US20060211752A1 - Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression - Google Patents

Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression Download PDF

Info

Publication number
US20060211752A1
US20060211752A1 US11/130,922 US13092205A US2006211752A1 US 20060211752 A1 US20060211752 A1 US 20060211752A1 US 13092205 A US13092205 A US 13092205A US 2006211752 A1 US2006211752 A1 US 2006211752A1
Authority
US
United States
Prior art keywords
disease
inflammatory
inhibitors
group
tlr3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/130,922
Other languages
English (en)
Inventor
Leonard Kohn
Norikazu Harii
Uruguaysito Benavides-Peralta
Mariana Gonzalez-Murguiondo
Christopher Lewis
Giorgio Napolitano
Cesidio Giuliani
Ramiro Malgor
Douglas Goetz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ohio University
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/801,986 external-priority patent/US20050209295A1/en
Priority claimed from US10/912,948 external-priority patent/US7928132B2/en
Priority to US11/130,922 priority Critical patent/US20060211752A1/en
Application filed by Individual filed Critical Individual
Assigned to THE INTERTHYR CORPORATION reassignment THE INTERTHYR CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BENAVIDES-PERALTA, URUGUAYSITO LORELEY, GONZALEZ-MURGUIONDO, MARIANA, GIULIANI, CESIDIO, NAPOLITANO, GIORGIO, HARII, NORIKAZU, MALGOR, RAMIRO, GOETZ, DOUGLAS J., LEWIS, CHRISTOPHER J., KOHN, LEONDARD D.
Priority to CA002606769A priority patent/CA2606769A1/en
Priority to AU2006247504A priority patent/AU2006247504B2/en
Priority to EP20110161080 priority patent/EP2399578A1/de
Priority to PCT/US2006/018554 priority patent/WO2006124676A1/en
Priority to EP06770302A priority patent/EP1896015A1/de
Priority to JP2008512377A priority patent/JP2008545651A/ja
Publication of US20060211752A1 publication Critical patent/US20060211752A1/en
Priority to US12/286,880 priority patent/US20100004304A1/en
Assigned to BENAVIDES-PERALTA, URUGUAYSITO LORELEY, GIULIANI, CESIDIO, MALGOR, RAMIRO, LEWIS, CHRISTOPHER, NAPOLITANO, GIORGIO, HARII, NORIKAZU, GONZALEZ-MURGUIONDO, MARIANA, GOETZ, DOUGLAS J., KOHN, LEONARD D. reassignment BENAVIDES-PERALTA, URUGUAYSITO LORELEY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: INTERTHYR CORPORATION
Assigned to OHIO UNIVERSITY reassignment OHIO UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LEWIS, CHRISTOPHER, BENAVIDES-PERALTA, URUGUAYSITO LORELEY, GONZALEZ-MURGUIONDO, MARIANA, GIULIANI, CESIDIO, HARII, NORIKAZU, NAPOLITANO, GIORGIO, MALGOR, RAMIRO, KOHN, LEONARD D., GOETZ, DOUGLAS J.
Priority to US13/370,079 priority patent/US9326972B2/en
Priority to US15/047,851 priority patent/US20160220536A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4166—1,3-Diazoles having oxo groups directly attached to the heterocyclic ring, e.g. phenytoin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/04—Antipruritics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/16—Otologicals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A61P31/06—Antibacterial agents for tuberculosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10—Antimycotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the treatment of autoimmune and/or inflammatory diseases associated with overexpression of Toll-like receptor 3 (TLR3) as well as Toll-like receptor 4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages, and/or dendritic cells in association with related pathologies.
  • TLR3 Toll-like receptor 3
  • TLR4 Toll-like receptor 4
  • This invention also relates to the use of phenylmethimazoles, methimazole (MMI) derivatives, and tautomeric cyclic thiones for the treatment of autoimmune and inflammatory diseases associated with Toll-like receptor 3 (TLR3) as well as Toll-like receptor 4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages, and/or dendritic cells in association with related pathologies.
  • TLR3 Toll-like receptor 3
  • TLR4 Toll-like receptor 4
  • TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages, and/or dendritic cells in association with related pathologies.
  • This invention also relates to treating a subject having a disease or condition associated with abnormal Toll-like receptor 3 (TLR3) as well as Toll-like receptor 4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages, and/or dendritic cells in association with related pathologies.
  • TLR3 Toll-like receptor 3
  • TLR4 Toll-like receptor 4
  • TLR3/TLR4 TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages, and/or dendritic cells in association with related pathologies.
  • Autoimmune diseases are currently clinically defined by (i) humoral or autoantibody response to a self antigen, e.g. Graves' primary hyperthyroidism with antibodies to the TSH receptor, or (ii) cellular response wherein immune cells destroy nonimmune cells from which the self-antigen is derived, e.g. the thyrocyte (Hashimoto's thyroiditis) or pancreatic ⁇ -islet cell (Type 1 diabetes) (I. Roitt, Essential Immunology, 7th ed., 312-346 (1991)). Many autoimmune diseases are in fact a combination of both phenomena (I.
  • autoimmune diseases often have a significant inflammatory component including increases in adhesion molecules, e.g. vascular cell adhesion molecule-1 (VCAM-1), and altered leukocyte adhesion to the vasculature, e. g., colitis, systemic lupus, systemic sclerosis, and the vascular complications of diabetes (I. Roitt, Essential Immunology, 7th ed., 312-346 (1991); S. A. Jimenez, et al., Ann Intern Med, 140:37-50 (2004)).
  • VCAM-1 vascular cell adhesion molecule-1
  • TLR Toll-like receptor
  • Innate immunity is a protective immune cell response that functions rapidly to fight environmental insults including, but not limited to, bacterial or viral agents.
  • Adaptive immunity is a slower response, which involves differentiation and activation of naive T lymphocytes into T helper 1 (Th1) or T helper 2 (Th2) cell types (I.
  • Th1 cells mainly promote cellular immunity
  • Th2 cells mainly promote humoral immunity.
  • pathologic expression of the innate immunity signals emanating from the TLR pathway are now implicated in initiating autoimmune-inflammatory diseases.
  • autoimmune-inflammatory endocrine or non-endocrine diseases are largely aimed at treating the symptoms of the disease.
  • the underlying genetic susceptibilities are poorly defined, are multiple, are often not disease specific, and are largely not readily amenable to therapy.
  • Immunosuppressive agents that are used to treat autoimmune-inflammatory diseases largely target the immune cell response or the cytokines they produce. They are only partially effective in inducing remission (methimazole in Graves'), toxic (cyclosporin for Type 1 diabetes), or simply palliative (anti-inflammatory corticosteroids for colitis or systemic lupus).
  • TLR TLR-associated autoimmune-inflammatory diseases
  • G. Pasterkamp et al., Eur J Clin Invest, 34:328-34 (2004)
  • L. D. Kohn, et al. Research Ohio, In press, (2005)
  • N. Harii et al., Mol Endocrinol, 19:1231-50 (2005)
  • TLR and the TLR signal mechanism of innate immunity upon which adaptive (humoral or cell-mediated) immunity depends has created an opportunity to develop of a new class of drugs as well as new diagnostic paradigms (L. D. Kohn, et al., Research Ohio, In press, (2005); N. Harii, et al., Mol Endocrinol, 19:1231-50 (2005); D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L. D. Kohn, et al., U.S. patent application Ser. No. 10/801,986 (2004); L. D. Kohn, et al., U.S. patent application Ser. No. 10/912,948 (2004)).
  • Pasterkamp et al., Eur J Clin Invest, 34:328-34 (2004); H. M. Dansky, et al., Arterioscler Thromb Vasc Biol, 21:1662-7 (2001); P. E. Szmitko, et al., Circulation, 108:2041-8 (2003); P. E. Szmitko, et al., Circulation, 108:1917-23 (2003); M. I. Cybulsky, et al., Can J Cardiol, 20 Suppl B:24B-8B (2004); P. M. Ridker, et al., Circulation, 109:IV6-19,(2004)). No such method exists although it is considered important.
  • TLRs Toll-like receptors
  • TLR Family Mammalian TLRs comprise a large family consisting of at least 10 functional members such as TLR1-9 which are conserved between the human and mouse.
  • the cytoplasmic portion of TLRs shows high similarity to that of the IL-I receptor family and is termed a Toll/IL-1 receptor (TIR) domain.
  • TIR Toll/IL-1 receptor
  • the IL-1 receptors possess an immunoglobulin-like domain, whereas TLRs bear leucine-rich repeats (LRRs) in the extracellular domain.
  • LRRs leucine-rich repeats
  • TLRs play important roles in recognizing specific signature molecules derived from pathogens including bacteria, fungi, protozoa and viruses, derived from their invasion of cells, or resultant from the effects of noxious environmental stimuli which cause cell damage.
  • TLR1 Toll-like Receptors 1, 2, and 6
  • TLR2 recognizes a variety of lipoproteins/lipopeptides from various pathogens, e.g. Gram-positive bacteria, mycobacteria, Trypanosoma cruzi, fungi and Treponema (K. Takeda, et al., Annu Rev Immunol, 21:335-76 (2003)).
  • TLR2 reportedly recognizes LPS preparations from non-enterobacteria such as Leptospira interrogans, Porphyromonas gingivalis and Helicobacter pylori.
  • LPS structurally differ from the typical LPS of Gram-negative bacteria recognized by TLR4 in the number of acyl chains in the lipid A component, which presumably confers differential recognition; thus, LPS from P. gingivalis only poorly activates TLR4 (M. Hashimoto, et al., Int Immunol, 16:1431-7 (2004)).
  • TLR2 recognizes a wide spectrum of microbial components.
  • TLR2 forms heterophilic dimers with other TLRs such as TLR1 and TLR6, both of which are structurally related to TLR2.
  • TLR1 and TLR6 both of which are structurally related to TLR2.
  • TLR2 involves interactions (B. N. Gantner, et al., J Exp Med, 197:1107-17 (2003)) with distinct types of receptors such as dectin-1, a lectin family receptor for the fungal cell wall component beta-glucan.
  • dectin-1 a lectin family receptor for the fungal cell wall component beta-glucan.
  • TLR3 Toll-like receptor 3
  • TLR3-deficient mice are impaired in their response to dsRNA (L. Alexopoulou, et al., Nature, 413:732-8 (2001)) which is produced by most viruses during their replication and which induces the synthesis of type I interferons (IFN- ⁇ / ⁇ ). Type I IFNs induce anti-viral and immunostimulatory activities in the cells.
  • TLR3 is implicated in the recognition of dsRNA and viruses and the antiviral gene response thereto.
  • TLR4 Toll-like Receptor 4
  • HPS60 and HSP70 heat shock proteins
  • domain A of fibronectins as well as oligosaccharides of hyaluronic acid, heparan sulfate and fibrinogen.
  • HPS60 and HSP70 heat shock proteins
  • oligosaccharides of hyaluronic acid as well as oligosaccharides of hyaluronic acid, heparan sulfate and fibrinogen.
  • these endogenous ligands require very high concentrations to activate TLR4, contamination by LPS is suspected.
  • TLR5 Toll-like Receptor 5
  • flagellin a monomeric constituent of bacterial flagella
  • TLR5 is expressed on the basolateral side of intestinal epithelial cells and intestinal endothelial cells of the subepithelial compartment.
  • flagellin activates lung epithelial cells to induce inflammatory cytokine production and a stop codon polymorphism in TLR5 has been associated with susceptibility to pneumonia caused by the flagellated bacterium Legionella pneumophila.
  • TLR7 and TLR8 are structurally highly conserved proteins, which recognize guanosine- or uridine-rich, single-stranded RNA (ssRNA) from viruses such as human immunodeficiency virus, vesicular stomatitis virus and influenza virus (F. Heil, et al., Science, 303:1526-9 (2004); S. S. Diebold, et al., Science, 303:1529-31 (2004); J. M. Lund, et al., Proc Natl Acad Sci USA, 101:5598-603 (2004)).
  • ssRNA guanosine- or uridine-rich, single-stranded RNA
  • ssRNA is abundant in the host, but usually the host-derived ssRNA is not detected by TLR7 or TLR8. This might be due to the fact that TLR7 and TLR8 are expressed in the endosome, and host-derived ssRNA is not delivered to the endosome (see below).
  • TLR9 Toll-like Receptor 9
  • CpG DNA H. Hemmi, et al., Nature, 408:740-5 (2000).
  • Bacterial and viral DNA contains unmethylated CpG motifs, which confer its immunostimulatory activity. In vertebrates, the frequency of CpG motifs is severely reduced and the cytosine residues of CpG motifs are highly methylated, leading to abrogation of the immunostimulatory activity.
  • B/K-type CpG DNA is a potent inducer of inflammatory cytokines such as IL-12 and TNF- ⁇ ;
  • A/D-type CpG DNA has a greater ability to induce IFN- ⁇ production from plasmacytoid dendritic cells (PDC),
  • PDC plasmacytoid dendritic cells
  • TLR9 is involved in pathogenesis of autoimmune disorders. Thus it may be important in Graves' autoimmune hyperthyroidism and mediates production of rheumatoid factor by auto-reactive B cells (G. A. Viglianti, et al., Immunity, 19:837-47 (2003)).
  • TLR9 mediated PDC induction of IFN- ⁇ by immune complexes containing IgG and chromatin, which are implicated in the pathogenesis of systemic lupus erythematosus (SLE) (M. W. Boule, et al., J Exp Med, 199:1631-40 (2004)).
  • SLE systemic lupus erythematosus
  • TLR9 appears to be involved in the pathogenesis of several autoimmune diseases through recognition of the chromatin structure.
  • Chloroquine which is clinically used for treatment of rheumatoid arthritis and SLE, is currently presumed to block TLR9-dependent signaling through inhibition of the pH-dependent maturation of endosomes by neutralizing acidification in the vesicle (H. hacker, et al., Embo J, 17:6230-40 (1998)),
  • TLR11 Toll-like Receptor 11
  • the most recently identified TLR11 has been shown to be expressed in bladder epithelial cells and mediate resistance to infection by uropathogenic bacteria in mouse (D. Zhang, et al., Science, 303:1522-6 (2004)).
  • TLR9 is recruited from the endoplasmic reticulum upon non-specific uptake of CpG DNA (H.hacker, et al., Embo J, 17:6230-40 (1998); E.
  • TLR ligands such as dsRNA, ssRNA and CpG DNA to TLR9 in the phagosomal/lysosomal or endosomal/lysosomal compartments.
  • TLR-independent Recognition of Micro-organisms dsRNA Transfection De Novo or RNA/DNA Introduction By viruses—Can Nevertheless Activate TLR Signaling Pathways.
  • TLR3 is involved in the recognition of viral-derived dsRNA, the impairment observed in TLR3-deficient mice is only partial (L. Alexopoulou, et al., Nature, 413:732-8 (2001); M. Yamamoto, et al., Science, 301:640-3 (2003)).
  • introduction of dsRNA into the cytoplasm of dendritic cells leads to the induction of type I IFNs independent of TLR3 (S. S. Diebold, et al., Nature, 424:324-8 (2003)).
  • PKR is implicated in dsRNA recognition, it is still controversial if it plays a critical role in dsRNA-induced type I IFN expression (E. J. Smith, et al., J Biol Chem, 276:8951-7 (2001)).
  • RIG-1 encodes a DExD/H box RNA helicase containing a caspase recruitment domain that augments dsRNA-dependent activation of the IRF-3-dependent promoter.
  • nucleotide-binding oligomerization domain (NOD) family of proteins also plays an important role in the TLR-independent recognition of intracellular bacteria.
  • NOD1 contains a caspase-recruitment domain (CARD), a NOD domain and a C-terminal LRR domain.
  • CARD caspase-recruitment domain
  • iE-DAP c-D-glutamyl-meso diaminopimelic acid
  • NOD2 shows structural similarity to NOD1, but possesses two CARD domains and the essential structure recognized by NOD2 is a muramyl dipeptide MurNAc-L-Ala-D-isoGln (MDP) derived from PGN.
  • MDP muramyl dipeptide MurNAc-L-Ala-D-isoGln
  • NOD2 mutations also lead to an increase in NF- ⁇ B activity and are associated with Blau syndrome, a disease characterized by granulomatous arthritis, uveitis and skin rash (C. Miceli-Richard, et al., Nat Genet, 29:19-20 (2001)).
  • Rip2/RICK a serine/threonine kinase
  • Rip has a CARD domain in its C-terminal portion and an N-terminal catalytic domain that shares sequence similarity with Rip, a factor essential for NF- ⁇ B activation through the TNF receptor.
  • NODs and Rip2/RICK interact via their respective CARD domains, and induce recruitment of the IKK complex to the central region of Rip2/RICK. This in turn leads to activation of NF- ⁇ B.
  • TLR Signaling Pathways MyD88 Pathway and NF- ⁇ B/MAP Kinase Signals.
  • MyD88 TIR domain-containing adaptor
  • TLR3 and TLR4 signaling pathways resulted in induction of type I interferons (IFNs), but activation of TLR2-and TLR5-mediated pathways did not (V. Toshchakov, et al., J Endotoxin Res, 9:169-75 (2003); K. Hoshino, et al., Int Immunol, 14:1225-31 (2002); S.
  • TLR7, TLR8 and TLR9 signaling pathways also lead to induction of Type I IFNs through mechanisms distinct from TLR3/4-mediated induction (H. Hemmi, et al., J Immunol, 170:3059-64 (2003); T. Ito, et al., J Exp Med, 195:1507-12 (2002)).
  • TLR3/4-mediated induction H. Hemmi, et al., J Immunol, 170:3059-64 (2003); T. Ito, et al., J Exp Med, 195:1507-12 (2002).
  • MyD88 MyD88-dependent and MyD88-independent pathways.
  • the MyD88-dependent pathway is analogous to signaling by the IL-1 receptors.
  • MyD88 harboring a C-terminal TIR domain and an N-terminal death domain, associates with the TIR domain of TLRs.
  • MyD88 recruits IRAK-4 to TLRs through interaction of the death domains of both molecules, and facilitates IRAK-4-mediated phosphorylation of IRAK-1.
  • Activated IRAK-1 then associates with TRAF6, leading to the activation of two distinct signaling pathways.
  • One pathway leads to activation of AP-1 transcription factors through activation of MAP kinases.
  • Another pathway activates the TAK1/TAB complex, which enhances activity of the I ⁇ B kinase (IKK) complex.
  • IKK I ⁇ B kinase
  • MyD88-dependent pathway plays a crucial role and is essential for inflammatory cytokine production through all TLRs.
  • MyD88-deficient mice do not show production of inflammatory cytokines such as TNF- ⁇ and IL-12p40 in response to all TLR ligands (F. Hayashi, et al., Nature, 410:1099-103, (2001); H. Hemmi, et al., Nat Immunol, 3:196-200 (2002); O. Takeuchi, et al., Int Immunol, 12:113-7 (2000); T.
  • TIRAP TIR domain-containing adaptor protein
  • Mal MyD88-adaptor-like
  • TIRAP/Mal-deficient macrophages show impaired inflammatory cytokine production in response to TLR4 and TLR2 ligands (T. Horng, et al., Nature, 420:329-33 (2002); M. Yamamoto, et al., Nature, 420:324-9 (2002)) but are not impaired in their response to TLR3, TLR5, TLR7 and TLR9 ligands,
  • TLR3-and TLR4-mediated signaling pathways activation of IRF-3 and induction of IFN- ⁇ are observed in a MyD88-independent manner.
  • the TIR domain-containing adaptor, TRIF is essential for the MyD88-independent pathway; however, in the case of TLR4, but not TLR3, the TIR domain-containing adaptor, TRAM, is also involved in the TRIF-dependent activation of IRF-3 and induction of IFN- ⁇ -and IFN-inducible genes pathway as evidenced in TRAM-deficient mice or by RNAi-mediated knockdown (K. A. Fitzgerald, et al., J Exp Med, 198:1043-55 (2003); M. Yamamoto, et al., Nat Immunol, 4:1144-50 (2003); H. Oshiumi, et al., J Biol Chem, 278:49751-62 (2003)).
  • Non-typical IKKs, IKKi/IKKe and TBK1 mediate activation of IRF-3 downstream of TRIF as well as the late phase of NF- ⁇ B activation in a MyD88-independent manner (T. Kawai, et al., J Immunol, 167:5887-94 (2001)).
  • Activation of IRF-3 leads to production of IFN- ⁇ .
  • IFN- ⁇ in turn activates Stat1 and induces several IFN-inducible genes (V. Toshchakov, et al., J Endotoxin Res, 9:169-75 (2003); K. Hoshino, et al., Int Immunol, 14:1225-31 (2002); S.
  • IRF-3 activation Key molecules that mediate IRF-3 activation have been revealed to be non-canonical IKKs, TBK1 and IKKi/IKKe.
  • TIR domain of TRIF The TIR domain of TRIF is located in the middle portion of this molecule, flanked by the N-terminal and C-terminal portions. Both N-terminal and C-terminal portions of TRIF mediate activation of the NF- ⁇ B-dependent promoter, whereas only the N-terminal portion is involved in IFN- ⁇ promoter activation (M. Yamamoto, et al., J Immunol, 169:6668-72 (2002)).
  • TRIF N-terminal portion of TRIF was shown to associate with IKKi/IKKe and TBK1, which mediate IRF-3-dependent IFN- ⁇ induction (K. A. Fitzgerald, et al., Nat Immunol, 4:491-6 (2003); S. Sato, et al., J Immunol, 171:4304- 10 (2003)).
  • the N-terminal portion of TRIF was also shown to associate with TRAF6 (S. Sato, et al., J Immunol, 171:4304-10 (2003); Z. Jiang, et al., Proc Natl Acad Sci USA, 101:3533-8 (2004)); TRAF6 is critically involved in TLR-mediated NF- ⁇ B activation (J.
  • RIP1 was shown to be responsible for NF- ⁇ B activation that originates from the C-terminal portion of TRIF.
  • TLR signaling pathways are negatively regulated by several molecules.
  • IRAK-M inhibits dissociation of IRAK-1/IRAK-4 complex from the receptor.
  • MyD88s blocks association of IRAK-4 with MyD88.
  • SOCS1 is likely to associate with IRAK-1 and inhibits its activity.
  • TRIAD3A induces ubiquitination-mediated degradation of TLR4 and TLR9.
  • TIR domain-containing receptors SIGIRR and T1/ST2 are also shown to negatively modulate TLR signaling.
  • several molecules are postulated to negatively modulate TLR signaling pathways and in combination may normally finely coordinate the TLR signaling pathway to limit exaggerated innate responses causing harmful disorders.
  • LPS tolerance Exposure to microbial components such as LPS results in a severely reduced response to a subsequent challenge by LPS, termed endotoxin or LPS tolerance.
  • endotoxin or LPS tolerance Several negative regulation mechanisms are also shown to be involved in LPS tolerance (H. Fan, et al., J Endotoxin Res, 10:71-84 (2004)).
  • IRF-1 autoimmune-inflammatory diseases
  • Arthritis A. Shiraishi, et al., J Immunol, 159:3549-54 (1997); T. Inoue, et al., J Rheumatol, 28:1229-37 (2001); S. John, et al., J Rheumatol, 28:1752-5 (2001)
  • colitis M. Clavell, et al., J Pediatr Gastroenterol Nutr, 30:43-7 (2000)
  • neurological inflammation M.
  • IRF-1 IRF-1 is implicated in patients with, autoimmune myocarditis associated with viral infection in human and in rodent models (K. Bachmaier, et al., Circulation, 96:585-91 (1997)).
  • IRF-1 can up-regulate the inflammatory immune response at the innate and adaptive level by increasing the inflammatory gene expression in macrophages, dendritic cells and CD-4 T cells.
  • upregulation of IRF-1 gene expression can increase the expression of inflammatory mediators such as arachidonic acid signaling, COX-1 and, COX-2 enzymes (X. Teng, et al., Am J Physiol Cell Physiol, 282:C144-52, (2002)), chemokines (M. S. Baker, et al., Surgery, 134:134-41 (2003); Y. Ohmori, et al., J Leukoc Biol, 69:598-604 (2001)), iNOS (M.
  • IRF-1 gene overexpression may thus induce autoimmune-inflammatory diseases by its effects on macrophages, dendritic cells and CD4 ⁇ Th1 cell lymphocytic cells.
  • Leukocyte adhesion is central to atherosclerosis, an autoimmune-inflammatory disease.
  • leukocytes monocytes and lymphocytes
  • This process occurs through a cascade of adhesive events.
  • This adhesion cascade is mediated, in part, by binding of molecules present on the surface of the leukocyte (e.g. ⁇ 1 integrins) to adhesion molecules on the surface of the endothelium (e.g VCAM-1).
  • the monocyte-derived macrophages ingest lipids and become foam cells.
  • Activation of the recruited leukocytes is believed to induce release of important mediators of inflammation (e.g. pro-inflammatory cytokines) that serve to continue the process of lesion development.
  • Smooth muscle cells are recruited to the fatty spot and, together with the foam cells and lymphocytes, form the fatty streak (intermediate lesion). This entire process can continue leading to a fibrofatty lesion and ultimately to a fibrous plaque.
  • the vascular endothelium remains intact. Since the mechanisms of atherogenesis are similar to those present in “general” pathological inflammation, atherosclerosis is often considered a disease of pathological inflammation.
  • ECAMs Endothelial cell adhesion molecules
  • VCAM-1 Endothelial cell adhesion molecules
  • ICAM-1 Endothelial cell adhesion molecules
  • Monocytes exhibit greatly increased adhesion to carotid arteries isolated from ApoE ⁇ / ⁇ mice compared to carotid arteries isolated from wild-type mice and this increased adhesion is mediated, in part, by VCAM-1 (C. L. Ramos, et al., Circ. Res., 84:1237-44 (1999)).
  • ECAMs The expression of ECAMs is regulated, in part, by pro-inflammatory cytokines (e.g. TNF- ⁇ ) which increase the activity of certain transcription factors (e.g. NF- ⁇ B) (M. J. May, et al., Immunol. Today, 19:80-88 (1998)) and IRF-1 (A. S. Neish, et al., Mol. Cell Biol., 15:2558-2569 (1995)).
  • TNF- ⁇ pro-inflammatory cytokines
  • IRF-1 A. S. Neish, et al., Mol. Cell Biol., 15:2558-2569 (1995)
  • the activated or increased transcription factors bind to promoter elements on the ECAM genes.
  • Several current or potential therapeutics for pathological inflammation work, at least in part, by modulating the activity of transcription factors to inhibit leukocyte adhesion to the endothelium and reduce inflammation in animal models (E. M.
  • One such group includes methimazole, methimazole derivatives, and tautomeric cyclic thiones (Kohn, L. D., et al., U.S. Pat. No. 6,365,616 Apr. 2, (2002.); Kohn, L. D., et al., U.S. patent application Ser. No. 10/801,986, (2004)).
  • C10 phenylmethimazole
  • pro-inflammatory e.g TNF- ⁇
  • C10 (i) inhibits monocytic cell adhesion to cytokine inflamed human aortic endothelial cells (HAEC) under in vitro flow conditions that mimic conditions present in vivo; (ii) strongly inhibits cytokine-induced HAEC expression of VCAM-1 at the protein and mRNA level; (iii) has a modest effect on E-selectin expression; and (iv) has very little effect on ICAM-1 expression.
  • HAEC cytokine inflamed human aortic endothelial cells
  • the VCAM-1 promoter contains several cis elements known to play a role in TNF- ⁇ induced human VCAM-1 expression: NF- ⁇ B, AP-1, SP-1, IRF-1 and GATA.
  • TNF- ⁇ stimulation of endothelial cells activates NF- ⁇ B (M. J. May, et al., Immunol. Today, 19:80-88 (1998)); however, C10 does not appear to have any effect on NF- ⁇ B translocation to the nucleus or binding to the VCAM-1 promoter (N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)).
  • IRF-1 is present at a very low level in resting endothelial cells; however, upon stimulation with TNF- ⁇ , IRF-1 is induced, binds to the VCAM-1 promoter, and is necessary for full cytokine-induced transcriptional activation (A. S. Neish, et al., Mol. Cell Biol., 15:2558-2569 (1995); N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)). C10 inhibits TNF- ⁇ induced IRF-1 expression at the protein and mRNA level.
  • VCAM-1 VCAM-1-binding protein
  • the mechanism of TNF- ⁇ induction of IRF-1 in endothelial cells involves Stat1.
  • the IRF-1 promoter region contains two NF- ⁇ B binding sites and an activated Stat1-GAS binding sequence (Y. Ohmori, et al., J Biol Chem, 272:14899-907 (1997); H. Ochi, et al., Eur J Immunol, 32:1821-31 (2002)).
  • TNF- ⁇ -activated NF- ⁇ B is directly involved in the activation of IRF-1 gene transcription, NF- ⁇ B is, insufficient for full expression and requires Stat1 occupation of the GAS site.
  • Stat1 could be increased by indirect or direct means.
  • TNF- ⁇ could induce IRF-1 promoter activity by its effect on NF- ⁇ B, an increase in type I IFN, and the autocrine/paracrine activation of Type I IFN on Stat1 (O. Tliba, et al., J Biol Chem, 278:50615-23 (2003))
  • TNF- ⁇ may directly activate Stat1 since (H.
  • cycloheximide a protein synthesis inhibitor
  • TLRs in inflammatory-autoimmune disorders. For example, constitutive activation of immune cells caused by defective IL-10 signaling results in development of chronic enterocolitis (K. Takeda, et al., Immunity, 10:39-49 (1999)). Introduction of TLR4 deficiency into these mutant mice results in improvement of intestinal inflammation (M. Kobayashi, et al., J Clin Invest, 111:1297-308 (2003)). Development of atherosclerosis observed in apolipoprotein E-deficient mice is rescued by introduction of MyD88 deficiency, implicating the TLR-mediated pathway in the development of atherosclerosis (K. S.
  • TLR3/TLR4 and TLR3/TLR4 Signals in Nonimmune Cells as well as Monocytes, Macrophages, and Dendritic Cells are Associated with Autoimmune-inflammatory Diseases.
  • Multiple autoimmune inflammatory diseases are now associated with overexpressed TLR3 and TLR4 and or their signals in nonimmune cells, monocytes, macrophages, and dendritic cells.
  • TLR3/TLR3 signaling these include Hashimoto's thyroiditis and Type 1 diabetes; in the case of TLR4/TLR4 signaling these include ulcerative colitis, Crohn's, atherosclerosis, and toxic shock.
  • TLR3/4 or TLR3/4 signaling is not limited to these disorders and includes any disease where TLR signaling is activated and increases type I IFNs or cytokine-increased ECAM expression and leukocyte adhesion, e.g., systemic lupus, rheumatoid arthritis, or any autoimmune-inflammatory disease.
  • TLR3 on dendritic cells recognize dsRNA, then signal increases in cytokines and recognition molecules important for immune cell interactions.
  • TLR3 mRNA and protein are now recognized to be expressed on thyrocytes and associated with Hashimoto's thyroiditis (N. Harii, et al., Mol Endocrinol, 19:1231-50 (2005)).
  • TLR3 are functional, since incubating thyroid cells with Poly (I:C) causes (i) transcriptional activation of both the NF- ⁇ B/Elk1 and IRF-3/IFN- ⁇ signal paths, (ii) post transcriptional activation of NF- ⁇ B and ERK1/2, and (iii) increased IFN- ⁇ mRNA.
  • TLR3 can be overexpressed, along with PKR, major histocompatibility complex (MHC)-I or II, and IRF-1, by transfecting dsRNA into the cells, infection with Influenza A virus, or incubation with IFN- ⁇ , but not by incubation with dsRNA or IFN-gamma, or by dsDNA transfection.
  • MHC major histocompatibility complex
  • TLR3 can be functionally overexpressed in cultured human thyrocytes by dsRNA transfection or IFN- ⁇ treatment. Immunohistochemical studies show TLR3 protein is overexpressed in human thyrocytes surrounded by immune cells in 100% of patients with Hashimoto's thyroiditis examined, but not in normal or Graves' thyrocytes.
  • TLR3 functional TLR3 are present on thyrocytes; TLR3 downstream signals can be overexpressed by pathogen-related stimuli; overexpression can be reversed by C10>>MMI by inhibiting only the IRF-3/IFN- ⁇ /STAT arm of the TLR3 signal system; and TLR3 overexpression can induce an innate immune response in thyrocytes which may be important in the pathogenesis of Hashimoto's thyroiditis and in the immune cell infiltrates.
  • Hashimoto's thyroiditis the most frequent tissue-specific autoimmune disease in humans, is characterized by infiltration of the thyroid gland by B and T lymphocytes, cellular and humoral autoimmunity, and autoimmune destruction of the thyroid (C. M. Dayan, et al., N Engl J Med, 335:99-107 (1996)).
  • Thyrocytes of patients with Hashimoto's thyroiditis express ICAM-1, B7-1, essential co-stimulatory molecules important for immune cell interactions, major histocompatibility complex (MHC) class I, interferon (IFN) inducible protein IP-10, a CXCL chemokine that exerts a chemotactic activity on lymphoid cells, and Fas gene, a member of the closely linked group of tumor necrosis factor genes (G. Pesce, et al., J Endocrinol Invest, 25:289-95 (2002); M. A. Garcia-Lopez, et al., J Clin Endocrinol Metab, 86:5008-16 (2001)).
  • MHC major histocompatibility complex
  • IFN interferon
  • IP-10 interferon inducible protein IP-10
  • Fas gene a member of the closely linked group of tumor necrosis factor genes
  • TLR4 Endotoxic Shock.
  • C3H/HeJ mice have a point mutation in the Tlr4 gene that results in defects in TLR4 signaling and hypo-responsiveness to challenge with LPS (K. Hoshino, et al., J Immunol, 162:3749-52 (1999)).
  • Recent work (G. Andonegui, et al., J Clin Invest, 111:1011-1020 (2003)) found strong evidence that endothelial TLR4, as opposed to leukocyte TLR4, is a critical player in endotoxic shock.
  • mice deficient in endothelial TLR4, but not leukocyte TLR4 had significantly attenuated leukocyte sequestration in the lungs subsequent to challenge with LPS
  • LPS stimulated genes in cultured murine macrophages include genes coding for proinflammatory cytokines (IFN- ⁇ IL-1 ⁇ , TNF- ⁇ , IL-6, and IL-12), which act on either the macrophages/monocytes themselves or on other target cells to regulate the inflammatory process, which occurs in septic shock.
  • proinflammatory cytokines IFN- ⁇ IL-1 ⁇ , TNF- ⁇ , IL-6, and IL-12
  • macrophages Upon stimulation with LPS, macrophages can also produce CXC chemokines such as IP-10, which serve to further attract immune cells to a site of inflammation (K. M. Kopydlowski, et al., J Immunol, 163:1537-44 (1999)). Macrophages stimulated with LPS can also produce nitric oxide (NO) as a result of expression of the inducible nitric oxide synthase enzyme (iNOS) (C. Bogdan, Nat Immunol, 2:907-16 (2001)).
  • NO nitric oxide
  • iNOS inducible nitric oxide synthase enzyme
  • IFN- ⁇ binding to the type I interferon receptor results in phosphorylation of Stat I as a key component for the transduction of a signal to the nucleus to induce expression of iNOS and IP-10 in the mouse macrophage (Y. Ohmori, et al., J Leukoc Biol, 69:598-604 (2001)).
  • Stat1 null animals show an approximately 50% enhanced survival rate when challenged with a lethal dose of LPS (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)) whereas IFN- ⁇ null mice challenged with a lethal LPS dose showed a 100% enhancement of survival (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)) Therefore, blocking parts of the IFN- ⁇ signal pathway is not as effective as blocking the pathway completely.
  • IRF-1 Interferon Response factor-1
  • iNOS Interferon Response factor-1-1
  • IRF-1 target genes such as the interferon inducible MX gene which codes for the antiviral Mx protein (D. Danino, et al., Curr Opin Cell Biol, 13:454-60 (2001)).
  • the MX promoter has been shown to contain strong IRF- 1 binding elements (C. E. Grant, et al., Nucleic Acids Res, 28:4790-9 (2000)).
  • the proinflammatory cytokines IL-1 ⁇ , TNF- ⁇ , IL-6, and IL-12 can be induced by LPS signaling through TLR4 (M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14 (2002)) and play a role in endotoxic shock (N. C. Riedemann, et al., J Clin Invest, 112:460-7 (2003)).
  • IFN- ⁇ as a critical secondary effector, which is induced upon LPS activation of TLR4 signaling and contributes to mortality in a murine septic shock model (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)).
  • Inflammatory Bowel Disease IBD. TLR4 and components of normal gastrointestinal gram-negative bacteria appear to play a key role in the pathogenesis of colitis (C. Fiocchi, Gastroenterology, 115:182-205 (1998); E. Cario, et al., Infect Immun, 68:7010-7 (2000)).
  • the disease is associated with severe inflammation, edema, and leukocyte infiltration in the colonic tissues(C. Fiocchi, Gastroenterology, 115:182-205 (1998); E. Cario, et al., Infect Immun, 68:7010-7 (2000); U. P. Singh, et al., J Immunol, 171:1401-6 (2003); M. B.
  • IFN interferon
  • ECAMs endothelial cell adhesion molecules
  • chemokine levels such as IP-10 which is known to be colitis related (U. P. Singh, et al., J Immunol, 171:1401-6 (2003)).
  • Enterocolitis was reported to be significantly improved in TLR4/Stat3-deficient mice, whereas TNF- ⁇ /Stat3 deficient mice still had severe enterocolitis, also indicating the importance of TLR4 in mouse models of enterocolitis (M. Kobayashi, et al., J Clin Invest, 111:1297-308 (2003)).
  • TLR4 the Vascular Complications of Types 1 and 2 Diabetes, Obesity, and Hypertension: Recent studies have demonstrated the importance of TLR4 in the initiation and progression of atherosclerosis (K. S. Michelsen, et al., Proc Natl Acad Sci USA, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); G. Andonegui, et al., J Clin Invest, 111:1011-1020 (2003)). Thus, mouse knockout studies and studies of human TLR4 polymorphisms have demonstrated that TLR4 plays a role in the initiation and progression of atherosclerosis and vascular disease. Further, (K. S. Michelsen, et al., Proc Natl Acad Sci USA, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); G. Andonegui, et al., J Clin
  • mice deficient in endothelial cell TLR4 had a significant reduction in aortic plaque development in atherosclerosis-prone apolipoprotein E-deficient (ApoE ⁇ / ⁇ ) mice and the lack of TLR4 signaling can result in reduced monocyte adhesion to TLR4 ⁇ / ⁇ endothelium.
  • Type 1 Diabetes A recent report has associated overexpressed TLR3 in pancreatic ⁇ cells and destructive changes in Type 1 diabetes (L. Wen, et al., J Immunol, 172:3173-80 (2004)). Moreover, the report showed dsRNA could induce insulinitis and type 1 diabetes in animals, consistent with the known animal model wherein coxsacki virus induces Type 1 diabetes in NOD mice. Devendra and Eisenbarth (D.
  • Type I diabetes appears to require a permissive genetic background and an external factor which may be viral.
  • Islet cell antibodies are common in the first months of the disease. They probably arise in part due to ⁇ cell injury and represent a primary autoimmune disease.
  • the preeminent metabolic abnormality in Type 1 diabetes is hyperglycemia and glucosuria. Late complications of diabetes are numerous and include increased atherosclerosis with attendant stroke and heart complications, kidney disease and failure, and neuropathy that can be totally debilitating.
  • the link to HLA antigens has been known since 1970. Certain HLA alleles are associated with increased frequency of disease, others with decreased frequency. Increased MHC class I and aberrant MHC class II expression in islet cells has been described (G. F.
  • MHC class I deficiency results in resistance to the development of diabetes in the NOD mouse (D. V. Serreze, et al., Diabetes, 43:505-9 (1994); L. S. Wicker, et al., Diabetes, 43:500-4 (1994)).
  • TLR signaling pathway and its pathologic expression in nonimmune cells represents an intriguing link between viral agents and autoimmune-inflammatory disease.
  • multiple viruses have been linked to type 1 diabetes, (e.g., Coxsackie B4 virus) (J. Guardiola, et al., Crit Rev Immunol, 13:247-68 (1993); R. Gianani, et al., Proc Natl Acad Sci USA, 93:2257-9 (1996); M. S. Horwitz, et al., Nat Med, 4:781-5 (1998); H. Wekerle, Nat Med, 4:770-1 (1998); C.
  • type 1 diabetes e.g., Coxsackie B4 virus
  • Cigarette smoking enhances a diabetic's chance of having high blood pressure, high levels of lipids such as triglycerides, and lower levels of the protective HDL cholesterol. Cigarette smoking may thus act in concert with other environmental triggers, such as oobesity or infectious agents, and can be construed as a major and related environmental factor in the development of diabetes and its complications.
  • Hashimoto's thyroiditis may be grouped with insulinitis and Type 1 diabetes, colitis, toxic shock, and atherosclerosis as an autoimmune/inflammatory disease associated with TLR3 or TLR4 overexpression and signaling in nonimmune cells, monocytes, macrophages, and dendritic cells by an induction process involving molecular signatures of environmental pathogens (K. S. Michelsen, et al., Proc Natl Acad Sci USA, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L.
  • the present invention provides for the use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with TLR3 or TLR4 overexpression and signaling in nonimmune cells as well as monocytes, macrophages, and dendritic cells. It additionally provides for the use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with pathologic activation of TLR signaling involving activation of IRF-3, synthesis of Type 1 IFN, activation of STATs, increased IRF-1 gene expression, and activation of proteins with ISRE elements.
  • the present invention relates to the treatment of autoimmune and/or inflammatory diseases associated with overexpression of toll-like receptor 3 as well as toll-like receptor 4, and or their signals, in nonimmune cells, as well as monocytes, macrophages, or dendritic cells, and related pathologies.
  • This invention also relates to the use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune and inflammatory diseases associated with overexpression of toll-like receptor 3 as well as toll-like receptor 4, and or their signals, in nonimmune cells, as well as monocytes, macrophages, or dendritic cells, and related pathologies.
  • This invention also relates to treating a subject having a disease or condition associated with abnormal toll-like receptor 3 as well as toll-like receptor 4, and or their signals, in nonimmune cells, as well as in monocytes, macrophages, or dendritic cells.
  • the present invention provides for methods of treating a TLR mediated disease involving activation of, or pathologic signaling of, IRF-3. In another embodiment, the present invention provides for methods of treating a disease involving overexpression or pathologic signaling Type 1 interferons. In another embodiment, the present invention provides for methods of treating a TLR mediated disease involving overexpression or pathologic signaling of ISRE containing genes. In another embodiment, the present invention provides for methods of treating a TLR mediated disease involving overexpression or pathologic signaling of IRF-1. In another embodiment, the present invention provides for methods of treating a TLR mediated disease involving activation of, or pathologic signaling by Stat1 or Stat3.
  • the present invention provides for methods of treating a disease involving activation of, or pathologic expression, of the TLR signal pathway resulting in activation of IRF-3. In another embodiment, the present invention provides for methods of treating a disease involving overexpression or pathologic expression of the TLR signal pathway resulting in the synthesis of Type 1 interferons. In another embodiment, the present invention provides for methods of treating a disease involving overexpression or pathologic signaling of the TLR signal pathway resulting in the activation of ISRE containing genes. In another embodiment, the present invention provides for methods of treating a disease involving pathologic expression of the TLR signal pathway resulting in overexpression of IRF-1. In another embodiment, the present invention provides for methods of treating a disease involving activation of, or pathologic expression of the TLR signal pathway resulting in activation of Stat1 or Stat3.
  • the present invention provides for methods of treating a TLR-mediated disease or disorder in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the present invention provides for methods of treating a TLR-mediated disease or disorder involving a pathological condition resulting from abnormal cell proliferation; transplantation rejection, autoimmune, inflammatory, proliferative, hyperproliferative, or cardiovascular disease in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the present invention provides for methods of treating a subject having a TLR-mediated autoimmune-inflammatory disease, or a predisposition to a TLR-mediated autoimmune-inflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition of the present invention.
  • the TLR-mediated autoimmune-inflammatory disease is Alopecia, Areata, Ankylosing Spondylitis, Antiphospholipid Syndrome, Autoimmune Addison's Disease, Autoimmune Hemolytic Anemia, Autoimmune Hepatitis, autoimmune blepharitis, Behcet's Disease, Bullous Pemphigoid, Cardiomyopathy, Celiac Sprue-Dermatitis, Chronic Fatigue Immune Dysfunction Syndrome (CFIDS), Chronic Inflammatory Demyelinating Polyneuropathy, Churg-Strauss Syndrome, Cicatricial Pemphigoid, CREST Syndrome, Cold Agglutinin Disease, Crohn's Disease, Discoid Lupus, Essential Mixed Cryoglobulinemia, Fibromyalgia-Fibromyositis, Graves' Disease, Guillain-Barre, Hashimoto's Thyroiditis, Post partum thyroiditis, Idiopathic Pulmonary Fibrosis, Idiopathic Pulmon
  • the TLR-3 mediated autoimmune-inflammatory disease is Insulin-dependent Diabetes.
  • the present invention provides for methods of treating a TLR-mediated disease in nonimmune cells or disorder in a patient in need thereof.
  • the present invention provides for methods of treating a TLR-mediated autoimmune-inflammatory disease or disorder in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the present invention provides for methods of treating a TLR-mediated autoimmune-inflammatory disease or disorder involving nonimmune cells in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the present invention provides for methods of treating a TLR-mediated autoimmune-inflammatory disease or disorder associated with immune cell infiltration and destruction of the nonimmune cells in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the present invention provides for methods of treating a TLR-mediated disease or disorder involving a pathologic innate immune response in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones.
  • the TLR-mediated disease or disorder is a pathological condition resulting from abnormal cell proliferation; transplantation rejections, autoimmune, inflammatory, proliferative, hyperproliferative, or cardiovascular diseases.
  • the cardiovascular disease or disorder is restenosis, coronary artery disease, atherosclerosis, atherogenesis, cerebrovascular diseases or events, coronary events, angina, ischemic disease, congestive heart failure, pulmonary edema associated with acute myocardial infarction, thrombosis, high or elevated blood pressure in hypertension, platelet aggregation, platelet adhesion, smooth muscle cell proliferation, a vascular or non-vascular complication associated with the use of a medical device, a wound associated with the use of a medical device, vascular or non-vascular wall damage, peripheral vascular disease or neoinitimal hyperplasia following percutaneous transluminal coronary angiograph.
  • the cerebrovascular disease or event is a cerebral infarction or stroke (caused by vessel blockage or hemorrhage), or transient ischemia attack (TIA), syncope, or atherosclerosis of the intracranial and/or extracranial arteries, and the like.
  • the coronary event is a myocardial infarction, myocardial revascularization procedures, angina, cardiovascular death or acute coronary syndrome.
  • the present invention provides for a method of ameliorating one or more symptoms of atherosclerosis in a mammal, said method comprising administering to said mammal a methimazole derivative and/or tautomeric cyclic thione in an amount sufficient to ameliorate one or more symptoms of atherosclerosis.
  • the present invention provides for a method of ameliorating one or more symptoms of myocardial diseases in a mammal, said method comprising administering to said mammal a methimazole derivative and/or tautomeric cyclic thione in an amount sufficient to ameliorate one or more symptoms of myocardial diseases.
  • the myocardial diseases have inflammatory and immunological properties.
  • the myocardial disease is coronary heart disease, reversible or irreversible myocardial ischemia/reperfusion damage, acute or chronic heart failure and restenosis.
  • the present invention provides for a method of mitigating or preventing a coronary complication associated with an acute phase response to an inflammation in a mammal, wherein said coronary complication is a symptom of atherosclerosis, said method comprising administering to a mammal having said acute phase response, or at risk for said acute phase response, a methimazole derivative and/or tautomeric cyclic thione in an amount sufficient to mitigate or prevent said coronary complication.
  • the present invention provides for a method of mitigating or preventing an acute phase response.
  • the acute phase response is an inflammatory response associated with a recurrent inflammatory disease.
  • the acute phase response is associated with a disease selected from the group consisting of leprosy, tuberculosis, systemic lupus erythematosus, polymyalgia rheumatica, polyarteritis nodosa, scleroderma, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, Alzheimer's Disease AIDS, coronary calcification, calcific aortic stenosis, osteoporosis, and rheumatoid arthritis.
  • a disease selected from the group consisting of leprosy, tuberculosis, systemic lupus erythematosus, polymyalgia rheumatica, polyarteritis nodosa, scleroderma, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, Alzheimer's Disease AIDS, coronary calcification, calcific aortic stenos
