amino acid sequence of amino acids 1-452 SEQ ID NO.: 8, U12 5′ ⁇ 3′ direction 18396 to 19436 amino acid sequence of amino acids 1-347 SEQ ID NO.: 9, U13 5′ ⁇ 3′ direction 19521 to 19817 amino acid sequence of amino acids 1-99 SEQ ID NO.: 10, U

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Communicable Diseases (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • AIDS & HIV (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
US10/843,877 2004-05-06 2004-05-12 Recombinant virus vector for gene transfer into lymphoid cells Abandoned US20080226677A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US12/437,644 US7820436B2 (en) 2004-05-06 2009-05-08 Recombinant viral vector for gene transfer into lymphoid cells
US12/794,193 US8148060B2 (en) 2004-05-06 2010-06-04 Recombinant viral vector for gene transfer into lymphoid cells
US13/214,137 US20120129263A1 (en) 2004-05-06 2011-08-19 Recombinant viral vector for gene transfer into lymphoid cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2004-137953 2004-05-06
JP2004137953 2004-05-06

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/437,644 Continuation US7820436B2 (en) 2004-05-06 2009-05-08 Recombinant viral vector for gene transfer into lymphoid cells

Publications (1)

Publication Number Publication Date
US20080226677A1 true US20080226677A1 (en) 2008-09-18

Family

ID=35320236

Family Applications (4)

Application Number Title Priority Date Filing Date
US10/843,877 Abandoned US20080226677A1 (en) 2004-05-06 2004-05-12 Recombinant virus vector for gene transfer into lymphoid cells
US12/437,644 Expired - Fee Related US7820436B2 (en) 2004-05-06 2009-05-08 Recombinant viral vector for gene transfer into lymphoid cells
US12/794,193 Expired - Fee Related US8148060B2 (en) 2004-05-06 2010-06-04 Recombinant viral vector for gene transfer into lymphoid cells
US13/214,137 Abandoned US20120129263A1 (en) 2004-05-06 2011-08-19 Recombinant viral vector for gene transfer into lymphoid cells

Family Applications After (3)

Application Number Title Priority Date Filing Date
US12/437,644 Expired - Fee Related US7820436B2 (en) 2004-05-06 2009-05-08 Recombinant viral vector for gene transfer into lymphoid cells
US12/794,193 Expired - Fee Related US8148060B2 (en) 2004-05-06 2010-06-04 Recombinant viral vector for gene transfer into lymphoid cells
US13/214,137 Abandoned US20120129263A1 (en) 2004-05-06 2011-08-19 Recombinant viral vector for gene transfer into lymphoid cells

Country Status (8)

Country Link
US (4) US20080226677A1 (ja)
EP (1) EP1743942A4 (ja)
JP (2) JP4796958B2 (ja)
KR (2) KR101234062B1 (ja)
CN (1) CN1981040B (ja)
AU (1) AU2005240902B2 (ja)
CA (1) CA2565509A1 (ja)
WO (1) WO2005108581A1 (ja)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100119550A1 (en) * 2005-11-24 2010-05-13 Yasuyuki Gomi Recombinant multivalent vaccine
US20100247486A1 (en) * 2003-08-29 2010-09-30 Virus Ikagaku Kenkyusho Inc. Recombinant virus vector originating in HHV-6 or HHV-7, method of producing the same, method of transforming host cell using the same, host cell transformed thereby and gene therapy method using the same
US20110189233A1 (en) * 2004-03-05 2011-08-04 Kazuhiro Nagaike Recombinant Varicella-Zoster Virus
WO2011095174A1 (en) * 2010-02-08 2011-08-11 Aarhus Universitet Human herpes virus 6 and 7 u20 polypeptide and polynucleotides for use as a medicament or diagnosticum
US20120122700A1 (en) * 2010-11-11 2012-05-17 University Of South Florida Materials and methods for determining subtelomere dna sequence
US20120220028A1 (en) * 2009-09-04 2012-08-30 The Research Foundation For Microbial Diseases Of Osaka University Enhancer for promoter, and use thereof
CN103849640A (zh) * 2014-03-12 2014-06-11 南京师范大学 一种寡核苷酸和可消除质粒共转化用于大肠杆菌必需基因点突变的方法