  • the acute phase response is an inflammatory response associated with a condition selected from the group consisting of a bacterial infection, a viral infection, a fungal infection, an organ transplant, a wound, an implanted prosthesis, parasitic infection, sepsis, endotoxic shock syndrome, and biofilm formation.
  • the present invention provides for methods of treating a TLR-mediated autoimmune-inflammatory disease or disorder associated with immune cell infiltration and destruction of the nonimmune cells in a patient in need thereof, the method comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones to a mammal in an amount or mixture effective for treating one or more conditions selected from the group consisting of septic shock, sepsis, endotoxic shock, hemodynamic shock and sepsis syndrome, post ischemic reperfusion injury, malaria, mycobacterial infection, meningitis, psoriasis, congestive heart failure, fibrotic disease, cachexia, graft rejection, cancer, autoimmune disease, opportunistic infections in AIDS, rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis, other arthritic conditions, Crohn's disease, ulcerative colitis, inflammatory
  • the TLR-mediated autoimmune/inflammatory disease or disorder is an acute inflammatory disease.
  • the TLR-mediated autoimmune/inflammatory disease or disorder is an acute inflammatory disease selected from the group consisting of: (a) endotoxemia or (b) toxic shock syndrome associated with (c) septicemia; and (d) infectious disease.
  • the TLR-mediated autoimmune/inflammatory disease or disorder is selected from septic shock of whatever type, etiology, or pathogenesis; or septic shock that is a associated with renal failure; acute renal failure; cachexia; malarial cachexia; hypophysial cachexia; uremic cachexia; cardiac cachexia; cachexia suprarenalis or Addison's disease; cancerous cachexia; and cachexia as a consequence of infection by the human immunodeficiency virus (HIV).
  • the septic shock is endotoxic shock.
  • the endotoxic shock is induced by gram negative bacteria.
  • the endotoxic shock is induced by gram positive bacteria.
  • the septic shock is LPS-induced shock.
  • the toxic shock, septic shock, endotoxemia, endotoxic shock or LPS-induced toxic shock syndrome is associated with a disease wherein an antibiotic is being administered to the subject.
  • the present invention provides for methods of treating a TLR3-mediated pathological condition resulting from or in abnormal cell proliferation, a transplant rejection, an autoimmune, inflammatory, proliferative, hyperproliferative or vascular disease, for reducing scar tissue or for inhibiting wound contraction in a patient in need thereof comprising administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones to a subject in need of such therapy.
  • the pathological condition resulting from abnormal cell proliferation is a cancer, a Karposi's sarcoma, a cholangiocarcinoma, a choriocarcinoma, a neoblastoma, a Wilm's tumor, Hodgkin's disease, a melanoma, multiple myelomas, a chronic lymphocytic leukemia or an acute or chronic granulocytic lymphoma.
  • the autoimmune, inflammatory, proliferative, hyperproliferative or vascular disease is rheumatoid arthritis, restenosis, lupus erythematosus, systemic lupus erythematosus, Hashimoto's thyroiditis, myasthenia gravis, diabetes mellitus, uveitis, nephritic syndrome, multiple sclerosis, an inflammatory skin disease, an inflammatory lung disease, an inflammatory bowel disease, an inflammatory disease that affects or causes obstruction of a body passageway, an inflammation of the eye, nose or throat, a fungal infection or a food related allergy.
  • the present invention provides for methods of treating a TLR3-mediated pathological condition resulting from an allergen. In another embodiment, the present invention provides for methods of treating a TLR3-mediated pathological condition resulting in an allergy.
  • the present invention provides for methods of treating a TLR3/4-mediated disease, disorder or condition caused by is asthma, chronic bronchoconstriction, acute bronchoconstriction, bronchitis, small airways obstruction, emphysema, obstructive airways disease, inflammatory airways disease, acute lung injury or bronchiectasis.
  • the asthma is atopic asthma; non-atopic asthma; allergic asthma; atopic bronchial IgE-mediated asthma; bronchial asthma; essential asthma; true asthma; intrinsic asthma caused by pathophysiologic disturbances; extrinsic asthma caused by environmental factors; essential asthma of unknown or unapparent cause; bronchitic asthma; emphysematous asthma; exercise-induced asthma; allergen induced asthma; cold air induced asthma; occupational asthma; infective asthma caused by bacterial, fungal, protozoal or viral infection; non-allergic asthma; incipient asthma; whez infant syndrome; or bronchiolytis.
  • the present invention provides for methods of treating a TLR3-mediated pathological condition resulting from an obstructive airways disease or inflammatory airways disease.
  • the obstructive airways disease or inflammatory airways disease is chronic eosinophilic pneumonia, chronic obstructive pulmonary disease (COPD), COPD that includes chronic bronchitis, pulmonary emphysema or dyspnea associated or not associated with COPD, COPD that is characterized by irreversible, progressive airways obstruction, adult respiratory distress syndrome (ARDS), exacerbation of airways hyper-reactivity consequent to other drug therapy or airways disease that is associated with pulmonary hypertension.
  • COPD chronic osinophilic pneumonia
  • COPD chronic obstructive pulmonary disease
  • COPD that includes chronic bronchitis, pulmonary emphysema or dyspnea associated or not associated with COPD
  • COPD that is characterized by irreversible, progressive airways obstruction, adult respiratory distress syndrome (ARDS),
  • the obstructive airways disease or inflammatory airways disease is bronchitis.
  • the bronchitis is chronic bronchitis, acute bronchitis, acute laryngotracheal bronchitis, arachidic bronchitis, catarrhal bronchitis, croupus bronchitis, dry bronchitis, infectious asthmatic bronchitis, productive bronchitis, staphylococcus bronchitis, streptococcal bronchitis or vesicular bronchitis.
  • the bronchiectasis is cylindric bronchiectasis, sacculated bronchiectasis, fusiform bronchiectasis, capillary bronchiectasis, cystic bronchiectasis, dry bronchiectasis or follicular bronchiectasis.
  • the present invention provides for methods of treating an autoimmune or inflammatory disease associated with Toll-like receptor 3 overexpression resulting from other inflammation inducing conditions that may be treated to ameliorate symptoms associated with inflammation or to diminish the existing inflammation.
  • the other inflammation or irritation associated therewith may be from a variety of sources either physical or chemical and may include: insect bites or stings, contact with a particular type plant (e.g., poison oak, etc.), radiation (e.g., U.V.), non-infectious conjunctivitis, hemorrhoids (acute), abrasions, ingrown finger or toenail (granulation), skin graft donor sites, vaginitis, psoriasis, herpes simplex (cold sores, aphthous ulcers), pruritis ani/cruri, chemical inflammation, and the like.
  • the present invention provides for methods of treating an autoimmune or inflammatory disease associated with Toll-like receptor 3/4 overexpression resulting from other inflammation inducing conditions that may be treated to ameliorate symptoms associated with inflammation or to diminish the existing inflammation wherein the inflammation is the result of extraneously induced damage to cells or tissue.
  • damage may be induced by chemical and/or physical influences upon the skin or mucus membranes of humans and animals. Examples of physical influences are infarction, heat, cold, radiation and electrical shock, and examples of chemical influences are contact with acids, bases and allergens.
  • Inflammation may be induced by microorganisms or their molecular signature molecules acting on the skin, as well as being the result of microorganisms invading the human or animal body.
  • the inflammatory responses that may be ameliorated may be on the skin or a mucus membrane of a subject and includes, but is not limited to, conditions such as inflammation around erupting wisdom teeth, following extraction of teeth, periodontal abscesses, prosthesis induced pressure sores on the mucosa, fungal infections, for treating exposed bone surface in alveolitis sicca dolorosa, which is a painful condition which may arise following extraction of teeth, chronic and acute inflammatory diseases including, but not limited to, pancreatitis, rheumatoid arthritis, osteoarthritis, asthma, inflammatory bowel disease, psoriasis and in certain neurological disorders such as Alzheimer's disease.
  • conditions such as inflammation around erupting wisdom teeth, following extraction of teeth, periodontal abscesses, prosthesis induced pressure sores on the mucosa, fungal infections, for treating exposed bone surface in alveolitis sicca dolorosa, which is a painful condition which may arise following extraction of teeth, chronic and acute inflammatory
  • the present invention provides for methods of treating an autoimmune or inflammatory disease associated with Toll-like receptor 3 overexpression, e.g., Hashimoto's thyroiditis, inflammatory lung disease, and Type 1 diabetes).
  • an autoimmune or inflammatory disease associated with Toll-like receptor 3 overexpression e.g., Hashimoto's thyroiditis, inflammatory lung disease, and Type 1 diabetes.
  • the present invention provides for methods of treating TLR3- or TLR4-linked diseases involving pathogen or pathogen molecular signals by inhibiting the increased IRF-3 signal pathway, but not the NF-kappa B signal pathway.
  • the pathogen related agent or product is a virus, bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g tobacco.
  • the bacteria is exemplified by, but not limited to, Chlamydia or an enterobacteria.
  • the bacteria are gram negative bacteria.
  • the virus is an RNA virus, enterovirus, Chlamydia, or Coxsackie virus.
  • the virus is a single strand RNA virus.
  • the virus is Influenza A.
  • the present invention provides for methods of treating TLR3- or TLR4-linked diseases involving pathogen or pathogen molecular signal increased Type 1 interferon gene expression.
  • the pathogen related agent or product is a virus, bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g. tobacco.
  • the bacteria are exemplified by, but not limited to, Chlamydia or enterobacteria.
  • the bacteria are gram-negative bacteria.
  • the virus is an RNA virus, enterovirus, or Coxsackie virus.
  • the virus is a single strand RNA virus.
  • the virus is Influenza A.
  • the present invention provides for methods of inhibiting TLR3- or TLR4-linked, pathogen or pathogen molecular signal increased Stat1 or Stat3 activation.
  • the pathogen related agent or product is a virus, bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g. tobacco.
  • the bacteria are exemplified by, but not limited to, Chlamydia or enterobacteria.
  • the bacteria re a gram negative bacteria.
  • the virus is an RNA virus, enterovirus, or Coxsackie virus.
  • the virus is a single strand RNA virus.
  • the virus is Influenza A.
  • the present invention provides for methods of inhibiting TLR3- or TLR4-linked, pathogen increased activation of interferon sensitive response element (ISRE).
  • the pathogen related agent or product is a virus, bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g. tobacco.
  • the bacteria are exemplified by, but not limited to, Chlamydia or enterobacteria.
  • the bacteria re a gram negative bacteria.
  • the virus is an RNA virus, enterovirus, or Coxsackie virus.
  • the virus is a single strand RNA virus.
  • the virus is Influenza A.
  • the present invention provides for methods of inhibiting TLR3- or TLR4-linked, pathogen or pathogen molecular signal increased Stat1 or Stat3 activation.
  • the pathogen related agent or product is lypopolysaccharide, Type 1 IFN, or environmental induction event, e.g. tobacco, hyperlipidemia.
  • the pathogen is bacteria.
  • the bacteria are exemplified by, but not limited to, Chlamydia or enterobacteria.
  • the bacteria are gram-negative bacteria.
  • the bacteria are gram-negative bacteria.
  • the pathogen is a virus.
  • the virus is an enterovirus.
  • the present invention provides for methods of inhibiting TLR3 or TLR4-linked, pathogen or pathogen molecular signal increased activation of genes with interferon sensitive response elements (ISREs).
  • the pathogen related agent or product is lypopolysaccharide, Type 1 IFN, or environmental induction event, e.g. tobacco, hyperlipidemia.
  • the pathogen is bacteria.
  • the bacteria are gram-negative bacteria.
  • the pathogen is a virus.
  • the virus is an enterovirus.
  • the present invention provides for methods of inhibiting cytokine increased activation of interferon sensitive response element (ISRE).
  • ISRE interferon sensitive response element
  • the cytokine is IL-1.
  • the cytokine is TNF-alpha.
  • the cytokine is gamma interferon.
  • the cytokine is a proinflammatory cytokine including but not limited to IL-6, IL-12, IFN- ⁇ , or IFN- ⁇ .
  • the present invention provides for methods which measure therapeutic efficacy of an agent that reduces pathologic TLR3 or TLR4 expression and TLR3 or TLR4 mediated signal molecules in nonimmune cells, monocytes, macrophages or serum as well of a pathology such as an autoimmune or inflammatory disease (e.g Type 1 diabetes, colitis, autoimmune thyroiditis, atherosclerosis, and vascular complications of diabetes).
  • an agent that reduces pathologic TLR3 or TLR4 expression and TLR3 or TLR4 mediated signal molecules in nonimmune cells, monocytes, macrophages or serum as well of a pathology such as an autoimmune or inflammatory disease (e.g Type 1 diabetes, colitis, autoimmune thyroiditis, atherosclerosis, and vascular complications of diabetes).
  • an autoimmune or inflammatory disease e.g Type 1 diabetes, colitis, autoimmune thyroiditis, atherosclerosis, and vascular complications of diabetes.
  • the levels of expression of TLR3 or TLR4 and TLR3-sor TLR4 signaling molecules in nonimmune cells, monocytes, or macrophages, or serum is a diagnostic measure to predict therapeutic efficacy of an agent that reduces pathologic TLR3 or TLR4 expression and TLR3 or TLR4 mediated signal molecules in an autoimmune-inflammatory diseases.
  • the level of expression of TLR3 in thyrocytes or pancreatic islet cells is measured as a method not only for diagnosis of Hashimoto's disease, insulinitis or Type 1 diabetes but as a measure of therapy by an agent that reduces pathologic TLR3 expression and TLR3 mediated signal molecules altered in these autoimmune-inflammatory diseases.
  • the levels of expression of TLR4 and TLR4 mediated signal molecules in monocytes, macrophages, vascular endothelial cells, intestinal epithelial cells is measured as a method not only for diagnosis but also as a measure of therapy by an agent that reduces pathologic TLR4 expression and TLR4 mediated signal molecules in a pathologic state such as an autoimmune or inflammatory disease, e.g. vascular disease, colitis, or toxic shock.
  • the present invention provides for methods which measure diagnosis as well as therapeutic efficacy of an agent that reduces pathologic expression of TLR and TLR-mediated signal molecules in an autoimmune or inflammatory disease (e.g. systemic lupus, uveitis, rheumatoid arthritis, Graves' disease).
  • an agent that reduces pathologic expression of TLR and TLR-mediated signal molecules in an autoimmune or inflammatory disease e.g. systemic lupus, uveitis, rheumatoid arthritis, Graves' disease.
  • the levels of expression of TLR or TLR-signaling molecules is measured in nonimmune cells, monocytes, macrophages or serum in order to measure therapeutic efficacy of an agent that reduces pathologic TLR expression and TLR mediated signal molecules in an autoimmune-inflammatory disease.
  • the present invention provides for methods which measure diagnosis as well as therapeutic efficacy of an agent that reduces pathologic expression of IRF-3/Type 1 IFN, STAT, IRF-3, or ISRE regulated molecules in the nonMyD88-related pathway of TLR involved autoimmune or inflammatory disease.
  • the levels of expression of IRF-3/Type 1 IFN, STAT, IRF-3, or ISRE regulated molecules in the nonMyD88-related pathway is measured in nonimmune cells, monocytes, macrophages or serum in order to measure therapeutic efficacy of an agent that reduces pathologic expression of an autoimmune-inflammatory disease.
  • the present invention also provides for methods of treating a TLR3 or TLR4-mediated disease or disorder wherein the treatment is curative therapy, prophylactic therapy, ameliorative therapy or preventative therapy for a subject.
  • the present compounds may also be used in co-therapies, partially or completely, in place of other conventional anti-inflammatory agents, such as together with steroids, cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics, immunosuppressive agents, 5-lipoxygenase inhibitors, LTB 4 antagonists and LTA 4 hydrolase inhibitors and anti-cell adhesion molecules, such as anti E-selectin.
  • conventional anti-inflammatory agents such as together with steroids, cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics, immunosuppressive agents, 5-lipoxygenase inhibitors, LTB 4 antagonists and LTA 4 hydrolase inhibitors and anti-cell adhesion molecules, such as anti E-selectin.
  • the present invention contemplates a method of relieving symptoms utilizing a combination comprising methimazole derivatives and tautomeric cyclic thiones in combination with salicylates (including sulfasalazine, olsalazine, and mesalamine), corticosteroids, immunosuppressants (including azathioprine and 6-mercaptopurine), antibiotics, anti adhesion molecules such as anti E-selectin, and a vitamin D compound (e.g., 1-alpha, 25-dihydroxyvitamin D 3 ).
  • salicylates including sulfasalazine, olsalazine, and mesalamine
  • immunosuppressants including azathioprine and 6-mercaptopurine
  • antibiotics including azathioprine and 6-mercaptopurine
  • anti adhesion molecules such as anti E-selectin
  • a vitamin D compound e.g., 1-alpha, 25-dihydroxy
  • the present invention provides for the use of methimazole (1-methyl-2-mercaptoimidazole) and its derivatives.
  • the present invention provides for the use of a prodrug form of methimazole, known as carbimazole (neomercazole) and its derivatives.
  • the present invention provides for the use of a composition containing one or more of the compounds selected from the group consisting of: methimazole, metronidazole, 2-mercaptoimidazole, 2-mercaptobenzimidazole, 2-mercapto-5-nitrobenzimidazole, 2-mercapto-5-methylbenzimidazole, s-methylmethimazole, n-methylmethimazole, 5-methylmethimazole, 5-phenylmethimazole, and 1-methyl-2-thiomethyl-5 (4)nitroimidazole.
  • the activities and specificities of the compounds according to this invention may be determined using in vitro and in vivo assays.
  • These methods may employ the compounds of this invention in a monotherapy or in combination with an anti-inflammatory or immunosuppressive agent.
  • combination therapies include administration of the agents in a single dosage form or in multiple dosage forms administered at the same time or at different times.
  • NK-104 pitavastatin also referred to as NK-104 (see PCT international publication number WO 97/23200) and ZD4522; HMG-CoA synthase inhibitors; squalene epoxidase inhibitors; squalene synthetase inhibitors (also known as squalene synthase inhibitors), acyl-coenzyme A: cholesterol acyltransferase (ACAT) inhibitors including selective inhibitors of ACAT-1 or ACAT-2 as well as dual inhibitors of ACAT- I and -2; microsomal triglyceride transfer protein (MTP) inhibitors; probucol; niacin; bile acid sequestrants; LDL (low density lipoprotein) receptor inducers; platelet aggregation inhibitors, for example glycoprotein IIb/IIIa fibrinogen receptor antagonists and aspirin; human peroxisome proliferator activated receptor gamma (PPAR ⁇ ) agonists including the compounds commonly
  • the compounds of this invention may be used in combination with anti-retroviral therapy in AIDS infected patients to treat lipid abnormalities associated with such treatment, for example but not limited to their use in combination with HIV protease inhibitors such as indinavir, nelfinavir, ritonavir and saquinavir.
  • HIV protease inhibitors such as indinavir, nelfinavir, ritonavir and saquinavir.
  • cholesterol absorption inhibitors including plant sterols.
  • Cholesterol absorption inhibitors block the movement of cholesterol from the intestinal lumen into enterocytes of the small intestinal wall. This blockade is their primary mode of action in reducing serum cholesterol levels.
  • These compounds are distinct from compounds that reduce serum cholesterol levels primarily by mechanisms of action such as acyl coenzyme A—cholesterol acyl transferase (ACAT) inhibition, inhibition of triglyceride synthesis, MTP inhibition, bile acid sequestration, and transcription modulation such as agonists or antagonists of nuclear hormones.
  • ACAT acyl coenzyme A—cholesterol acyl transferase
  • MTP inhibition inhibition of triglyceride synthesis
  • MTP inhibition bile acid sequestration
  • transcription modulation such as agonists or antagonists of nuclear hormones.
  • combination-therapy of the compounds of the present invention with other pharmaceutical agents is not limited to those listed herein, supra or infra, but includes in principle any combination with any pharmaceutical agent or pharmaceutical composition useful for the prophylaxis or treatment of diseases, conditions or disorders that are linked to metabolic related disorders.
  • the present invention provides for a method of diagnosing and following therapeutic efficacy of an agent inhibiting a TLR3 or TLR4 mediated and related disease in a subject, the method comprising detecting the level of expression of TLR3/TLR4 or TLR3/TLR4 signaled molecules (a) in a test sample of nonimmune tissue cells or serum obtained from the subject, and (b) in a control sample of known normal nonimmune tissue cells of the same cell type or serum, wherein a higher or lower level of expression of TLR3 or TLR4 or their signature signal molecules in the test sample as compared to the control sample is indicative of the presence of an TLR3/4 related disease or efficacy of therapy in the subject from which the test tissue cells were obtained.
  • the present invention provides for a method of diagnosing, in a subject, an autoimmune or inflammatory disease associated with toll-like receptor overexpression in nonimmune cells, monocytes, macrophages, or dendritic cells, the method comprising detecting the level of expression of TLR or TLR signaled molecules (a) in a test sample of nonimmune cells monocytes, macrophages, or dendritic cells, or serum obtained from the subject, and (b) in a control sample of known normal nonimmune cells monocytes, macrophages, or dendritic cells of the same cell type, or in serum wherein a higher or lower level of expression of TLR or TLR-signaled molecules in the test sample as compared to the control sample is indicative of the presence or the efficacy of therapy of an autoimmune or inflammatory disease associated with toll-like receptor overexpression or overexpressed signaling in the subject from which the test tissue cells were obtained.
  • the present invention provides for a method of diagnosing, in a subject, an autoimmune or inflammatory disease associated with overexpression of genes or gene products induced by pathologic activation of the nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signal system of TLR in nonimmune cells, monocytes, macrophages, or dendritic cells, or serum the method comprising detecting the level of expression of molecules altered by overexpression of the nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signal system of TLR (a) in a test sample of nonimmune cells monocytes, macrophages, or dendritic cells, or serum obtained from the subject, and (b) in a control sample of known normal nonimmune cells monocytes, macrophages, or dendritic cells, of the same cell type, or in serum wherein a higher or lower level of expression of TLR or TLR-signaled molecules in the test sample as compared to
  • the present invention provides for a method of identifying a compound that inhibits the expression of toll-like receptor 3 or TLR4 or their signals, the method comprising contacting cells which normally exhibit TLR3 or TLR4 expression or activity with an enhancer of this expression or activity, e. g. LPS, Type I IFN, dsRNA transfection, a virus, IL-1 ⁇ , TNF- ⁇ , together with, preceded, or followed by a candidate compound, and determining the responsiveness or lack of responsiveness by the cell to the test compound.
  • an enhancer of this expression or activity e. g. LPS, Type I IFN, dsRNA transfection, a virus, IL-1 ⁇ , TNF- ⁇
  • the present invention provides for methods for screening a test compound for the potential to prevent, ameliorate, stabilize, or treat an autoimmune or inflammatory disease associated with toll-like receptor 3 or TLR4 overexpression and/or signaling in the subject comprising the steps of first contacting a nonimmune cell sample, monocyte, macrophage, or dendritic cell from a subject that has, or is at risk for developing, an autoimmune or inflammatory disease associated with toll-like receptor 3 or TLR4 overexpression and/or signaling in the subject with the test compound; b) contacting a second nonimmune cell sample, monocyte, macrophage, or dendritic cell from the subject with a known standard compound, wherein the first and second nonimmune cell samples are contacted with the test compound in the same manner; and c) measuring TLR3 or TLR4 expression or activity in the first and second samples, wherein the compound is determined to have the potential if the TLR3 or TLR4 expression or activity in the first sample is decreased relative to the second sample.
  • the present invention provides for methods for screening a test compound for the potential to prevent, ameliorate, stabilize, or treat an autoimmune or inflammatory disease associated with toll-like receptor overexpression or signaling in the subject comprising the steps of: a) first contacting a nonimmune cell sample, monocyte, macrophage, or dendritic cell from a first subject that has, or is at risk for developing, an autoimmune or inflammatory disease associated with toll-like receptor overexpression or signaling in the subject with the test compound; b) contacting a second nonimmune cell, monocyte, macrophage, or dendritic cell sample from a second subject that does not have, or is not predisposed to developing, an autoimmune or inflammatory disease associated with toll-like receptor 3 or TLR4 overexpression or signaling with the test compound, wherein the first and second nonimmune cell samples, monocyte, macrophage, or dendritic cell are contacted with the test compound in the same manner; and c) measuring TLR3 or TLR4 expression or activity
  • the present invention provides for methods for screening a test compound for the potential to prevent, ameliorate, stabilize, or treat an autoimmune or inflammatory disease associated with increased TLR3, TLR4, or TLR expression in or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signaling in the subject comprising the steps of: a) first contacting a nonimmune cell, monocyte, macrophage, or dendritic cell sample with an inducer of expression of TLR3, TLR4, or TLR expression or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signaling b) contacting a second nonimmune cell, monocyte, macrophage, or dendritic cell sample with an inducer of expression of TLR3, TLR4, or TLR expression or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signaling in the same manner but before or after a test compound, c) contacting a third nonimmune
  • TLR3 protein expression was also detected in FRTL-5 cells by first immunoprecipitating cell lysates with (IP+) or without (IP ⁇ ) 10 ⁇ g/ml of anti-TLR3 monoclonal antibody. The immunoprecipitated fractions were then blotted together with whole cell lysates (20 ⁇ g) from CHO-K1 cells transiently transfected with 20 ⁇ g of indicated TLR expression vector and analyzed by western blot with anti-TLR3 antibody (4 ⁇ g/ml).
  • Poly (I:C) (the dsRNA ligand commonly used as a test compound) activates the TLR3 mediated NF- ⁇ /Map kinase signal pathway in FRTL-5 thyrocytes.
  • FRTL-5 cells were transiently transfected with 100 ng of luciferase reporter pNF- ⁇ B Luc and 2 ng of internal control phRL-Tk. After 36 h, cells were incubated with 100 ⁇ g/ml poly (I:C) or endotoxin-free E. coli DNA for 6 h. Measurements were made with the Dual Luciferase Assay System (Promega).
  • poly (I:C) induced p50/p65 complex formation as measured by the presence of a specific new protein/DNA complex and its inhibition by anti-p50 and p65 antibodies, but not by anti-p52, c-rel and Rel B antibodies; the complex was also supershifted by anti-p50.
  • Poly (I:C) also increased TLR3-mediated ERK1/2 and MAKK activity.
  • FRTL-5 cells were maintained in medium (4 hormone or 4H) that does not contain insulin and TSH, and then were stimulated with 100 ⁇ g/ml of poly (I:C) or 10 ⁇ M insulin.
  • FIG. 1 shows signaling by the more important path, which is relevant to therapy with methimazole, methimazole derivatives, and tautomeric cyclic thiones as evidenced in the additional Figures below.
  • FRTL-5 cells were transiently transfected with 100 ng of luciferase reporter IFN- ⁇ -promoter-luc and 2 ng of internal control phRL-Tk-Int.
  • HEK293cells were transfected with IFN- ⁇ -promoter-luc and phRL-Tk in the presence (hTLR3) or absence (mock) of co-transfection of human TLR3 expression plasmid. After 36 h, cells were incubated with the indicated dose of poly (I:C) or with endotoxin-free E. coli DNA for 6 h. Data was obtained with the Dual Luciferase Assay System (Promega). TLR3 activation thus increased IFN- ⁇ gene expression.
  • FIG. 1B FRTL-5 cells were incubated with 100 ⁇ g/ml of poly (I:C). After the indicated time points, total RNA was isolated and IFN- ⁇ and GAPDH were determined by RT-PCR using gene specific primers (S. Yokoyama, et al., Biochem Biophys Res Commun, 232:698-701, (1997)).
  • FIG. 1C cells were co-transfected with pCMV-BD-hIRF-3 and pFR-luc, then incubated with poly (I:C) or IL-1 ⁇ for 6 hours. TLR3 activation in thyrocytes increased the activity of IRF-3 whose binding to the IFN- ⁇ promoter results in the increased IFN- ⁇ gene expression.
  • FIG. 1D cells were transiently transfected with 200 ng of IFN- ⁇ -promoter-luc, the indicated dose of TRIF/TICAM-1, wild type MyD88 or dominant negative MyD88 and 2 ng of internal control phRL-Tk. After 36 h, cells were incubated with indicated dose of poly (I:C) or IL-1 ⁇ for 6 h. Data was obtained with the Dual Luciferase Assay System (Promega). TRIF/TICAM is thus functional in thyrocytes. In sum, the TLR3 receptor on thyrocytes, when activated, can increase the TRIF coupled signal to increase IRF-3/IFN- ⁇ as well apparently increase the NF- ⁇ B signal system.
  • FIG. 2 Poly (I:C) incubation does not upregulate TLR 3 mRNA in FRTL-5 thyrocytes; in contrast, Poly (I:C) transfection increases TLR 3 expression independently of PKR.
  • FIG. 2A the effect on mRNA levels of TLR3 and several other genes was measured after incubating FRTL-5 thyrocytes with 100 ⁇ g/ml of Poly (I:C) or 10 ng/ml of IL-1 ⁇ for the indicated hours. After total RNA purification, 20 ⁇ g of total RNA were analyzed with indicated radiolabeled cDNA probes.
  • RNA transfection did increase TLR3, Major histocompatibility Class I, and PKR which are implicated in autoimmune-inflammatory diseases; DNA transfection was much less effective.
  • C the effect of 2-aminopurine (a PKR inhibitor) on transfected dsRNA-induced TLR3 mRNA levels was measured. Again cells were transfected with Lipofectamine 2000 alone or Lipofectamine with the indicated amount of Poly (I:C) or endotoxin-free E. coli DNA in the presence or absence of 10 mM 2-aminopurine. After the indicated incubation time, cells were harvested and 20 ⁇ g of total RNA was analyzed with the indicated radiolabeled cDNA probes.
  • a PKR inhibitor significantly reduced the ability of dsDNA to slightly increase PKR, MHC class I, and TLR3 mRNA levels but had no effect on dsRNA transfection in this regard.
  • the effect of 2-AP on IFN- ⁇ gene expression was measured by RT-PCR using gene specific primers (S. Yokoyama, et al., Biochem Biophys Res Commun, 232:698-701, (1997)); and the effect of 2-AP on dsRNA induced NF- ⁇ activation was measured by EMSA.
  • 2-AP strongly reduced the dsRNA induced NF- ⁇ complex but had no effect on IFN- ⁇ mRNA levels. Data are representative of multiple experiments.
  • dsRNA transfection is needed to increase gene expression of signals implicated in autoimmune-inflammatory diseases such as MHC genes and high levels of Type I interferons, not simply activation of TLR by incubating thyrocytes with dsRNA by dsRNA binding to TLR3 receptors. Moreover, despite increased PKR, the critical signal involved in TLR3/Type I IFN signaling by dsRNA transfection is not PKR mediated.
  • FIG. 3 Influenza A virus infection of FRTL-5 cells causes overexpression of TLR3, IRF-1, MHC class II, and IFN- ⁇ RNA levels similar to the action of dsRNA transfection.
  • A Cells were infected for 24 hours with Influenza A (+) or were noninfected ( ⁇ ). Separately, cells were transfected with dsRNA (+) or exposed to a mock transfection ( ⁇ ). Total RNA, 20 ug, was isolated and Northern blotted to detect TLR3, IRF-1, and MHC II using radiolabeled cDNA probes. Ribosomal bands are shown as control for loading and integrity of samples.
  • Influenza A infection mimicked the ability of dsRNA transfection to increase TLR3, IRF-1 and MHC Class II mRNA levels.
  • cDNA was synthesized from total RNA and used as the template to amplify IFN- ⁇ or GAPDH by PCR.
  • Influenza A and dsRNA transfection significantly increased IFN- ⁇ mRNA levels with no change in GAPDH, the housekeeping gene control.
  • results were similar: Influenza A and dsRNA transfection had largely the same effects on TLR3 expression and signaling in thyrocytes. Data are representative of multiple experiments.
  • FIG. 4 Phenylmethimazole (C10) and Methimazole (MMI) inhibit the ability of IFN- ⁇ to increase TLR3, PKR, and MHC class I RNA levels in FRTL-5 thyrocytes.
  • Cells were incubated with or without 100 U/ml of IFN- ⁇ for 3 hours in the presence of dimethyl sulfoxide (DMSO), C10, or MMI.
  • DMSO is the vehicle control.
  • Northern blots were performed with 20 ug of total RNA to detect TLR 3, PKR, MHC I, and GAPDH using radiolabeled cDNA probes. Data are representative of multiple experiments. As was the case for Poly (I:C) transfection in FIG.
  • IFN- ⁇ increased TLR3.
  • FIG. 5 Phenylmethimazole (CIO) and Methimazole (MMI) inhibit the ability of Poly (I:C), lipopolysaccharide (LPS) and IL-1 ⁇ to increase IFN- ⁇ gene expression (Top Left) and IRF-3 transactivation (Top Right) in FRTL-5 thyrocytes.
  • (Top Left) Cells were co-transfected with IFN ⁇ -Luc and control vector (pRLTk-Int), then treated with or without ( ⁇ ) Poly (I:C) (100 ⁇ g/ml), LPS (100 ng/ml), or IL-1 ⁇ (10 ng/ml) in the presence of the vehicle (DMSO) alone ( ⁇ ), C10, or MMI for 6 hours.
  • DMSO vehicle
  • C10 significantly attenuates the effects of Poly (I:C) (100 ⁇ g/ml), LPS (100 ng/ml), or IL-1 ⁇ (10 ng/ml) on IRF-3 transactivation and IFN- ⁇ gene expression; its effect is much better than MMI.
  • Phenylmethimazole (C10) has no effect on the ability of Poly (I:C) or LPS to increase formation of the p50/p65 heterodimer complex of NF-6B (A), but can inhibit the Influenza A induced activation of Stat1 phosphorylation in FRTL-5 thyrocytes (B).
  • EMSA were performed using nuclear extracts from cells which were treated with nothing (none), Poly (I:C) (100 ⁇ g/ml), LPS (100 ng/ml), in the presence of DMSO, C10, or MMI for 6 hours. Probe was the NF- ⁇ consensus oligonucleotide.
  • the p65/p50 and p50/p50 complexes are indicated and were identified as in FIG. 2B by antibody inhibition or supershifts of the p50 or p65 components of the induced complexes.
  • (B) cells were infected with Influenza A for 24 hours and then DMSO or C10 were added to the medium for 6 hours. In each, 25 ⁇ g of nuclear extracts were used in Western blots performed to detect Stat1 PY701. Blots were then stripped and reprobed for unphosporylated Stat1. The first lane is a non infected control ( ⁇ ). Duplicate effects were seen with serine phosphorylation of Stat1 and with phosphorylated Stat3 (see below).
  • FIG. 7 C-10 inhibits LPS induced MCP-1, IRF-1, and IP-10 expression in different tissues, pondered products of both the TLR4 increased MyD88 dependent or MyD88 independent signaling pathways.
  • Northern analysis M. Saji, et al., J Clin Endocrinol Metab, 75:871-8 (1992); D. S. Singer, et al., U.S. Pat. No. 5,556,754 (1996); V. Montani, et al., Endocrinology, 139:290-302 (1998)
  • LPS LPS+C10
  • LPS+DMSO vehicle control
  • Ribosomal bands are shown as control for loading and integrity of samples.
  • the Northern blots demonstrate that LPS induced expression of products from both the NF- ⁇ B (MCP-1) and IRF-3/IFN- ⁇ (IP-10, IRF-1) signal pathways that are activated by TLR4 are significantly increased by LPS but attenuated by C10 treatment.
  • FIG. 8 Mice protected from Endotoxic shock by C10 have reduced tissue levels of activated Stat1.
  • protein phosphorylation levels of Stat1 in whole tissue lysates was examined. Both kidney and lung tissues displayed detectable levels of activated Stat1 protein in mice treated with LPS plus control solvent (DMSO) and not protected from shock (lanes 2 and 5 respectively) by comparison to controls (Lanes 1 and 4). These levels were reduced to basal in mice that were protected from LPS induced shock by treatment with C10 (lanes 3 and 6 respectively).
  • FIG. 9 Proinflammatory cytokines induced by endotoxic shock are suppressed by C10.
  • the pro-inflammatory cytokines TNF ⁇ , IL-1 ⁇ , IL-6, IL-12 and IFN ⁇ are reported to be secreted by the activation of LPS-TLR-4-MyD88 dependent pathway but involve also the MyD88 independent signals.
  • mice LPS and LPS plus DMSO treated mice increased as much as 1000 fold compared to mice treated with C10.
  • Phenylmethimazole (C-10) normalized these cytokines to levels approaching those in normal control mice. Blood was collected from the inner canthus of the eye under anesthesia and serum was taken and kept at ⁇ 20 degree centigrade until use. ELISA kits from R&D System were used and the results were expressed in picograms per ml of serum.
  • FIG. 10 C10 decreases LPS/toxic shock increased COX-2, and iNOs expression but decreases COX-1 expression in mice.
  • LPS and C10 oppositely affect COX-1, COX-2 and iNOS expression as analyzed by PCR.
  • LPS injection in mice from the Experiment in Table 5 decreased COX-1 expression at 24 hours compared to normal levels, in heart, kidney and liver.
  • C10 treatment attenuated this LPS effect on COX-1 in these organs, causing expression to revert to normal levels. No variation on COX-1 expression due to LPS injection was observed in spleen.
  • COX-2 and iNOS were over-expressed in all five organs after LPS injection; C10 treatment reversed the overexpression to normal levels.
  • FIG. 11 C10 ameliorates the pathological inflammatory effects of LPS-induced endotoxic shock in the lungs of mice.
  • Hematoxylin and eosin staining of lung showed inflammatory changes at the microvascular level and inflammatory cell infiltration induced by endotoxic shock at 20 ⁇ magnification.
  • LPS treated mice from Table 5 showed an increase of inflammatory cells in the as a function of time (Panels B and C by comparison to Panel A at same magnification). There was an increase in inflammatory cells in the lumen of the vessel (indicated by V in all Panels). This was particularly evidenced by the margination or stickiness of the cells to the vessel wall which suggesting rolling and adhesion of the inflammatory cells (Panel C bold arrow).
  • C10 blocks the increase in the inflammatory cells and their increase in margination, stickiness to the wall, diapedesis and movement from the lumen to the septum. C10 thus ameliorates the microcirculatory damage and inflammatory cell infiltration to the lung of LPS treated mice.
  • the same results of C10 treatment in LPS-induced toxic shock changes in the lung inflammatory response were noted at 40 ⁇ magnification.
  • These experiments utilized tissues from the mice whose survival curves are detailed in Table 5.-Attraction of inflammatory cells to the vessels of the lung and the tissues should be associated with increases in adhesion molecule expression in the vascular cells.
  • C10 decreased the expression of adhesion molecules ICAM-1 and VCAM-1 in lung as evidenced when comparing lung tissues from different groups of mice treated with LPS (Panels B and C) or LPS+C10 (Panel D) with normal mice as a control (Panel A).
  • the expression of the adhesion molecules was marked by the intensity of the brown color within the tissue.
  • ICAM-1 and VCAM-1 molecule expression was clearly increased and localized to the vascular endothelium.
  • C10 clearly decreased VCAM-1 expression compared with the LPS treated group, reverting changes toward normal levels.
  • FIG. 12 C10 decreases LPS-increased IFN- ⁇ , IL-1 ⁇ , TNF- ⁇ , IP-10, and IL-6 in RAW macrophages.
  • RAW mouse macrophages were stimulated with LPS (1 ⁇ g/mL) for different times and RNA extracted for Northern analyses (A) or for real time quantitative polymerase chain reaction (PCR) (B).
  • A Northern analysis compared mRNA expression profiles in the presence of C10 or the vehicle control (DMSO).
  • DMSO vehicle control
  • FIG. 13 C10 decreases LPS-increased iNOS mRNA and Stat1 activation in RAW macrophages.
  • the RAW 264.7 cells were treated with LPS in the presence of C10 or control DMSO or another vehicle (Vehicle B) for 3 hours.
  • the LPS treatment with the DMSO control (lane 4) or with vehicle B only (lane 5) little or no iNOS reduction was detected when compared to LPS only (lane 3).
  • cells treated with C10 showed a strong reduction of LPS induced iNOS mRNA (lanes 6 and 7 vs. lanes 4 and 5).
  • C10 had a strong inhibitory effect regardless of the vehicle used to dissolve the compound.
  • Cyclohexamide treatment was performed to confirm that new protein synthesis is required for the LPS induction of iNOS mRNA and thus confirm that interferon signaling was responsible for the increase in iNOS not direct TLR4 signaling. This is consistent with the ability of C10 to reduce the LPS induced increase in IFN- ⁇ mRNA ( FIG. 12 ).
  • Phosphorylation of Stat1 is a key component for the transduction of the IFN- ⁇ signal to the nucleus to induce expression of iNOS and IP-10 in the mouse macrophage (Y. Ohmori, et al., J Leukoc Biol, 69:598-604 (2001)).
  • FIG. 14 C10 down regulates LPS-increased IRF-1 RNA levels and IRF-1 DNA binding to ISRE elements in RAW macrophages.
  • LPS increased IRF-1 mRNA levels, as measured by northern analysis when macrophages were treated with LPS (1 ⁇ g/mL) for periods of 1, 2, or 3 hour.
  • C10 caused a strong reduction in IRF-1mRNA at 2 and 3 hour.
  • Methimazole (MMI) has a significantly less impressive effect but also decreases IRF-1 mRNA levels. In order for IRF-1 to enhance gene transcription it must bind to cis-DNA elements located on the target gene.
  • FIG. 15 C10 reduces vascular inflammation in ApoE ⁇ / ⁇ mice fed a high fat diet.
  • C10 was given orally (1 mg/kg) every other day to mice for 8 weeks.
  • Control mice received DMSO alone.
  • Mice were sacrificed at 8 weeks and histopathology examined in different tissues as determined by hematoxylin and eosin staining. Sections of the base of the aorta in C10 treated (Panel A) and untreated mice (Panel B) are presented as well as sections of the coronary artery vasculature in C10 treated (Panel C) and untreated mice (Panel D). Significant improvement in both is evident by the decrease in the extent of lesion and vessel patency in Panel A vs.
  • TLR4 positive cells abound in the macrophages infiltrating the area or in other cells, i.e. interstitial cells around the myocardial sheaths.
  • FIG. 16 Atherosclerotic lesions in human tissues are associated with overexpressed TLR4 and VCAM-1. Sections of the coronary arteries from surgically removed plaques were immunstained with anti-TLR4 (Bottom Right Panel), anti-VCAM-1 (Top Right Panel), anti-ICAM-1 (Bottom Left Panel) in sequential slices from the paraffin imbedded block. An H &E stain (Top Left Panel) shows the occluded vessel with a foam cell, lipid laden “plaque” surrounded by a muscle wall and myocardial tissue. VCAM-1 (dark color) is overexpressed in the lesion but also in the endothelial layer opposite the lesion area.
  • TLR4 (dark color) is more expressed in the area opposite the lesion and, surprisingly, throughout the smooth muscle layer surrounding the vessel, particularly opposite the plaque. TLR4 is also expressed in the myocardial musculature. The expression suggests a widespread inflammatory response wherein TLR4 positive cells abound be they macrophages infiltrating the area or other cells. In all respects these data duplicate those in the ApoE ⁇ / ⁇ mice and thus should be, like the lesions in the ApoE ⁇ / ⁇ mice (Table 15), sensitive to C10 therapy.
  • FIG. 17 C10 decreases IFN- ⁇ induction of phosphorylation of Stat1 and the activation of IRF-1 in human aortic endothelial cells (HAEC); C10 also decreases Stat1 serine phosphorylation in HAEC as well as rat thyrocytes and RAW cells.
  • IFN- ⁇ induction of IRF-1 protein was strongly decreased by C10 but not the DMSO vehicle control (noted as D). The same blot, stripped and reprobed for an activated form of Stat1 (phosphorylated at Y701), showed a decrease of IFN- ⁇ induced Stat1 phosphorylation.
  • HAEC were treated for 2 hours in the absence or presence of C10 (1 mM) or DMSO (D) carrier control. A non infected/non treated sample was included as a control (far left lane). Twenty five (25) mg of whole cell lysate were resolved by SDS-PAGE and then blotted onto nitrocellulose membranes. In (B), the affect of C10 was also observed on Stat1 serine phosphorylation at residue 727 in rat thyrocytes, HAEC cells, and RAW cells by western blot using a phosphoserine specific Stat1 antibody.
  • Rat thyrocytes were (lane 2) or were not infected (lane 1) with Influenza A virus for 24 hours and then treated with either DMSO (1%) (lane 3) or 1 mM C10 (lane 4).
  • Human aortic endothelial cells (HAEC) were incubated with 100 U/mL of hIFN- ⁇ for 2 hours in the presence of either DMSO (1%) (lane 5) or 1 mM C10 (lane 6).
  • Mouse macrophages (RAW 264.7) were incubated for 3 hours with E. coli LPS at a concentration of 500 ng/ml either alone (lane 7), in the presence of DMSO (0.5%) (lane 8), or with 0.5 mM C10 (lane 9).
  • each whole cell lysate was resolved by SDS-PAGE, blotted onto a nitrocellulose membrane and then probed with the indicated antibodies. Loading was controlled by stripping and reprobing with an antibody directed against non phosphorylated Stat1.
  • C10 inhibits Stat1 serine phosphorylation independent of cell type [nonimmune cell (thyrocyte, HAEC cell) or macrophage] or stimulus (IFN- ⁇ , Influenza A, or LPS).
  • Stat3 phosphorylation was similarly inhibited.
  • administration of the pharmaceutically active compounds and the pharmaceutical compositions defined herein includes systemic use, as by injection (especially parenterally), intravenous infusion, suppositories and oral administration thereof, as well as topical application of the compounds and compositions. Oral administration is particularly preferred in the present invention.
  • allergen refers to a substance that can induce an allergic or asthmatic response in a susceptible subject.
  • the list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g penicillin).
  • Examples of natural, animal and plant allergens include proteins specific to the following genera: Canine ( Canis familiaris ); Dermatophagoides (e.g. Dermatophagoides farinae ); Felis ( Felis domesticus ); Ambrosia ( Ambrosia artemiisfolia; Lolium (e.g.
  • Lolium perenne or Lolium multiflorum Cryptomeria ( Cryptomeria japonica ); Altemaria ( Alternaria alternata ); Alder; Alnus ( Alnus gultinosa ); Betula ( Betula verrucosa ); Quercus ( Quercus alba ); Olea ( Olea europa ); Artemisia ( Artemisia vulgaris ); Plantago (e.g. Plantago lanceolata ); Parietaria (e.g. Parietaria officinalis or Parietaria judaica ); Blattella (e.g. Blattella germanica ); Apis (e.g. Apis multiflorum ); Cupressus (e.g.
  • Juniperus e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei ); Thuya (e.g. Thuya orientalis ); Chamaecyparis (e.g. Chamaecyparis obtusa ); Periplaneta (e.g Periplaneta americana ); Agropyron (e.g. Agropyron repens ); Secale (e.g. Secale cereale ); Triticum (e.g. Triticum aestivum ); Dactylis (e.g.
  • Festuca e.g. Festuca elatior
  • Poa e.g. Poa pra
  • Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
  • “Ameliorate” or “amelioration” means a lessening of the detrimental effect or severity of the disorder in the subject receiving therapy, the severity of the response being determined by means that are well known in the art.
  • Asthma refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
  • “Atherosclerosis” is a form of chronic vascular injury in which some of the normal vascular smooth muscle cells in the artery wall, which ordinarily control vascular tone regulating blood flow, change their nature and develop “cancer-like” behavior. These vascular smooth muscle cells become abnormally proliferative and responsive to inflammatory growth factors, then secrete tissue-degradation enzymes and other proteins, which enable them to invade and spread into the inner vessel lining where they engulf fat and inflammatory debris, lyse, and repetitively cycle, thereby expanding the inner inflamed lining of the blood vessels.
  • This process reduces vascular diameter, blocking blood flow, and making that vessel abnormally susceptible to being completely blocked by leukocytes and platelets, which adhere to adhesion molecules overexpressed on the vascular endothelium. Local blood clotting ensues, resulting in the death of the tissue served by that artery.
  • “Autoimmune, inflammatory, proliferative, hyperproliferative or vascular diseases” refers to any autoimmune, inflammatory, proliferative or hyperproliferative disease or disorder known in the art whether of a chronic or acute nature, including, but not limited to, rheumatoid arthritis, restenosis, lupus erythematosus, systemic lupus erythematosus, Hashimoto's thyroiditis, myasthenia gravis, diabetes mellitus, uveitis, nephritic syndrome, multiple sclerosis; inflammatory skin diseases, such as, for example, psoriasis, dermatitis, contact dermatitis, eczema and seborrhea; surgical adhesion; tuberculosis; inflammatory lung diseases, such as, asthma, pneumoconiosis, chronic obstructive pulmonary disease, emphysema, bronchitis, nasal polyps and
  • Blood includes blood products, blood components and the like.
  • Cardiovascular disease or disorder refers to any cardiovascular disease or disorder known in the art, including, but not limited to, restenosis, coronary artery disease, atherosclerosis, atherogenesis, cerebrovascular disease, angina, (particularly chronic, stable angina pectoris), ischemic disease, congestive heart failure or pulmonary edema associated with acute myocardial infarction, thrombosis, high or elevated blood pressure in hypertension (especially hypertension associated with cardiovascular surgical procedures), platelet aggregation, platelet adhesion, smooth muscle cell proliferation, vascular or non-vascular complications associated with the use of medical devices, wounds associated with the use of medical devices, vascular or non-vascular wall damage, peripheral vascular disease, neoinitimal hyperplasia following percutaneous transluminal coronary angiograph, and the like.
  • Complications associated with the use of medical devices may occur as a result of increased platelet deposition, activation, thrombus formation or consumption of platelets and coagulation proteins.
  • Such complications which are within the definition of “cardiovascular disease or disorder,” include, for example, myocardial infarction, pulmonary thromboembolism, cerebral thromboembolism, thrombophlebitis, thrombocytopenia, bleeding disorders and/or any other complications which occur either directly or indirectly as a result of the foregoing disorders.
  • Cerebrovascular diseases or events refers to cerebral infarction or stroke (caused by vessel blockage or hemorrhage), or transient ischemia attack (TIA), syncope, atherosclerosis of the intracranial and/or extracranial arteries, and the like.
  • Chemokines are chemotactic cytokines that are released by a wide variety of cells to attract macrophages, T-cells, eosinophils, basophils, neutrophils and endothelial cells to sites of inflammation and tumor growth.
  • the CXC-chemokines include interleukin-8 (IL-8), neutrophil-activating protein-1 (NAP-1), neutrophil-activating protein-2 (NAP-2), GRO ⁇ , GRO ⁇ , GRO ⁇ , ENA-78, GCP-2, IP-10, MIG and PF4.
  • CC chemokines include RANTES, MIP-1 ⁇ , MIP-2 ⁇ , monocyte chemotactic protein-1 (MCP-1), MCP-2, MCP-3 and eotaxin.
  • compatible herein is meant that the components of the compositions which comprise the present invention are capable of being commingled without interacting in a manner which would substantially decrease the efficacy of the pharmaceutically active compound under ordinary use conditions.
  • coronary events refers to myocardial infarction, myocardial revascularization procedures, angina, cardiovascular death and acute coronary syndrome.
  • corticosteroid any naturally occurring or synthetic steroid hormone, which can be derived from cholesterol and is characterized by a hydrogenated cyclopentanoperhydrophenanthrene ring system.
  • Naturally occurring corticosteroids are generally produced by the adrenal cortex.
  • Synthetic corticosteroids may be halogenated. Functional groups required for activity include a double bond at ⁇ 4, a C3 ketone, and a C20 ketone.
  • Corticosteroids may have glucocorticoid and/or mineralocorticoid activity.
  • endotoxic shock or “septic shock” includes without limitation a physical or mental disturbance induced by the release of endotoxin from Gram-negative bacteria or by the release of super antigens from Gram-positive bacteria.
  • septic shock or “sepsis” refers to a clinical disorder whose symptoms may include well defined abnormalities in body temperature, heart rate, breathing rate, white blood cell count, hypertension then hypotension, organ perfusion abnormalities, and multiple organ dysfunction. It may be caused by or associated with bacterial (either gram negative or gram positive), fungal, viral or other infection, as well as by non-infective stimuli such as multiple trauma, severe bums, organ transplantation and pancreatitis.
  • Septic shock is commonly caused by “gram-negative” endotoxin- (LPS) producing aerobic rods— Escherichia coli, Klebsiella pneumoniae, Proteus species, Pseudomonas aeruginosa and Salmonella. Septic shock involved with gram negative bacteria is referred to as “endotoxic shock”.
  • LPS gram-negative endotoxin-
  • corticosteroids include, for example, dexamethasone, betamethasone, triamcinolone, triamcinolone acetonide, triamcinolone diacetate, triamcinolone hexacetonide, beclomethasone, dipropionate, beclomethasone dipropionate monohydrate, flumethasone pivalate, diflorasone diacetate, fluocinolone acetonide, fluorometholone, fluorometholone acetate, clobetasol propionate, desoximethasone, fluoxymesterone, fluprednisolone, hydrocortisone, hydrocortisone acetate, hydrocortisone butyrate, hydrocortisone sodium phosphate, hydrocortisone sodium succinate, hydrocortisone cypionate, hydrocortisone probutate, hydrocortisone valerate, cortisone acetate, paramethasone acetate, methylpred
  • low dose corticosteroid is meant a dose that is less than a dose that would typically be given to a patient for treatment of inflammation.
  • exemplary low doses of corticosteroids are as follows: cortisol: 12 mg/day; cortisone: 15 mg/day; prednisone: 3 mg/day; methylprednisolone: 2.5 mg/day; triameinolone: 2.5 mg/day; betamethasone: 250 ⁇ g/day; dexamethasone: 450 ⁇ g/day; hydrocortisone: 9 mg/day.
  • HMG-CoA reductase inhibitor where used in the specification and the appendant claims, is synonymous with the terms “3-hydroxy-3-methylglutary-1-Coenzyme A reductase inhibitor”, “HMG-CoA inhibitor” and “statins.” These three terms are used interchangeably throughout the specification and appendant claims. As the synonyms suggest, statins are inhibitors of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase and, as such, are effective in lowering the level of blood plasma cholesterol. Statins and pharmaceutically acceptable salts thereof are particularly useful in lowering low-density lipoprotein cholesterol (LDL-C) levels in mammals and particularly in humans.
  • LDL-C low-density lipoprotein cholesterol
  • the HMG-CoA reductase inhibitors suitable for use herein include, but are not limited to, simvastatin, pravastatin, rivastatin, mevastatin, fluindostatin, cerivastatin, velostatin, fluvastatin, dalvastatin, dihydrocompactin, compactin, or lovastatin; or a pharmaceutically acceptable salt of simvastatin, pravastatin, rivastatin, cerivastatin, mevastatin, fluindostatin, velostatin, fluvastatin, dalvastatin, dihydrocompactin, compactin, lovastatin, or pharmaceutically acceptable salts thereof.
  • statin calcium is a particularly preferred statin to be employed in the present combination. See U.S. Pat. No. 5,273,995 incorporated herein by reference.
  • the statins disclosed herein are prepared by methods well-known to those skilled in the art. Specifically, simvastatin may be prepared according to the method disclosed in U.S. Pat. No. 4,444,784, which is incorporated herein by reference. Pravastatin may be prepared according to the method disclosed in U.S. Pat. No. 4,346,227, which is incorporated herein by reference. Cerivastatin may be prepared according to the method disclosed in U.S. Pat. No. 5,502,199, which is incorporated herein by reference.
  • Cerivastatin may alternatively be prepared according to the method disclosed in European Patent Application Publication No. EP617019.
  • Mevastatin may be prepared according to the method disclosed in U.S. Pat. No. 3,983,140, which is incorporated herein by reference.
  • Velostatin may be prepared according to the methods disclosed in U.S. Pat. No. 4,448,784 and U.S. Pat. No. 4,450,171, both of which are incorporated herein by reference.
  • Fluvastatin may be prepared according to the method disclosed in U.S. Pat. No. 4,739,073, which is incorporated herein by reference.
  • Compactin may be prepared according to the method disclosed in U.S. Pat. No. 4,804,770, which is incorporated herein by reference.
  • Lovastatin may be prepared according to the method disclosed in U.S. Pat. No. 4,231,938, which is incorporated herein by reference. Dalvastatin maybe prepared according to the method disclosed in European Patent Application Publication No. 738510 A2. Fluindostatin may be prepared according to the method disclosed in European Patent Application Publication No. 363934 A1. Dihydrocompactin may be prepared according to the method disclosed in U.S. Pat. No. 4,450,171, which is incorporated herein by reference. It will be recognized that certain of the above statins contain either a free carboxylic acid or a free amine group as part of the chemical structure. Further, certain statins within the scope of this invention contain lactone moieties, which exist in equilibrium with the free carboxylic acid form.
  • salts are intended to define but is not limited to such salts as the alkali metal salts, (e.g., sodium and potassium), alkaline earth metal salts (e.g., calcium and magnesium), aluminum salts, ammonium salts, and salts with organic amines such as benzathine (N,N′-dibenzylethylenediamine), choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), benethamine (N-benzylphenethylamine), diethylamine, piperazine, tromethamine (2-amino-2-hydroxymethyl-1,3-propanediol) and procaine.
  • alkali metal salts e.g., sodium and potassium
  • alkaline earth metal salts e.g., calcium and magnesium
  • aluminum salts e.g., ammonium salts
  • salts with organic amines such as benzathine (N,N′-dibenzylethylened
  • pharmaceutically acceptable acid addition salts is intended to define but is not limited to such salts as the hydrochloride, hydrobromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogenphosphate, acetate, succinate, citrate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts.
  • the pharmaceutically acceptable cationic salts of statins containing free carboxylic acids may be readily prepared by reacting the free acid form of the statin with an appropriate base, usually one equivalent, in a co-solvent.
  • Typical bases are sodium hydroxide, sodium methoxide, sodium ethoxide, sodium hydride, potassium methoxide, magnesium hydroxide, calcium hydroxide, benzathine, choline, diethanolamine, piperazine, and tromethamine.
  • the salt is isolated by concentration to dryness or by addition of a non-solvent.
  • salts are preferably prepared by mixing a solution of the acid with a solution of a different salt of the cation (sodium or potassium ethylhexanoate, magnesium oleate), employing a solvent (e.g., ethyl acetate) from which the desired cationic salt precipitates, or can be otherwise isolated by concentration and/or addition of a non-solvent.
  • a solvent e.g., ethyl acetate
  • the pharmaceutically acceptable acid addition salts of statins containing free amine groups may be readily prepared by reacting the free base form of the statin with the appropriate acid.
  • the salt is of a monobasic acid (e.g., the hydrochloride, the hydrobromide, the p-toluenesulfonate, the acetate), the hydrogen form of a dibasic acid (e.g., the hydrogen sulfate, the succinate), or the dihydrogen form of a tribasic acid (e.g., the dihydrogen phosphate, the citrate), at least one molar equivalent and usually a molar excess of the acid is employed.
  • a monobasic acid e.g., the hydrochloride, the hydrobromide, the p-toluenesulfonate, the acetate
  • the hydrogen form of a dibasic acid e.g., the hydrogen sulfate, the succinate
  • salts as the sulfate, the hemisuccinate, the hydrogen phosphate, or the phosphate
  • the appropriate and exact chemical equivalents of acid will generally be used.
  • the free base and the acid are usually combined in a co-solvent from which the desired salt precipitates, or can be otherwise isolated by concentration and/or addition of a non-solvent.
  • infectious disease includes, but is not limited to any disease that is caused by an infectious agent or organism.
  • Infectious organisms may comprise viruses, (e.g., single stranded RNA viruses, double strand DNA viruses, single stranded DNA viruses, human immunodeficiency virus (HIV), hepatitis A, B, and C virus, herpes simplex virus (HSV), cytomegalovirus (CMV) Epstein-Barr virus (EBV), human papilloma virus (HPV)), parasites (e.g., protozoan and metazoan pathogens such as Plasmodia species, Leishmania species, Schistosoma species, Trypanosoma species), bacteria (e.g., Mycobacteria, in particular, M.
  • viruses e.g., single stranded RNA viruses, double strand DNA viruses, single stranded DNA viruses, human immunodeficiency virus (HIV), hepatitis A, B, and C virus, herpes simplex
  • tuberculosis Salmonella, Streptococci, E. coli, Staphylococci ), fungi (e.g., Candida species, Aspergillus species), Pneumocystis carinii, and prions.
  • fungi e.g., Candida species, Aspergillus species
  • Pneumocystis carinii and prions.
  • Retroviridae e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., Ebola viruses);
  • infectious bacteria examples include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M.
  • infectious fungi examples include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
  • Other infectious organisms i.e., protists
  • Plasmodium falciparum and Toxoplasma gondii examples include: Plasmodium falciparum and Toxoplasma gondii.
  • “Inflammatory disease or disorder” refers to reperfusion injury to an ischemic organ, myocardial infarction, inflammatory bowel disease, rheumatoid arthritis, osteoarthritis, hypertension, psoriasis, organ transplant rejection, organ preservation, a female or male sexual dysfunction, radiation-induced injury, asthma, atherosclerosis, thrombosis, platelet aggregation, restenosis, metastasis, influenza, incontinence, stroke, burn, trauma, acute pancreatitis, pyelonephritis, hepatitis, an autoimmune disease, an immunological disorder, senile dementia, insulin-dependent diabetes mellitus, disseminated intravascular coagulation, fatty embolism, Alzheimer's disease, adult or infantile respiratory disease, carcinogenesis or a hemorrhage in a neonate.
  • Inflammatory response is characterized by redness, heat, swelling and pain (i.e., inflammation) and typically involves tissue injury or destruction.
  • An inflammatory response is usually a localized, protective response elicited by injury or destruction of tissues, which serves to destroy, dilute or wall off (sequester) both the injurious agent and the injured tissue.
  • Inflammatory responses are notably associated with the influx of leukocytes and/or leukocyte (e.g., neutrophil) chemotaxis.
  • Inflammatory responses may result from infection with pathogenic organisms and viruses, noninfectious means such as trauma or reperfusion following myocardial infarction or stroke, immune responses to foreign antigens, and autoimmune diseases.
  • Inflammatory responses amenable to treatment with the methods and compounds according to the invention encompass conditions associated with reactions of the specific defense system as well as conditions associated with reactions of the non-specific defense system.
  • Niacin includes such drugs as derivatives of niacinamide, niacin, and niacin esters. Such examples include but not limited to niacinamide salicylate, niacinamide lipoate, niacinamide mandelate, niacinamide lactate, niacinamide glycolate, niacinamide malate, niacinamide adenosine phosphate, niacinamide adenosine triphosphate, niacinamide ascorbate, niacinamide folate, niacinamide hydroxycitrate, niacinamide hydroxytetronate, niacinamide pantothenate, niacin salicylate, niacin lipoate, niacin mandelate, niacin lactate, niacin glycolate, niacin malate, niacin adenosine phosphate,
  • NSAID refers to a nonsteroidal anti-inflammatory compound or a nonsteroidal anti-inflammatory drug. NSAIDs inhibit cyclooxygenase, the enzyme responsible for the biosyntheses of the prostaglandins and certain autocoid inhibitors, including inhibitors of the various isozymes of cyclooxygenase (including but not limited to cyclooxygenase-1 and -2), and as inhibitors of both cyclooxygenase and lipoxygenase.
  • patient is intended to encompass any mammal, animal or human subject, which may benefit from treatment with the compounds, compositions and methods of the present invention, and includes children and adults.
  • “Pharmaceutically-acceptable” shall mean that the pharmaceutically active compound and other ingredients used in the pharmaceutical compositions and methods defined herein are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio.
  • Phosphodiesterase inhibitor or “PDE inhibitor” refers to any compound that inhibits the enzyme phosphodiesterase. The term refers to selective or non-selective inhibitors of cyclic guanosine 3′,5′-monophosphate phosphodiesterases (cGMP-PDE) and cyclic adenosine 3′,5′-monophosphate phosphodiesterases (cAMP-PDE).
  • cGMP-PDE cyclic guanosine 3′,5′-monophosphate phosphodiesterases
  • cAMP-PDE cyclic adenosine 3′,5′-monophosphate phosphodiesterases
  • Alpha-adrenergic receptor antagonist refers to any compound that reversibly or irreversibly blocks the activation of any alpha-adrenergic receptor.
  • Phosphokinase inhibitor refers to any compound that inhibits a phosphokinase, which includes but is not limited to kinases phosphorylating Stats, viral activated kinases, tamoxifen, dinitro-fluorobenzene (DNFB), and inhibitors of a serine kinase including isopentenyladenine, 6-dimethylaminopurine, olomoucine, roscovitine, CVT-313, purvanol, butyrolactone-I, flavopiridols, staurosporine, indirubins, hymenialdesine, and paullones.
  • a serine kinase including isopentenyladenine, 6-dimethylaminopurine, olomoucine, roscovitine, CVT-313, purvanol, butyrolactone-I, flavopiridols, staurosporine, indirubins, hyme
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • “Respiratory disease or disorder” refers to any pulmonary dysfunction including, for example, acute pulmonary vasoconstriction, pneumonia, traumatic injury, aspiration or inhalation injury, fat embolism in the lung, acidosis, inflammation of the lung, adult respiratory distress syndrome, acute pulmonary edema, acute mountain sickness, asthma, post cardiac surgery acute pulmonary hypertension, persistent pulmonary hypertension of the newborn, perinatal aspiration syndrome, hyaline membrane disease, acute pulmonary thromboembolism, heparin-protamine reactions, sepsis, asthma, status asthmaticus, or hypoxia (including that which may occur during one-lung anesthesia), chronic pulmonary vasoconstriction, chronic pulmonary hypertension, bronchopulmonary dysplasia, chronic pulmonary thromboembolism, idiopathic or primary pulmonary hypertension, or chronic hypoxia.
  • acute pulmonary vasoconstriction chronic pulmonary hypertension
  • bronchopulmonary dysplasia chronic pulmonary thromboembolism
  • a “safe and effective amount” means a sufficient amount of a pharmaceutically active compound to effect the inhibition of TLR-mediated disease expression and related pathologies.
  • a “safe and effective amount” means a sufficient amount of a pharmaceutically active compound to effect the inhibition of TLR3, TLR4, or TLR mediated disease expression and related pathologies involving abnormal MyD88-dependent and MyD88 independent signaling, most preferably TLR3, TLR4, or TLR mediated disease expression and related pathologies involving abnormal MyD88 independent signaling that increases IRF-3, Type 1 IFN, STAT, IRF-1, and ISRE increase or activation.
  • therapeutically effective amounts of a pharmaceutically active agent or of the pharmaceutical composition containing that active agent will vary with the severity of the condition being treated, the duration of the treatment, the nature of adjunct treatment, the age and physical condition of the patient, the specific active compound employed, and like considerations discussed more fully hereinafter. In arriving at the “safe and effective amount” for a particular compound, these risks must be taken into consideration.
  • “Therapeutic agent” as used herein refers to those agents effective in the prevention or treatment of a disorder or pathologic physiological condition.
  • Therapeutic agent includes the pro-drugs and pharmaceutical derivatives thereof including but not limited to the corresponding nitrosated and/or nitrosylated derivatives.
  • “Therapeutically effective amount” refers to the amount of the compound and/or composition that is effective to achieve its intended purpose.
  • TLRs are type I transmembrane proteins containing repeated leucine-rich motifs in their extracellular domains and a cytoplasmic tail that contains a conserved region called the Toll/IL1 receptor (TIR) domain. At least 10 mammalian TLR proteins have been identified, Toll-like receptors 1-10. TLRs play a critical role in early innate immunity to invading pathogens by sensing microorganisms or noxious environmental agents.
  • PAMPs pathogen-associated microbial patterns
  • dsRNA microbial pathogens
  • PAMPs include various bacterial cell wall components such as lipopolysaccharide (LPS), peptidoglycan (PGN) and lipopeptides, as well as flagellin, bacterial DNA and viral double-stranded RNA.
  • LPS lipopolysaccharide
  • PPN peptidoglycan
  • TLR thus protect mammals from pathogenic organisms, such as viruses, bacteria, parasitic agents, or fungi, and from tissue injury, by generating an “innate immune” response to products of the pathogenic organism.
  • TLRs may additionally protect animals from noxious environmental agents that destroy cells and release dsRNA or other PAMPs that can interact with the TLR.
  • the innate immune response results in increases in genes encoding several inflammatory cytokines, chemokines, as well as co-stimulatory molecules, and is critical for the development of antigen-specific adaptive immunity. Stimulation of TLRs by PAMPs initiates a signaling cascade that involves a number of proteins, such as MyD88 and IRAK1. This signaling cascade leads to the activation of the transcription factor NF-kB which induces the secretion of pro-inflammatory cytokines (such as TNF ⁇ and IL-1 ⁇ ) and effector cytokines that direct the adaptive immune response.
  • pro-inflammatory cytokines such as TNF ⁇ and IL-1 ⁇
  • the signaling cascade additionally involves adaptors such as TRIF/TICAM- 1 which can signal the IRF-3 pathway to increase Type 1 IFN production, activate Stats, increase IRF-1 gene expression, and activate ISRE's, interferon response factor (IRF) elements.
  • adaptors such as TRIF/TICAM- 1 which can signal the IRF-3 pathway to increase Type 1 IFN production, activate Stats, increase IRF-1 gene expression, and activate ISRE's, interferon response factor (IRF) elements.
  • injection of dsRNA or single strand RNA with its replication can activate viral kinases, bypass TLR, activate PKR and IRF-3, and initiate the NF- ⁇ B and Type 1 IFN cascades, which, by the autocrine/paracrine action of type 1 IFNs, the cytokines and the chemokines can initiate the innate immune-adaptive immune response sequence.
  • Transplantation rejection refers to the transplant of any organ or body part resulting in organ or tissue graft rejection, allograft rejection, and graft-versus-host disease, including but not limited to, heart, kidney, liver, lung, bone marrow, cornea and skin transplants.
  • Treat,” “treating,” “treatment,” and “therapy” as used herein refer to any curative therapy, prophylactic therapy, ameliorative therapy and preventative therapy for a subject.
  • vasoactive agent refers to any therapeutic agent capable of relaxing vascular and/or nonvascular smooth muscle. Suitable vasoactive agents include, but are not limited to, potassium channel activators, calcium channel blockers, beta-blockers, long and short acting alpha-adrenergic receptor antagonists, prostaglandins, phosphodiesterase inhibitors, adenosine, ergot alkaloids, vasoactive intestinal peptides, dopamine agonists, opioid antagonists, endothelin antagonists, thromboxane inhibitors and the like.
  • RNA viral infections include, but are not limited to, orthomyxoviridae, paramyxoviridae, picornaviridae, rhabdoviridae, coronavaridae, togaviridae, bunyaviridae, arenaviridae and reteroviridae.
  • the DNA viral infections include, but are not limited to, adenoviridae, proxviridae, papovaviridae, herpetoviridae and herpesviridae.
  • the viral infections include, but are not limited to, double or single strand RNA viruses such as flu viruses, hepatitis virus, enteroviruses, and Coxsackie viruses, viruses of the herpetoviridae family, such as, for example, herpes simplex viruses HSV- 1 and HSV-2, cytomegalovirus (CMV), herpes varicella-zoster (VZV), Epstein-Barr (EBV), HHV6, HHV7, pseudorabies and rhinotracheitis, and the like.
  • RNA viruses such as flu viruses, hepatitis virus, enteroviruses, and Coxsackie viruses
  • viruses of the herpetoviridae family such as, for example, herpes simplex viruses HSV- 1 and HSV-2, cytomegalovirus (CMV), herpes varicella-zoster (VZV), Epstein-Barr (EBV), HHV6, HHV7, pseudorabies and rhinotracheitis, and the like.
  • the present invention relates to the treatment of TLR3 as well as TLR4 mediated diseases and related pathologies.
  • This invention relates to the treatment of TLR3-mediated diseases, including Hashimoto's thyroiditis, Type I diabetes, and insulinitis but is not limited to these.
  • This invention relates to the treatment of TLR4-mediated diseases, including toxic shock, atherosclerosis, vascular diseases associated with hyperlipidemia, ulcerative colitis, and Crohn's disease, but is not limited to these.
  • the present invention also relates to the treatment of TLR mediated diseases and related pathologies, e.g. TLR9, which involve pathologic expression of MyD88-independent signaling involving activation of the IRF-3/Type I IFN signal pathway as in diseases including but not limited to systemic lupus and rheumatoid arthritis.
  • the present invention relates to the treatment of TLR3 as well as TLR4 mediated diseases in nonimmune cells, monocytes, macrophages, or dendritic cells and related pathologies.
  • This invention relates to the treatment of TLR3-mediated diseases in nonimmune cells, monocytes, macrophages, or dendritic cells, including Hashimoto's thyroiditis, Type I diabetes, and insulinitis but is not limited to these.
  • This invention relates to the treatment of TLR4-mediated diseases in nonimmune cells, monocytes, macrophages, or dendritic cells including toxic shock, atherosclerosis, vascular diseases associated with hyperlipidemia, ulcerative colitis, and Crohn's disease, but is not limited to these.
  • the present invention relates to the treatment of TLR mediated diseases with abnormal IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies.
  • This invention thus relates to the treatment of TLR-mediated diseases, including Graves' disease, systemic lupus, rheumatoid arthritis, autoimmune uveitis, autoimmune blepharitis, and psoriasis, wherein there is abnormal TLR signaling through this pathway, but is but is not limited to these.
  • the present invention relates to the treatment of TLR mediated diseases with abnormal IRF-3, Type-1 IFN, STAT, and IRF-1 signaling in nonimmune cells, monocytes, macrophages, or dendritic cells and related pathologies.
  • This invention thus relates to the treatment of TLR-mediated diseases in nonimmune cells, monocytes, macrophages, or dendritic cells, including Graves' disease, systemic lupus, rheumatoid arthritis, autoimmune uveitis, autoimmune blepharitis, and psoriasis, wherein there is abnormal TLR signaling in nonimmune cells, monocytes, macrophages, or dendritic cells through this pathway, but is not limited to these.
  • This invention also relates to treating a subject having a disease or condition associated with an autoimmune inflammatory disease induced by abnormal Toll-like receptor 3 or TLR4 expression or signaling induced by viruses are noxious agents that enter the cell and cause abnormal NF- ⁇ B and IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies as exemplified by diseases with increased Type 1 IFN levels in the serum.
  • This invention also relates to treating a subject having a disease or condition associated with an autoimmune inflammatory disease induced by abnormal Toll-like receptor expression or signaling caused by phagocytosis of infectious or noxious agents that enter the cell and cause abnormal TLR-mediated expression of IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies as exemplified by diseases with increased Type 1 IFN levels in the serum.
  • This invention also relates to treating a subject having a disease or condition associated with an autoimmune inflammatory disease induced by abnormal Toll-like receptor 3 or TLR4 expression or signaling in a nonimmune cell, monocyte, macrophage, or dendritic cell induced by viruses or noxious agents that enter the cell and cause abnormal NF- ⁇ B and IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies as exemplified by diseases with increased Type 1 IFN levels in the serum.
  • This invention also relates to treating a subject having a disease or condition associated with an autoimmune inflammatory disease induced by abnormal Toll-like receptor expression or signaling in a nonimmune cell, monocyte, macrophage, or dendritic cell caused by phagocytosis of infectious or noxious agents that enter the cell and cause abnormal NF- ⁇ B and IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies as exemplified by diseases with increased Type 1 IFN levels in the serum.
  • This invention also relates to treating a subject having a disease or condition associated with an autoimmune inflammatory disease induced by abnormal Toll-like receptor 3 or TLR4 expression or signaling induced by viruses or noxious agents that enter the cell and cause abnormal IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related pathologies as exemplified by diseases with increased Type 1 IFN levels in the serum.
  • the present invention also provides for methods of treating such disease comprising administering to a patient in need of such treatment a therapeutically effective amount of one or more compound selected from methimazole (MMI), phenylmethimazole, and tautomeric cyclic thione compounds and active derivatives thereof of the present invention capable of preventing, ameliorating or inhibiting pathologies that are mediated or associated with Toll-like receptor 3 or Toll-like receptor 4 overexpression, activation, and signaling or both together.
  • MMI methimazole
  • phenylmethimazole phenylmethimazole
  • tautomeric cyclic thione compounds and active derivatives thereof of the present invention capable of preventing, ameliorating or inhibiting pathologies that are mediated or associated with Toll-like receptor 3 or Toll-like receptor 4 overexpression, activation, and signaling or both together.
  • the invention provides methods of inhibiting a TLR3-or TLR4 mediated autoimmune-inflammatory response comprising administering an amount of a therapeutically effective amount of a phenylmethimazole, methimazole derivative, and/or tautomeric cyclic thione compound.
  • the immune response may be an inflammatory response.
  • the immune response may be a leukocyte response. More specifically, the immune response may include one or more of: directed leukocyte migration; leukocyte superoxide production; leukocyte degranulation including but not limited to neutrophil elastase exocytosis; and, leukocyte transmigration and/or leukocyte extravasation.
  • Leukocytes can be selected from the group consisting of neutrophils, eosinophils, basophils, T-lymphocytes, B-lymphocytes, monocytes, macrophages, dendritic cells, Langerhans cells, and mast cells.
  • an “endogenous factor” is defined as a product which is synthesized by host cells, e.g., cells of the individual being treated.
  • tumor necrosis factor- ⁇ TNF- ⁇
  • complement factor C3a complement factor C5a
  • chemokine CXCL1 chemokine CXCL2
  • chemokine CXCL3 chemokine CXCL4
  • chemokine CXCL5 chemokine CXCL5
  • chemokine CXCL5 chemokine CXCL5
  • chemokine CXCL5 chemokine CXCL5a
  • chemokine CXCL5a chemokine CXCL1 ⁇
  • chemokine CXCL2 chemokine CXCL3, chemokine CXCL4, chemokine CXCL5, chemokine CXCL6, chemokine CXCL7
  • the therapeutic methods of the invention include methods for the amelioration of conditions associated with inflammatory cell activation.
  • “Inflammatory cell activation” refers to the induction by a stimulus (including but not limited to, cytokines, antigens or auto-antibodies) of a proliferative cellular response, the production of soluble mediators (including but not limited to cytokines, oxygen radicals, enzymes, prostanoids, growth factors, or vasoactive amines), or cell surface expression of new or increased numbers of mediators (including but not limited to, major histocompatibility antigens or cell adhesion molecules) in inflammatory cells (including but not limited to monocytes, macrophages, T lymphocytes, B lymphocytes, granulocytes (polymorphonuclear leukocytes including neutrophils, basophils, and eosinophils) mast cells, dendritic cells, Langerhans cells, or nonimmune cells that become antigen presenting cells (including but not limited to smooth muscle cells, end
  • the invention provides methods of treating various inflammatory conditions including but not limited to arthritic diseases such as rheumatoid arthritis (RA), osteoarthritis, gouty arthritis, spondylitis, and reactive arthritis; Behcet's syndrome; sepsis; septic shock; endotoxic shock; gram negative sepsis; gram positive sepsis; toxic shock syndrome; multiple organ injury syndrome secondary to septicemia, trauma, or hemorrhage; ophthalmic disorders including but not limited to allergic conjunctivitis, vernal conjunctivitis, uveitis, blepharitis, and thyroid-associated ophthalmopathy; eosinophilic granuloma; pulmonary or respiratory conditions including but not limited to asthma, chronic bronchitis, allergic rhinitis, adult respiratory distress syndrome (ARDS), severe acute respiratory syndrome (SARS), chronic pulmonary inflammatory diseases (e.g., chronic obstructive pulmonary disease), silico
  • the invention provides methods for the use of the methimazole derivatives and tautomeric cyclic thione compounds of the present invention for the preparation of a medicament for the treatment or prevention of one or more of the following diseases, pathological disorders or conditions from the group consisting of: asthma of whatever type, etiology or pathogenesis, or asthma selected from the group consisting of atopic asthma, non-atopic asthma, allergic asthma, atopic, bronchial, IgE-mediated asthma, bronchial asthma, essential asthma, true asthma, intrinsic asthma caused by patho-physiological disturbances, extrinsic asthma caused by environmental factors, essential asthma of unknown or unapparent cause, non-atopic asthma, bronchitic asthma, emphysematous asthma, exercise-induced asthma, occupational asthma, infective asthma caused by bacterial, fungal, protozoal, or viral infection, non-allergic asthma, incipient asthma and whez infant syndrome; chronic or acute bronchoconstriction, chronic bronchitis, small airway obstruction and e
  • methimazole derivatives and tautomeric cyclic thione compounds of the present invention are suitable for the treatment of (1) inflammatory diseases and conditions, including joint inflammation, rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis, inflammatory bowel disease, ulcerative colitis, chronic glomerulonephritis, dermatitis, atherosclerosis, the vascular complications of Type 2 diabetes, and Crohn's disease, (2) respiratory diseases and conditions, including asthma, acute respiratory distress syndrome, chronic pulmonary inflammatory disease, bronchitis, chronic obstructive airway disease and silicosis, (3) infectious diseases and conditions, including sepsis, septic shock, endotoxic shock, Gram-negative sepsis, toxic shock syndrome, fever and myalgias due to bacterial, viral or fungal infection, and influenza, (4) immune diseases and conditions, including autoimmune diabetes, systemic lupus erythematosis, GvH reaction, rejection of foreign transplants, multiple organ damage
  • the treatment methods of the invention are useful in the fields of human medicine and veterinary medicine.
  • the individual to be treated may be a mammal, preferably human, or other animals.
  • individuals include but are not limited to farm animals including cows, sheep, pigs, horses, and goats; companion animals such as dogs and cats; exotic and/or zoo animals; laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters; and poultry such as chickens, turkeys, ducks, and geese.
  • the present invention relates to, but is not limited to, pre- or postoperative intervention in animals such as horses to prevent or treat toxic shock syndromes.
  • compositions of the present invention comprise specifically defined methimazole derivatives and tautomeric cyclic thiones, used in a safe and effective amount, together with a pharmaceutically acceptable carrier.
  • methimazole derivatives used in the compositions of the present invention are those having the following structural formulae:
  • Y is selected from H, C 1 -C 4 alkyl C 1 -C 4 substituted alkyl, —NO 2 , and the phenyl moiety:
  • R 1 is selected from H, —OH, halogens (F, Cl, Br or I), C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl, C 1 -C 4 ester or C 1 -C 4 substituted ester;
  • R 2 is selected from H, C 1 -C 4 alkyl or C 1 -C 4 substituted alkyl;
  • R 3 is selected from H, C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl or —CH 2 Ph (wherein Ph is phenyl);
  • R 4 is selected from H, C 1 -C 4 alkyl or C 1 -C 4 substituted alkyl;
  • X is selected from S or O;
  • Z is selected from —SR 3 , —OR 3 , S(O)R 3 or C 1 -C 4 alkyl; and wherein at least two of the R 2 and R 3 groups on said compound are C 1 -
  • Y is preferably H, the phenyl moiety or —NO 2 , and is most preferably H or the phenyl moiety
  • R 1 is selected from H, —OH, halogens (F, Cl, Br and I), C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl, C 1 -C 4 ester and C 1 -C 4 substituted ester; preferably R 1 is H, —OH, halogen, —OOCCH 2 M (where M is H or a halogen); and is most preferably H.
  • R 2 is selected from H, C 1 -C 4 alkyl and C 1 -C 4 substituted alkyl; preferably one or both of the R 2 groups is methyl.
  • substituted alkyl or “substituted ester” is intended to include alkyl, aryl or ester groups which are substituted in one or more places with hydroxyl or alkoxyl groups, carboxyl groups, halogens, nitro groups, amino or acylamino groups, and mixtures of those moieties.
  • Preferred “substituted alkyl” groups are C 1 -C 4 hydroxyl or alkoxyl groups, as well as groups substituted with halogens.
  • R 3 groups in the above formulae are selected from H, C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl and —CH 2 Ph (wherein Ph is phenyl); in preferred compounds, R 3 is H or C 1 -C 4 alkyl; most preferably R 3 is C 1 -C 4 alkyl, particularly methyl. R 4 is selected from H, C 1 -C 4 alkyl and C 1 -C 4 substituted alkyl, and preferably is H.
  • X may be S or O, and is preferably S.
  • Z is selected from C 1 -C 4 alkyl, —SR 3 , —S(O)R 3 and —OR 3 , is preferably —SR 3 , —OR 3 , and —S(O)R 3 ; most preferably —SR 3 and —OR 3 ; and particularly —SR 3 .
  • at least two of the R 2 and R 3 groups on the compound must be C 1 -C 4 alkyl when Y is not a phenyl moiety. Further, at least one of the Y groups should be —NO 2, , when Z is C 1 -C 4 alkyl.
  • R 5 , R 6 ⁇ CH 3 , CH 3 ; Ph, H; H, Ph
  • R 8 ⁇ O, S, NH, NCH 3
  • Preferred compounds for use in the compositions of the present invention include those having the formulae:
  • compositions include those having the formulae:
  • R 10 is selected from H. NO 2 , Ph, 4-HOPh and 4-m-Ph (wherein m is F, Cl, Br, or I).
  • a particularly preferred subset of the pharmaceutical compounds defined herein are those wherein one of the Y groups is the phenyl moiety defined above. These compounds have the following formulae:
  • Y is selected from H, C 1 -C 4 alkyl and C 1 -C 4 substituted alkyl, and is preferably H.
  • R 1 is selected from H, —OH, halogens (F, Cl, Br and I), C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl, C 1 -C 4 ester, and C 1 -C 4 substituted ester, and is preferably H, —OH, halogen, —OOCCH 2 M (where) M is H or a halogen), and is not preferably H.
  • R 2 is selected from H, C 1 -C 4 alkyl and C 1 -C 4 substituted alkyl, and it is preferred that at least one of the R 2 groups be methyl.
  • R 3 is selected from H, C 1 -C 4 alkyl, C 1 -C 4 substituted alkyl, and —CH 2 Ph; preferred R 3 moieties are H and methyl.
  • R 4 is selected from H, C 1 -C 4 alkyl and C 1 -C 4 substituted alkyl, and is preferably H.
  • X is selected from S and O, and is preferably S.
  • the Z moiety is selected from —SR 3 and —OR 3 , and is preferably —SR 3 .
  • Particularly preferred compounds are those having the structural formulae:
  • R 9 is selected from —OH, —M and —OOCCH 2 M; and M is selected from F, Cl, Br and I.
  • methimazole derivatives and tautomeric cyclic thiones described above can be synthesized using techniques well known to those skilled in the art. For example, the synthesis of several tautomeric cyclic thiones is described in Kjellin and Sandstrom, (G. Kjellin, et al., Acta Chem Scand, 23:2879-2887 (1969)), incorporated herein by reference.
  • a representative methimazole derivative may be synthesized using the following procedure.
  • Appropriately substituted analogs of acetaldehyde are brominated in the 2-position by treatment with bromine and UV light, followed by formation of the corresponding diethylacetal using absolute ethanol.
  • the bromine is then displaced from this compound by treatment with anhydrous methylamine, or other suitable amine, in a sealed tube at about 120° for up to about 16 hours.
  • methimazole derivative compounds of the present invention are shown in Table 16. TABLE 16 Structure of Compounds. Com- pounds Imidazole #1 1-Methylimidazole-2-thiol (Methimazole) C 4 H 6 N 2 S; 1-Methyl-2- mercaptoimidazole (MMI) #2 2-Methyl-5-nitro-1- imidazole ethanol (Metronidazole) C 6 H 9 N 3 O 3 ; MW: 171.16 #3 2-Mercaptoimidazole MW: 100.14 #4 2-Mercaptobenzimidazole MW: 150.20 #5 2-Mercapto-5- nitrobenzimidazole MW: 195.20 #6 2-Mercapto-5- methylbenzimidazole MW: 164.23 #7 S-Methylmethimazole C 5 H 8 N 2 S; MW: 128.20 B.
  • compositions of the present invention comprise a safe and effective amount of one or more of the methimazole derivatives or tautomeric cyclic thione compounds (i.e., the active compounds).
  • Preferred compositions contain from about 0.01% to about 25% of the active compounds, with most preferred compositions containing from about 0.1% to about 10% of the active compounds.
  • the pharmaceutical compositions of the present invention may be administered in any way conventionally known, for example, intraperitoneally, intravenously, intramuscularly, or topically, although oral administration is preferred.
  • Preferred compositions are in unit dosage form, i.e., pharmaceutical compositions, which are available in a pre-measured form suitable for single dosage administration without requiring that the individual dosage be measured out by the user, for example, pills, tablets or ampules.
  • compositions of the present invention additionally include a pharmaceutically-acceptable carrier compatible with the methimazole derivatives or tautomeric cyclic thiones described above.
  • a pharmaceutically-acceptable carrier compatible with the methimazole derivatives or tautomeric cyclic thiones described above.
  • the pharmaceutical compositions may contain, at their art accepted levels, additional compatible ingredients, such as additional pharmaceutical actives, excipients, formulational aids (e.g., tabletting aids), colorants, flavorants, preservatives, solubilizing or dispersing agents, and other materials well known to those skilled in the art.
  • the term “pharmaceutical carrier” denotes a solid or liquid filler, diluent or encapsulating substance. These materials are well known to those skilled in the pharmaceutical arts.
  • Some examples of the substances which can serve as pharmaceutical carriers are sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; stearic acid; magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and oil of theobroma; polyols, such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; agar; alginic acid; pyrogen-free water; isotonic saline;
  • liposomes or drug carriers made lipids or polymeric particles, including biodegradable polymers, or targeted delivery applications, e.g., coupling to antibodies.
  • Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, tableting agents, and preservatives, can also be present. They may include excipients such as cyclodextrins to improve aqueous solubilization. Formulation of the components into pharmaceutical compositions is done using conventional techniques.
  • the pharmaceutical carrier employed in conjunction with the pharmaceutical compositions of the present invention is used at a concentration sufficient to provide a practical size-to-dosage relationship.
  • the pharmaceutical carrier comprises from about 25% to about 99.99%, preferably from about 50% to about 99.9%, by weight of the total pharmaceutical composition.
  • the conditions treated with the pharmaceutical compositions of this invention generally include any autoimmune-inflammatory disease mediated by or associated with TLR3 or TLR4 overexpression or signaling, particularly in, but not limited to nonimmune cells, monocytes, macrophages, or dendritic cells, or both TLR3 or TLR4 overexpression or signaling, for example, but not limited to, Hashimoto's thyroiditis, insulinitis, Type 1 diabetes, atherosclerosis, vascular complications of type 1 or 2 diabetes, vascular complications associated with obesity or hyperlipidemias, toxic shock, colitis, or IBD and the various symptoms that fall within a definition of IBD.
  • the formulations are administered to achieve a therapeutic effect.
  • a once-a-day regimen is possible.
  • multiple doses such as up to three doses per day, typically, may offer more effective therapy.
  • a single dose or a multidose regimen may be used.
  • the conditions treated with the pharmaceutical compositions of this invention generally include any autoimmune-inflammatory disease mediated by or associated with TLR overexpression or signaling, particularly in, but not limited to nonimmune cells, monocytes, macrophages, or dendritic cells which phagocytose infectious or noxious environmental agents inducing TLR overexpression or signaling, for example, but not limited to, systemic lupus erythematosis, Graves' disease, autoimmune blepharitis.
  • the formulations are administered to achieve a therapeutic effect. For those compounds that exhibit a long residency in the body, a once-a-day regimen is possible. Alternatively, multiple doses, such as up to three doses per day, typically, may offer more effective therapy. Thus, a single dose or a multidose regimen may be used
  • the present invention also provides for methods of diagnosing, treating, and following therapeutic intervention in any autoimmune-inflammatory disease mediated by or associated with TLR3 or TLR4 overexpression or signaling, particularly in, but not limited to nonimmune cells, monocytes, macrophages, or dendritic cells, or both TLR3 or TLR4 overexpression or signaling, for example, but not limited to, Hashimoto's thyroiditis, insulinitis, Type 1 diabetes, atherosclerosis, vascular complications of type 1 or 2 diabetes, vascular complications associated with obesity or hyperlipidemias, toxic shock, colitis, or IBD and the various symptoms that fall within a definition of IBD.
  • TLR3 or TLR4 overexpression or signaling particularly in, but not limited to nonimmune cells, monocytes, macrophages, or dendritic cells, or both TLR3 or TLR4 overexpression or signaling, for example, but not limited to, Hashimoto's thyroiditis, insulinitis, Type 1 diabetes, atherosclerosis, vascular complications of
  • ulcerative colitis which is a disease of the large intestine characterized by overexpressed TLR4 and TLR4 signaling in intestinal epithelial cells, monocytes, macrophages, and dendritic cells involves chronic diarrhea with cramping abdominal pain, rectal bleeding, and loose discharges of blood, pus and mucus. The manifestations of this disease vary widely. A pattern of exacerbations and remissions typifies the clinical course of most ulcerative colitis patients (70%), although continuous symptoms without remission are present in some patients with ulcerative colitis. Systemic complications of ulcerative colitis include arthritis, eye inflammation such as uveitis, skin ulcers and liver disease. In addition, ulcerative colitis and especially long-standing, extensive disease is associated with an increased risk of colon carcinoma.
  • Type I diabetes is an autoimmune inflammatory disease of the pancreas characterized by overexpressed TLR3 and TLR3 signaling in pancreatic P cells, monocytes, macrophages, and dendritic cells, characterized by a prolonged inflammatory state or insulinitis, a honeymoon period or lag phase with islet cell and GAD auto-antibodies, a destructive phase resulting in loss of insulin secretion, hyperglycemia, hyperlipidemia, and tissue complications such as macro- and microvascular diseases including atherosclerosis, strokes, myocardial infarcts, nephropathy, neuropathy, retinopathy, and higher incidences of autoimmune thyroid disease and cancer.
  • the pharmaceutical composition is administered in such a manner so that compound is delivered into the patient's bloodstream.
  • intravenous administration ranges from about 0.01 mg/kg/hour of active amide compound to about 100 mg/kg/hour, all for from about 1 to about 120 hours and especially 1 to 96 hours.
  • a preloading bolus of from about 0.001 to about 500 mg may also be administered to achieve adequate steady state levels.
  • Other forms of parenteral administration, such as intramuscular or intraperitoneal injection can be used, as well. In this case, similar dose levels are employed.
  • oral dosing With oral dosing, one to three oral doses per day, each from about 0.001 to about 150 mg/kg of active compound are employed, with preferred doses being from about 0.05 to about 100 mg/kg.
  • rectal dosing one to three rectal doses per day, each from about 1 to about 150 mg/kg of active compound are employed, with preferred doses being from about 1 to about 100 mg/kg.
  • the health care professional should assess the patient's condition and determine whether or not the patient would benefit from treatment. Some degree of routine dose optimization may be required to determine an optimal doing level and pattern. A positive dose-response relationship has been observed. As such and bearing in mind the severity of the side effects and the advantages of providing maximum possible amelioration of symptoms, it may be desired in some settings to administer large amounts of active compound, such as those described above.
  • compositions of the present invention are administered such that appropriate levels of pharmaceutical active are achieved in the bloodstream.
  • dosage level required in a given case will depend upon, for example, the particular methimazole derivative used, the nature of the disease being treated, and the size, weight, age and physical condition of the patient.
  • salts derived from inorganic bases include: aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc, and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium, and sodium salts.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include: salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as arginine, betaine, caffeine, choline, N,N′-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine, and the like.
  • basic ion exchange resins such
  • salts may be prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids.
  • acids include: acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic acid, and the like.
  • Particularly preferred are citric, hydrobromic, hydrochloric, maleic, phosphoric, sulfuric, and tartaric acids. It will be understood that, as used herein, the compounds referred to herein are meant to also include the pharmaceutically acceptable salts.
  • prophylactic or therapeutic dose of the therapeutic compound of the present invention will, of course, vary with the nature of the severity of the condition to be treated and with the particular therapeutic compound of the present invention and its route of administration. It will also vary according to the age, weight and response of the individual patient. In general, the daily dose range lie within the range of from about 0.001 mg to about 100 mg per kg body weight of a mammal, preferably 0.01 mg to about 50 mg per kg, and most preferably 0.1 to 10 mg per kg, in single or divided doses. On the other hand, it may be necessary to use dosages outside these limits in some cases.
  • a suitable dosage range is from about 0.001 mg to about 25 mg (in another embodiment from 0.01 mg to about 1 mg) of a therapeutic compound of the present invention per kg of body weight per day and for cytoprotective use from about 0.01 mg to about 100 mg (in another embodiment from about 0.1 mg to about 100 mg and in another embodiment from about 1 mg to about 10 mg) of the therapeutic compound of the present invention per kg of body weight per day.
  • a suitable dosage range is, e.g. from about 0.01 mg to about 100 mg of the therapeutic compound of the present invention per kg of body weight per day, in another embodiment from about 0.1 mg to about 10 mg per kg and for cytoprotective use from 0.1 mg to about 100 mg (in another embodiment from about 1 mg to about 100 mg and in another embodiment from about 10 mg to about 100 mg) of a therapeutic compound of the present invention per kg of body weight per day.
  • the present invention utilizes pharmaceutical formulation techniques to provide compositions of a methimazole derivatives and tautomeric cyclic thiones for treating the inflammatory and/or autoimmune diseases or autoimmune-inflammatory disease mediated by or associated with overexpression of TLR3 or TLR3 signaling, TLR4 or TLR4 signaling, or both in nonimmune cells, monocytes, macrophages, or dendritic cells including but not limited to Hashimoto's thyroiditis, insulinitis, Type 1 diabetes, atherosclerosis, vascular complications of diabetes, obesity, or hyperlipidemias, toxic shock, colitis, IBD, autoimmune uveitis, autoimmune blepharitis, psoriasis, as hereinbefore defined.
  • compositions of a methimazole derivatives and tautomeric cyclic thiones for treating the inflammatory and/or autoimmune diseases or autoimmune-inflammatory disease mediated by or associated with overexpression of TLR signaling involving over expressed IRF-3/Type 1 IFN/STAT/IRF-1/and genes with ISREs in nonimmune cells, monocytes, macrophages, or dendritic cells including but not limited to systemic lupus and rheumatoid arthritis.
  • the dosage and dose rate of the compounds of this invention effective to prevent, suppress or inhibit diseases will depend on a variety of factors, such as the nature of the inhibitor, the size of the patient, the goal of the treatment, the nature of the pathology to be treated, the specific pharmaceutical composition used, and the judgment of the treating physician.
  • the transit time through the gastro-intestinal canal for different dosage forms are rather well known.
  • the transit through the small intestine takes 3 to 5 hours.
  • the residence time in the large intestine is considerably longer, 25 to 50 hours.
  • no release should occur. If colitis in the small intestine is going to be treated the release should continue during about 5 hours after the dosage form has left the stomach. If the large intestine is going to be treated, the local release should ideally start at caecum, and continue for up to 50 hours.
  • composition as in pharmaceutical composition, is intended to encompass a product comprising the active ingredient (s), and the inert ingredient (s) (pharmaceutically acceptable excipients) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients.
  • pharmaceutical compositions of the present invention encompass any composition made by mixing a compound of the present invention, additional active ingredient (s), and pharmaceutically acceptable excipients.
  • Any suitable route of administration may be employed for providing a mammal, especially a human with an effective dosage of a compound of the present invention.
  • oral, rectal, topical, parenteral, ocular, pulmonary, nasal, and the like may be employed.
  • Dosage forms include tablets, troches, dispersions, suspensions, solutions, capsules, creams, ointments, aerosols, and the like. They may be conveniently presented in unit dosage form and prepared by any of the methods well-known in the art of pharmacy.
  • the compounds of the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or nebulizers.
  • the compounds may also be delivered as powders, which may be formulated and the powder composition may be inhaled with the aid of an insufflation powder inhaler device.
  • the preferred delivery systems for inhalation are metered dose inhalation (MDI) aerosol, which may be formulated as a suspension or solution of a compound of the present invention in suitable propellants, such as fluorocarbons or hydrocarbons and dry powder inhalation (DPI) aerosol, which may be formulated as a dry powder of a compound of the present invention with or without additional excipients.
  • suitable topical formulations include transdermal devices, aerosols, creams, ointments, lotions, dusting powders, and the like.
  • the compounds of the present invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be coated by standard aqueous or nonaqueous techniques.
  • the therapeutic compound of the present invention may also be administered by controlled release means and/or delivery devices such as those described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598,123; 3,630,200 and 4,008,719.
  • compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in-oil liquid emulsion.
  • Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active ingredient with the carrier, which constitutes one or more necessary ingredients.
  • the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
  • a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent.
  • Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
  • each tablet contains from about 1 mg to about 500 mg of the active ingredient and each cachet or capsule contains from about 1 to about 500 mg of the active ingredient.
  • a compound as described herein or pharmaceutical composition thereof can be utilized for modulating the activity of TLR3/4 mediated diseases, conditions and/or disorders as described herein.
  • modulating the activity of TLR3/4 mediated diseases include the prophylaxis or treatment of metabolic related disorders such as, but not limited to, type I diabetes, type II diabetes, inadequate glucose tolerance, insulin resistance, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, dyslipidemia and syndrome X.
  • TLR3/4 mediated diseases include the prophylaxis or treatment of obesity and/or overweight by decreasing food intake, inducing satiation (i.e., the feeling of fullness), controlling weight gain, decreasing body weight and/or affecting metabolism such that the recipient loses weight and/or maintains weight.
  • a compound as described herein or pharmaceutical composition thereof can be utilized for modulating the activity of TLR mediated diseases, conditions and/or disorders as described herein with increased signaling involving IRF-3/Type 1 IFN/STAT/IRF-1/and ISRE containing genes.
  • TLR mediated diseases examples include the prophylaxis or treatment of such disorders as, but not limited to, systemic lupus, rheumatoid arthritis, coliutis, Crohn's disease, or other inflammatory disorders.
  • another aspect of the present invention includes methods of prophylaxis and/or treatment of a metabolic related disorder or a weight related disorder, such as obesity, comprising administering to an individual in need of prophylaxis and/or treatment a therapeutically effective amount of a compound of the present invention, in combination with one or more additional pharmaceutical agent as described herein.
  • Suitable pharmaceutical agents that can be used in combination with the compounds of the present invention include anti-obesity agents such as apolipoprotein-B secretion/microsomal triglyceride transfer protein (apo-B/MTP) inhibitors, MCR-4 agonists, cholescystokinin-A (CCK-A) agonists, serotonin and norepinephrine reuptake inhibitors (for example, sibutramine), sympathomimetic agents, beta-3 adrenergic receptor agonists, dopamine agonists (for example, bromocriptine), melanocyte-stimulating hormone receptor analogs, cannabinoid 1 receptor antagonists [for example, SR141716: N-(piperidin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide], melanin concentrating hormone antagonists, leptons (the OB protein), lep
  • GPP human agouti-related proteins
  • ghrelin receptor antagonists ghrelin receptor antagonists
  • histamine 3 receptor antagonists or reverse agonists neuromedin U receptor agonists
  • noradrenergic anorectic agents for example, phentermine, mazindol and the like
  • appetite suppressants for example, bupropion
  • anti-obesity agents are used in conjunction with the present methods, selected from the group consisting of orlistat, sibutramine, bromocriptine, ephedrine, leptin, and pseudoephedrine.
  • compounds of the present invention and combination therapies are administered in conjunction with exercise and/or a sensible diet.
  • the methods of the invention may comprise administering a therapeutically effective amount of phenylmethimazoles, methimazole derivatives, and/or tautomeric cyclic thiones with one or more of TNF, IL-1, IL-2, IL-3, IL4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-I, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IFN, G-CSF, Meg-CSF, GM-CSF, thrombopoietin, stem cell factor, and erythropoietin or antibodies thereto.
  • Compositions in accordance with the invention may also include other known angiopoietins such as Ang-2, Ang-4, and Ang-Y, growth factors such as bone morphogenic protein-1, bone morphogenic protein-2, bone morphogenic protein-3, bone morphogenic protein-4, bone morphogenic protein-5, bone morphogenic protein-6, bone morphogenic protein-7, bone morphogenic protein-8, bone morphogenic protein-9, bone morphogenic protein-10, bone morphogenic protein-11, bone morphogenic protein-12, bone morphogenic protein-13, bone morphogenic protein-14, bone morphogenic protein-15, bone morphogenic protein receptor IA, bone morphogenic protein receptor IB, brain derived neurotrophic factor, ciliary neutrophic factor, ciliary neutrophic factor receptor a, cytokine-induced neutrophil chemotactic factor 1, cytokine-induced neutrophil chemotactic factor 2 ⁇ , cytokine-induced neutrophil chemotactic factor 2 ⁇ , ⁇ endothelial cell growth factor, end
  • Compounds of the present invention may be used in combination with other drugs that are used in the treatment/prevention/suppression or amelioration of the diseases or conditions for which compounds of the present invention are useful.
  • Such other drugs may be administered, by a route and in an amount commonly used therefore, contemporaneously or sequentially with a compound of the present invention, such as methimazole derivatives and tautomeric cyclic thiones.
  • a pharmaceutical composition containing such other drugs in addition to the compound of the present invention is preferred.
  • the pharmaceutical compositions of the present invention include those that also contain one or more other active ingredients, in addition to a compound of the present invention.
  • Examples of other active ingredients that may be combined with a compound of the present invention, either administered separately or in the same pharmaceutical compositions, include, but are not limited to: (a) VCAM-1, ICAM-1, or E-selectin antagonists; (b) steroids such as beclomethasone, methylprednisolone, betamethasone, prednisone, dexamethasone, and hydrocortisone; (c) immunosuppressants such as cyclosporin, tacrolimus, rapamycin and other FK-506 type immunosuppressants; (d) antihistamines (HI-histamine antagonists) such as brompheniramine, chlorpheniramine, dexchlorpheniramine, triprolidine, clemastine, diphenhydramine, diphenylpyraline, tripelennamine, hydroxyzine, methdilazine, promethazine, trimeprazine, azatadine, cyproheptadine, ant
  • Prophylaxis or treatment of one or more of the diseases cited herein include the use of one or more pharmaceutical agents known in the art belonging to the classes of drugs referred to, but not limited to, the following: sulfonylureas, meglitinides, biguanides, ⁇ -glucosidase inhibitors, peroxisome proliferators-activated receptor- ⁇ (i.e., PPAR- ⁇ ) agonists, insulin, insulin analogues, HMG-CoA reductase inhibitors, cholesterol-lowering drugs (for example, fibrates that include: fenofibrate, bezafibrate, gemfibrozil, clofibrate and the like; bile acid sequestrants which include: cholestyramine, colestipol and the like; and niacin), antiplatelet agents (for example, aspirin and adenosine diphosphate receptor antagonists that include: clopidogrel, ticlopidine and the like), angiotens
  • the compounds of the present invention can be used alone or in combination with one or more additional agents depending on the indication and the desired therapeutic effect.
  • additional agent may be selected from the group consisting of: insulin or an insulin mimetic, a sulfonylurea (such as acetohexamide, chlorpropamide, glimepiride, glipizide, glyburide, tolbutamide and the like) or other insulin secretagogue (such as nateglinide, repaglinide and the like), a thiazolidinedione (such as pioglitazone, rosiglitazone and the like) or other peroxisome proliferator-activated receptor (PPAR)- ⁇ agonist, a fibrate (such as bezafibrate, clofibrate, fenofibrate, gemfibrozol and the like) or other PPAR- ⁇ agonist
  • the additional agent (s) may be selected from the group consisting of: a nonsteroidal anti-inflammatory drug (NSAID) (such as diclofenac, diflunisal, ibuprofen, naproxen and the like), a cyclooxygenase-2 inhibitor (such as celecoxib, rofecoxib and the like), a corticosteroid (such as prednisone, methylprednisone and the like) or other immunosuppressive agent (such as methotrexate, leflunomide, cyclophosphamide, azathioprine and the like), a disease-modifying anti-rheumatic drug (DMARD) (such as injectable gold, penicilliamine, hydroxychloroquine, sulfasalazine and the like), a TNF- ⁇ inhibitor (such as etanercept, infliximab and
  • NSAID nonsteroidal anti-inflammatory drug
  • Preferred diseases that may be treated by the preferred methods include inflammatory or immunological disease, for example, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, asthma, acute respiratory distress syndrome, chronic obstructive pulmonary disease, or multiple sclerosis.
  • Additional preferred diseases that may be treated by the preferred methods include diabetes, hyperlipidemia, includes coronary heart disease, cancer or proliferative disease.
  • Another aspect of the invention is a method of treating diabetes and related diseases comprising the step of administering to a subject suffering from a diabetic or related condition a therapeutically effective amount of a methimazole derivative and/or tautomeric cyclic thione compound described herein.
  • the invention provides a method of treating inflammation or inflammatory diseases or diseases mediated by cytokines, PDE4, PDE3, p44/42 MAP kinase, iNOS and/or COX-2 by administering to a subject in need of such treatment an effective amount of a methimazole derivative and/or tautomeric cyclic thione compound described herein.
  • compositions containing a therapeutically effective amount of one or more methimazole derivative and/or tautomeric cyclic thione compounds described herein together with a pharmaceutically or physiologically acceptable carrier, for use in the treatments contemplated herein, are also provided.
  • the compounds of the invention are useful for the treatment of diabetes, characterized by the presence of elevated blood glucose levels, that is, hyperglycemic disorders such as diabetes mellitus, including both type 1 and 2 diabetes, as well as other hyperglycemic related disorders such as obesity, increased cholesterol, hyperlipidemia such as hypertriglyceridemia, kidney related disorders and the like.
  • hyperglycemic disorders such as diabetes mellitus, including both type 1 and 2 diabetes, as well as other hyperglycemic related disorders such as obesity, increased cholesterol, hyperlipidemia such as hypertriglyceridemia, kidney related disorders and the like.
  • the compounds are also useful for the treatment of disorders linked to insulin resistance and/or hyperinsulinemia, which include, in addition to diabetes, hyperandrogenic conditions such as polycystic ovary syndrome (Ibanez et al., J. Clin Endocrinol Metab, 85:3526-30, (2000); Taylor A.
  • the compounds of the present invention are also useful for the treatment of inflammation and immunological diseases that include those mediated by signaling pathways linked to pro-inflammatory cytokines, such as rheumatoid arthritis, ankylosing spondylitis, multiple sclerosis, inflammatory bowel disease, psoriasis, and contact and atopic dermatitis.
  • cytokines such as rheumatoid arthritis, ankylosing spondylitis, multiple sclerosis, inflammatory bowel disease, psoriasis, and contact and atopic dermatitis.
  • the immunostimulatory oligonucleotide and/or immunomer used in the method according to the invention comprises an immunostimulatory dinucleotide selected from the group consisting of CpG, C*pG, CpG*, and C*pG*, wherein C is cytidine or 2′-deoxycytidine, C* is 2′-deoxythymidine.
  • arabinocytidine 2′-deoxy-2′-substituted arabinocytidine, 2′-O-substitutedarabinocytidine, 2′-deoxy-5-hydroxycytidine, 2′-deoxy-N-4-alkyl-cytidine, 2′-deoxy-4-thiouridine, other non-natural pyrimidine nucleosides, or 1- (2′-deoxy-beta-D-ribofuranosyl-)-2-oxo-7-deaza-8-methyl-purine; G is guanosine or 2′-deoxyguanosine, G* is 2′ deoxy-7-deazaguanosine, 2′-deoxy-6-thioguanosine, arabinoguanosine, 2′-deoxy-2′-substituted-arabinoguanosine, 2′-O-substituted-arabinoguanosin-e, or other non-natural purine nucleoside, and p is an internu
  • ⁇ -adrenergic receptor antagonists block the action of the sympathetic nervous system and a portion of the involuntary nervous system. By blocking the action of these nerves, they reduce the heart rate and are useful in treating abnormally rapid heart rhythms. These drugs also reduce the force of heart muscle contractions and lower blood pressure. By reducing the heart rate and the force of muscle contraction, ⁇ -blockers reduce heart muscle oxygen demand.
  • Useful ⁇ -adrenergic blocking agents are selected from a group including atenolol, betaxolol, acebutolol, bisoprolol, carteolol, labetalol, metoprolol, nadolol, oxprenolol, penbutolol, pindolol, propranolol, sotalol, and timolol.
  • Atenolol is a presently preferred beta-adrenergic blocking agent.
  • This invention employs any effective cholesterol-lowering agent or combination of such agents in combination with the present methods.
  • Useful cholesterol-lowering agents include HMG CoA reductase inhibitors, bile acid sequestrants, probucol, and fibric acid agents.
  • the selective inhibitor of intestinal cholesterol absorption having the adopted name “ezetimibe,” and the chemical name 1-(4-fluorophenyl)-3(R)-[3-(4-fluorophenyl)-3(S)-hydroxypropyl]-4(S)-(4-hydroxyphenyl)-2-azetidinone.
  • Ezetimibe is particularly effective when administered together with a statin.
  • HMG CoA reductase inhibitors are competitive inhibitors of HMG CoA reductase, the rate-limiting step in cholesterol biosynthesis. They occupy a portion of the binding site of HMG CoA, blocking access of this substrate to the active site on the enzyme.
  • HMG CoA reductase inhibitors comprise atorvastatin, cerivistatin, fluindostatin, fluvastatin, lovastatin, mevastatin, pravastatin, simvastatin, and velostatin; the most preferred agents are lovastatin and pravastatin, particularly lovastatin.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include inhibitors of the renin-angiotensin system.
  • the renin-angiotensin system plays a major role in regulating blood pressure. Renin, an enzyme, functions by acting on angiotensinogen to form the decapeptide angiotensin I. Angiotensin I is rapidly converted to the octapeptide angiotensin II by angiotensin converting enzyme (ACE). Angiotensin II acts by numerous mechanisms to raise blood pressure, including raising total peripheral resistance.
  • Inhibitors of the renin-angiotensin system are classified as angiotensin converting enzyme (ACE) inhibitors and angiotensin II receptor antagonists (ARBs).
  • ACE angiotensin converting enzyme
  • ARBs angiotensin II receptor antagonists
  • angiotensin converting enzyme (ACE) inhibitors examples include captopril, cilazapril, delapril, enalapril, fentiapril, fosinopril, indolapril, lisinopril, perindopril, pivopril, quinapril, ramipril, spirapril, trandolapril, and zofenopril; preferred for use in this invention are captopril, enalapril, fosinopril, lisinopril, quinapril, ramipril, and trandolapril, and more preferred is enalapril.
  • ACE angiotensin converting enzyme
  • angiotensin II receptor antagonists include losartan, irbesartan, eprosartan, candesartan, valsartan, telmisartan, zolasartin, and tasosartan. Preferred is losartan.
  • angiotensin converting enzyme (ACE) inhibitors are more preferred over angiotensin II receptor antagonists.
  • Cyclooxygenase inhibitors are useful in the present invention, due to their ability to affect platelets; the most widely used and studied cyclooxygenase inhibitor is aspirin, which has been shown to prevent myocardial infarction and strokes due to thrombosis, when administered in low daily doses over a long term to patients at risk for cardiovascular events. When sufficient aspirin is present in the circulatory system, platelets that are being formed have an impaired ability to aggregate over their entire 7-10 day lifetimes.
  • Diuretics increase the rate of urine flow and sodium excretion and are used to adjust the volume and/or composition of body fluids in a variety of clinical situations, including hypertension, congestive heart failure, renal failure, nephritic syndrome and cirrhosis.
  • Diuretics can be selected from variety of classes such as inhibitors of carbonic anhydrase, loop diuretics, thiazides and thiazide-like diuretics, K+ sparing diuretics, and antagonists of mineralocorticoid receptors.
  • thiazides and thiazide-like derivatives are preferred diuretics, including bendroflumethazide, chlorothiazide, hydrochlorothiazide, hydroflumethazide, methyclothazide, polythiazide, trichlormethazide, chlorthalidone, indapamide, metolazone, and qiunethazone.
  • diuretic is hydrochlorothiazide, which acts by blocking salt and fluid reabsorption in the kidneys, causing increased urine output (diuresis). It has also been widely used in treating mild hypertension.
  • a combination product can include at least one antidiabetic agent, such as the oral hypoglycemic agents metformin, the sulfonylurea drugs glibenclamide, tolbutamide, tolazamide, glyburide, glipizide, and glimipiride, and the thiazolidinedione drugs troglitazone, rosiglitazone, and pioglitazone.
  • an anti-diabetic agent can be included in a product that is intended for use by persons having non-insulin dependent diabetes mellitus.
  • Vitamin B6 may be included in amounts between about 2 mg and 2 grams.
  • Vitamin B12 may be included in amounts between about 3 ⁇ g and 2 mg.
  • Folic acid may generally be included in amounts up to about 5 mg, such as about 400 to 800 g, about 500 ⁇ g to 2 mg, or about 1 mg to 5 mg.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include sulfonylureas.
  • the sulfonyiureas (SU) are drugs which promote secretion of insulin from pancreatic beta cells by transmitting signals of insulin secretion via SU receptors in the cell membranes.
  • Examples of the sulfonylureas include glyburide, glipizide, glimepiride and other sulfonylureas known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the meglitinides.
  • the meglitinides are benzoic acid derivatives represent a novel class of insulin secretagogues. These agents target postprandial hyperglycemia and show comparable efficacy to sulfonylureas in reducing HbAlc.
  • Examples of meglitinides include repaglinide, nateglinide and other meglitinides known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the biguanides.
  • the biguanides represent a class of drugs that stimulate anaerobic glycolysis, increase the sensitivity to insulin in the peripheral tissues, inhibit glucose absorption from the intestine, suppress of hepatic gluconeogenesis, and inhibit fatty acid oxidation.
  • Examples of biguanides include phenformin, metformin, buformin, and biguanides known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the alpha-glucosidase inhibitors.
  • the alpha-glucosidase inhibitors competitively inhibit digestive enzymes such as alpha-amylase, maltase, alpha-dextrinase, sucrase, etc. in the pancreas and or small intestine.
  • the reversible inhibition by alpha-glucosidase inhibitors retard, diminish or otherwise reduce blood glucose levels by delaying the digestion of starch and sugars.
  • alpha-glucosidase inhibitors examples include acarbose, N-(1,3-dihydroxy-2-propyl)valiolamine (generic name; voglibose), miglitol, and alpha-glucosidase inhibitors known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the peroxisome proliferators-activated receptors (i.e., PPAR-Y) agonists.
  • the peroxisome proliferators-activated receptor- ⁇ agonists represent a class of compounds that activates the nuclear receptor PPAR- ⁇ and therefore regulate the transcription of insulin-responsive genes involved in the control of glucose production, transport and utilization. Agents in the class also facilitate the regulation of fatty acid metabolism.
  • Examples of PPAR- ⁇ agonists include rosiglitazone, pioglitazone, tesaglitazar, netoglitazone, GW-409544, GW-501516 and PPAR- ⁇ agonists known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the HMG-CoA reductase inhibitors.
  • the HMG-CoA reductase inhibitors are agents also referred to as Statin compounds that belong to a class of drugs that lower blood cholesterol levels by inhibiting hydroxymethylglutalyl CoA (HMG-CoA) reductase.
  • HMG-CoA reductase is the rate-limiting enzyme in cholesterol biosynthesis.
  • the statins lower serum LDL concentrations by upregulating the activity of LDL receptors and are responsible for clearing LDL from the blood.
  • statin compounds include rosuvastatin, pravastatin and its sodium salt, simvastatin, lovastatin, atorvastatin, fluvastatin, cerivastatin, rosuvastatin, pitavastatin, BMS's “superstatin”, and HMG-CoA reductase inhibitors known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the Fibrates.
  • Fibrate compounds belong to a class of drugs that lower blood cholesterol levels by inhibiting synthesis and secretion of triglycerides in the liver and activating a lipoprotein lipase. Fibrates have been known to activate peroxisome proliferators-activated receptors and induce lipoprotein lipase expression.
  • fibrate compounds include bezafibrate, beclobrate, binifibrate, ciplofibrate, clinofibrate, clofibrate, clofibric acid, etofibrate, fenofibrate, gemfibrozil, nicofibrate, pirifibrate, ronifibrate, simfibrate, theofibrate, and fibrates known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the angiotensin converting enzyme (ACE) inhibitors.
  • ACE angiotensin converting enzyme
  • the angiotensin converting enzyme inhibitors belong to the class of drugs that partially lower blood glucose levels as well as lowering blood pressure by inhibiting angiotensin converting enzymes.
  • angiotensin converting enzyme inhibitors examples include captopril, enalapril, alacepril, delapril; ramipril, lisinopril, imidapril, benazepril, ceronapril, cilazapril, enalaprilat, fosinopril, moveltopril, perindopril, quinapril, spirapril, temocapril, trandolapril, and angiotensin converting enzyme inhibitors known in the art.
  • Suitable pharmaceutical agents that can be used in conjunction with compounds of the present invention include the angiotensin II receptor antagonists.
  • Angiotensin II receptor antagonists target the angiotensin II receptor subtype 1 (i.e., ATI) and demonstrate a beneficial effect on hypertension.
  • Examples of angiotensin II receptor antagonists include losartan (and the potassium salt form), and angiotensin II receptor antagonists known in the art.
  • amylin agonists for example, pramlintide
  • insulin secretagogues for example, GLP-1 agonists; exendin-4; insulinotropin (NN22 11); dipeptyl peptidase inhibitors (for example, NVP-DPP-728), acyl CoA cholesterol acetyltransferase inhibitors (for example, Ezetimibe, eflucimibe, and like compounds), cholesterol absorption inhibitors (for example, ezetimibe, pamaqueside and like compounds), cholesterol ester transfer protein inhibitors (for example, CP-529414, JTT-705, CETi-1, and like compounds), microsomal triglyceride transfer protein inhibitors (for example, implitapide, and like compounds), cholesterol modulators (for example, NO-1886, and like compounds), bile acid modulators (
  • Squalene synthesis inhibitors belong to a class of drugs that lower blood cholesterol levels by inhibiting synthesis of squalene.
  • examples of the squalene synthesis inhibitors include (S)-alpha-[Bis[2,2-dimethyl-1-oxopropoxy)methoxy]phosphinyl]-3-phenoxybenzenebutanesulfonic acid, mono potassium salt (BMS-188494) and squalene synthesis inhibitors known in the art.
  • Combination therapy according to the invention may be performed alone or in conjunction with another therapy and may be provided at home, the doctor's office, a clinic, a hospital's outpatient department, or a hospital.
  • Treatment generally begins at a hospital so that the doctor can observe the therapy's effects closely and make any adjustments that are needed.
  • the duration of the combination therapy depends on the type of disorder being treated, the age and condition of the patient, the stage and type of the patient's disease, and how the patient responds to the treatment. Additionally, a person having a greater risk of developing a disorder (e.g., a person who is genetically predisposed or previously had a disease or disorder) may receive prophylactic treatment to inhibit or delay a response.
  • the duration of the combination therapy depends on the type of autoimmune-inflammatory disorder associated with overexpressed TLR3, TLR4, TLR3 or TLR4 signaled events, overexpressed cytokines, chemokines, or interferons, the age and condition of the patient, the stage and type of the patient's disease, and how the patient responds to the treatment. Additionally, a person having a greater risk of developing a disease or a related autoimmune-inflammatory disease, i.e. thyroiditis in a diabetic, or a person who is genetically predisposed or previously had a disease or disorder may receive prophylactic treatment to inhibit or delay a response.
  • Combination therapy according to the invention may be performed alone or in conjunction with another therapy and may be provided at home, the doctor's office, a clinic, a hospital's outpatient department, or a hospital. Treatment generally begins at a hospital so that the doctor can observe the therapy's effects closely and make any adjustments that are needed.
  • the duration of the combination therapy depends on the type of disease caused by or associated with TLR, TLR3, TLR4, or all overexpression and signaling in nonimmune cells, monocytes, macrophages or dendritic cells, including, but not limited to, Hashimoto's thyroiditis, type 1, insulinitis, Type 1 diabetes, atherosclerosis, vascular complications of diabetes, obesity, or hyperlipidemias, toxic shock, or autoimmune inflammatory disorder being treated, the age and condition of the patient, the stage and type of the patient's disease, and how the patient responds to the treatment.
  • each component of the combination can be controlled independently.
  • one compound may be administered orally three times per day, while the second compound may be administered intramuscularly once per day.
  • Combination therapy may be given in on-and-off cycles that include rest periods.
  • the compounds may also be formulated together such that one administration delivers both compounds.
  • the relative efficacies of compounds can be established by determining the concentrations at which each compound inhibits the activity to a predefined extent and then comparing the results.
  • the preferred determination is the concentration that inhibits 50% of the activity in a biochemical assay, i.e., the 50% inhibitory concentration or “IC 50 .”
  • IC 50 determinations can be accomplished using conventional techniques known in the art. In general, an IC 50 can be determined by measuring the activity of a given enzyme in the presence of a range of concentrations of the inhibitor under study. The experimentally obtained values of activity then are plotted against the inhibitor concentrations used. The concentration of the inhibitor that shows 50% activity (as compared to the activity in the absence of any inhibitor) is taken as the IC 50 value.
  • inhibitory concentrations can be defined through appropriate determinations of activity. For example, in some settings it can be desirable to establish a 90% inhibitory concentration, i.e., IC 90 , etc.
  • a methimazole derivative and/or tautomeric cyclic thione compound is typically administered in an amount such that it selectively inhibits TLR3 or TLR4 expression or activity, as described above.
  • An optionally rate-limiting layer on the compositions comprises a water insoluble polymer or a mixture of water insoluble polymers or a mixture of water soluble and water insoluble polymers.
  • the composition comprises the compounds of the present invention and a water-soluble or water-insoluble polymer that acts both as binder for the therapeutic compounds and as a rate-limiting layer for release of the compounds.
  • a water-soluble or water-insoluble polymer that acts both as binder for the therapeutic compounds and as a rate-limiting layer for release of the compounds.
  • Such polymers may be selected from cellulose derivatives, acrylic polymers and copolymers, vinyl polymers and other high molecular polymer derivatives or synthetic polymers such as methylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, ethylcellulose, cellulose acetate, polyvinyl pyrrolidone, polyvidone acetate, polyvinyl acetate, polymethacrylates and ethylene-vinyl acetate copolymer or a combination thereof
  • Preferred film-forming polymers are ethylcellulose or copolymers of acrylic and methacrylic acid esters in aqueous dispersion form.
  • the composition comprises homogeneously distributed methimazole derivatives and tautomeric cyclic thiones contained in a water insoluble polymer or a mixture of water insoluble polymers or a mixture of water soluble and water insoluble polymers mentioned above.
  • the composition comprises a second rate-limiting layer.
  • the polymers in the second layer may be selected from the group of anionic carboxylic polymers suitable for pharmaceutical purposes and being soluble with difficulty at a low pH but being soluble at a higher pH, the pH limit for solubility being in the interval of pH 4 to pH 7.5, said group comprising cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethylcellulose phthalate, polyvinyl acetate phthalate and acrylic acid polymers, e.g., partly asterified methacrylic acid-polymers. These polymers may be used alone or in combination with each other or in combination with water insoluble polymers mentioned before.
  • the coatings may optionally comprise other pharmaceutically acceptable materials that improve the properties of the film-forming polymers such as plasticizers, anti-adhesives, surfactants, and diffusion-accelerating or diffusion-retarding substances.
  • plasticizers comprise phthalic acid esters, triacetin, dibutylsebacate, monoglycerides, citric acid esters and polyethyleneglycols.
  • Preferred plasticizers are acetyltributyl citrate and triethyl citrate.
  • Suitable anti-adhesives comprise talc and metal stearates.
  • the amount of the first coating applied on the units is normally in the range between 0.5% and 30% by weight, preferably between 1% and 15%. This amount includes in the relevant case the weight of the adjunct therapeutic, for example the steroid, or statin, as well.
  • the amount of the second coating applied on the units is normally in the range between 1% and 50% by weight, preferably between 2% and 25%, calculated on the weight of the coated units. The remainder constitutes the weight of the dosage.
  • the weight ratio of the therapeutic compound of the present invention to the second or third active ingredient may be varied and will depend upon the effective dose of each ingredient. Generally, an effective dose of each will be used. Thus, for example, when a therapeutic is combined with an NSAID the weight ratio of the compound of the therapeutic compound of the present invention to the NSAID will generally range from about 1000:1 to about 1 :1000, preferably about 200:1 to about 1:200. Combinations of a therapeutic and other active ingredients will generally also be within the aforementioned range, but in each case, an effective dose of each active ingredient should be used.
  • compositions in dosage unit form comprise an amount of composition that provides from about 0.05 to about 600 milligrams. In another embodiment, the composition provides from about 0.05 to about 200 milligrams of active compound per day.
  • Useful pharmaceutical formulations for administration of the active compounds of this invention may be illustrated below. They are made using conventional techniques.
  • This tablet can be sugar coated according to conventional art practices. Colors may be added to the coating.
  • TLR3 is present and functional in thyrocytes.
  • TLR3 is present in thyrocytes. Using Northern blotting, we showed that rat FRTL-5 thyrocytes contained detectable levels of a single 5.8 kb mRNA that hybridizes with a 32 P-labeled mouse TLR3 cDNA probe and is present in mouse spleen (positive control). The presence of TLR3 on FRTL-5 thyrocytes grown in continuous culture was duplicated in intact mouse thyroids, which had a similarly sized RNA. Specificity was indicated since neither human embryonic kidney (HEK293), Chinese hamster ovary (CHO-K1) cell, or mouse liver exhibited significant levels of a similar sized hybridizing band.
  • HEK293 human embryonic kidney
  • CHO-K1 Chinese hamster ovary
  • TLR9 mRNA which is involved in the recognition of specific unmethylated CpG-ODN sequences that distinguish bacterial DNA from mammalian DNA, was not expressed basally in FRTL-5 cells despite its prominent appearance in spleen cells.
  • the low level of TLR3 mRNA which we detected in mRNA from mouse heart is consistent with a previous report studying TLR3 expression in mouse heart, lung, brain and kidney (L. Alexopoulou, et al., Nature, 413:732-8, (2001)).
  • TLR3 mRNA is present basally in mouse thyroid tissue and rat thyroid cells.
  • TLR3 protein was expressed by Western blotting. Lysates of FRTL-5 cells were immunoprecipitated with a monoclonal TLR3 antibody and resolved by SDS-PAGE. An approximately 120 kDa protein was detected in FRTL-5 cell lysates immuno-precipitated by the TLR3 MAb.
  • TLR3 MAb detected a similarly sized TLR3 protein in CHO-K1 cells transiently transfected, with a human TLR3 expression vector or one from mouse.
  • TLR3 was expressed basally in thyrocytes; the following experiments established the TLR3 was functional.
  • TLR3 is Functional in thyrocytes.
  • Poly (I:C) a chemically synthesized dsRNA that is a specific ligand for TLR3 (K. Takeda, et al., Annu Rev Immunol, 21:335-76 (2003); K. Takeda, et al., Cell Microbiol, 5:143-53 (2003); L. Alexopoulou, et al., Nature, 413:732-8 (2001)) was added to the culture medium to stimulate TLR3 signaling.
  • Extracellular dsRNA is known to be specifically recognized by TLR3 as evidenced by the lack of response to extracellular dsRNA in TLR3 ⁇ / ⁇ mouse-derived fibroblasts (L.
  • NF-6B pathway was evaluated by incubating extracellular dsRNA, [Poly (I:C)] with pNF- ⁇ B-luc-transfected FRTL-5 cells and measuring reporter gene activity and by EMSA in nontransfected cells, using an NF- ⁇ B consensus oligonucleotide probe.
  • Poly (I:C) increased NF- ⁇ B Luc activity by comparison to non treated cells or cells incubated with E. coli dsDNA.
  • Poly (I:C) incubation also increased formation of a p65/p50 NF- ⁇ B complex as evidenced by the appearance of a major complex whose formation was inhibited by incubations containing the nuclear extracts from treated cells with anti-p50 or anti-p65 , but not by incubations with anti c-rel, anti-p52, or anti-relB, which served as negative antibody controls.
  • Poly (I:C) incubation was also able to activate ERK1/2 MAPK within 15 min as detected by measuring phosphorylated ERK1/2 in immunoblots. Lysates from insulin-treated FRTL-5 cells were used as a positive control. Elk1 was also transactivated by Poly (I:C) treatment of reporter gene-coupled ELK-1 in FRTL-5 cell transfectants, as measured by luciferase activity. IL-1 ⁇ treatment, which can activate ELK-1 (K. Takeda, et al., Annu Rev Immunol, 21:335-76 (2003)) served as a positive control.
  • TLR3-IRF-3/IFN- ⁇ -coupled signal system was also expressed in FRTL-5 thyroid cells.
  • Poly (I:C) incubations increased both IFN- ⁇ promoter activity ( FIG. 1A ) and IFN- ⁇ mRNA levels (FIG. 1 B). IFN- ⁇ promoter activity was measured by incubating Poly (I:C) with FRTL-5 cells transfected with pIFN- ⁇ -luc constructs. Poly (I:C) incubation strongly increased IFN- ⁇ promoter activity, whereas E. coli dsDNA had no effect ( FIG.
  • TRIF/TICAM wild-type TIR domain-containing molecule adapter inducing IFN- ⁇ /TIR-containing adapter molecule
  • FRTL-5 cells not only express the TLR3 receptor, they seem to signal through both the NF-6B and IRF-3/IFN- ⁇ pathways when incubated with extracellular Poly (I:C), similar to immune cells. Their dual activation results in gene responses characteristic of an innate immune response (K. Takeda, et al., Annu Rev Immunol, 21:335-76 (2003); K. Takeda, et al., Cell Microbiol, 5:143-53 (2003); B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004)).
  • Type I IFN is an important intermediate.
  • dsRNA transfection and IFN- ⁇ induce overexpression of TLR and TLR3 signaling: Incubating FRTL-5 thyroid cells with Poly (I:C) did not increase TLR3, PKR or MHC Class I mRNA levels over a 24 hour period, although Poly (I:C) incubation significantly increased IP-10 mRNA and slightly increased ICAM-1 mRNA levels, demonstrating the functional activity of the Poly (I:C) in this experiment ( FIG. 2A ). IL-1 ⁇ (the positive control) also caused an increase in IP-10 and ICAM-1 mRNA levels but did not change TLR3, Class I, or PKR mRNA levels ( FIG. 2A ). This suggested that dsRNA incubation with TLR3 was not an effective means of increasing TLR3 expression in FRTL-5 cells nor induce changes in genes important in the expression of autoimmune-inflammatory diseases.
  • transfection of Poly (I:C) into the cytoplasm of FRTL-5 cells strongly increased TLR3 mRNA, as well as MHC Class I, PKR, ICAM-I, and IP-10 mRNA levels, both 12 and 24 hrs after transfection, by comparison to control cells (C) or a mock transfection (L) without dsRNA ( FIG. 2B , lanes 3 and 7).
  • dsDNA transfection was only weakly effective in increasing TLR3 mRNA and at 12 hrs only ( FIG. 2B , lanes 4 and 8), but, as previously reported (K.
  • TLR3 mRNA was still increased by dsRNA transfection by comparison to control cells (C) or a mock transfection (L) in the presence of 2-AP ( FIG. 2C , lane 7 vs 3).
  • 2-AP did not inhibit the dsRNA-transfection-induced increase in IFN- ⁇ mRNA levels ( FIG. 2C , lane 7 vs 3), however, 2-AP strongly inhibited the ability of dsRNA-transfection to increase NF- ⁇ B p65/p50 complex formation in EMSA ( FIG. 2C , bottom).
  • the dsRNA transfection-induced increase in PKR and MHC Class I was only slightly decreased by 10 mM 2-AP ( FIG.
  • the dsDNA effect may be consistent with the activity of TLR9, which is not present basally, but could be expressed in the lysosomal-endosomal fractions of thyrocytes after transfection and phagocytosis.
  • Type I interferon produced by dsRNA transfection might be an autocrine/paracrine activator of thyrocytes post dsRNA transfection was considered and confirmed.
  • exogenously added Type I IFN in our case IFN- ⁇ , increased TLR3 mRNA levels in FRTL-5 thyrocytes in a time- and dose-dependent manner (Table 1).
  • the increases were not duplicated by a Type II IFN, IFN- ⁇ , even if a high dose (1000 Units/ml) of IFN- ⁇ was used (Table 1).
  • IFN- ⁇ also increased MHC I, PKR, and IP-10 mRNA levels, concurrent with the increase in TLR3 mRNA levels.
  • IFN- ⁇ not IFN- ⁇ (100 U/ml each) can mimic dsRNA transfection effect on RNA levels of genes important in autoimmune-inflammatory diseases.
  • IFN- ⁇ or IFN- ⁇ were measured as a function of time.
  • FRTL-5 cells were incubated with 100 U/ml of IFN- ⁇ or IFN- ⁇ for between 1 and 12 hours.
  • IFN- ⁇ duplicated the effect of dsRNA transfection by increasing TLR3, PKR, MHC Class I, and IP-10 RNA levels whereas IFN- ⁇ had no effect.
  • cells were stimulated with between 10 and 1000 units of IFN- ⁇ or IFN- ⁇ for 3 hours, total RNA purified, and 20 ⁇ g of total RNA analyzed by Northern analysis using the radiolabeled cDNA probes of FIG. 2 , only IFN- ⁇ increased TLR3, PKR, MHC Class I, and IP-10 RNA levels.
  • Influenza A virus mimics the action of dsRNA transfection and IFN- ⁇ to induce overexpression of TLR and TLR3 signaling: The ability of dsRNA transfection, but not dsRNA incubation, to increase TLR3 levels is presumed to mimic the action of a virus to inject RNA into the cell as previously suggested (M. Yamamoto, et al., J Immunol, 169:6668-72 (2002); M. Montgomeryn, et al., Genes Immun, 2:349-55 (2001); L. Alexopoulou, et al., Nature, 413:732-8 (2001); S. Sharma, et al., Science, 300:1148-51 (2003); K. A.
  • methimazole methimazole, methimazole derivatives, or tautomeric cyclic thiones, inhibit Stat1 phosphorylation which regulates IRF-1 gene expression (R. Pine, et al., Embo J, 13:158-67 (1994)) and that this effect reflects an action to inhibit the TRIF-couples IRF-3/IFN- ⁇ not the TRIF-coupled NF-6B signal pathway.
  • MMI Methimazole
  • MMI Methimazole
  • D. S. Cooper N. Engl. J. Med., 311:1353-62 (1984)
  • MMI contributes to long-term remission of autoimmune/inflammatory diseases by functioning as a broadly active immunomodulator.
  • MMI has been used as an immunosuppressive in treating psoriasis in humans (A. N. Elias, et al., Int.
  • Phenylmethimazole (C10) is a derivative that is 50-100-fold more potent in suppressing MHC gene expression (L. D. Kohn et al., U.S. Pat. No. 6,365,616 (2002)).
  • C10 prevented the ability of dsRNA transfection and incubation with IFN- ⁇ to increase TLR3 RNA levels in FRTL-5 cells, as measured by PCR ( FIG. 4A ). Additionally it prevented the ability of both IFN- ⁇ (FIG. 4 B) and dsRNA transfection (data not shown) to increase TLR3 by Northern analysis and was significantly better than MMI in this respect, even at 10-fold lower concentrations (0.5 vs 5 mM).
  • DMSO is the vehicle for C10 because of the hydrophobicity of C10; it had no significant effect on basal activity and was used as the control value in all experiments described herein.
  • C10 and MMI reduced the ability of IFN- ⁇ to increase PKR and MHC class I RNA levels, albeit relatively less than TLR3 ( FIG. 4B ).
  • C10 slightly reduced the basal level of TLR 3 mRNA, without affecting control PKR or class I RNA levels ( FIG. 4B , lane 2 vs 1).
  • the Northern data thus suggested C10, to a far greater extent than MMI, could block pathogenic expression of the TLR3 induced innate immune response in FRTL-5 thyrocytes. We questioned the C10 mechanism of action.
  • IL-1 receptors are reported to activate IRF-3 and IFN- ⁇ by a non TRIF coupling mechanism (D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80 (2004); E. Cario, et al., Infect Immun, 68:7010-7 (2000); B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004); M.
  • IFN-inducible genes A key to activation of other IFN-inducible genes by the autocrine/paracrine action of IFN- ⁇ is its action to regulate downstream genes with ISREs, in part by phosphorylation of STATS, which are important activators of interferon-stimulated response elements (ISRE) and interferon- ⁇ -activated sites (GAS).
  • ISRE-Luc an ISRE sequence coupled to luciferase as a reporter gene (ISRE-Luc) we could show that C-10 was an effective inhibitor of ISRE activation by poly (I:C), LPS, IL-1 ⁇ , TNF- ⁇ , IFN- ⁇ and IFN- ⁇ (Table 2).
  • phenylmethimazole (C10) inhibits the ability of Poly (I:C), LPS, IL-1 ⁇ , TNF- ⁇ , IFN- ⁇ , and IFN- ⁇ to activate an ISRE reporter gene in FRTL-5 thyrocytes.
  • Cells were co-transfected with ISRE-Luc and pRLTk-Int and then treated without (none) or with Poly I:C (100 ⁇ g/ml), LPS (100 ng/ml), IL-1 ⁇ (10 ng/ml)TNF- ⁇ (25 ng/ml), IFN- ⁇ (100 U/ml) or IFN- ⁇ (1000 U/ml) in the presence of DMSO ( ⁇ ) or C10 for 6 hours.
  • C10 was a profound inhibitor of virus ( FIG. 6B ) or IFN- ⁇ -stimulated (data not shown) Stat1 phosphorylation without a change in Stat1 total protein ( FIG. 6B ).
  • D in this experiment was the vehicle (DMSO) control.
  • TLR3 Expression in Hashimoto's Disease A prototype of Type 1 diabetes
  • NPA thyrocytes are from a papillary carcinoma but are known to retain functional properties of normal thyrocytes.
  • Transfection with dsRNA [Poly (I:C)] but not transfection by dsDNA or incubation with Poly (I:C)
  • the dsRNA, but not the dsDNA transfection, could also increase IFN- ⁇ mRNA levels, measured as before with PCR.
  • TLR3 was overexpressed in autoimmune/inflammatory disease in vivo not only human thyrocytes in culture.
  • TLR3 protein is present in thyrocytes of 100% of patients examined with Hashimoto's thyroiditis but not in thyrocytes from normal thyroids or thyroids from patients with Graves' disease: there is coincident expression of Type 1 IFN not PKR signaling.
  • TLR3 Present/ Tissue Number IFN- ⁇ Present/Number PKR/Number Source patients Tested patients Tested patients Tested patients Tested patients Tested patients Tested patients Tested patients Tested Hashimoto's 21 of 21 20 of 21 10 of 21 Graves' 0 of 20 16 of 20 8 of 20 Normal 0 of 20 0 of 20 0 of 20 Bold Values represent statistically significant correlation P ⁇ 0.01.
  • TLR-3 signaled IRF-3/IFN- ⁇ in the Hashimoto's thyrocytes correlated with TLR3 overexpression in a statistically significant manner by comparison to the TLR3 and PKR association in Hashimoto's and when compared with the presence of IRF-3/IFN- ⁇ signaling in Graves' vs TLR3 expression, which was zero.
  • TLR3 can be overexpressed in nonimmune cells and can produce an innate immune gene response that leads to an adaptive immune cell (TH1) response.
  • a critical signal system involved is Type I IFN. Methimazole, methimazole derivatives, and tautomeric cyclic thiones, exemplified by C10, can prevent this by inhibiting predominantly the IRF-3/Type I IFN signal system activated when dsRNA or viruses overexpress TLR3 signals.
  • Poly (I:C) [a synthetic dsRNA], endotoxin free E. coli DNA, the mouse TRIF/TICAM-1, the mouse and human TLR3 expression vectors were purchased from (Invivogen, San Diego, Calif.). TNF- ⁇ , IFN- ⁇ , IFN- ⁇ , and IL-1 62 were from (Biosource International, Camarillo, Calif.). Insulin and 2-Aminopurine were from Sigma (St. Louis, Mo.).
  • the antibodies used in this study were anti-TLR3 (IMGENEX, San Diego, Calif.), anti-IFN- ⁇ (Chemicon International, Temecula, Calif.), anti-Stat1PY701 (Cell Signaling Technologies, Beverley, Mass.), anti-Stat1p84/p91 E-23 (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.), anti-PKR (Cell Signaling Technology, Beverly, Mass.), and anti-phosphospecific ERK 1/2 (Biosource International, Camarillo, Calif.). Vectastain Universal Quick kit (Vector Laboratories, Burlingame, Calif.) antigen unmasking solution and DAB substrate kit were used.
  • C-10 was synthesized as described by Ricerca (Cleveland, Ohio) (L. D. Kohn et al., U.S. Pat. No. 6,365,616 (2002)). C-10 was prepared as 200 mM stock solution in DMSO. MMI was from Sigma. The source of all other materials was the same as previously reported (K. Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)).
  • the F1 subclone of FRTL-5 thyrocytes (Interthyr Research Foundation, Baltimore, Md. [ATCC CRL 8305]) was grown in Coon's modified Ham's F-12 medium supplemented with 5% calf serum, 2 mM glutamine and 1 mM nonessential amino acids, plus a six-hormone mixture (6H medium), containing bovine TSH (1 ⁇ 10 ⁇ 10 M), insulin (10 ⁇ g/ml), cortisol (0.4 ng/ml), transferrin (5 ⁇ g/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml).
  • 6H medium containing bovine TSH (1 ⁇ 10 ⁇ 10 M), insulin (10 ⁇ g/ml), cortisol (0.4 ng/ml), transferrin (5 ⁇ g/ml), glycyl-L-histidyl-L-ly
  • HEK293H cells (Invitrogen, Carlsbad, Calif.) were maintained in DMEM with 10% fetal calf serum.
  • CHO-K1 cells (ATCC CCL-61) were maintained in Ham's F-12 medium with 10% fetal calf serum.
  • NPA-87 cells are a continuous line of human thyrocytes derived from papillary carcinoma cells. They retain several functional responses including TSH-increased cAMP signaling (J. Xu, et al., J Clin Endocrinol Metab, 88:4990-6 (2003)). They were kindly provided by Dr. Guy Julliard (University of California, Los Angeles, Calif.) and grown in RPMI 1640 medium supplemented with 2 g/liter sodium bicarbonate, 0.14 mM nonessential amino acids, 1.4 mM sodium pyruvate, and 10% fetal bovine serum, pH 7.2.
  • RNA Isolation and Northern Analysis were prepared using the RNeasy Mini Kit (Qiagen Inc., Valencia, Calif.) and the method described by the manufacturer. For Northern, 15 to 20 ⁇ g total RNA were run on denatured agarose gels, capillary blotted on Nytran membranes (Schleicher & Schuell, Keene, N.H.), UV cross-linked, and subjected to hybridization. Probes were labeled with [ ⁇ - 32 P] dCTP using a Ladderman Labeling Kit (Takara, Madison, Wis.). The probes for MHC Class I, ICAM-1, IRF-1, PKR and GAPDH have been described (K.
  • the probes for IFN- ⁇ were obtained using gene specific primers that have also been described (S. Yokoyama, et al., Biochem Biophys Res Commun, 232:698-701 (1997)).
  • the probes for TLR3 were mouse or human whole cDNAs obtained from the Invivogen expression vectors.
  • RT-PCR DNA was removed from total RNA using the DNA-free Kit (Ambion) according to the manufacturer's instructions. One ⁇ g of RNA was used to synthesize cDNA using the Advantage RT-for-PCR Kit (BD Biosciences) according to the manufacturer's protocol. Fifty ng of cDNA was subsequently used for PCR of TLR-3, and ⁇ -Actin; 250 ng of cDNA was used for PCR of IFN- ⁇ . The primers used for amplification of human TLR-3 and ⁇ -Actin have been previously described (K. U. Saikh, et al., Clin Diagn Lab Immunol, 10:1065-73 (2003)).
  • Human IFN- ⁇ primers are as follows: (5′ primer) 5′-TGGCAATTGAATGGGAGGCTTG-3′ (SEQ ID NO:7) and (3′ primer) 5′-TCCTTGGCCTTCAGGTAATGCAGA-3′. (SEQ ID NO:8) PCR reaction conditions for humanTLR-3 and ⁇ -Actin are as follows: 94° C. for 5 min.
  • Human IFN- ⁇ PCR reaction conditions are: 94° C. for 3 min., followed by 35 cycles of 94° C. for 10 sec., 58° C. for 30 sec., 72° C. for 1 min., and a final cycle of 72° C. for 10 min.
  • Human IRF-3 was amplified from human cDNA and cloned into pCR 2.1 by the TOPO/TA (Invitrogen, Carlsbad, Calif.) cloning method, and then sequenced. IRF-3 was then excised by EcoRI digestion and subcloned into pCMV-BD (Stratagene, La Jolla, Calif.) for use in transactivation assays. To construct IFN- ⁇ -luc the human IFN- ⁇ promoter sequence was amplified from human genomic DNA (Clontech, Palo Alto, Calif.)) using Ex TaqTM Polymerase (Takara, Madison, Wis.).
  • the PCR fragment contained human IFN- ⁇ promoter sequence from ⁇ 125 to +34 relative to the transcription start site (+1) and incorporated KpnI and XhoI restriction sites at the 5′ and 3′ ends, respectively.
  • the primers were as follows: hIFN- ⁇ ( ⁇ 125) KpnI (5′-CAGGGTACCGAGTTTTAGAAACTACTAAAATG-3′) (SEQ ID NO:9) and hIFN- ⁇ (+34) XhoI (5′-GTACTCGAGCAAAGGCTTCGAAAGG-3′). (SEQ ID NO: 10)
  • the fragment was digested with KpnI and XhoI then ligated into a similarly digested pGL3 Basic (Promega, Madison, Wis.) vector.
  • pFR-luc (5 ⁇ Gal4 DNA binding domains and minimal TATA box), ISRE-Luc, NF- ⁇ B-luc and the Elk1 trans-Reporting System were purchased from Stratagene.
  • pRL TK-Int was purchased from Promega.
  • FRTL-5 cells were grown in 24-well plates to about 70% confluence, washed with 0.5 ml of serum-free culture medium (6H0 medium), then exposed to 125 ⁇ l of premade plasmid-DEAE mixture per well for 15 min at room temperature.
  • the plasmid-DEAE mixture was prepared by incubating 100 ng of plasmid DNA, unless otherwise noted in individual experiments, with 3.125 ⁇ l of DEAE-Dextran (10 mg/ml) (Promega, Madison Wis.).
  • FRTL-5 cells were incubated with this mixture for 2 hr at 37° C.
  • CHO-K1 and FRTL-5 cells for transfecting expression vectors were subjected to the lipofection method. Cells were grown in 10 cm dishes to about 80% confluence and then exposed to the plasmid-Lipofectamine2000 mixture as described by the manufacturer (Invitrogen, Calif.).
  • lysates were incubated with anti-TLR3 antibody (Imgenex, San Diego, Calif.) (10 ⁇ g/ml) at 4° C. for 6 hours, followed by adsorption to protein G-Sepharose beads (Amersham Pharmacia Biotech). Precipitates were washed and resolved as stated above.
  • CHO-K1 cells were transiently transfected with 20 ⁇ g of expression vector.
  • FRTL-5 cells were harvested by scraping into PBS (pH 7.4) and washing twice with PBS. Nuclear extracts were then prepared using NE-PER extraction reagents (Pierce Chemical Co., Rockford, Ill.). The protocol was as per manufacturer instructions and involved the presence of protease inhibitor cocktail III (AEBSF hydrochloride, aprotinin, bestatin, E-64 protease inhibitor, leupeptin, pepstatin) (Calbiochem).
  • protease inhibitor cocktail III AEBSF hydrochloride, aprotinin, bestatin, E-64 protease inhibitor, leupeptin, pepstatin
  • Oligonucleotides (NF- ⁇ B sense 5′-AGT TGA GGG GAC TTT CCC AGG C-3′ (SEQ ID NO:11); NF- ⁇ B anti sense 5′-GCC TGG GAA AGT CCC CTC AAC T-3′ (SEQ ID NO: 12)) were annealed and labeled with [ ⁇ 32 P]-ATP using T4 polynucleotide kinase.
  • EMSA was performed using 3 ⁇ g of nuclear extracts.
  • 50-fold molar excess of unlabeled oligonucleotide or 2 ⁇ g of antibody was added to the mixtures.
  • a 32 P-labeled oligonucleotide probe (100,000 cpm) was added and the incubation was continued for 20 min at room temperature. Mixtures were analyzed on 5% native polyacrylamide gels and autoradiographed.
  • Influenza A A/Victoria/3/75 was obtained from Diagnostic Hybrids Inc. (Athens, Ohio).
  • FRTL-5 cells were grown in 6H growth media until 60% confluence and then maintained in 5H (-TSH) media for 7 days before infections.
  • Ten (10) cm dishes were 95-100% % confluent at the time of infection.
  • Seven (7) million viral particles were added to each 10 cm dish of cells in 5H media.
  • Fresh 5H media was added 24 hours prior to infection. Cells were incubated with virus for 24 hours at which point C10 was added directly to the media and incubated for 6 hours before cells were harvested.
  • Tissue specimens were obtained from 30 individuals treated at the Ukrainian Center of Endocrine Surgery in Kiev. Thyroid lesions were classified as Hashimoto's thyroiditis in 21 cases, hyperplasia associated with Graves' disease in 20 cases. Normal thyroid tissue was from the contralteral glands of 20 patients undergoing thyroid surgery for adenomas or tumors. After fixation in 10% formalin and embedding in paraffin, 5- ⁇ m-thick serial sections were made for each specimen. The 5- ⁇ m sections were stained with hematoxylin and eosin.
  • Immunohistochemical Staining Sections were dewaxed, soaked in alcohol and after microwave treatment in antigen unmasking solution for 10 min incubated in 3% hydrogen peroxide for 15 min to inactivate endogenous peroxidase activity. Then sections were incubated at 4° C. overnight with anti-TLR3 antibody (1:100 dilution). Immunostaining was performed by use of the Vectastain Universal Quick kit according to the manufactured instruction. Peroxidase staining was revealed in 3,3-diaminobenzidine. Negative control was applied by omission of antiserum.
  • Phenylmethimazole (C10) protects mice from TLR3 mediated Type 1 diabetes and improves survival.
  • Example 1 we show that TLR3 and IFN- ⁇ protein are expressed in situ in thyrocytes from patients with Hashimoto's thyroiditis which are surrounded by immune cells but not in thyrocytes from normal individuals or Graves' autoimmune hyperthyroidism, a novel finding never previously demonstrated.
  • the results from human thyrocytes in culture indicate that TLR3 activation and functional increases in signaling can occur in human as well as rat thyrocytes in culture and this can occur in the absence of lymphocytes or a lymphocyte-produced IFN, since lymphocytes primarily produce type II interferon (T. Taniguchi, et al., Annu Rev Immunol, 19:623-55 (2001)).
  • the immunocytochemistry study shows that the intense brown stain for IFN- ⁇ is localized in the thyrocytes and is not significant in the immune cells.
  • the results thus raise the possibility that thyrocytes are affected by a primary insult, which activates the TLR3 system to produce an innate immune response mimicking that of a dendritic cell.
  • the resultant cytokine and co-stimulatory molecule changes in the thyrocyte may then contribute to attracting lymphocytes to the gland, since unlike dendritic cells, the thyrocytes cannot migrate to the lymphoid organ.
  • Hashimoto's and Type 1 diabetes may have immune cell infiltrates and destructive thyrocyte or ⁇ -cell changes because of a primary insult to the specific tissue cell that activates TLR3 and an innate immune response in the tissue cells; this may be an early event in the pathogenic mechanism (D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80 (2004); B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004)).
  • Example 1 looked at whether TLR3 overexpression/signaling leading to increased Type I IFN levels might be sensitive to the immunomodulatory actions of methimazole (MMI) or its more potent derivative, phenylmethimazole (C10) (M. Saji, et al., J Clin Endocrinol Metab, 75:871-8 (1992); V. Montani, et al., Endocrinology, 139:290-302 (1998); L. D.
  • MMI methimazole
  • C10 phenylmethimazole
  • IRF-1 has a GAS, which binds Stat1. It is reasonable to suggest that the ability of C10 to block IRF-1 gene expression, both herein and in our studies of C10 inhibition of TNF- ⁇ -induced VCAM-1 and leukocyte adhesion, is related to its action on components of the TLR3 regulated IRF-3/IFN- ⁇ /ISRE/STAT signal path.
  • C10 may be an example of an agent that meets the new therapeutic paradigm requested by Davendra and Eisenbath in their review (D. Devendra, et al., Clin Immunol, 111:225-33 (2004)).
  • the NOD mouse is a prototypical example of type 1 diabetes.
  • C10 was effective in retarding the development of glucosuria in the NOD mice (Table 4).
  • no effect of C10 was noted. What was noted, however, was the onset of glucosuria in the mice was much earlier in the animals maintained in “nonclean” as opposed to “clean” mouse facilities (Table 4).
  • Enteroviruses are associated with expression of Type 1 diabetes and there is a well-described Coxsackie's virus mouse model of type 1 diabetes.
  • the MMI, MMI derivative, tautomeric cyclic thione family family of drugs are likely to prevent both the initial insult and repeated insults during the lag phase. Further intermittent therapy may be useful to extend the life of the lag phase, if not to totally prevent disease. This would be applicable to Hashimoto's autoimmune thyroiditis, as well as Type 1 diabetes in humans, since the NOD model is broadly used for evaluating mechanisms and therapies applicable to inducing an autoimmune-inflammatory human disease and has been shown to be associated with iodide induced thyroiditis as well as Type I diabetes.
  • C10 protects NOD mice from infection-induced Type 1 Diabetes Week 1 Week 4 Week 8 Week 12 Week 16 Week 20 Glucosuria Glucosuria Glucosuria Glucosuria Glucosuria Glucosuria Rx % of Total % of Total % of Total % of Total % of Total Faci None 0 0 15 100 NA NA Dirt C10 0 0 0 0 NA NA Dirt None 0 0 0 10 50 100 Clea C10 0 0 0 20 40 100 Clea None + virus 10 70 100 NA NA NA Dirt C10 + virus 0 0 20 30 NA NA Dirt NA: Not Assayed.
  • Table 4 shows the ability of C10 to attenuate Coxsackie virus-induced Glucosuria in NOD mice.
  • Mice were housed in germ free facilities, termed clean, or normal facilities where viral infections can occur, termed dirty. Animals showing urine Tes-Tape positivity greater than 1+ are considered positive and to have diabetes (L. S. Wicker, et al., Diabetes, 35:855-60 (1986)).
  • C10 was effective in retarding the development of glucosuria in the NOD mice. When this was repeated in a “clean” or germ free laboratory, no effect of C10 was noted.
  • glucosuria was confirmed by measuring blood levels, viral titers in the pancreas were determined to be positive, and insulinitis 2+ to 4+ was observed microscopically in diabetic but not C10 treated animals.
  • NOD/Lt female mice were from the Jackson Laboratory (Bar Harbor, Me.). All experiments were carried out in accordance with “Guide for Care and Use of Laboratory Animals” (NIH Publication No. 85-23, revised 1985). Mice were injected with 200 ⁇ l PBS or 5 ⁇ 10 5 PFU of the CVB4 Edwards Coxsackie virus strain ip (D. V. Serreze, et al., J Virol, 79:1045-52 (2005)). Mice were treated daily with i/p injections of C-10, MMI, 2.5% DMSO (C10 carrier control), or PBS (MMI carrier control).
  • Phenyl Methimazole protects mice from LPS-induced endotoxic shock mediated by TLR4 signals and improves survival
  • the LPS that causes endotoxic shock binds to TLR-4 receptors on nonimmune cells, monocytes, macrophages, and dendritic cells, then activates two signal pathways, (S. Sato, et al., Int Immunol, 14:783-91 (2002)), MyD88-dependent (M. Yamamoto, et al., J Immunol, 169:6668-72 (2002); T. Ogawa, et al., Int Immunol, 14:1325-32 (2002); K. Ruckdeschel, et al., J Immunol, 168:4601-11 (2002)) and MyD88-independent (M.
  • the MyD88-dependent pathway activate the NF- ⁇ B signal and MAP Kinase signal systems.
  • p50 and p60 enter the nucleus to interact with a multiplicity of gene promoters, causing the synthesis and secretion of proinflammatory cytokines TNF- ⁇ , IL-1, IL-6, and IL12, as well as the synthesis of the adhesion molecules ICAM-1 and VCAM-1, cytokines such as IFN- ⁇ , and chemokines such as MCP-1 (S.
  • IRF-1 interferon regulatory factor
  • TLR4 and TLR4 adaptor molecules are involved in the toxic shock syndrome and the associated cellular inflammatory infiltration at the organ levels.
  • Methimazole has been largely used for the treatment of Graves' disease as well as in lupus eritematosus systemic (D. S. Singer, et al., J Immunol, 153:873-80 (1994); E. Mozes, et al., Isr J Med Sci, 32:19-21 (1996)), spontaneous autoimmune disease (E. Mozes, et al., J Clin Immunol, 18:106-13 (1998)) and periocular inflammation in mice with experimental systemic lupus erythematosus (C. C. Chan, et al., J Immunol, 154:4830-5 (1995)).
  • MMI has been attributed to anti-oxidant and immunomodulatory effects including effects on IFN- ⁇ signaling (L. D. Kohn, et al., U.S. Pat. No. 6,365,616 (2002)).
  • a more potent methimazole derivative in the family of tautomeric cyclic thiones, phenylmethimazole (C10 or pMMI) was developed based on its ability to suppress MHC gene expression (L. D. Kohn et al., U.S. Pat. No.
  • VCAM-1 TNF- ⁇ -increased venular cell adhesion molecule-1
  • HEC human aortic endothelial cells
  • HAVEC human umbilical venous endothelial cells
  • IRF-1 interferon regulatory factor 1
  • IRF-1 binds to an element closer to the transcriptional start site on the VCAM-1 promoter than the NF- ⁇ B elements and is required for optimal TNF- ⁇ activation of the VCAM-1 promoter (N. M. Dagia, et al., _i J Immunol, 173:2041-9 (2004)).
  • phenylmethimazole (C10) but not Methimazole (MMI) has been shown to suppress the inflammatory response and improve survival in DSS induced colitis by its down regulatory effects on TLR4 overexpression in intestinal epithelial cells and by its effects to decrease pathologically expressed TLR4 signals including TNF- ⁇ , IL-1, IL-6, interferon protein-10 (IP-10), and VCAM-1 gene transcription (L. D. Kohn, et al., Research Ohio, In press ( 2005)).
  • TNF- ⁇ TNF- ⁇
  • IL-1 interferon protein-10
  • IP-10 interferon protein-10
  • VCAM-1 gene transcription L. D. Kohn, et al., Research Ohio, In press ( 2005)
  • mice developed a toxic shock syndrome (hypotension, hypothermia, collapse) between 6 and 12 hours post injection and were dead by 12 to 36 hours (Table 5A).
  • Phenylmethimazole C10 or pMMI protected the mice from death after LPS injection in 100% of animals examined (Table 5A) in this experiment and in 3 separate replicate experiments. This protection was due to C10 (PMMI) and not to the solvent used for C10, DMSO (Table 5A).
  • PMMI C10
  • DMSO solvent used for C10
  • mice treated with pMMI or C10 showed mild symptoms, i.e. mild decreases of body temperature, but maintained normal feeding and drinking habits, as well as mobility (Table 5B).
  • mice developed profound hypothermia, hypotension, and shock (Table 5B). They were depressed, hypothermic, and stopped feeding and drinking (Table 5B). Moreover, all mice that developed severe shock died within 36 hours (Table 5A and 5B)).
  • C10 dramatically increases viability and signs of shock in mice challenged with LPS.
  • C57BL/6J mice injected with 20 mg/kg LPS develop symptoms of shock within 12 hours and die within 36 hours. 100% of C57BL/6J mice injected intra-peritoneally (i/p) with C10 (1 mg/kg) 30 minutes before injection with LPS survive at 36 hours, whereas all mice treated with methimazole (MMI), which is less effective than CO (L. D. Kohn, et al., U.S. Pat. No. 6,365,616 (2002)), or prednisolone, and flunixin of meglumine, which are currently in use clinically to treat LPS shock in humans and animals, respectively, die.
  • MMI methimazole
  • mice treated with C10 survived for as long as they were observed (4 weeks).
  • mice treated with C10 had only a slight decrease in body temperature 12 hrs after LPS and no signs of shock.
  • C10 administered in daily doses of 0.1 or 1 mg/kg 12 hours after challenge with LPS also results in 100% survival compared to 0% survival for control mice. TABLE 5 C10 dramatically increases viability and signs of shock in mice challenged with LPS.
  • mice Number of surviving mice in each group of a representative experiment wherein mice were challenged with LPS first then treated with C10 after 12 hours at which time shock had appeared Treatment 18 hrs 36 hrs 1 week None 8 8 8 LPS 4 0 0 LPS + DMSO 2 0 0 LPS + C10 LPS + MMI 4 0 0 LPS + prednisolone 1 0 0 LPS + flunixin of 0 0 0 meglumine Bold Italicized Values reveal statistically significant improvemed survival, P ⁇ 0.01)
  • IRF-1, MCP-1, and IP-10 as well as downstream genes such as pro-inflammatory cytokine genes, COX genes, and INOS are altered by LPS-induced endotoxic shock in mice and reversed to normal levels by C10 (PMMI) in association with successful therapy.
  • IRF-1 and IP-10 are the main reported inducible genes after LPS activation of the MyD88 independent, IRF-3/IFN- ⁇ pathway
  • MCP-1 is a gene activated primarily by the MyD88-dependent, NF- ⁇ B-linked pathway.
  • C10 Given the action of C10 to block the IRF-3, IFN- ⁇ , Stat1, ISRE, IRF-1 pathway, but not the NF- ⁇ B path (N. Harii, et al., Mol Endocrinol, 19:1231-50 (2005); (N. M.
  • the MCP-1 pattern with LPS and LPS plus C10 replicated the profound ability of this agent to decrease RNA increases induced by LPS activation of the NF- ⁇ B pathway.
  • C10 was an effective suppressor of LPS-increased mRNA levels of genes reported to be important in both MyD88-independent and dependent pathways.
  • pathologic expression of genes downstream of both the TLR4-mediated NF- ⁇ B as well as the IRF-3/IFN- ⁇ signal paths were suppressed. It is suggested in the literature that the NF- ⁇ B activation of the MCP-1 can be the result of a delayed signal secondary to IFN- ⁇ activity.
  • pro-inflammatory cytokine genes TNF- ⁇ , IL-1 ⁇ , IL-6, IL-12 and IFN- ⁇ are reported to be synthesized and secreted by the activation of the LPS-TLR-4-MyD88 dependent pathway through NF- ⁇ B gene activation.
  • pro-inflammatory cytokine genes as determined by histochemistry in multiple tissues from the animals in Table 5, were strongly increased by inducing endotoxic shock with LPS at 24 hours. Induction was suppressed, however, by C10 (PMMI) treatment. This was evidenced for IL-6 and TNF- ⁇ in all tissues examined by Northern analyses ( FIG. 9 ). In the case of IFN- ⁇ , this phenomenon was true in most tissues examined ( FIG. 9 ).
  • Cytokine Level (% of Control ⁇ 12%) Cytokine Control LPS LPS + DMSO LPS + C IL-1 ⁇ 100 6000 5900 IL-6 100 2800 2600 TNF- ⁇ 100 4000 4200 IFN- ⁇ 100 4500 1900 IL-12p70p 100 200 260
  • Bold values with LPS or LPS + DMSO Vehicle control are statistically increased (p ⁇ 0.001).
  • Bold and italicized values in mice treated with C10 were statistically lower than LPS or LPS plus vehicle control (P ⁇ 0.001). Experiments were representative of three separate replicated groups.
  • C10 (PMMI) suppressed pro-inflammatory cytokine production induced by the LPS-TLR-4-MyD88 dependent and independent pathways in vivo consistent with its effects to prevent or reverse toxic shock (Table 5).
  • the data are consistent with previous data in vitro, that C10 (PMMI) down regulates the IRF3/IFN- ⁇ /Stat1/ISRE/IRF-1 signal transduction pathway (N. Harii, et al., Mol Endocrinol, 19:1231-50 (2005); N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)).
  • C10 C10
  • NF- ⁇ B activation pathway possibly by a secondary effect on IFN- ⁇ autocrine/paracrine effects on nonimmune cells, rather than a direct block of the MyD88-linked signal system.
  • COX cyclooxygenase
  • the cyclooxygenase (COX) enzyme system catalyzes the synthesis of prostaglandins and regulates their tissue levels. Prostaglandins are well described as important in the induction of hypotension in endotoxic shock. COX-2 is over-expressed in toxic shock and in autoimmune-inflammatory diseases related to toxic shock, as well as in cancer progression. It is responsible for catalyzing the formation of PGE2 which is the prostaglandin responsible for blood pressure decreases and hypotension in septic shock. In contrast to COX-2, COX-1 is the “house-keeping” enzyme with a protective role.
  • C10 selectively suppressed the expression of COX-2, which is increased in tissues by LPS-induced endotoxic shock and increased COX-1 gene expression, which is decreased in tissues by LPS-induced endotoxic shock, to the normal level.
  • the ratio of COX-2/COX-1 is considered important both to disease expression and therapeutic efficacy.
  • COX-1 and COX-2 RNA levels were evaluated by RT-PCR in the organs of different groups of mice described in Table 5, the COX-1 RNA levels were down-regulated in most examined organs of LPS treated mice except spleen and heart, while the C10 returned RNA levels to the normal levels ( FIG. 10 ). These data indicate that C10 protects cells from damage induced by LPS, since COX-1 is a protective enzyme in the inflammatory process.
  • COX-2 RNA levels were up-regulated in kidney, liver, lung, spleen, and heart of mice suffering from endotoxic shock ( FIG. 10 ) establishing that all organs suffer a strong inflammatory process. Further elevated COX-2 RNA levels were completely suppressed and returned to normal by C10 in kidney, liver and lung and also suppressed in spleen and heart, albeit less dramatically.
  • C10 is a selective COX-2 inhibitor compared to COX-1 and acts as a more physiologic regulator by reversing both the increased COX-2 and decreased COX-1 toward normal levels.
  • the changes in spleen indicate that the COX-2 enzyme changes in immune cells are an important component of disease expression in immune as well as nonimmune cells. Nevertheless, the absence of COX-1 changes in the spleen emphasize that the LPS-induced, and C10 decreased, COX-2 changes in nonimmune cells are also important in toxic shock and its effective therapy by C10.
  • INOS is only one of the several terminal mediators of shock and inflammation.
  • the overproduction of nitric oxide (NO) in endotoxic shock has been well documented, as it has been in autoimmune-inflammatory diseases and atherosclerosis.
  • tissue damage induced by peroxinitrites from multiple pathways is documented.
  • FIG. 10 show that iNOS mRNA gene expression is undetectable or poorly expressed as measured by RT-PCR in normal tissue ( FIG. 10 , non treated mice). This gene is clearly induced by LPS in the organs of mice ( FIG. 10 , iNOS in spleen, liver, lung, kidney, heart).
  • C10 suppressed iNOS RNA levels increased by LPS, returning them toward normal.
  • IRF-1 regulates the expression of several genes involved in autoimmunity and inflammation. Genes regulated by IRF-1 include among others, the Type 1 IFN cytokines (IFN- ⁇ and IFN- ⁇ ), the type 2 IFNS (IFN- ⁇ ), Interleukin-12 (IL-12) and IL-15 as well as nitric oxide, COX-2, MHC-I and ⁇ -2 microglobulins.
  • IRF-1 seems to be positioned at the intersection of multiple different downstream paths leading to a Th1 response and to host defense again microorganisms and environmental insults—moreover it is critically positioned to affect TLR3 and TLR4 signals.
  • C10 is a lead compound representative of a group of agents which blocks autoimmune-inflammatory disease in vivo and that it acts by a critical effect on pathological increases in IRF-1 gene expression not evident in normal tissues. This has two important consequences. First, because of the absence of high IRF-1 gene expression in normal tissues, C10 (pMMI) will have no significant effect in normal tissues or normal individuals.
  • C10 is a lead compound that blocks pathologic expression of multiple genes important in pathologic autoimmune-inflammatory disorders by blocking the IRF-3/Type 1 IFN/STAT/ISRE/IRF1 signal path.
  • the C10 family of compounds can act in vivo to attenuate the NF- ⁇ B signaled increases in downstream genes or gene products.
  • C10 and its family members block the pathological innate immune response in nonimmune tissues that are associated with TLR4 as well as TLR3-associated autoimmune-inflammatory disorders, as evidenced for TLR4 associated diseases in the colitis and toxic shock models and in TLR3 mediated disease, as evidenced for insulinitis and Type I diabetes model, but likely in its related disease, Hashimoto's thyroiditis.
  • Phenylmethimazole ameliorates the microvasculature damage, decreases inflammatory cellular infiltration, and decreases adhesion molecule expression on the vascular endothelial cells of tissues affected by endotoxic shock.
  • Adhesion molecules that are up-regulated in the vascular endothelium of organs suffering from endotoxic shock are suppressed by C10 (pMMI): Sections from different organs were study by immunohistochemistry in order to evaluate the effect of pMMI on ICAM-1 and VCAM-1 adhesion molecules in endotoxic shock. Both ICAM-1 and VCAM-1 are the ligands for systemic inflammatory cells to bind to the endothelium and infiltrate tissues in septic shock. Moreover, organ infiltration by inflammatory cells has been largely associated to the systemic organ failure. The data showed that ICAM-1 and VCAM-1 adhesion molecules were strongly up-regulated in mice treated with LPS and suffering from endotoxic shock.
  • ICAM-1 is over-expressed in lung and liver. ICAM-1 specific staining on the endothelial cells of lung capillaries is decreased by C10 (pMMI) as well as in endothelial cells of vein and reticulooendothelial space of the liver. VCAM-1 is specifically up-regulated in the large veins and C10 (pMMI) suppress the VCAM-1 levels.
  • mice In order to determine the survival curve of C57BL/6J mice, they were injected intra-peritoneally (i/p) with different drugs and solvents (See Table 7 below) 30 minutes before LPS injection (See Scheme 1, below). Twenty (20) mg/Kg LPS from E. coli was then injected intra-peritoneally (i/p) into each mouse. The experiment was performed using at least 8 mice in each of 3 experiments. After LPS injection, the survival curve was determined at 6, 12, 18, 36 hours and 1 week. The result is expressed as a percentage of survival without LPS treatment.
  • mice were evaluated 18 hours after the induction of endotoxic shock by intra-peritoneal LPS injection. Samples were collected for mRNA isolation, Histology and Immunohistochemistry (see Scheme 1). C10 (pMMI) effects on LPS-TLR4-increased TNF- ⁇ , IL-1 ⁇ , IL-6,IL-12, IFN- ⁇ , COX-2, iNOs, and MCP-1 gene expression were measured by Northern analysis and RT-PCR in spleen, lung, liver, heart and kidney. Results were confirmed by protein studies using ELISA and by immunohistochemistry. The LPS-TLR4- MyD88 independent, IFN- ⁇ -signaled genes including IRF-1, IP-10, COX-2 and iNOS were similarly studied.
  • mice Tissue from liver, lung, kidney and heart from normal, LPS and LPS plus C-10 treated mice (experiment in Table 5), were fixed in 4% -PBS- formalin overnight. They then were dehydrated serially in alcohols 50%-70%-90%-100%, clarified in chloroform, and embedded in paraffin. Five (5) ⁇ m sections were obtained and mounted on VectabondTM (Vector Laboratories, Inc. Burlingame, Calif.) pretreated slides. The sections were incubated twice (10 minutes each) in xylol and re-hydrated by serial alcohol treatments, 100%-90-70-50, followed by distilled water. Tissues were stained with Hematoxylin-Eosin using standard protocols, mounted, and observed by optical microscopy in a double blind manner.
  • VectabondTM Vector Laboratories, Inc. Burlingame, Calif.
  • Immunohistochemistry C10 (pMMI) effects on the over-expression of adhesion molecules induced by LPS were studied in different organs. These results focus lung and liver. At 18 h after LPS injection, mice were sacrificed and the heart, lung, liver spleen and kidney were removed and fixed in 4% formalin in PBS. The tissue was then dehydrated in serial alcohols (50% v/v, twice; 70% v/v, twice; 80% v/v, twice; 95% v/v, twice; and 100% v/v, twice), cleared in pure chloroform, embedded in paraffin and sectioned (5 prm thickness) and mounted on VectabondTM (Vector Laboratories, Inc. Burlingame, Calif.) pre-treated slides.
  • serial alcohols 50% v/v, twice; 70% v/v, twice; 80% v/v, twice; 95% v/v, twice; and 100% v/v, twice
  • the section were then cleared of paraffin by exposure to xylol twice (10 minutes each) and rehydrated using serial alcohol treatments, 100%-90-70-50. After endogenous peroxidase inhibition with 3% H 2 O 2 in methanol and nonspecific protein blocking using 5% BSA (Sigma Aldrich), the tissue sections were incubated overnight at 4° C. with 5 ul/ml of anti-mouse VCAM-1 polyclonal goat IgG or 3 ul/ml of anti-mouse ICAM-1 extracellular domain specific goat IgG as primary antibodies (R&D System, Inc. Minneapolis, Minn.).
  • the samples were extensively rinsed with PBS and subsequently incubated (1 hr) with biotinylated anti-goat IgG diluted 1/20 using the Goat Extravidin Staining Kit (Sigma-Aldrich St. Louis, Mo.). After extensive washing, the sections were incubated with streptavidin-peroxidase diluted 1/20 from the same kit. The sections were then washed three times and incubated (10 minutes) with DAB Chromogen reagent (Sigma-Aldrich). The slides were washed and were subsequently counterstained with methyl green (Vector Laboratories, Inc. Burlingame, Calif.), then dehydrated in ethanol followed by pure xylene. Slides were mounted and examined under a light microscope at 40 ⁇ (Nikon Eclipse-E600).
  • cytokines TNF- ⁇ , IL-1 ⁇ , IL-6, IFN- ⁇ and IL-12 were quantified in serum using ELISA techniques. Blood was collected from the inner canthus of the eye under anesthesia and serum saved at ⁇ 20° C. until use. The ELISA kits were from R&D System and the results were expressed in pg/ml serum.
  • RNA isolation and Northern Blot analysis of gene expression RNA used to measure expression of TNF- ⁇ , IL-1 ⁇ , IL-6, IFN- ⁇ , IRF-1, IP-10 and MCP-1 genes was extracted using Trizol (Invitrogen, Carlsbad, Calif.) and subjected to Northern blot analysis in a similar manner to that described previously (V. Toshchakov, et al., J Endotoxin Res, 9:169-75 (2003)). The GAPDH cDNA was from Clontech (Palo Alto, Calif.). TNF- ⁇ cDNA was excised from pORF9-mTNF vectors (Invivogen, San Diego, Calif.).
  • probe sequences were synthesized by RT-PCR (ibid) using the following cDNA specific primers: (SEQ ID NO: 13) mIP-10: 5'CCATCAGCACCATGAACCCAAGTCCTGCCG 3' and (SEQ ID NO: 14) 5'GGACGTCCTCCTCATCGTCGACTACACTGG 3' (469bp); mIL-1 ⁇ ): (SEQ ID NO: 15) CTCATCTGGGATCCTCTCCAGCCAAGCTTC 3' and (SEQ ID NO: 16) 5'CCATGGTTTCTTGTGACCCTGAGCGACCTG 3' (1006bp).
  • RNA isolation and RT-PCR analysis of gene expression were studied in different organs. Tissues were isolated from different groups of mice and washed with sterile Phosphate Buffered saline (PBS), pH 7.2-7.4. After tissues were homogenized in 0.5 ml of Trizol (Invitrogen, Carlsbad, Calif.), the RNA was extracted by chloroform-isopropanol, washed in alcohol 70%, dried and redissolved in RNase free water. Total RNA was treated in order to remove any DNA contamination using the DNase Free Kit (Ambion cat# 1906). cDNA was obtained using the Clontech RT for PCR kit (Clontech cat # K 1402-2).
  • PCR was performed using the Takara kit for PCR (Takara BIO, Inc, by Fisher Scientific # R001A) after optimizing conditions for each set of primers. Primers were designed using standard procedure and obtained from BIO Synthesis Inc. After specific DNA amplification, the samples were run in a 2% agars gel in TAE buffer with 4% of Ethidium Bromide. The samples were analyzed by fluorescence intensity. Relative quantities of RNA for Cox-1, Cox-2, iNOs and the “housekeeping gene,” GAPDH, were determined by coupled reverse transcription (RT)-PCR.
  • the primers used in each case were as follows: Cox-1 sense primer 5′ CCCAGAGTCATGAGTCGAAGGAG-3′ (SEQ ID NO:17), antisense 5′-CAGGCGCATGAGTACTTCTCGG-3′ (SEQ ID NO:18); Cox-2 sense primer 5′-GCAAATCCTTGCTGTTCCAATC-3′ (SEQ ID NO:19), antisense primer 5′-GCAGAAGGCTTCCCAGCTTTTG-3′ (SEQ ID NO:20); iNOS sense primer 5′-CCCTTCCGAAGTTTCTGGCGACAGCGGC-3′ (SEQ ID NO:21), antisense primer 5′-GGCTGTCAGAGCCTCGTGGCTTTGG-3′ (SEQ ID NO:22).
  • Phenylmethimazole (C10) decreases LPS induced TLR4 signaling in Macrophages.
  • Macrophages in animals treated with LPS display a rapid induction of many genes which are regulators of the inflammatory response (M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14 (2002)).
  • C10 may be preventing endotoxic shock in our animal model we chose to examine the affect of C10 on LPS stimulated genes in cultured murine macrophages in particular the murine macrophage cell line RAW 264.7.
  • RAW 264.7 cells are a transformed functional macrophage cell line (W. C. Raschke, et al., Cell, 15:261-7 (1978)).
  • the RAW 264.7 cell line has been a common and well accepted tool in the scientific literature used to further understand the affects of LPS on macrophages (V. Toshchakov, et al., J Endotoxin Res, 9:169-75 (2003); T. Horng, et al., Nat Immunol, 2:835-41 (2001); D. Schilling, et al., J Immunol, 169:5874-80 (2002); B. W. Jones, et al., Ann Rheum Dis, 60 Suppl 3:iii6-12 (2001)).
  • cytokines can be directly or indirectly induced by LPS signaling through TLR4 (M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14, (2002)) and certainly play a role in endotoxic shock (N. C. Riedemann, et al., J Clin Invest, 112:460-7, (2003)), a recent report identified IFN- ⁇ as a critical secondary effector, which is induced upon LPS activation of TLR4 signaling and contributes to mortality in a murine septic shock model (M.
  • LPS induced genes are down regulated in cultured mouse macrophages: LPS can activate monocytes and macrophages to produce cytokines such as IFN- ⁇ , IL-10, TNF- ⁇ , IL-6, and IL-1.2 (M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14, (2002)) which act on either the macrophages/monocytes themselves or other target cells to regulate the inflammatory process which occurs in septic shock. Upon stimulation with LPS, macrophages can also produce CXC chemokines such as IP-10 which serve to further attract immune cells to a site of inflammation (K. M.
  • Macrophages stimulated with LPS can also produce nitric oxide (NO) as a result of expression of the inducible nitric oxide synthase enzyme (iNOS) (C. Bogdan, Nat Immunol, 2:907-16 (2001)).
  • NO nitric oxide
  • iNOS inducible nitric oxide synthase enzyme
  • Gene expression levels were quantified by normalizing to an endogenous control (GAPDH) and normalizing to the untreated (DMSO control), which allowed the comparison of mRNA levels in C10 treated versus DMSO control treated, LPS stimulated macrophages ( FIG. 12B ).
  • the fold decrease in induced IFN- ⁇ gene expression was most strongly decreased at the one hour time point (8 fold) and was maintained at a low level throughout the time course ( FIG. 12B ).
  • the reduction in the TNF- ⁇ increase induced by LPS was at a maximum at 3 hours (4 fold) ( FIG. 12B ) but showed no reduction at 1 or 6 hours when LPS-increased TNF- ⁇ levels were low.
  • the LPS-induced increase in IL-6 was maximally reduced at the 3 hour time point at greater than a 16 fold reduction ( FIG. 12B ).
  • LPS induced IL-1 ⁇ was maximally decreased at 1 hour (11 fold) ( FIG. 12B ).
  • IL-12 p40 was not detectable until4 to 5 hours but was strongly reduced at 6 hours (16 fold) ( FIG. 12B ).
  • NO production occurs as a result of LPS induction of iNOS (C. Bogdan, Nat Immunol, 2:907-16 (2001)) and is a process that depends on autocrine signaling by IFN- ⁇ .
  • the RAW 264.7 cells were treated with LPS in the presence of C10, its vehicle control, DMSO, or another excipient vehicle (compound B; see Table 8) for 3 hours.
  • Table 8 establishes that C10 is effective in vivo in the mouse toxic shock model and in FRTL-5 cell assays in vitro when solubilized in water in the presence of the compound B excipient, i.e., water soluble forms of C10 are effective in both in vivo and in vitro just as C10 in DMSO.
  • the compound B excipient i.e., water soluble forms of C10 are effective in both in vivo and in vitro just as C10 in DMSO.
  • DMSO control FIG. 13A , lane 4
  • vehicle B only FIG. 13A , lane 5
  • C10 can improve toxic shock whether in DMSO or solubilized in excipient (Compound B) making it water soluble; excipient is also effective in C-10 Use in DMSO or Excipient in Mouse Models and in vitro Assays Survival
  • C10 % of Experiment Animals Dosage Route of Admin #days Control Colitis model 10 0.1 mg/kg Ip freshly diluted in DMSO 14 100% Colitis model 10 0.1 mg/kg Oral stored in excipient 1 week 14 100% Toxic Shock model 10 1 mg/kg Ip freshly diluted in DMSO 1.5 100% Toxic Shock model 10 1 mg/kg Oral stored in excipient 1 week 1.5 100% Toxic Shock model 10 1 mg/kg Oral diluted & stored in 1.5 100% excipient 6 wks Toxic Shock model 10 1 mg/kg Ip diluted & stored in DMSO 1 wk 1.5 0% Assay Replicates C10 Conc. % TLR3 Inhibition vs Control dsRNA increased T
  • Table 8 shows that C10 in excipient is as good as C10 in DMSO in vitro and in vivo.
  • C10 was formulated in DMSO and administered i.p. DMSO was used due to the low solubility of C10 in aqueous environments but can have well documented independent effects (M. S. Ivanovic, et al., Toxicology Letters, 147:153-159 (2004))].
  • C10 solubilized in DMSO and diluted to a working concentration is not stable for prolonged periods of time.
  • CD cyclodextrin
  • C10 stored in the aqueous preparation for 6 weeks prior to use was equally effective in decreasing TLR3 and IFN- ⁇ -mRNA levels in thyrocytes by comparison to solutions with DMSO.
  • oral excipient-solubilized C10 stored in diluted form at 4° C. for 8 weeks, was as effective in preventing death as was freshly made C10 i.p. in DMSO at the same 1 mg/kg dose.
  • Solutions of C10 diluted in DMSO and stored in diluted form at either 4° C. or ⁇ 70° C. were inactive in vitro or in vivo.
  • FIG. 13A , CHX A cyclohexamide treatment was done ( FIG. 13A , CHX) to confirm that new protein synthesis is required for the LPS induction of iNOS mRNA and support that Type 1 interferon signaling might be responsible for the increase in iNOS, rather than direct effects of TLR4 signaling.
  • C10 might be acting via a mechanism that required new protein synthesis, i.e. the synthesis of IFN- ⁇ . This is the case as shown by a loss of LPS increased iNOS equivalent to that of C10 in the presence of cyclohexamide ( FIG. 13A , CHX)
  • FIG. 13A , CHX We have already seen that C10 can reduce the LPS induced transcription of IFN- ⁇ mRNA ( FIG. 12A and B).
  • C10 inhibits the LPS induced activation of Stat1 in cultured macrophages:
  • the important role of type I interferons in LPS induced septic shock was recently demonstrated in mouse models (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)).
  • FIGS. 12A and 12B LPS induced increases of IFN- ⁇ (a type I interferon) mRNA levels are strongly inhibited by C10. It is has been shown that binding of IFN- ⁇ to the type I interferon receptor results in phosphorylation of Stat1 as a key component for the transduction of a signal to the nucleus to induce expression of iNOS and IP-10 in the mouse macrophage (Y.
  • C10 can reduce signal transduction through the IFN- ⁇ signal pathway by reducing the LPS induced autocrine/paracrine action of IFN- ⁇ , thereby decreasing Statl activation.
  • IRF-1 is a transcription factor which is induced upon LPS stimulation of macrophages through a Stat1 dependent mechanism (Y. Ohmori, et al., J Leukoc Biol, 69:598-604 (2001)). Therefore IRF-1 provides another example of a response that may be affected by an inhibitor of LPS induced IFN- ⁇ signaling. Unlike other molecules studied thus far, IRF-1 acts as a transcription factor to directly bind to DNA to enhance transcription of other genes such as iNOS (R. Kamijo, et al., Science, 263:1612-5, (1994)).
  • IRF-1 is required for the transcriptional control of the iNOS gene (R. Kamijo, et al., Science, 263:1612-5 (1994)).
  • Macrophages were treated with LPS (1 ug/mL) for 1, 2, or 3 hours and longer in the presence of C10, a DMSO control, or a commercially available derivative of C10 (MMI) ( FIG. 14A ).
  • Typical LPS induction for each time point is observed in each LPS plus DMSO lane ( FIG. 14A , lanes 2, 5, 8).
  • LPS increased IRF-1 RNA is small at 1 hr but becomes maximal by 3 in the presence of DMSO, the C10 solvent ( FIG. 14A , lane 8).
  • IRF-1 In order for IRF-1 to enhance gene transcription it must bind to cis-DNA elements located on the target gene.
  • iNOS is an example of a target gene that contains an IRF-1 cis-binding element (R. Kamijo, et al., Science, 263:1612-5 (1994)).
  • IRF-1 target genes such as the interferon inducible MX gene which codes for the antiviral Mx protein (D. Danino, et al., Curr Opin Cell Biol, 13:454-60 (2001)).
  • the MX promoter has been shown to contain strong IRF-1 binding elements (C. E. Grant, et al., Nucleic Acids Res, 28:4790-9 (2000)).
  • Mx ISRE IRF-1 binding site
  • EMSA EMSA
  • Stat1 null animals show an approximately 50% enhanced survival rate when challenged with a lethal dose of LPS (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)).
  • IFN- ⁇ null mice which were challenged with a lethal LPS dose showed a 100% enhancement of survival (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)). Therefore blocking parts of the IFN- ⁇ signal pathway is not as effective as blocking the pathway completely, i.e., by preventing the ligand receptor interaction or blocking the initial signal induced by the ligand-receptor interaction.
  • C10 did decrease TNF- ⁇ RNA levels and protein but it seemed possible this reflected a secondary action through IFN- ⁇ or the possibility that multiple interacting cell types were affected by the C10 primary action on nonimmune cells. It is nevertheless evident that LPS induced IFN- ⁇ is an attractive therapeutic target due to its multiple down stream affects which stem from the activation of Stat1 which is required in macrophages for the transcriptional upregulation of IRF-1, iNOS, and IP-10.
  • the Stat1 reduction in the macrophages and in nonimmune cells in tissues can partially explain the reduction of the genes in the mouse tissues of Example 3.
  • the mouse macrophage cell line RAW 264.7 (TIB-71) was obtained from the American Type Culture Collection (Manassas, Va.). RAW 264.7 were cultured in DMEM supplemented with glutamine and 10% FBS.
  • RNA isolation and Northern blot analysis was used to characterize the mRNA levels of key inflammatory mediators involved in endotoxic shock (M. A. Dobrovolskaia, et al., Microbes Infect 4:903-14, (2002)). RNA was extracted using Trizol® (Invitrogen, Carlsbad, Calif.) and subjected to Northern blot analysis in a manner similar to that described previously (K. Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)). The G3PDH cDNA was from Clontech (Palo Alto, Calif.).
  • the mTNF- ⁇ probe was excised from pORF9-mTNF- ⁇ (Invivogen, San Diego, Calif.).
  • Other probe sequences were synthesized by RT-PCR (K. Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)) using the following cDNA specific primers: mIP-10, 5′CCATCAGCACCATGAACCCAAGTCCTGCCG3′ (SEQ ID NO:23) and 5′GGACGTCCTCCTCATCGTCGACTACACTGG3′ (469 bp) (SEQ ID NO:24); mIL-1 ⁇ 5′CTCATCTGGGATCCTCTCCAGCCAAGCTTC3′ (SEQ ID NO:25) and 5′CCATGGTTTCTTGTGACCCTGAGCGACCTG 3′ (1006 bp) (SEQ ID NO:26); mIL-6, 5′ CCAGTTGCCTTCTTGGGACTGATGCTGGTG 3′ (SEQ ID NO:27) and
  • cDNA template 2.5 ⁇ l was used in a 25 ⁇ l real time PCR reaction with ABI Taqman® Universal Master Mix (Applied Biosystems, Branchburg, N.J.).
  • the IFN- ⁇ reactions were done with Sybr® green dye using the Quantitect Sybr® Green kit according to the manufacturer's instructions using 1 ⁇ l of cDNA template in a 25 ⁇ l reaction volume.
  • Primers used for IFN- ⁇ were as follows 5′ ATGAGTGGTGGTTGCAGGC 3′ (SEQ ID NO:31) and 5′ TGACCTTTCAAATGCAGTAGATTCA 3′ (SEQ ID NO:32).
  • Thermal cycling conditions consisted of 10 min at 95° C. followed by 40 cycles of 15 s at 95° C. and 1 min at 60° C. in a Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad, Hercules, Calif.).
  • Threshold cycle (Ct) values were calculated with the iCycler iQ software (Bio-Rad, Hercules, Calif.).
  • a standard curve for each gene was prepared from a 10-fold dilution series of the corresponding cDNA. The standard curves were plotted in terms of number of cDNA molecules (copy number) vs. threshold cycle (Ct).
  • the software was then used to calculate copy number of starting cDNA in each sample based on the standard curve for the gene of interest. Copy number for each gene was then normalized against GAPDH.
  • HRP-conjugated goat anti-rabbit Ab (sc-2054; Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) was detected using the ECLplus Western Blotting Detection System (Amersham Biosciences, Piscataway, N.J.).
  • Oligonucleotides (sense and antisense strands) (Biosynthesis Inc.; Lewisville, Tex.) were annealed and the resultant double stranded oligonucleotides precipitated, then end-labeled with 32 P-ATP using T4 polynucleotide kinase enzyme. Binding reactions (20 min., room temperature) included 32 P-labeled probe (activity 100,000 cpm), 5 ⁇ g RAW nuclear extract, 1 ⁇ g poly (dI-dC), 1 mM DTT, 10% glycerol and 1 ⁇ binding buffer.
  • Binding buffer (10 ⁇ ) for EMSA was 100 mM Tris-HCL (pH 7.5), 500 mM NaCl, 50 mM MgCl 2 , 10 mM EDTA (pH 8.0).
  • competition studies nuclear extracts were incubated with 100 fold molar excess of unlabeled double stranded oligonucleotide.
  • supershift studies nuclear extracts were incubated with 2 ⁇ g of appropriate antibodies to IRF-1 (H-205; Santa Cruz Biotechnology, Santa Cruz, Calif.) or IRF-3 (Active Motif, Carlsbad, Calif.).
  • reaction mixtures were electrophoresed (160V, room temperature) on 5% non-denaturing polyacrylamide gels containing 5% glycerol in 1 ⁇ TBE (50 mM Tris, 50 mM boric acid, and 1 mM EDTA). Gels were dried and autoradiographed.
  • C10 protects horses from Endotoxic shock induced by LPS or peritonitis.
  • Endotoxemia in horses is one such model of endotoxic shock in humans.
  • Endotoxemia in horses is caused by the biological consequences of endotoxins in blood.
  • Endotoxins are structural components of the walls of gram negative bacteria, the main representative molecule being lipopolysaccharide (LPS).
  • LPS lipopolysaccharide
  • LPS can be released from the gut to its surrounding environment, i.e. the peritoneal cavity and bloodstream. Once LPS reaches either, it can interact with mononuclear phagocytic cells.
  • This interaction increases the sensitivity of those cells to endotoxins by 1000-fold and induces an excessive response of an inflammatory cascade including activation of arachidonic acid, activation of the TLR4 signal pathway, and activation of a coagulation cascade.
  • the end result is the production of pro-inflammatory mediators with development of circulatory shock, e.g., TNF- ⁇ .
  • the TNF- ⁇ synthesis and release, mediated through the TLR4 signal, is associated with the synthesis of other inflammatory mediators, including Interleukins 1, (IL-1) Interleukin 6 (IL-6), prostaglandins and tissue factors such as acute phase protein (D. D. Morris, J Vet Intern Med, 5:167-81 (1991); D. L. Hawkins, et al., Vet Immunol Immunopathol, 66:1 -10 (1998); H. Kato, et al., Vet Immunol Immunopathol, 48:221-31 (1995)).
  • Serum concentration of IL-6 activity begins to increase approximately 1 hour after serum TNF- ⁇ and peaks between 3 to 6 hours after onset of endotoxemia.
  • IL-6 and IL-1 mediate the endotoxin-induced febrile response and are responsible for the inflammatory cascade, which constitutes the acute phase response.
  • nitric oxide is a well known mediator of endotoxic shock tissue injury in animal and human (A. Petros, et al., Cardiovasc Res, 28:34-9 (1994); P.
  • LPS is a potent inducer of inducible nitric oxide synthase (iNOS) (P. P.
  • the intestinal lumen of the horse usually contains large amount of endotoxins. It has been estimated that ceacum and ventral colon of a normal horse contains more than 2 grams of endotoxin, which is restricted to the intestinal lumen by an efficient mucosal barrier. Thus, any pathology that damages the mucosal barrier will allow the endotoxins to reach the peritoneal cavity and the blood (D. D. Morris, J Vet Intern Med, 5:167-81 (1991); J. N. Moore, et al., Can J Comp Med, 45:330-2 (1981); D. Chakravortty, et al., Microbiol Immunol, 43:527-33 (1999); J.
  • C-10 Using a mouse model of inflammatory bowel disease and colitis as well as endotoxic shock, C-10 exhibited suppressive action on interferon inducibles genes, IP-10, IRF-1, and MCP-1, a multiplicity of pro-inflammatory cytokine genes (TNF- ⁇ , IL-1, IL-6) as well as IRF-1 dependent genes (COX-2, iNOS).
  • Example 3 C-10 was able to inhibit pro-inflammatory cytokines, adhesion molecules, chemoattractant proteins, IRF-1, IFN- ⁇ , iNOS and COX-2 in the target organs, as well as circulating inflammatory mediators in the LPS-treated animals associated with the signs and symptoms of endotoxic shock, i.e. the hypotension, multi-systemic failure and disseminated intravascular coagulation.
  • Oxygen saturation in blood was decreased coincident with the shock, causing the mucosal membranes to become strongly cyanotic; total collapse followed shortly.
  • the digestive system was characterized by suppression of borborygmi, suppression of intestinal ileocecal activity, abdominal pain, colic, intestinal obstruction, strangulation and alteration of the mucosal barrier. Temperature increased at 6 hours and was normalized at 24 hours.
  • C10 protects horses from Endotoxic shock induced by LPS.
  • Horses were treated with a sub-lethal dose of LPS (10 ⁇ g/kg) after pretreatment with pure DMSO (10 ml) or C10 (2 mg/kg) dissolved in 10 ml pure DMSO injected intravenously (iv).
  • Horses with LPS developed toxic shock over a 24 hour period with hypotension, hypothermia, tachypnea, rapid pulse, abnormal cardiograms, and, finally, collapse, whereas C10 treated animals had none of these changes.
  • the results in Tables 9 and 10 are from a typical experiment with LPS or LPS+DMSO vs.
  • LPS+C10 treated animals studied at early time points and up to 24 hrs, with 1 week follow up, wherein cardiovascular parameters of circulatory shock were measured: toxemia, congestion, and cyanosis.
  • C10 protects horses from LPS-induced shock as measured by Toxemia and Vascular Congestion Time (hours)
  • C10 protects horses from LPS-induced shock as measured by Toxemia, Vascular Congestion, Cyanosis Time (hours) LPS Group LPS + DMSO Group LPS + c10 Group 0.00 Normal Normal Normal 0.15 Toxemic Toxemic Normal 0.3 Toxemic Toxemic Weak Congestion 1.0 Toxic Line Toxic Line 3 Cyanotic Cyanotic +++ Cyanotic Weak Congestion +++ +++ 6 Cyanotic +++ 24 Toxemic Toxemic Normal Toxic Line Toxic Line 1 week Normal Normal Normal Normal Normal
  • LPS+C10 treated animals studied at early time points and up to 24 hrs, with 1 week follow up, wherein fluid in the lungs was measured by auscultation, as well as tachypnea, and dyspnea. They demonstrate that C10 suppresses the signs of pulmonary distress suffered during toxic shock. TABLE 11 C10 protects horses from LPS-induced toxic shock as measured by Lung Auscultation. Time LPS + DMSO (hours) LPS Group Group LPS + c10 Group 0.00 Normal Normal Normal 0.15 0.3 Crackles Crackles Normal 1.0 3 Crackles Crackles Normal 6 Wheezes Wheezes 24 Crackles Crackles Normal Wheezes Wheezes 1 week Normal Normal Normal Normal
  • C10 also protects horses from Endotoxic shock induced by LPS as measured by abdominal pain, diarrhea, increased number of stools, and collapse or prostration to a lying rather than standing state.
  • Horses were treated with a sublethal dose of LPS (10 ⁇ g/kg) after pretreatment with 10 ml of pure DMSO or C10 (1 mg/kg) in 10 ml of pure DMSO injected iv.
  • Horses with LPS developed toxic shock over a 24 hour period with decreased blood pressure, hypothermia, rapid respiration, rapid pulse, abnormal cardiograms, and total prostration or collapse, whereas C10 treated animals had none of these changes.
  • Table 13 depicts typical LPS or LPS+DMSO vs.
  • LPS+C 10 treated animals studied at early time points and up to 24 hrs, with 1 week follow up, wherein abdominal pain, watery diarrhea, number of stools, and collapse to a lying state vs. normal gastrointestinal function and disposition were measured. The severe abdominal pain, diarrhea, and increased frequency of stools were evident in a typical LPS or LPS+DMSO treated animal by 3 hours as was the collapse and shock response of LPS treated animals. None of this occurred in animals treated with LPS plus C10. These data are representative of all animals in each group.
  • C10 protects horses from Endotoxic shock induced by LPS as measured by abdominal pain, diarrhea, increased number of stools, and collapse or prostration to a lying rather than standing state Time (Hours) LPS Group LPS + DMSO LPS + C10 0 normal normal normal 0.15-6 Abdominal pain Abdominal pain Normal Diarrhea Diarrhea 1 stool 10 ⁇ 2 stools 10 ⁇ 2 stools Collapsed and Collapsed and prostrate prostrate 24 normal Weak but upright normal 1 week normal normal normal normal normal normal
  • Phenylmethimazole (C10) protects horses form LPS-induced endotoxemia and endotoxic shock: In sum, C-10 clearly blocked symptoms of endotoxemia including hypotension and hypoxemia, as well as endotoxic shock collapse, cardiac anoxia, acute renal failure, and loses of water from blood in all respects (Tables 9-13). In contrast the DMSO vehicle had no protection from hypotension, hypoxemia, shock, collapse and organ failure after endotoxin (LPS) inoculation (Tables 9-13).
  • LPS endotoxin
  • Phenylmethimazole (C10) protects horses form peritonitis—induced endotoxemia and endotoxic shock: C10 protected horses from endotoxic shock and death by septic peritonitis induced by intestinal fluid. After intestinal (caecal) fluid was inoculated intraperitoneally into normal horses, the animals rapidly exhibited clear symptoms of endotoxemia, presumably because the fluid had free endotoxin. C10 protected in the first stage of endotoxemia due to free lipopolysaccharide present in the intestinal lumen (Table 14). Clinical evaluation of the animal at 0:30, 1, 3, 6, showed clinical signs of endotoxemia in non C10 treated animal but not in the C10 treated animal that were clinically protected from endotoxemia.
  • Toxic Shock Symptoms (% of horses and severity % survival measured as +, ++, etc.) Antibiotic C10 plus Antibiotic C10 plus Time (Hours) Therapy Antibiotics Therapy Antibiotics 0.0 100 100 0 0 0.15 100 100 0 0 0.3 100 100 0 0 1 100 100 0 0 3 100 100 0 0 6 100 100 50 (+) 12 100 100 50 (++) 24 100 100 100 (+++) 36 0 ND 1 week 0 ND Bold and Italicized Values are statistically significant from control group with antibiotics only. ND is not determined. Toxic shock symptoms were measured as described above.
  • Phenylmethimazole (C10) Phenylmethimazole (C10) on horses subjected to operative procedures to repair necrotic bowels: A group of animals were also subjected to an operative procedure that clamped vessels in a small portion of bowel. Within 2 days, bowel necrosis and peritonitis ensued. At that point animals were re-operated to remove the necrotic bowel and treated with 2 mg/kg C10 or DMSO alone pre-op and post-op for three days. Animals treated with C10 were walking and eating within 24 hours and had full recovery in all cases, whereas those without C10 developed toxic shock in most cases, were severely ill, and died. Both groups had the same antibiotic therapy as used above. These results indicate C10 is effective to prevent toxic shock in horses subjected to surgical procedures or endotoxin administration.
  • Phenylmethimazole (C10) is a methimazole derivative and lead compound of a family of tautomeric cyclic thione drugs that block pathologic activation of TLR3/TLR4 signaling in nonimmune tissues, monocytes, macrophages, and dendritic cells. They suppress the expression type I interferon genes (e.g.
  • INF- ⁇ interferon inducible genes
  • IRF-1 interferon inducible genes
  • pro-inflammatory cytokines TNF- ⁇ , IL-1 ⁇ , IL-6 pro-inflammatory cytokines such as MCP-1, COX-2 and iNOS.
  • Endotoxemia and endotoxic shock in horses are associated by the up-regulation of several mediators, COX-2 dependent mediators such as prostaglandins, TNF- ⁇ , IL-1, IL-6 and iNOS.
  • the Endotoxic shock survival rate is strongly dependent on type I interferon transcription genes in knock out rodent models. Using an endotoxemia horse model we carried out clinical studies showing that phenylmethimazole (C10) protects horses from clinical signs of endotoxemia and endotoxic shock induced by E.
  • coli lipopolysaccharide hypotension, hypoxemia, tachypnea, tachycardia, hypoxemia, respiratory distress, abdominal pain and colic, watery diarrhea, intestinal hypomotility and anus relaxation, acute renal failure, hyperglycemia and circulatory shock or collapse.
  • endotoxemia and shock due to septic peritonitis using intraperitoneal inoculation of intestinal flora the C10 survival rate was 100% compared with 0% of survival in non-treated animal.
  • Endotoxemia protection experiment In order to determine the effect of C-10 on experimental endotoxemia induced by E. coli LPS, we used 3 groups of horses. In Group 1 (LPS group), horses were injected with 10 ⁇ g/kg of E. coli (055 LPS from Sigma, St. Louis) by intravenous bolus injection as recommended by others (J. N. Moore, et al., Equine Vet J, 13:95-8 (1981); G. E. Burrows, Am J Vet Res, 40:991-8 (1979)). Group 2 horses (LPS+DMSO) were injected with the same dose of vehicle (100% DMSO) and the effect of DMSO alone was analyzed.
  • LPS group horses were injected with 10 ⁇ g/kg of E. coli (055 LPS from Sigma, St. Louis) by intravenous bolus injection as recommended by others (J. N. Moore, et al., Equine Vet J, 13:95-8 (1981); G. E. Burrows, Am J Vet Res, 40
  • Group 3 (LPS+C-10) horses were injected with LPS plus 100% DMSO used as the vehicle. Horses from the different groups were studied clinically at different time points. In the groups LPS+C-10 and LPS+DMSO, C-10 and DMSO were injected 30 minutes before LPS.
  • Time 0 was defined as a normal horse before injection of LPS. After LPS injection, we evaluated the animals at 15 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 24 hours and 1 week. We evaluated changes in the following biological systems targeted by LPS: cardiovascular, circulatory, abdominal, and pulmonary. Time of capillary flow, integrity of the vessels and other vessel alterations were evaluated clinically. Maximum venous blood pressure (NIBP max.), minimum venous blood pressure (NIBP min.), electrocardiogram (ECG), and oxygen saturation in blood (PsO 2 ), expressed by %, were determined using a Cardell Monitor 9403.
  • NIBP max. maximum venous blood pressure
  • NIBP min. minimum venous blood pressure
  • ECG electrocardiogram
  • PsO 2 oxygen saturation in blood
  • Glucose, GOT (glutamic oxalacetic transaminase enzyme), GPT (glutamic pyruvate transaminase enzyme), creatinine, urea, hemogram, hemoglobin (Hb), hematocrit (Ht), red cell number, PMN number (neutrophils, eosinophils, basophils), monocyte number and lymphocyte number were determined at different time points. Clinical observations were recorded by skilled veterinarians who were unaware of which animal received C10, i.e. results were evaluated in a blinded fashion.
  • Endotoxic shock survival experiments The ceacum and ventral colon of normal horses contain more than 2 g of free endotoxin as well as gram-negative bacteria which are restricted to the intestinal lumen by an intact intestinal barrier. The pathologies that damage the mucosal barrier allow the endotoxins to reach the peritoneal cavity as well as the blood.
  • To evaluate the protective effect of C-10 on horse endotoxic shock survival rate we injected 100 ml of ceacum fluid intraperitoneally to induce peritonitis and endotoxic shock. Ceacal fluid was extracted from horse under anesthesia. The group of horses that were inoculated intraperitoneally with intestinal fluid developed clinical peritonitis and symptoms of endotoxemia 12 hours after intraperitoneal fluid inoculation.
  • Phenylmethimazole (C10) decreases TLR4-mediated inflammation associated with atherosclerosis.
  • Atherosclerosis is a systemic disease of the circulation involving abnormal TLR4 expression and signaling causing increases in genes downstream, such as VCAM-1. Increased VCAM-1 on vascular endothelial cells is important to attract leukocytes to the inflammatory region.
  • Atherosclerosis is more advanced in patients with diabetes, hypertension, and hyperlipidemia.
  • the epidemic of obesity is associated with the epidemic of cardiovascular complications broadly considered as atherosclerosis complications: myocardial infarcts, strokes, etc.
  • a drug that might attenuate the inflammatory response has been suggested as potentially effective by TLR4 knockouts. This does not eliminate lesions, because the damaging insult, hyperlipidemia, remains.
  • the oxidized lipids can be construed as environmental signature molecules that elicit inflammation when they penetrate the endothelial layer.
  • An important point, however, to recall is that lesions can be selective—located primarily in one or another vascular bed. Further they may be influenced by the inflammatory response that causes swelling of the vessel wall and diminished size of the lumen. That decrease in lumen, plus leukocyte/platelet binding which further decreases the lumenal opening, results in occlusive disease.
  • a critical component of many physiological and pathological inflammatory processes is thus the adhesion of leukocytes to the endothelium in the fluid dynamic environment of the circulation.
  • Leukocyte adhesion to the endothelium occurs through a cascade of adhesive events involving tethering (i.e. attachment) to the endothelium from the free stream, rolling on the apical surface of the endothelium, cessation of rolling termed “arrest”, spreading to more pleomorphic shapes, and migration between adjacent endothelial cells to reach the extravascular space.
  • This adhesion cascade is mediated, in part, by non-covalent bonds that form between molecules present on the surface of the leukocyte (ligands such as integrins) and cognate molecules present on the surface of the endothelium (receptors; e.g. E-selectin, ICAM-1, VCAM-1).
  • ligands such as integrins
  • cognate molecules present on the surface of the endothelium
  • ECAMs endothelial cell adhesion molecules
  • VCAM-1 is present in a localized fashion on aortic endothelium that overlies early foam cell lesions in atherosclerosis.
  • the increased expression of ECAMs mediates, in part, the selective recruitment of leukocytes to a site of inflammation (T. A. Springer, Cell, 76:301-314, (1994)).
  • VCAM-1 is up-regulated at sites of developing and developed atherosclerotic lesions (M. I. Cybulsky, et al., Science, 251:788-791 (1991)) and participates in monocyte adhesion to the endothelium during atherogenesis (F. W. Luscinskas, et al., J. Cell Biol., 125:1417-27 (1994); C. L. Ramos, et al., Circ. Res., 84:1237-44 (1999)).
  • a promising therapeutic approach for treating pathological inflammation is to reduce aberrant leukocyte adhesion to the endothelium via suppression of ECAMs (J. Panes, et al., Br. J. Pharmacol., 126:537-550 (1999)).
  • ECAM expression is regulated at the gene level by the activity of transcription factors.
  • Pro-inflammatory cytokine e.g. TNF- ⁇
  • NF- ⁇ B transcription factors
  • IRF-1 transcription factor 1
  • C10 could potentially serve this purpose (N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)).
  • C10 (i) inhibits monocytic cell adhesion to cytokine inflamed human aortic endothelial cells (HAEC) under in vitro flow conditions that mimic conditions present in vivo, (ii) strongly inhibits cytokine-induced HAEC expression of VCAM-1 via suppression of the transcription factor IRF-1, and not NF- ⁇ B, (iii) has a more modest effect on E-selectin expression and (iv) has very little effect on ICAM-1 expression.
  • HAEC cytokine inflamed human aortic endothelial cells
  • mice deficient in TLR4 had a significant reduction in aortic plaque development in atherosclerosis-prone apolipoprotein E-deficient (ApoE ⁇ / ⁇ ) mice suggesting an important role for TLR4 in atherosclerosis.
  • the well-accepted ApoE ⁇ / ⁇ murine model (Y. Nakashima, et al., Arterioscler. Thromb. Vasc. Biol., 18:842-51 (1998)) was our animal model of atherosclerosis. In initial experiments, these mice were fed a high fat diet and received injections of C10 intraperitoneally every other day or orally every other day. Mice were sacrificed at 8 weeks and lesions characterized, including VCAM-1 and TLR4 expression in accord with literature based studies (Y. Nakashima, et al., Arterioscler. Thromb. Vasc. Biol., 18:842-51 (1998)).
  • mice treated with C10 were compared to controls to determine if C10 has a statistical effect on lesions in the carotid arteries.
  • C10 reduced vascular inflammation in ApoE ⁇ / ⁇ mice fed a high fat diet: C10 was given i.p. (1 mg/kg) every other day to mice for 8 weeks. Control mice received DMSO alone. Mice were sacrificed at 8 weeks and histopathology examined in different tissues as determined by hematoxylin and eosin staining.
  • FIG. 15 sections from the base of the aorta in C10 treated ( FIG. 15 , Panel A) and untreated mice ( FIG. 15 , Panel B) are presented as well as sections of the coronary artery vasculature in C10 treated ( FIG. 15 , Panel C) and untreated mice ( FIG. 15 , Panel D).
  • Vessels in the myocardium were also compared in C10 treated and untreated mice.
  • Panel B the arrows show that the severity of the lesions in the base of the aorta is markedly greater in untreated mice by comparison to C10 treated mice (Panel A).
  • Panel D the picture is representative of long sections of the coronary arteries that were nearly fully occluded with plaque in untreated mice whereas in C10 treated mice (Panel C), coronary arteries were largely unobstructed. Further, even where lesions were evident the lumens of vessels remained patent. Vessels within the myocardium were obstructed by plaque in the absence of C10 but patent and nearly free of plaque in the mice treated with C10. Data are representative of multiple slides taken from multiple animals.
  • Atherosclerotic lesions are decreased in C10 treated mice.
  • Sections of the coronary arteries and myocardium as well as the base of the aorta were compared in untreated mice vs. C10 treated mice both for extent of lesion, quality of lesion, overexpressed TLR4, overexpressed VCAM-1, and extent of inflammation and plaque.
  • Lesions and observations were qualitatively evaluated using ++++ for severe to + for very mild.
  • C10 treated animals were clearly improved. The results indicated that C10 decreased the widespread inflammatory response wherein TLR4 positive cells abound and there are macrophages infiltrating the area. Evaluation was double blinded.
  • the ApoE ⁇ / ⁇ model in mice is representative of changes in human atherosclerotic plaques.
  • Atherosclerotic lesions in human tissues are associated with overexpressed TLR4 and VCAM-1.
  • Sections of the coronary arteries from surgically removed plaques were immunstained with anti-TLR4 ( FIG. 16 , Bottom Right Panel), anti-VCAM-1 ( FIG. 16 , Top Right Panel), anti-ICAM-1 ( FIG. 16 , Bottom Left Panel) in sequential slices from the paraffin imbedded block.
  • An H &E stain FIG. 16 , Top Left Panel shows the occluded vessel with a foam cell, lipid laden “plaque” surrounded by a muscle wall and myocardial tissue.
  • VCAM-1 (dark grey color) is overexpressed in the lesion but also in the endothelial layer opposite the lesion area.
  • TLR4 (dark grey color) is more expressed in the area opposite the lesion and, surprisingly, throughout the smooth muscle layer surrounding the vessel, particularly opposite the plaque. TLR4 is also expressed in the myocardial musculature. The expression suggests a widespread inflammatory response wherein TLR4 positive cells abound be they macrophages infiltrating the area or other cells. In all respects these data duplicate those in the ApoE ⁇ / ⁇ mice and thus should be, like the lesions in the ApoE ⁇ / ⁇ mice (Table 15), sensitive to C10 therapy.
  • C10 decreases IFN- ⁇ induction of phosphorylation of Stat1 and the activation of IRF-1 in human aortic endothelial cells (HAEC):
  • HAEC human aortic endothelial cells
  • Tyrosine phosphorylation of Stat1 is one requirement for its activation of downstream genes; tyrosine phosphorylation is important in the dimerization process necessary for Stat binding to promoter elements on sensitive genes. Another requirement is serine phosphorylation, which contributes to full Stat1 transcriptional activation.
  • Rat thyrocytes (FRTL-5) were infected ( FIG. 17B , lane 2) or not ( FIG. 17B , lane 1) with Influenza A virus for 24 hours and then treated with either DMSO (1%) ( FIG. 17B , lane 3) or 1 mM C10 ( FIG.
  • FIG. 17B , lane 4 Human aortic endothelial cells (HAEC) were incubated with 100U/mL of hIFN- ⁇ (Biosource, Camarillo, Calif.) for 2 hours in the presence of either DMSO (1%) ( FIG. 17B , lane 5) or 1 mM C10 ( FIG. 17B , lane 6); and (iii) mouse macrophages (RAW 264.7) were incubated for 3 hours with E. coli LPS serotype 0111 :B4 (Sigma, Milwaukee, Wis.) at a concentration of 500 ng/mL either alone ( FIG. 17B , lane 7) or in the presence of DMSO (0.5%) ( FIG.
  • FIG. 17B , lane 8 or 0.5 mM C10 ( FIG. 17B , lane 9).
  • IFN- ⁇ given with vehicle control DMSO also increases serine phosphorylation in HAEC ( FIG. 17B lane 5) and this is decreased by C10 ( FIG. 17B , lane 6).
  • the effect of C10 to reduce pathologically induced serine phosphorylation of Stat1 is not limited to HAEC but is also seen in FRTL-5 cells ( FIG. 17B . lane 4 vs lanes 2 and 3) and RAW cells ( FIG. 17B , lane 9 vs lanes 7 and 8). Additionally, it is not limited to pathologic induction by IFN- ⁇ ( FIG.
  • C10 is a inhibitor of IRF-3/IFN- ⁇ /Stat/IRF-1/ISRE activation pathways and blocks pathologically increased effects on Stat1 tyrosine and serine phosphorylation induced by TLR3/TLR4 pathologic signals in nonimmune cells, monocytes, macrophages, and dendritic cells.
  • Compound 10 is an effective agent in a mouse model of atherosclerosis even given every other day and evaluated 8 weeks after insult onset (high fat feeding). However, it is also effective at earlier time points. Thus, when we compared the effect of C10 on mice at 4 weeks, given both orally and ip, there were significant effects on weight. This strain of mice is the same as used in obese animal studies related to the rapid onset of Type 2 diabetes (M. Fujimoto, et al., Diabetes, 54:1340-8, (2005)). In this regard, chronic inflammation has been postulated to play an important role in the pathogenesis of insulin resistance and linked to overexpression of iNOS (M. Fujimoto, et al., Diabetes, 54:1340-8 (2005)). C10 decreased weight gain evident before the 4 week time period and also reduced the inflammatory TLR4 mediated response.
  • mice Twenty female Apo E ⁇ / ⁇ mice (Jackson Laboratory), 5 weeks old and weighing 14.5 g (average weight), were divided in 4 groups: (1) animals treated with 10% DMSO; (2) animals treated orally with C-10 in DMSO (1 mg/kg body weight); (3) animals treated I/P with C-10 in DMSO (same dose); and (4) control animals without treatment.
  • the treatment was done every other day (8 week expt) or every day.
  • the animals were fed on a Western-type diet (TD 88137 from Harlan, Teklan). The experiment was terminated after 4 or 8 weeks.
  • Tissue preparation At the end of the experiment, the animals were anesthetized by IP injection of Avertin 0.1 ml/5 g of body weight. In situ perfusion-fixation was performed with PBS for 10 min followed by PBS/4% formaldehyde at 37° C. Heart and aorta were removed; the arch, thoracic and abdominal portions of the aorta were dissected; and the surrounding tissues were carefully removed. The tissues were post fixed by immersion in PBS/4% formaldehyde over night at 4° C. Tissue samples were then washed 10 minutes with PBS; after dehydration they were embedded in paraffin and sectioned (7 ⁇ m thick). Sections were stained with Hematoxylin-eosin and examined under a light microscope.
  • Immunoblot analysis in HAEC To determine if C10 blocks IFN- ⁇ mediated activation of tyrosine phosphorylation of Stat1 in HAEC we treated confluent HAEC with 100U/ml IFN- ⁇ in the absence or presence of C10 (1.0 mM), 0.25% DMSO (carrier control for C10) for 2 hours.
  • Whole cell lysates were prepared in lysis buffer (150 mM NaCl, 1% IGE-PAL CA 630, and 50 mM Tris-HCl, pH 8.0) in the presence of a protease inhibitor mixture (PMSF, leupeptin, and pepstatin A).
  • HAEC Human aortic endothelial cells
  • phenylmethimazole (C10) a lead compound of the methimazole, methimazole derivative, tautomeric cyclic thione family is effective to reduce pathologic TLR3/TLR4 overexpression and/or signaling in nonimmune cells, monocytes, macrophages, and dendritic cells.
  • TLR3 Type 1 diabetes
  • TLR4 Endotoxic shock, colitis, and atherosclerosis
  • TLR3 or TLR4 are functional, and that their activation causes increases or decreases in genes and gene products of two signal paths which have been linked to TLR3 or TLR4 signaling via its MyD88 and/or its TRIF adaptor protein: (i) the NF- ⁇ B and ERK1/2 MAPK path pondered to emanate from TRAF6 interactions and (ii) the IRF-3 and IFN- ⁇ signal path.
  • NF- ⁇ B and ERK1/2 MAPK path reputed to emanate from TRAF6 interactions
  • IRF-3 and IFN- ⁇ signal path are relevant not only to mouse or rat cells (FRTL-5 thyrocytes, RAW macrophages) but human as well (HAEC, NPA thyrocytes, HUVEC).
  • the C10 effect is shown to be applicable to multiple pathologic stimuli from infectious agents to dsRNA and to noxious environmental insults such as hyperlipidemias linked to overeating high lipid containing diets.
  • TLR3/4 overexpression and signaling can be blocked by C10 and this family of compounds in vitro and in vivo.
  • disease caused by transfection by dsRNA mimics infection by a virus (Influenza A), which is a single strand RNA virus whose replication and activity after infection is likely to be mimicked by the dsRNA transfection.
  • dsRNA transfection a virus that is a single strand RNA virus whose replication and activity after infection is likely to be mimicked by the dsRNA transfection.
  • pancreatic cell systems associated with insulinitis and diabetes as well as lung epithelial cells associated with pulmonary autoimmune inflammatory disorders also link virus infection, dsRNA transfection, and TLR3 overexpression, indicating this phenomenon and the action of C10 is applicable to nonimmune cells in multiple tissues.
  • TLR3 and IFN- ⁇ protein are expressed in situ in thyrocytes from patients with Hashimoto's thyroiditis which are surrounded by immune cells but not in thyrocytes from normal individuals or Graves' autoimmune hyperthyroidism, a novel finding never previously demonstrated.
  • the results from human thyrocytes in culture indicate that TLR3 activation and increases can occur in a human as well as rat thyrocyte in culture and this can occur in the absence of lymphocytes or a lymphocyte-produced IFN, since lymphocytes primarily produce type II interferon (63).
  • thyrocytes are affected by a primary insult that activates the TLR3 system to produce an innate immune response mimicking that of a dendritic cell.
  • the resultant cytokine and co-stimulatory molecule changes in the thyrocyte may then contribute to attracting lymphocytes to the gland, since unlike dendritic cells, the thyrocytes cannot migrate to the lymphoid organ.
  • Hashimoto's and Type 1 diabetes may have immune cell infiltrates and destructive thyrocyte or ⁇ -cell changes because of a primary insult to the specific tissue cell that activates TLR3 and an innate immune response in the tissue cells; this may be an early event in the pathogenic mechanism (D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80 (2004); B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004)).
  • TLR3 overexpression/signaling might be sensitive to the immunomodulatory actions of methimazole (MMI) or its more potent derivative, phenylmethimazole (C10) (M. Saji, et al., J Clin Endocrinol Metab, 75:871-8 (1992); V.
  • IRF-1 acts more broadly than just inhibition of IRF-3 transactivation and, therefore, may inhibit activation of a broad range of ISRE sequences on other genes.
  • IRF-1 has a GAS, which binds Stat1.
  • GAS which binds Stat1.
  • C10 may be an example of an agent that meets the new therapeutic paradigm requested by Davendra and Eisenbath in their review (D.
  • IRF-3/IFN- ⁇ /ISRE/STAT signal for example by VAK kinases is a pathologic event induced, for example, by viral infection. It is this that C10 inhibits. IRF-1 is normally not expressed, is increased only in pathologic states, and is effectively blocked by C10 therapy.
  • TLR signaling remains complex with many unknowns.
  • the role of PI3 kinase and Akt involvement in phosphorylation of IRF-3 has recently emerged (S. N. Sarkar, et al., Nat Struct Mol Biol, 11:1060-7 (2004)); full phosphorylation of IRF-3 requires TBK-1 and Akt.
  • Reactive oxygen species involvement in virus-induced activation of STATs is recognized (T. Liu, et al., J Biol Chem, 279:2461-9 (2004)).
  • the P38alphaMap kinase pathway is important in downstream effectors that participate in Type I IFN-dependent gene transcription and involvement (Y. Li, et al., J Biol Chem, 279:970-9 (2004)).
  • Transcriptional activation of the IFN- ⁇ gene requires assembly of an enhanceosome containing transcription factors ATF-2/c-Jun, IRF-3/IRF-7, NF- ⁇ B, and HMGI (Y) (D. Panne, et al., Embo J, 23:4384-93 (2004))and thus indicates the two signal paths are intertwined both at the earliest level of IRF-3/IFN- ⁇ activation as well as at downstream molecules such as VCAM-1 gene expression.
  • Hashimoto's may, therefore, not only be grouped with insulinitis and Type 1 diabetes, but also with colitis and atherosclerosis as autoimmune/inflammatory diseases associated with TLR3/4 overexpression and signaling in nonimmune cells, whose overexpression involves induction by molecular signatures of environmental pathogens (K. S. Michelsen, et al., Proc Natl Acad Sci US A, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L.
  • the DSS model is used to study ulcerative colitis and Crohn's disease. Recent work indicates that TLR4 is strongly up-regulated in both (E. Cario, et al., Infect Immun, 68:7010-7 (2000)) and that enterocolitis in another mouse enterocolitis model is significantly improved in TLR4-deficient mice. These data indicate the importance of innate immunity and TLR4 in Th1-dependent enterocolitis (M. Kobayashi, et al., J Clin Invest, 111:1297-308 (2003)) and thus the importance of C10 in blocking TLR4 overexpression in vitro and in vivo in colonic epithelial cells in the DSS model.
  • Hashimoto's and Type 1 diabetes may be prototypes of each other and that studies in FRTL-5 thyrocytes are a relevant model for studies in pancreatic ⁇ islet cells and diabetes.
  • High glucose levels can transcriptionally increase MHC I expression and amplify interferon-(action in FRTL-5 thyroid cells (G. Napolitano, et al., Endocrinology, 143:1008-17 (2002)). In retrospect, this is applicable to the islet cell changes induced by high glucose levels.
  • Type I IFN IFN- ⁇ or ⁇
  • Type I IFNs act as potent extracellular mediators of host defense and homeostasis and lead to the synthesis of proteins that mediate antiviral, growth inhibitory, and immunomodulatory responses.
  • the secreted Type I IFN can sensitize the same or adjacent cells to dsRNA or dsDNA by increasing expression of dsRNA recognition molecules such as TLR3 and PKR or dsDNA recognition by PKR.
  • dsRNA recognition molecules such as TLR3 and PKR or dsDNA recognition by PKR.
  • a similar model invoking TLR3 and Type I IFN in the innate immune response of nonimmune cells has been invoked in Influenza A infected lung tissue (L. Guillot, et al., J Biol Chem, 279:2712-8 (2004)).
  • Type I IFNs have been used in the clinical setting to treat hepatitis C and B, chronic myelogenous leukemias, melanoma, and renal cancer (C. E. Samuel, Clin Microbiol Rev, 14:778-809 (2001)).
  • One side effect of Type I IFN therapy is, however, a higher incidence of autoimmune disease.
  • the risk of Hashimoto's thyroiditis is increased with type I IFN treatment in HCV hepatitis patients.
  • Thyroid auto antibodies are found in up to 20% of patients who receive treatment with type I IFNs and approximately 5% of these patients develop clinical hypothyroidism (P.
  • dsRNA transfection was used to activate PKR-dependent NF- ⁇ B activation or a separate kinase system leading to IFN- ⁇ gene expression through IRF-3 activation.
  • the upstream mechanism resulting in IRF-3 activation following dsRNA transfection or viral infection in vitro has been clarified.
  • Pharmacological and molecular studies suggested that a novel viral-activated serine/threonine kinase (VAK), instead of PKR, might activate IRF-3 in response to cytosolic dsRNA (M. J. Servant, et al., J Biol Chem, 276:355-63 (2001); M. J.
  • the C10 family is effective on nonimmune cells, macrophages, monocytes and dendritic cells but has been shown to be minimally active on other immune cells. Further, the C10 family is restrictive in its action on the IRF-3/Type 1 IFN/STAT/ISRE/IRF-1 signal; its effect on direct activities of the NF- ⁇ B signal system is minimal. If IRF-1 is not expressed in the normal cell, but only induced after pathologic induction, i.e. by virus infection, LPS, dsRNA transfection, or noxious environmental insult, this family of compounds is clearly selective in affecting only pathologic overexpression leading to disease and not normal host immune defenses. They appear to be selective agents.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Diabetes (AREA)
  • Epidemiology (AREA)
  • Pulmonology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Neurosurgery (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Dermatology (AREA)
  • Rheumatology (AREA)
  • Cardiology (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Pain & Pain Management (AREA)
  • Vascular Medicine (AREA)
  • AIDS & HIV (AREA)
  • Urology & Nephrology (AREA)
US11/130,922 2004-03-16 2005-05-17 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression Abandoned US20060211752A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
US11/130,922 US20060211752A1 (en) 2004-03-16 2005-05-17 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
JP2008512377A JP2008545651A (ja) 2005-05-17 2006-05-11 トール様受容体に関連する自己免疫疾患及び炎症性疾患の治療のための方法及び組成物
EP06770302A EP1896015A1 (de) 2005-05-17 2006-05-11 Verfahren und zusammensetzungen zur behandlung von autoimmun- und entzündlichen erkrankungen im zusammenhang mit toll-artigen rezeptoren
CA002606769A CA2606769A1 (en) 2005-05-17 2006-05-11 Uses of phenylmethimazoles, methimazole derivatives, and cyclic thiones for the treatment of septic shock sepsis, and/or toxic shock syndrome
PCT/US2006/018554 WO2006124676A1 (en) 2005-05-17 2006-05-11 Methods and compositions for the treatment of autoimmune and inflammatory diseases associated with toll-like receptors
AU2006247504A AU2006247504B2 (en) 2005-05-17 2006-05-11 Methods and compositions for the treatment of autoimmune and inflammatory diseases associated with Toll-like receptors
EP20110161080 EP2399578A1 (de) 2005-05-17 2006-05-11 Verfahren und Zusammensetzungen zur Behandlung von autoimmun- und entzündlichen Erkrankungen im Zusammenhang mit toll-artigen Rezeptoren
US12/286,880 US20100004304A1 (en) 2004-03-16 2008-10-01 Methods and compositions for the treatment of malignant melanoma, breast, prostate, colon, papillary thyroid and pancreatic cancer
US13/370,079 US9326972B2 (en) 2004-03-16 2012-02-09 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
US15/047,851 US20160220536A1 (en) 2004-03-16 2016-02-19 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US10/801,986 US20050209295A1 (en) 2004-03-16 2004-03-16 Methimazole derivatives and tautomeric cyclic thiones to inhibit cell adhesion
US10/912,948 US7928132B2 (en) 2004-08-06 2004-08-06 Methods for the amelioration of episodes of acute or chronic ulcerative colitis
US11/130,922 US20060211752A1 (en) 2004-03-16 2005-05-17 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US10/801,986 Continuation-In-Part US20050209295A1 (en) 2004-03-16 2004-03-16 Methimazole derivatives and tautomeric cyclic thiones to inhibit cell adhesion
US10/912,948 Continuation-In-Part US7928132B2 (en) 2004-03-16 2004-08-06 Methods for the amelioration of episodes of acute or chronic ulcerative colitis

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/286,880 Continuation-In-Part US20100004304A1 (en) 2004-03-16 2008-10-01 Methods and compositions for the treatment of malignant melanoma, breast, prostate, colon, papillary thyroid and pancreatic cancer
US13/370,079 Continuation US9326972B2 (en) 2004-03-16 2012-02-09 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression

Publications (1)

Publication Number Publication Date
US20060211752A1 true US20060211752A1 (en) 2006-09-21

Family

ID=36923891

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/130,922 Abandoned US20060211752A1 (en) 2004-03-16 2005-05-17 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
US13/370,079 Expired - Fee Related US9326972B2 (en) 2004-03-16 2012-02-09 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
US15/047,851 Abandoned US20160220536A1 (en) 2004-03-16 2016-02-19 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression

Family Applications After (2)

Application Number Title Priority Date Filing Date
US13/370,079 Expired - Fee Related US9326972B2 (en) 2004-03-16 2012-02-09 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
US15/047,851 Abandoned US20160220536A1 (en) 2004-03-16 2016-02-19 Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression

Country Status (6)

Country Link
US (3) US20060211752A1 (de)
EP (2) EP2399578A1 (de)
JP (1) JP2008545651A (de)
AU (1) AU2006247504B2 (de)
CA (1) CA2606769A1 (de)
WO (1) WO2006124676A1 (de)

Cited By (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040234532A1 (en) * 2003-05-20 2004-11-25 Allergan, Inc. Methods and compositions for treating eye disorders
US20060246495A1 (en) * 2005-04-15 2006-11-02 Garrett James A Diagnosis of sepsis
US20070282005A1 (en) * 2005-06-01 2007-12-06 Ruben Zamora Hmgb1 expression and protective role of semapimod in nec
US20080039395A1 (en) * 2006-08-07 2008-02-14 United States Government As Represented By The Department Of Veterans Affairs Methods for treating septic shock
US20080085524A1 (en) * 2006-08-15 2008-04-10 Prometheus Laboratories Inc. Methods for diagnosing irritable bowel syndrome
WO2008124787A2 (en) * 2007-04-09 2008-10-16 Acclarent, Inc. Ethmoidotomy system and implantable spacer devices having therapeutic substance delivery capability for treatment of paranasal sinusitis
WO2008131074A1 (en) * 2007-04-19 2008-10-30 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Use of toll-like receptor-9 agonists, toll-like receptor-4 antagonists, and/or nuclear oligomerization domain-2 agonists for the treatment or prevention of toll-like receptor-4-associated disorders
WO2008147956A3 (en) * 2007-05-25 2009-01-29 Centocor Inc Toll-like receptor 3 modulators and uses thereof
US20090047243A1 (en) * 2007-07-17 2009-02-19 Richard Rickles Combinations for the treatment of b-cell proliferative disorders
US20090053168A1 (en) * 2007-07-17 2009-02-26 Richard Rickles Treatments of b-cell proliferative disorders
WO2009048947A1 (en) * 2007-10-09 2009-04-16 Board Of Regents, The University Of Texas System Methods of treatment of opioid tolerance, physical dependence, pain, and addiction with inhibitors of certain growth factor receptors
WO2009059143A2 (en) * 2007-10-31 2009-05-07 Centocor, Inc. Use of toll-like receptor 4 antagonists for the treatment or prevention of osteoarthritic conditions
US20090197806A1 (en) * 2006-01-09 2009-08-06 Morrow Ardythe L Adiponectin for treatment of various disorders
WO2009105260A2 (en) * 2008-02-21 2009-08-27 University Of Kentucky Ultra-small rnas as toll-like receptor-3 antagonists
WO2009154610A1 (en) * 2008-06-17 2009-12-23 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
US20100009934A1 (en) * 2008-06-09 2010-01-14 Combinatorx, Incorporated Beta adrenergic receptor agonists for the treatment of b-cell proliferative disorders
US20100035852A1 (en) * 2008-08-05 2010-02-11 The Regents Of The University Of Michigan Compositions and methods for treating inflammatory conditions of the bowel
WO2010040054A3 (en) * 2008-10-02 2010-06-17 Centocor Ortho Biotech Inc. Methods for suppressing toll-like receptor activity
WO2010118334A1 (en) * 2009-04-09 2010-10-14 The University Of North Carolina At Chapel Hill Methods of treating edema related to ischemia-reperfusion
US20100303799A1 (en) * 2007-10-04 2010-12-02 The Regents Of The University Of California Treatment of Conditions Related to Shock
US20100317564A1 (en) * 2009-06-05 2010-12-16 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
WO2011041582A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-inhibiting gene products
US7943328B1 (en) 2006-03-03 2011-05-17 Prometheus Laboratories Inc. Method and system for assisting in diagnosing irritable bowel syndrome
US8080000B2 (en) 2004-04-21 2011-12-20 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US8088101B2 (en) 2004-04-21 2012-01-03 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US8100933B2 (en) 2002-09-30 2012-01-24 Acclarent, Inc. Method for treating obstructed paranasal frontal sinuses
WO2012011100A1 (en) 2010-07-19 2012-01-26 Yeda Research And Development Co. Ltd. Peptides based on the transmembrane domain of a toll-like receptor (tlr) for treatment of tlr-mediated diseases
US8114113B2 (en) 2005-09-23 2012-02-14 Acclarent, Inc. Multi-conduit balloon catheter
US8114062B2 (en) 2004-04-21 2012-02-14 Acclarent, Inc. Devices and methods for delivering therapeutic substances for the treatment of sinusitis and other disorders
US8118757B2 (en) 2007-04-30 2012-02-21 Acclarent, Inc. Methods and devices for ostium measurement
US8142422B2 (en) 2004-04-21 2012-03-27 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US8146400B2 (en) 2004-04-21 2012-04-03 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US8172828B2 (en) 2004-04-21 2012-05-08 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US8182432B2 (en) 2008-03-10 2012-05-22 Acclarent, Inc. Corewire design and construction for medical devices
US8190389B2 (en) 2006-05-17 2012-05-29 Acclarent, Inc. Adapter for attaching electromagnetic image guidance components to a medical device
WO2013007660A1 (en) * 2011-07-08 2013-01-17 Biosynthema Inc. Enhanced in vivo targeting of radiolabelled peptides with the means of enzyme inhibitors
US8388642B2 (en) 2005-01-18 2013-03-05 Acclarent, Inc. Implantable devices and methods for treating sinusitis and other disorders
US8414473B2 (en) 2004-04-21 2013-04-09 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US8435290B2 (en) 2009-03-31 2013-05-07 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
US8439687B1 (en) 2006-12-29 2013-05-14 Acclarent, Inc. Apparatus and method for simulated insertion and positioning of guidewares and other interventional devices
US8485199B2 (en) 2007-05-08 2013-07-16 Acclarent, Inc. Methods and devices for protecting nasal turbinate during surgery
US8518903B2 (en) 2007-04-19 2013-08-27 University of Pittsburgh—of the Commonwealth System of Higher Education Use of toll-like receptor-9 agonists
US8580748B2 (en) 2011-04-06 2013-11-12 13Therapeutics, Inc. Peptides for the treatment of hearing
US8652527B1 (en) 2013-03-13 2014-02-18 Upsher-Smith Laboratories, Inc Extended-release topiramate capsules
US8702626B1 (en) 2004-04-21 2014-04-22 Acclarent, Inc. Guidewires for performing image guided procedures
US8715169B2 (en) 2004-04-21 2014-05-06 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US8740929B2 (en) 2001-02-06 2014-06-03 Acclarent, Inc. Spacing device for releasing active substances in the paranasal sinus
US8747389B2 (en) 2004-04-21 2014-06-10 Acclarent, Inc. Systems for treating disorders of the ear, nose and throat
US8764729B2 (en) 2004-04-21 2014-07-01 Acclarent, Inc. Frontal sinus spacer
US8809303B2 (en) 2008-04-09 2014-08-19 The University Of North Carolina At Chapel Hill Methods of regulating actin cytoskeletal rearrangement and intercellular gap formation
US8894614B2 (en) 2004-04-21 2014-11-25 Acclarent, Inc. Devices, systems and methods useable for treating frontal sinusitis
US8932276B1 (en) 2004-04-21 2015-01-13 Acclarent, Inc. Shapeable guide catheters and related methods
US8951225B2 (en) 2005-06-10 2015-02-10 Acclarent, Inc. Catheters with non-removable guide members useable for treatment of sinusitis
US8979888B2 (en) 2008-07-30 2015-03-17 Acclarent, Inc. Paranasal ostium finder devices and methods
KR101510941B1 (ko) * 2012-07-03 2015-04-10 일양약품주식회사 신규한 펩타이드 및 이의 용도
US9039657B2 (en) 2004-08-04 2015-05-26 Acclarent, Inc. Implantable devices and methods for delivering drugs and other substances to treat sinusitis and other disorders
US9072760B2 (en) 2010-09-24 2015-07-07 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US9072626B2 (en) 2009-03-31 2015-07-07 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
US9089258B2 (en) 2004-04-21 2015-07-28 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US9101384B2 (en) 2004-04-21 2015-08-11 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, Nose and/or throat
US9101545B2 (en) 2013-03-15 2015-08-11 Upsher-Smith Laboratories, Inc. Extended-release topiramate capsules
US9107574B2 (en) 2004-04-21 2015-08-18 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
WO2015124570A1 (en) * 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for the treatment of influenza a virus infection
US9155492B2 (en) 2010-09-24 2015-10-13 Acclarent, Inc. Sinus illumination lightwire device
US9265407B2 (en) 2004-04-21 2016-02-23 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US9295715B2 (en) 2010-10-02 2016-03-29 The Regents Of The University Of California Minimizing intestinal dysfunction
US9351750B2 (en) 2004-04-21 2016-05-31 Acclarent, Inc. Devices and methods for treating maxillary sinus disease
US9399121B2 (en) 2004-04-21 2016-07-26 Acclarent, Inc. Systems and methods for transnasal dilation of passageways in the ear, nose or throat
US9433437B2 (en) 2013-03-15 2016-09-06 Acclarent, Inc. Apparatus and method for treatment of ethmoid sinusitis
US9468362B2 (en) 2004-04-21 2016-10-18 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US9562066B2 (en) 2012-09-25 2017-02-07 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Oral therapy of necrotizing enterocolitis
US9629684B2 (en) 2013-03-15 2017-04-25 Acclarent, Inc. Apparatus and method for treatment of ethmoid sinusitis
US9708661B2 (en) 2008-04-03 2017-07-18 Becton, Dickinson And Company Advanced detection of sepsis
US9820688B2 (en) 2006-09-15 2017-11-21 Acclarent, Inc. Sinus illumination lightwire device
US20180045623A1 (en) * 2015-03-11 2018-02-15 Timothy Ragan Systems and methods for serial staining and imaging
CN108251456A (zh) * 2018-01-23 2018-07-06 新乡医学院 一种nod遗传背景的动脉粥样硬化小鼠模型的制备方法
US10023567B2 (en) 2014-07-18 2018-07-17 Ohio University Imidazole and thiazole compositions for modifying biological signaling
US10105305B2 (en) * 2014-02-19 2018-10-23 The Johns Hopkins University Compositions and methods for promoting skin regeneration and hair growth
US10172848B2 (en) 2010-12-22 2019-01-08 University of Pittsburgh—Of the Commonwealth Systems of Higher Education Gap junction-enhancing agents for treatment of necrotizing enterocolitis and inflammatory bowel disease
US10188413B1 (en) 2004-04-21 2019-01-29 Acclarent, Inc. Deflectable guide catheters and related methods
US10206821B2 (en) 2007-12-20 2019-02-19 Acclarent, Inc. Eustachian tube dilation balloon with ventilation path
US10524814B2 (en) 2009-03-20 2020-01-07 Acclarent, Inc. Guide system with suction
US10598597B2 (en) 2005-05-25 2020-03-24 Massachusetts Institute Of Technology Multifocal imaging systems and method
US10668092B2 (en) 2010-09-24 2020-06-02 The John Hopkins University Compositions and methods for treatment of inflammatory disorders
CN112143806A (zh) * 2019-06-28 2020-12-29 复旦大学 以ldl-ldlr代谢轴为靶点的肺部疾病的治疗药物及方法
US11065061B2 (en) 2004-04-21 2021-07-20 Acclarent, Inc. Systems and methods for performing image guided procedures within the ear, nose, throat and paranasal sinuses
CN113209090A (zh) * 2021-04-07 2021-08-06 中国人民解放军南部战区总医院 甲巯咪唑在作为和/或制备金属β-内酰胺酶抑制剂中的应用
WO2021242644A1 (en) * 2020-05-24 2021-12-02 Zhaoyang Li Composition and methods of retinoic acid
US11529502B2 (en) 2004-04-21 2022-12-20 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US11969402B2 (en) 2019-05-16 2024-04-30 The Johns Hopkins University Compositions and methods for skin rejuvenation