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2426518A (en) * 2005-05-25 2006-11-29 London School Hygiene & Tropical Medicine Cyokine from human herpes virus 6
US20110142918A1 (en) * 2008-06-12 2011-06-16 Phoebus S.R.L. Anti-angiogenic compositions and therapeutic applications thereof
KR20130131342A (ko) * 2010-11-05 2013-12-03 도쿠리쯔 교세이 호진 이야쿠 키반 켄큐쇼 헤르페스바이러스 6 글리코프로테인 q1에 대한 중화 항체의 제조 및 그의 해석
CN106282321B (zh) * 2015-05-26 2019-12-03 中山大学 由组织snoRNA组成的肝癌复发风险预测标志物及试剂盒
GB201609354D0 (en) * 2016-05-26 2016-07-13 Glaxosmithkline Ip Dev Ltd Transient transfection method for retroviral production
DE102016122317A1 (de) 2015-11-24 2017-05-24 Glaxosmithkline Intellectual Property Development Limited Transientes transfektionsverfahren für retrovirale produktion
CN106119425B (zh) * 2016-09-22 2020-02-18 武汉百格资产管理有限公司 同步检测人类疱疹病毒6、7型的引物、探针及试剂盒
CN106119424B (zh) * 2016-09-22 2020-02-18 武汉百格资产管理有限公司 同步检测人类疱疹病毒6、7、8型的引物、探针及试剂盒
CN106244731A (zh) * 2016-09-22 2016-12-21 武汉百格资产管理有限公司 同步检测人类疱疹病毒6、8型的引物、探针及试剂盒
US20210353708A1 (en) * 2018-10-01 2021-11-18 The Brigham And Women`S Hospital, Inc. Brevican-Binding Peptides for Brain Tumor Imaging

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6573090B1 (en) * 1998-12-09 2003-06-03 The General Hospital Corporation Enhanced packaging of herpes virus amplicons and generation of recombinant virus vectors
US20050106733A1 (en) * 2001-12-25 2005-05-19 Kenzo Takada Double-stranded cyclic dna capable of proliferating as a bacterial e coli chromosome
US7223411B1 (en) * 1992-07-31 2007-05-29 Dana-Farber Cancer Institute Herpesvirus replication defective mutants

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6503752B1 (en) * 1993-11-10 2003-01-07 Ramot University Authority For Applied Research & Industrial Development Ltd. Lymphotropic agents and vectors
EP1074624B1 (en) * 1999-02-25 2005-04-13 The Research Foundation for Microbial Diseases of Osaka University Attenuated chicken-pox virus oka strain gene 62 and method for identifying virus strain for attenuated live chicken-pox vaccine by using the gene
CN1140626C (zh) * 1999-10-27 2004-03-03 本元正阳基因技术股份有限公司 一种重组i型单纯疱疹病毒及其用途
EP1178111A1 (en) * 2000-08-03 2002-02-06 Lohmann Animal Health GmbH & Co. KG Vaccination against host cell-associated herpesviruses
DE60141976D1 (de) * 2000-11-29 2010-06-10 Univ Rochester Helfervirus-freie herpesvirus-amplifikatpartikel und deren verwendungen
WO2002053576A1 (en) * 2001-01-05 2002-07-11 The General Hospital Corporation Viral delivery system for infectious transfer of large genomic dna inserts
DE10116594A1 (de) * 2001-04-03 2002-10-10 Boehringer Ingelheim Vetmed Künstliche Chromosomen, die EHV-Sequenzen umfassen
EP2213300B1 (en) 2001-05-09 2015-03-25 Takara Bio, Inc. Composition and method for treating cancer using herpes virus
WO2005012539A1 (en) * 2003-08-04 2005-02-10 Niza Frenkel Vaccination vectors derived from lymphotropic human herpes viruses 6 and 7
EP1681346A4 (en) * 2003-08-29 2006-11-02 Soiken Inc HHV-6 OR HHV-7 DERIVED RECOMBINANT VIRUS VECTOR, METHOD FOR THE PRODUCTION THEREOF, METHOD FOR TRANSFORMING A HOST CELL USING THEREOF, TRANSFORMED HOST CELL AND GENE THERAPY METHOD USING THEREOF
EP1721981A4 (en) * 2004-03-05 2007-03-14 Univ Osaka Res Found RECOMBINANT VARICELLA ZOSTER VIRUS