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100183638A1 (en) * 2007-03-05 2010-07-22 Gowen Brian B Restrictive agonist of toll-like receptor 3 (tlr3)
ES2579628T3 (es) 2009-02-23 2016-08-12 Emergent Virology Llc Iminoazúcares y métodos de tratamiento de enfermedades virales
JP5951996B2 (ja) * 2009-02-24 2016-07-13 ユナイテッド セラピューティクス コーポレーション イミノ糖及びアレナウイルス感染症を治療する方法
JP5634510B2 (ja) 2009-06-12 2014-12-03 ユナイテッド セラピューティクス コーポレイション イミノ糖ならびにブニヤウイルスおよびトガウイルス疾患を治療する方法
IL304064A (en) 2009-07-10 2023-08-01 O Scott Linzy Iii Methods and compositions for the treatment of diseases related to the thyroid gland, with a reduced amount of folates
WO2011028781A1 (en) * 2009-09-04 2011-03-10 United Therapeutics Corporation Methods of treating poxviral infections
CA2803444A1 (en) * 2010-06-29 2012-01-05 Universite Laval Use of leukotriene b4 in combination with a toll-like receptor ligand, a rig-l-like receptor ligand or a nod-like receptor ligand to enhance the innate immune response
WO2013148072A1 (en) * 2012-03-28 2013-10-03 University Of Maryland Administration of eritoran or pharmaceutically acceptable salts thereof to treat orthomyxovirus infections
RU2015144149A (ru) * 2013-03-15 2017-04-21 Интермьюн, Инк. Протеомные маркеры илф
WO2014140648A1 (en) 2013-03-15 2014-09-18 Verona Pharma Plc Drug combination
US9750723B2 (en) 2013-10-31 2017-09-05 Ohio University Prevention and treatment of non-alcoholic fatty liver disease
DK3889145T3 (da) 2015-12-17 2024-03-18 Merck Patent Gmbh 8-cyano-5-piperidino-quinoliner som TLR7/8-antagonister og anvendelser deraf til behandling af immunsygdomme
CN109475586A (zh) 2016-06-29 2019-03-15 康纳塞斯创新公司 脱羧的大麻树脂、其用途和制备其的方法
EP4198031A1 (de) 2016-08-08 2023-06-21 Merck Patent GmbH Tlr7/8-antagonisten und verwendungen davon
WO2018044967A1 (en) * 2016-08-31 2018-03-08 Virginia Commonwealth University Local delivery of cholesterol-lowering drugs to treat and prevent bacterial vaginosis
US10738004B2 (en) * 2016-09-09 2020-08-11 Takeda Pharmaceutical Company Limited Cyclic compound
CN110944990B (zh) * 2017-07-18 2024-06-18 默克专利股份公司 Tlr7/8拮抗剂及其用途
WO2019209030A1 (ko) * 2018-04-27 2019-10-31 주식회사 젠센 Tlr4길항 펩타이드
CN110051666A (zh) * 2019-05-31 2019-07-26 中国科学院长春应用化学研究所 洛伐他汀在制备小胶质细胞活化抑制剂中的应用
KR20210012588A (ko) * 2019-07-26 2021-02-03 아주대학교산학협력단 Tlr7 및 tlr9의 신호전달 경로를 억제하는 신규한 소분자 화합물 및 그 용도
JP6937065B1 (ja) * 2021-03-10 2021-09-22 株式会社Ｗｉｋｏｍ研究所 間質性肺炎の治療剤

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) * 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) * 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3630200A (en) * 1969-06-09 1971-12-28 Alza Corp Ocular insert
US3845770A (en) * 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) * 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US4008719A (en) * 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US5556754A (en) * 1993-06-07 1996-09-17 The United States Of America As Represented By The Department Of Health And Human Services Methods for assessing the ability of a candidate drug to suppress MHC class I expression
US6365616B1 (en) * 1998-08-31 2002-04-02 Sentron Medical, Inc. Methimazole derivatives and tautomeric cyclic thiones to treat autoimmune diseases

Family Cites Families (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5612114B2 (de) 1974-06-07 1981-03-18
US4231938A (en) 1979-06-15 1980-11-04 Merck & Co., Inc. Hypocholesteremic fermentation products and process of preparation
US4342767A (en) 1980-01-23 1982-08-03 Merck & Co., Inc. Hypocholesteremic fermentation products
US4444784A (en) 1980-08-05 1984-04-24 Merck & Co., Inc. Antihypercholesterolemic compounds
MX7065E (es) 1980-06-06 1987-04-10 Sankyo Co Un procedimiento microbiologico para preparar derivados de ml-236b
US4450171A (en) 1980-08-05 1984-05-22 Merck & Co., Inc. Antihypercholesterolemic compounds
US4448784A (en) 1982-04-12 1984-05-15 Hoechst-Roussel Pharmaceuticals, Inc. 1-(Aminoalkylphenyl and aminoalkylbenzyl)-indoles and indolines and analgesic method of use thereof
US4739073A (en) 1983-11-04 1988-04-19 Sandoz Pharmaceuticals Corp. Intermediates in the synthesis of indole analogs of mevalonolactone and derivatives thereof
US5354772A (en) 1982-11-22 1994-10-11 Sandoz Pharm. Corp. Indole analogs of mevalonolactone and derivatives thereof
US4734421A (en) 1986-10-29 1988-03-29 Merck & Co., Inc. Anti-inflammatory substituted 2-benzyl-mercapto-imidazole and pyrimidine derivatives compositions and method of use therefor
US4804770A (en) 1988-04-29 1989-02-14 E. R. Squibb & Sons, Inc. Process for preparing a keto-phosphonate intermediate useful in preparing HMG-CoA reductase inhibitors
DE68911834T2 (de) 1988-10-13 1994-06-23 Sandoz Ag Verfahren zur Herstellung von 7-substituierten Hept-6-en- und Heptansäuren und Derivaten davon.
FI94339C (fi) 1989-07-21 1995-08-25 Warner Lambert Co Menetelmä farmaseuttisesti käyttökelpoisen /R-(R*,R*)/-2-(4-fluorifenyyli)- , -dihydroksi-5-(1-metyylietyyli)-3-fenyyli-4-/(fenyyliamino)karbonyyli/-1H-pyrroli-1-heptaanihapon ja sen farmaseuttisesti hyväksyttävien suolojen valmistamiseksi
PT98990A (pt) 1990-09-19 1992-08-31 American Home Prod Processo para a preparacao de esteres de acidos carboxilicos de rapamicina
US5177080A (en) 1990-12-14 1993-01-05 Bayer Aktiengesellschaft Substituted pyridyl-dihydroxy-heptenoic acid and its salts
US5162360A (en) 1991-06-24 1992-11-10 Warner-Lambert Company 2-heteroatom containing urea and thiourea ACAT inhibitors
US5480583A (en) 1991-12-02 1996-01-02 Intevep, S.A. Emulsion of viscous hydrocarbon in aqueous buffer solution and method for preparing same
DE4309553A1 (de) 1993-03-24 1994-09-29 Bayer Ag Verfahren zur Herstellung von 3R,5S-(+)-Natrium-erythro-(E)-7-(4-(4-flurophenyl)-2,6-diisopropyl-5-methoxymethyl-pyrid-3-yl)-3,5-dihydroxy-hept-6-enoat
WO1994022872A1 (en) 1993-03-30 1994-10-13 Yoshitomi Pharmaceutical Industries, Ltd. Cell adhesion inhibitor and thienotriazolodiazepine compound
US5716981A (en) 1993-07-19 1998-02-10 Angiogenesis Technologies, Inc. Anti-angiogenic compositions and methods of use
US5631365A (en) 1993-09-21 1997-05-20 Schering Corporation Hydroxy-substituted azetidinone compounds useful as hypocholesterolemic agents
EP0738510A3 (de) 1995-04-20 2005-12-21 L'oreal Verwendung eines HMG-CoA-Reduktase Inhibitors als Hautalterungschutzmittel und als Anti-Aknemittel. Zusammensetzung enthaltend mindestens einen HMG-CoA-Reduktase Inhibitor und mindestens einen Wirkstoff mit abschuppenden Eigenschaften
MY114803A (en) 1995-10-31 2003-01-31 Schering Corp Sugar-substituted 2-azetidinones useful as hypocholesterolemic agents
AU7472896A (en) 1995-11-02 1997-05-22 Schering Corporation Process for preparing 1-(4-fluorophenyl)-3(r)-(3(s)-hydroxy-3-({phenyl or 4-fluorophenyl})-propyl)-4(s)-(4-hydroxyphenyl)-2-azetidinon
PT814782E (pt) 1995-12-22 2003-04-30 Nissan Chemical Ind Ltd Composicao farmaceutica estabilizada com um agente basico
US5739321A (en) 1996-05-31 1998-04-14 Schering Corporation 3-hydroxy γ-lactone based enantionselective synthesis of azetidinones
US5886171A (en) 1996-05-31 1999-03-23 Schering Corporation 3-hydroxy gamma-lactone based enantioselective synthesis of azetidinones
WO1998009972A1 (en) 1996-09-09 1998-03-12 American Home Products Corporation Rapamycin derivatives with unnatural stereochemistries
US5756470A (en) 1996-10-29 1998-05-26 Schering Corporation Sugar-substituted 2-azetidinones useful as hypocholesterolemic agents
US6515016B2 (en) 1996-12-02 2003-02-04 Angiotech Pharmaceuticals, Inc. Composition and methods of paclitaxel for treating psoriasis
US6495579B1 (en) 1996-12-02 2002-12-17 Angiotech Pharmaceuticals, Inc. Method for treating multiple sclerosis
DE69826695T2 (de) 1997-05-23 2006-02-02 Bayer Pharmaceuticals Corp., West Haven Arylharnstoffderivate zur behandlung von inflammatorischen oder immunomodulatorischen erkrankungen
WO1999025333A1 (en) 1997-11-19 1999-05-27 Humanetics Corporation USE OF Δ5-ANDROSTENE-3β-OL-7,17-DIONE IN THE TREATMENT OF LUPUS ERYTHEMATOSUS
ATE300299T1 (de) 1997-12-22 2005-08-15 Bayer Pharmaceuticals Corp Inhibierung der raf-kinase durch substituierte heterocyclische harnstoffverbindungen
EP1041982B1 (de) 1997-12-22 2011-10-19 Bayer HealthCare LLC HEMMUNG DER p38 KINASE AKTIVITÄT DURCH SUBSTITUIERTE HETEROCYCLISCHE HARNSTOFFE
PL341356A1 (en) 1997-12-22 2001-04-09 Bayer Ag Raf kinase inhibition employing aryl- and heteroaryl-substituted heterocyclic ureas
ES2155817T3 (es) 1997-12-22 2007-06-16 Bayer Pharmaceuticals Corp. Inhibicion de la actividad de la quinasa p38 utilizando ureas heterociclicas sustituidas con arilo y heteroarilo.
US6133001A (en) 1998-02-23 2000-10-17 Schering Corporation Stereoselective microbial reduction for the preparation of 1-(4-fluorophenyl)-3(R)-[3(S)-Hydroxy-3-(4-fluorophenyl)propyl)]-4(S)-(4 -hydroxyphenyl)-2-azetidinone
EP1066039A4 (de) 1998-03-02 2003-02-26 Cocensys Inc Substituierte quinazoline und deren analoge und verwendungen
CA2339090C (en) 1998-08-31 2009-11-17 Sentron Medical, Inc. Methimazole derivatives and tautomeric cyclic thiones to treat autoimmune diseases
US20020142974A1 (en) 1998-09-11 2002-10-03 Leonard D. Kohn Immune activation by double-stranded polynucleotides
US5919672A (en) 1998-10-02 1999-07-06 Schering Corporation Resolution of trans-2-(alkoxycarbonylethyl)-lactams useful in the synthesis of 1-(4-fluoro-phenyl)-3(R)- (S)-hydroxy-3-(4-fluorophenyl)-propyl!-4(S)-(4-hydroxyphenyl)-2-azetidinone
DE19850445A1 (de) 1998-11-02 2000-05-04 Falk Pharma Gmbh Arzneimittel zur topischen Behandlung entzündlicher Darmerkrankungen
WO2000034240A1 (en) 1998-12-07 2000-06-15 Schering Corporation Process for the synthesis of azetidinones
EA200100704A1 (ru) 1998-12-23 2002-02-28 Джи.Ди.Сирл Ллс Комбинация для применения по сердечно-сосудистым показаниям
JP3679715B2 (ja) 1999-04-05 2005-08-03 シェーリング コーポレイション １−（４−フルオロフェニル）−３（ｒ）−［３（ｓ）−ヒドロキシ−３−（４−フルオロフェニル）プロピル）］−４（ｓ）−（４−ヒドロキシフェニル）−２−アゼチジノンの調製のための立体選択的微生物還元
WO2000063703A1 (en) 1999-04-16 2000-10-26 Schering Corporation Use of azetidinone compounds
EP2500018B1 (de) * 2002-03-08 2017-07-19 PhilERA New Zealand Limited Verhindern und/oder Behandeln der kardiovaskulären Erkrankung und/oder zugehöriges Herzversagen
DE60323380D1 (de) 2002-08-26 2008-10-16 Sla Pharma Ag Topische formulierung mit mindestens 10% metronidazol in entfärbtem petrolatum und ihre verwendung im anal- und rektalbereich
US7928132B2 (en) * 2004-08-06 2011-04-19 Ohio University Methods for the amelioration of episodes of acute or chronic ulcerative colitis
AU2004317993A1 (en) 2004-03-16 2005-10-13 Interthyr Corporation Methimazole derivatives and tautomeric cyclic thiones to inhibit cell adhesion
US20050209295A1 (en) 2004-03-16 2005-09-22 Kohn Leonard D Methimazole derivatives and tautomeric cyclic thiones to inhibit cell adhesion

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) * 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) * 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3630200A (en) * 1969-06-09 1971-12-28 Alza Corp Ocular insert
US3845770A (en) * 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) * 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US4008719A (en) * 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US5556754A (en) * 1993-06-07 1996-09-17 The United States Of America As Represented By The Department Of Health And Human Services Methods for assessing the ability of a candidate drug to suppress MHC class I expression
US6365616B1 (en) * 1998-08-31 2002-04-02 Sentron Medical, Inc. Methimazole derivatives and tautomeric cyclic thiones to treat autoimmune diseases

Cited By (220)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8740929B2 (en) 2001-02-06 2014-06-03 Acclarent, Inc. Spacing device for releasing active substances in the paranasal sinus
US8764786B2 (en) 2002-09-30 2014-07-01 Acclarent, Inc. Balloon catheters and methods for treating paranasal sinuses
US8317816B2 (en) 2002-09-30 2012-11-27 Acclarent, Inc. Balloon catheters and methods for treating paranasal sinuses
US8100933B2 (en) 2002-09-30 2012-01-24 Acclarent, Inc. Method for treating obstructed paranasal frontal sinuses
US9457175B2 (en) 2002-09-30 2016-10-04 Acclarent, Inc. Balloon catheters and methods for treating paranasal sinuses
US7465458B2 (en) 2003-05-20 2008-12-16 Allergan, Inc. Methods for treating eye disorders
US7220422B2 (en) * 2003-05-20 2007-05-22 Allergan, Inc. Methods and compositions for treating eye disorders
US20040234532A1 (en) * 2003-05-20 2004-11-25 Allergan, Inc. Methods and compositions for treating eye disorders
US20100098727A1 (en) * 2003-05-20 2010-04-22 Allergan, Inc. Methods for treating eye disorders
US20090087459A1 (en) * 2003-05-20 2009-04-02 Allergan, Inc. Methods for treating eye disorders
US8146400B2 (en) 2004-04-21 2012-04-03 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US10441758B2 (en) 2004-04-21 2019-10-15 Acclarent, Inc. Frontal sinus spacer
US10034682B2 (en) 2004-04-21 2018-07-31 Acclarent, Inc. Devices, systems and methods useable for treating frontal sinusitis
US10098652B2 (en) 2004-04-21 2018-10-16 Acclarent, Inc. Systems and methods for transnasal dilation of passageways in the ear, nose or throat
US9399121B2 (en) 2004-04-21 2016-07-26 Acclarent, Inc. Systems and methods for transnasal dilation of passageways in the ear, nose or throat
US9370649B2 (en) 2004-04-21 2016-06-21 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US10695080B2 (en) 2004-04-21 2020-06-30 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US9351750B2 (en) 2004-04-21 2016-05-31 Acclarent, Inc. Devices and methods for treating maxillary sinus disease
US8961495B2 (en) 2004-04-21 2015-02-24 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US8945088B2 (en) 2004-04-21 2015-02-03 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US8932276B1 (en) 2004-04-21 2015-01-13 Acclarent, Inc. Shapeable guide catheters and related methods
US9265407B2 (en) 2004-04-21 2016-02-23 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US11957318B2 (en) 2004-04-21 2024-04-16 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US9241834B2 (en) 2004-04-21 2016-01-26 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US9220879B2 (en) 2004-04-21 2015-12-29 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US11864725B2 (en) 2004-04-21 2024-01-09 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US8905922B2 (en) 2004-04-21 2014-12-09 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US11589742B2 (en) 2004-04-21 2023-02-28 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US9826999B2 (en) 2004-04-21 2017-11-28 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US9107574B2 (en) 2004-04-21 2015-08-18 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US8894614B2 (en) 2004-04-21 2014-11-25 Acclarent, Inc. Devices, systems and methods useable for treating frontal sinusitis
US10188413B1 (en) 2004-04-21 2019-01-29 Acclarent, Inc. Deflectable guide catheters and related methods
US10702295B2 (en) 2004-04-21 2020-07-07 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US11529502B2 (en) 2004-04-21 2022-12-20 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US9167961B2 (en) 2004-04-21 2015-10-27 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US11511090B2 (en) 2004-04-21 2022-11-29 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US8870893B2 (en) 2004-04-21 2014-10-28 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US11019989B2 (en) 2004-04-21 2021-06-01 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US11202644B2 (en) 2004-04-21 2021-12-21 Acclarent, Inc. Shapeable guide catheters and related methods
US8864787B2 (en) 2004-04-21 2014-10-21 Acclarent, Inc. Ethmoidotomy system and implantable spacer devices having therapeutic substance delivery capability for treatment of paranasal sinusitis
US8858586B2 (en) 2004-04-21 2014-10-14 Acclarent, Inc. Methods for enlarging ostia of paranasal sinuses
US8852143B2 (en) 2004-04-21 2014-10-07 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US8080000B2 (en) 2004-04-21 2011-12-20 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US8088101B2 (en) 2004-04-21 2012-01-03 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US8090433B2 (en) 2004-04-21 2012-01-03 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US9554691B2 (en) 2004-04-21 2017-01-31 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US11065061B2 (en) 2004-04-21 2021-07-20 Acclarent, Inc. Systems and methods for performing image guided procedures within the ear, nose, throat and paranasal sinuses
US8828041B2 (en) 2004-04-21 2014-09-09 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US8114062B2 (en) 2004-04-21 2012-02-14 Acclarent, Inc. Devices and methods for delivering therapeutic substances for the treatment of sinusitis and other disorders
US10492810B2 (en) 2004-04-21 2019-12-03 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US8123722B2 (en) 2004-04-21 2012-02-28 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US8142422B2 (en) 2004-04-21 2012-03-27 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, nose and/or throat
US8777926B2 (en) 2004-04-21 2014-07-15 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasel or paranasal structures
US8172828B2 (en) 2004-04-21 2012-05-08 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US11020136B2 (en) 2004-04-21 2021-06-01 Acclarent, Inc. Deflectable guide catheters and related methods
US9610428B2 (en) 2004-04-21 2017-04-04 Acclarent, Inc. Devices, systems and methods useable for treating frontal sinusitis
US8961398B2 (en) 2004-04-21 2015-02-24 Acclarent, Inc. Methods and apparatus for treating disorders of the ear, nose and throat
US8764709B2 (en) 2004-04-21 2014-07-01 Acclarent, Inc. Devices, systems and methods for treating disorders of the ear, nose and throat
US9468362B2 (en) 2004-04-21 2016-10-18 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US8764729B2 (en) 2004-04-21 2014-07-01 Acclarent, Inc. Frontal sinus spacer
US9649477B2 (en) 2004-04-21 2017-05-16 Acclarent, Inc. Frontal sinus spacer
US10874838B2 (en) 2004-04-21 2020-12-29 Acclarent, Inc. Systems and methods for transnasal dilation of passageways in the ear, nose or throat
US8764726B2 (en) 2004-04-21 2014-07-01 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US8414473B2 (en) 2004-04-21 2013-04-09 Acclarent, Inc. Methods and apparatus for treating disorders of the ear nose and throat
US8425457B2 (en) 2004-04-21 2013-04-23 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitus and other disorder of the ears, nose and/or throat
US10856727B2 (en) 2004-04-21 2020-12-08 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US10500380B2 (en) 2004-04-21 2019-12-10 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US8747389B2 (en) 2004-04-21 2014-06-10 Acclarent, Inc. Systems for treating disorders of the ear, nose and throat
US9101384B2 (en) 2004-04-21 2015-08-11 Acclarent, Inc. Devices, systems and methods for diagnosing and treating sinusitis and other disorders of the ears, Nose and/or throat
US9089258B2 (en) 2004-04-21 2015-07-28 Acclarent, Inc. Endoscopic methods and devices for transnasal procedures
US8721591B2 (en) 2004-04-21 2014-05-13 Acclarent, Inc. Apparatus and methods for dilating and modifying ostia of paranasal sinuses and other intranasal or paranasal structures
US8715169B2 (en) 2004-04-21 2014-05-06 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US10631756B2 (en) 2004-04-21 2020-04-28 Acclarent, Inc. Guidewires for performing image guided procedures
US9055965B2 (en) 2004-04-21 2015-06-16 Acclarent, Inc. Devices, systems and methods useable for treating sinusitis
US10806477B2 (en) 2004-04-21 2020-10-20 Acclarent, Inc. Systems and methods for transnasal dilation of passageways in the ear, nose or throat
US10779752B2 (en) 2004-04-21 2020-09-22 Acclarent, Inc. Guidewires for performing image guided procedures
US8702626B1 (en) 2004-04-21 2014-04-22 Acclarent, Inc. Guidewires for performing image guided procedures
US9039657B2 (en) 2004-08-04 2015-05-26 Acclarent, Inc. Implantable devices and methods for delivering drugs and other substances to treat sinusitis and other disorders
US9084876B2 (en) 2004-08-04 2015-07-21 Acclarent, Inc. Implantable devices and methods for delivering drugs and other substances to treat sinusitis and other disorders
US9039680B2 (en) 2004-08-04 2015-05-26 Acclarent, Inc. Implantable devices and methods for delivering drugs and other substances to treat sinusitis and other disorders
US8388642B2 (en) 2005-01-18 2013-03-05 Acclarent, Inc. Implantable devices and methods for treating sinusitis and other disorders
US9308361B2 (en) 2005-01-18 2016-04-12 Acclarent, Inc. Implantable devices and methods for treating sinusitis and other disorders
US20110105350A1 (en) * 2005-04-15 2011-05-05 Becton, Dickinson And Company Diagnosis of sepsis
US7767395B2 (en) 2005-04-15 2010-08-03 Becton, Dickinson And Company Diagnosis of sepsis
US20060246495A1 (en) * 2005-04-15 2006-11-02 Garrett James A Diagnosis of sepsis
US11578367B2 (en) 2005-04-15 2023-02-14 Becton, Dickinson And Company Diagnosis of sepsis
US10443099B2 (en) 2005-04-15 2019-10-15 Becton, Dickinson And Company Diagnosis of sepsis
US10598597B2 (en) 2005-05-25 2020-03-24 Massachusetts Institute Of Technology Multifocal imaging systems and method
US7795314B2 (en) * 2005-06-01 2010-09-14 Cytokine Pharmasciences, Inc. Protective role of semapimod in necrotizing enterocolitis
US20070282005A1 (en) * 2005-06-01 2007-12-06 Ruben Zamora Hmgb1 expression and protective role of semapimod in nec
US10842978B2 (en) 2005-06-10 2020-11-24 Acclarent, Inc. Catheters with non-removable guide members useable for treatment of sinusitis
US10124154B2 (en) 2005-06-10 2018-11-13 Acclarent, Inc. Catheters with non-removable guide members useable for treatment of sinusitis
US8951225B2 (en) 2005-06-10 2015-02-10 Acclarent, Inc. Catheters with non-removable guide members useable for treatment of sinusitis
US9999752B2 (en) 2005-09-23 2018-06-19 Acclarent, Inc. Multi-conduit balloon catheter
US8114113B2 (en) 2005-09-23 2012-02-14 Acclarent, Inc. Multi-conduit balloon catheter
US10639457B2 (en) 2005-09-23 2020-05-05 Acclarent, Inc. Multi-conduit balloon catheter
US9050440B2 (en) 2005-09-23 2015-06-09 Acclarent, Inc. Multi-conduit balloon catheter
US8968269B2 (en) 2005-09-23 2015-03-03 Acclarent, Inc. Multi-conduit balloon catheter
US8314061B2 (en) * 2006-01-09 2012-11-20 Children's Hospital Medical Center Adiponectin for treatment of various disorders
US20090197806A1 (en) * 2006-01-09 2009-08-06 Morrow Ardythe L Adiponectin for treatment of various disorders
US7943328B1 (en) 2006-03-03 2011-05-17 Prometheus Laboratories Inc. Method and system for assisting in diagnosing irritable bowel syndrome
US8190389B2 (en) 2006-05-17 2012-05-29 Acclarent, Inc. Adapter for attaching electromagnetic image guidance components to a medical device
US9629656B2 (en) 2006-05-17 2017-04-25 Acclarent, Inc. Adapter for attaching electromagnetic image guidance components to a medical device
US9198736B2 (en) 2006-05-17 2015-12-01 Acclarent, Inc. Adapter for attaching electromagnetic image guidance components to a medical device
US20110053830A1 (en) * 2006-08-07 2011-03-03 Oregon Health & Science University Methods for treating septic shock
US20080039395A1 (en) * 2006-08-07 2008-02-14 United States Government As Represented By The Department Of Veterans Affairs Methods for treating septic shock
US8463553B2 (en) 2006-08-15 2013-06-11 Nestec S.A. Methods for diagnosing irritable bowel syndrome
US20080166719A1 (en) * 2006-08-15 2008-07-10 Prometheus Laboratories Inc. Methods for diagnosing irritable bowel syndrome
US20080085524A1 (en) * 2006-08-15 2008-04-10 Prometheus Laboratories Inc. Methods for diagnosing irritable bowel syndrome
US9572480B2 (en) 2006-09-15 2017-02-21 Acclarent, Inc. Methods and devices for facilitating visualization in a surgical environment
US9820688B2 (en) 2006-09-15 2017-11-21 Acclarent, Inc. Sinus illumination lightwire device
US10716629B2 (en) 2006-09-15 2020-07-21 Acclarent, Inc. Methods and devices for facilitating visualization in a surgical environment
US9179823B2 (en) 2006-09-15 2015-11-10 Acclarent, Inc. Methods and devices for facilitating visualization in a surgical environment
US9603506B2 (en) 2006-09-15 2017-03-28 Acclarent, Inc. Methods and devices for facilitating visualization in a surgical environment
US8439687B1 (en) 2006-12-29 2013-05-14 Acclarent, Inc. Apparatus and method for simulated insertion and positioning of guidewares and other interventional devices
WO2008124787A3 (en) * 2007-04-09 2008-12-11 Acclarent Inc Ethmoidotomy system and implantable spacer devices having therapeutic substance delivery capability for treatment of paranasal sinusitis
WO2008124787A2 (en) * 2007-04-09 2008-10-16 Acclarent, Inc. Ethmoidotomy system and implantable spacer devices having therapeutic substance delivery capability for treatment of paranasal sinusitis
US8518903B2 (en) 2007-04-19 2013-08-27 University of Pittsburgh—of the Commonwealth System of Higher Education Use of toll-like receptor-9 agonists
US20080311112A1 (en) * 2007-04-19 2008-12-18 Hackam David J Use of toll-like receptor-9 agonists, toll-like receptor-4 antagonists, and/or nuclear oligomerization domain-2 agonists for the treatment or prevention of toll-like receptor-4-associated disorders
US8188058B2 (en) 2007-04-19 2012-05-29 University of Pittsburgh—of the Commonwealth System of Higher Education Use of toll-like receptor-9 agonists, toll-like receptor-4 antagonists, and/or nuclear oligomerization domain-2 agonists for the treatment or prevention of toll-like receptor-4-associated disorders
US8518905B2 (en) 2007-04-19 2013-08-27 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Use of toll-like receptor-9 agonists, toll-like receptor-4 antagonists, and/or nuclear oligomerization domain-2 agonists for the treatment of prevention of toll-like receptor-4-associated disorders
WO2008131074A1 (en) * 2007-04-19 2008-10-30 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Use of toll-like receptor-9 agonists, toll-like receptor-4 antagonists, and/or nuclear oligomerization domain-2 agonists for the treatment or prevention of toll-like receptor-4-associated disorders
US9549980B2 (en) 2007-04-19 2017-01-24 University of Pittsburgh—of the Commonwealth System of Higher Education Methods of treating necrotizing enterocolitis by administering nuclear oligomerization domain-2 agonists,TLR9 agonists and TLR4 antagonists
US8118757B2 (en) 2007-04-30 2012-02-21 Acclarent, Inc. Methods and devices for ostium measurement
US9615775B2 (en) 2007-04-30 2017-04-11 Acclarent, Inc. Methods and devices for ostium measurements
US8485199B2 (en) 2007-05-08 2013-07-16 Acclarent, Inc. Methods and devices for protecting nasal turbinate during surgery
US9463068B2 (en) 2007-05-08 2016-10-11 Acclarent, Inc. Methods and devices for protecting nasal turbinates
WO2008147956A3 (en) * 2007-05-25 2009-01-29 Centocor Inc Toll-like receptor 3 modulators and uses thereof
US20090047243A1 (en) * 2007-07-17 2009-02-19 Richard Rickles Combinations for the treatment of b-cell proliferative disorders
WO2009011893A3 (en) * 2007-07-17 2009-03-19 Combinatorx Inc Treatments of b-cell proliferative disorders
US20090053168A1 (en) * 2007-07-17 2009-02-26 Richard Rickles Treatments of b-cell proliferative disorders
US9272034B2 (en) * 2007-10-04 2016-03-01 The Regents Of The University Of California Treatment of conditions related to shock
US20100303799A1 (en) * 2007-10-04 2010-12-02 The Regents Of The University Of California Treatment of Conditions Related to Shock
US20100210709A1 (en) * 2007-10-09 2010-08-19 Howard Gutstein B Methods of Treatment of Opioid Tolerance, Physical Dependence, Pain and Addiction With Inhibitors of Certain Growth Factor Receptors
US8501740B2 (en) 2007-10-09 2013-08-06 Board Of Regents, The University Of Texas System Methods of treatment of opioid tolerance, physical dependence, pain and addiction with inhibitors of certain growth factor receptors
WO2009048947A1 (en) * 2007-10-09 2009-04-16 Board Of Regents, The University Of Texas System Methods of treatment of opioid tolerance, physical dependence, pain, and addiction with inhibitors of certain growth factor receptors
WO2009059143A2 (en) * 2007-10-31 2009-05-07 Centocor, Inc. Use of toll-like receptor 4 antagonists for the treatment or prevention of osteoarthritic conditions
US20090136509A1 (en) * 2007-10-31 2009-05-28 Simon Blake Use of Toll-Like Receptor 4 Antagonists for the Treatment or Prevention of Osteoarthritic Conditions
WO2009059143A3 (en) * 2007-10-31 2009-12-30 Centocor, Inc. Use of toll-like receptor 4 antagonists for the treatment or prevention of osteoarthritic conditions
US10206821B2 (en) 2007-12-20 2019-02-19 Acclarent, Inc. Eustachian tube dilation balloon with ventilation path
US11850120B2 (en) 2007-12-20 2023-12-26 Acclarent, Inc. Eustachian tube dilation balloon with ventilation path
US11311419B2 (en) 2007-12-20 2022-04-26 Acclarent, Inc. Eustachian tube dilation balloon with ventilation path
WO2009105260A3 (en) * 2008-02-21 2009-12-30 University Of Kentucky Ultra-small rnas as toll-like receptor-3 antagonists
JP2011518116A (ja) * 2008-02-21 2011-06-23 ユニバーシティ オブ ケンタッキー リサーチ ファウンデーション トール様受容体３拮抗薬としての超小型ｒｎａ
US8481508B2 (en) 2008-02-21 2013-07-09 University Of Kentucky Research Foundation Ultra-small RNAs as toll-like receptor-3 antagonists
WO2009105260A2 (en) * 2008-02-21 2009-08-27 University Of Kentucky Ultra-small rnas as toll-like receptor-3 antagonists
US8182432B2 (en) 2008-03-10 2012-05-22 Acclarent, Inc. Corewire design and construction for medical devices
US9861793B2 (en) 2008-03-10 2018-01-09 Acclarent, Inc. Corewire design and construction for medical devices
US9708661B2 (en) 2008-04-03 2017-07-18 Becton, Dickinson And Company Advanced detection of sepsis
US10221453B2 (en) 2008-04-03 2019-03-05 Becton, Dickinson And Company Advanced detection of sepsis
US9885084B2 (en) 2008-04-03 2018-02-06 Becton, Dickinson And Company Advanced detection of sepsis
US8809303B2 (en) 2008-04-09 2014-08-19 The University Of North Carolina At Chapel Hill Methods of regulating actin cytoskeletal rearrangement and intercellular gap formation
US20100009934A1 (en) * 2008-06-09 2010-01-14 Combinatorx, Incorporated Beta adrenergic receptor agonists for the treatment of b-cell proliferative disorders
WO2009154610A1 (en) * 2008-06-17 2009-12-23 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
US10271719B2 (en) 2008-07-30 2019-04-30 Acclarent, Inc. Paranasal ostium finder devices and methods
US9750401B2 (en) 2008-07-30 2017-09-05 Acclarent, Inc. Paranasal ostium finder devices and methods
US8979888B2 (en) 2008-07-30 2015-03-17 Acclarent, Inc. Paranasal ostium finder devices and methods
US11116392B2 (en) 2008-07-30 2021-09-14 Acclarent, Inc. Paranasal ostium finder devices and methods
US8293776B2 (en) 2008-08-05 2012-10-23 The Regents Of The University Of Michigan Compositions and methods for treating inflammatory conditions of the bowel
WO2010017312A1 (en) * 2008-08-05 2010-02-11 The Regents Of The University Of Michigan Compositions and methods for treating inflammatory conditions of the bowel
US20100035852A1 (en) * 2008-08-05 2010-02-11 The Regents Of The University Of Michigan Compositions and methods for treating inflammatory conditions of the bowel
WO2010040054A3 (en) * 2008-10-02 2010-06-17 Centocor Ortho Biotech Inc. Methods for suppressing toll-like receptor activity
US10524814B2 (en) 2009-03-20 2020-01-07 Acclarent, Inc. Guide system with suction
US11207087B2 (en) 2009-03-20 2021-12-28 Acclarent, Inc. Guide system with suction
US8435290B2 (en) 2009-03-31 2013-05-07 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
US9072626B2 (en) 2009-03-31 2015-07-07 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
US9636258B2 (en) 2009-03-31 2017-05-02 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
US10376416B2 (en) 2009-03-31 2019-08-13 Acclarent, Inc. System and method for treatment of non-ventilating middle ear by providing a gas pathway through the nasopharynx
WO2010118334A1 (en) * 2009-04-09 2010-10-14 The University Of North Carolina At Chapel Hill Methods of treating edema related to ischemia-reperfusion
CN102458113A (zh) * 2009-04-09 2012-05-16 北卡罗来纳大学查珀尔希尔分校 与缺血再灌注相关的水肿的治疗方法
US9187530B2 (en) 2009-06-05 2015-11-17 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
US8450285B2 (en) 2009-06-05 2013-05-28 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
US9974853B2 (en) 2009-06-05 2018-05-22 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
US20100317564A1 (en) * 2009-06-05 2010-12-16 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
US9150616B2 (en) 2009-06-05 2015-10-06 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
US9150617B2 (en) 2009-06-05 2015-10-06 13Therapeutics, Inc. Immunoregulatory peptides and methods of use
WO2011041582A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-inhibiting gene products
WO2011041584A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-enhancing gene products
WO2012011100A1 (en) 2010-07-19 2012-01-26 Yeda Research And Development Co. Ltd. Peptides based on the transmembrane domain of a toll-like receptor (tlr) for treatment of tlr-mediated diseases
US11413299B2 (en) 2010-09-24 2022-08-16 The Johns Hopkins University Compositions and methods for treatment of inflammatory disorders
US10933077B2 (en) 2010-09-24 2021-03-02 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US10300083B2 (en) 2010-09-24 2019-05-28 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US9532999B2 (en) 2010-09-24 2017-01-03 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US9155492B2 (en) 2010-09-24 2015-10-13 Acclarent, Inc. Sinus illumination lightwire device
US9072760B2 (en) 2010-09-24 2015-07-07 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US10668092B2 (en) 2010-09-24 2020-06-02 The John Hopkins University Compositions and methods for treatment of inflammatory disorders
US9295715B2 (en) 2010-10-02 2016-03-29 The Regents Of The University Of California Minimizing intestinal dysfunction
US9962432B2 (en) 2010-10-02 2018-05-08 The Regents Of The University Of California Minimizing intestinal dysfunction
US10172848B2 (en) 2010-12-22 2019-01-08 University of Pittsburgh—Of the Commonwealth Systems of Higher Education Gap junction-enhancing agents for treatment of necrotizing enterocolitis and inflammatory bowel disease
US8580748B2 (en) 2011-04-06 2013-11-12 13Therapeutics, Inc. Peptides for the treatment of hearing
US10449260B2 (en) 2011-07-08 2019-10-22 Theodosia Maina-Nock Enhanced in vivo targeting of radiolabelled peptides with the means of enzyme inhibitors
US11612667B2 (en) 2011-07-08 2023-03-28 Advanced Accelerator Applications Usa, Inc. Enhanced in vivo targeting of radiolabelled peptides with the means of enzyme inhibitors
WO2013007660A1 (en) * 2011-07-08 2013-01-17 Biosynthema Inc. Enhanced in vivo targeting of radiolabelled peptides with the means of enzyme inhibitors
KR101510941B1 (ko) * 2012-07-03 2015-04-10 일양약품주식회사 신규한 펩타이드 및 이의 용도
US9403874B2 (en) 2012-07-03 2016-08-02 Samsung Life Public Welfare Foundation Peptides and use thereof
US9562066B2 (en) 2012-09-25 2017-02-07 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Oral therapy of necrotizing enterocolitis
US8652527B1 (en) 2013-03-13 2014-02-18 Upsher-Smith Laboratories, Inc Extended-release topiramate capsules
US8889190B2 (en) 2013-03-13 2014-11-18 Upsher-Smith Laboratories, Inc. Extended-release topiramate capsules
US10363224B2 (en) 2013-03-13 2019-07-30 Upsher-Smith Laboratories, Llc Extended-release topiramate capsules
US9433437B2 (en) 2013-03-15 2016-09-06 Acclarent, Inc. Apparatus and method for treatment of ethmoid sinusitis
US10172878B2 (en) 2013-03-15 2019-01-08 Upsher-Smith Laboratories, Llc Extended-release topiramate capsules
US9555005B2 (en) 2013-03-15 2017-01-31 Upsher-Smith Laboratories, Inc. Extended-release topiramate capsules
US10524869B2 (en) 2013-03-15 2020-01-07 Acclarent, Inc. Apparatus and method for treatment of ethmoid sinusitis
US9629684B2 (en) 2013-03-15 2017-04-25 Acclarent, Inc. Apparatus and method for treatment of ethmoid sinusitis
US9101545B2 (en) 2013-03-15 2015-08-11 Upsher-Smith Laboratories, Inc. Extended-release topiramate capsules
WO2015124570A1 (en) * 2014-02-18 2015-08-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for the treatment of influenza a virus infection
US10105305B2 (en) * 2014-02-19 2018-10-23 The Johns Hopkins University Compositions and methods for promoting skin regeneration and hair growth
US10392381B2 (en) 2014-07-18 2019-08-27 Ohio University Prevention and treatment of non-alcoholic fatty liver disease
US10407420B2 (en) 2014-07-18 2019-09-10 Ohio University Imidazole and thiazole compositions for modifying biological signaling
US10633377B2 (en) 2014-07-18 2020-04-28 Ohio University Imidazole and thiazole compositions for modifying biological signaling
US10023567B2 (en) 2014-07-18 2018-07-17 Ohio University Imidazole and thiazole compositions for modifying biological signaling
US11519832B2 (en) * 2015-03-11 2022-12-06 Tissuevision, Inc. Systems and methods for serial staining and imaging
US20180045623A1 (en) * 2015-03-11 2018-02-15 Timothy Ragan Systems and methods for serial staining and imaging
US10788403B2 (en) * 2015-03-11 2020-09-29 Tissuevision, Inc. Systems and methods for serial staining and imaging
US20210199545A1 (en) * 2015-03-11 2021-07-01 Tissuevision, Inc. Systems and methods for serial staining and imaging
CN108251456A (zh) * 2018-01-23 2018-07-06 新乡医学院 一种nod遗传背景的动脉粥样硬化小鼠模型的制备方法
US11969402B2 (en) 2019-05-16 2024-04-30 The Johns Hopkins University Compositions and methods for skin rejuvenation
CN112143806A (zh) * 2019-06-28 2020-12-29 复旦大学 以ldl-ldlr代谢轴为靶点的肺部疾病的治疗药物及方法
WO2021242644A1 (en) * 2020-05-24 2021-12-02 Zhaoyang Li Composition and methods of retinoic acid
CN113209090A (zh) * 2021-04-07 2021-08-06 中国人民解放军南部战区总医院 甲巯咪唑在作为和/或制备金属β-内酰胺酶抑制剂中的应用

Also Published As

Publication number Publication date
EP2399578A1 (de) 2011-12-28
AU2006247504A1 (en) 2006-11-23
WO2006124676A1 (en) 2006-11-23
US9326972B2 (en) 2016-05-03
US20120238610A1 (en) 2012-09-20
EP1896015A1 (de) 2008-03-12
AU2006247504B2 (en) 2011-09-08
CA2606769A1 (en) 2006-11-23
JP2008545651A (ja) 2008-12-18
US20160220536A1 (en) 2016-08-04

Similar Documents

Publication Publication Date Title
US9326972B2 (en) Use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression
US20100004304A1 (en) Methods and compositions for the treatment of malignant melanoma, breast, prostate, colon, papillary thyroid and pancreatic cancer
JP7100018B2 (ja) ヒストンデアセチラーゼ６阻害剤及びｃｄ２０阻害抗体の薬学的組み合わせならびにその使用
JP5039550B2 (ja) 大腸炎の治療のための組成物及び方法
AU715380B2 (en) Pyrazolopyrimidines for treatment of neuronal and other disorders
US11357777B2 (en) Use of sGC stimulators for the treatment of nonalcoholic steatohepatitis (NASH)
WO2017143014A1 (en) Jak inhibitors and uses thereof
CN1784221A (zh) 影响体重减轻的组合物
JPWO2008111441A1 (ja) 医薬組成物
JP6250728B2 (ja) α−２Ｂアドレナリン受容体作動薬を用いて制御性Ｔ細胞を活性化する方法
JP2016540017A (ja) ｓＧＣ刺激物質
KR20230048358A (ko) 질환 및 장애를 치료하기 위한 조성물 및 방법
JP2013510900A (ja) 炎症性疾患治療のための大環状ラクトン誘導体の使用
AU2009225323B2 (en) Pyridylsulfonamido pyrimidines for treating diabetic nephropathy
WO2013079696A1 (en) Methods of treatment and prevention of eye diseases
Revill et al. Eltrombopag
WO2024073328A2 (en) Methods of treating cancer and compositions for the same
CA3160417A1 (en) Dosing of a bruton's tyrosine kinase inhibitor
US9907797B2 (en) Combination therapies for overcoming resistance to mitotic agents during chemotherapy
JP2023543197A (ja) Ｃｓｆ１ｒキナーゼ阻害剤およびその使用