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7223411B1 (en) * 1992-07-31 2007-05-29 Dana-Farber Cancer Institute Herpesvirus replication defective mutants
US6573090B1 (en) * 1998-12-09 2003-06-03 The General Hospital Corporation Enhanced packaging of herpes virus amplicons and generation of recombinant virus vectors
US20050106733A1 (en) * 2001-12-25 2005-05-19 Kenzo Takada Double-stranded cyclic dna capable of proliferating as a bacterial e coli chromosome

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100247486A1 (en) * 2003-08-29 2010-09-30 Virus Ikagaku Kenkyusho Inc. Recombinant virus vector originating in HHV-6 or HHV-7, method of producing the same, method of transforming host cell using the same, host cell transformed thereby and gene therapy method using the same
US8642045B2 (en) * 2003-08-29 2014-02-04 Virus Ikagaku Kenkyusho Inc. Recombinant virus vector originating in HHV-6 or HHV-7, method of producing the same, method of transforming host cell using the same, host cell transformed thereby and gene therapy method using the same
US20110189233A1 (en) * 2004-03-05 2011-08-04 Kazuhiro Nagaike Recombinant Varicella-Zoster Virus
US20100119550A1 (en) * 2005-11-24 2010-05-13 Yasuyuki Gomi Recombinant multivalent vaccine
US20120220028A1 (en) * 2009-09-04 2012-08-30 The Research Foundation For Microbial Diseases Of Osaka University Enhancer for promoter, and use thereof
WO2011095174A1 (en) * 2010-02-08 2011-08-11 Aarhus Universitet Human herpes virus 6 and 7 u20 polypeptide and polynucleotides for use as a medicament or diagnosticum
US20120122700A1 (en) * 2010-11-11 2012-05-17 University Of South Florida Materials and methods for determining subtelomere dna sequence
CN103849640A (zh) * 2014-03-12 2014-06-11 南京师范大学 一种寡核苷酸和可消除质粒共转化用于大肠杆菌必需基因点突变的方法

Also Published As

Publication number Publication date
EP1743942A4 (en) 2010-08-04
CN1981040B (zh) 2011-06-22
JP2011234726A (ja) 2011-11-24
US7820436B2 (en) 2010-10-26
JPWO2005108581A1 (ja) 2008-03-21
US20120129263A1 (en) 2012-05-24
AU2005240902A1 (en) 2005-11-17
WO2005108581A1 (ja) 2005-11-17
AU2005240902B2 (en) 2011-09-15
CA2565509A1 (en) 2005-11-17
JP4796958B2 (ja) 2011-10-19
US20110070651A1 (en) 2011-03-24
US20090253208A1 (en) 2009-10-08
JP5410477B2 (ja) 2014-02-05
KR20060123666A (ko) 2006-12-01
EP1743942A1 (en) 2007-01-17
KR101294238B1 (ko) 2013-08-07
US8148060B2 (en) 2012-04-03
KR20120088004A (ko) 2012-08-07
KR101234062B1 (ko) 2013-02-18
CN1981040A (zh) 2007-06-13

Similar Documents

Publication Publication Date Title
US8148060B2 (en) Recombinant viral vector for gene transfer into lymphoid cells
US11752206B2 (en) Herpes simplex virus vaccine
Puhlmann et al. Vaccinia as a vector for tumor-directed gene therapy: biodistribution of a thymidine kinase-deleted mutant
AU2023216825A1 (en) Herpes simplex virus vaccine
US9931396B2 (en) Koi herpesvirus vaccine
EP2195021B1 (en) A recombinant koi herpesvirus (khv) or cyprinid herpesvirus 3 (cyhv-3) and a vaccine for the prevention of a disease caused by khv/cyhv-3 in cyprinus carpio carpio or cyprinus carpio koi
US20130101620A1 (en) Recombinant varicella-zoster virus
CA2808179A1 (en) Promoter for introducing a gene into a lymphocyte or blood cell and application thereof
CN115916964A (zh) 用于治疗癌症的基因修饰的牛疱疹病毒1型（bhv-1）
WO2007102140A2 (en) A semliki forest virus replication competent vector with enhanced biosafety

Legal Events

Date Code Title Description
AS Assignment

Owner name: RESEARCH FOUNDATION FOR MICROBIAL DISEASES OF OSAK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MORI, YASUKO;TADAGAKI, KENJIRO;TAKEMOTO, MASAYA;AND OTHERS;REEL/FRAME:015887/0922;SIGNING DATES FROM 20040929 TO 20040930

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION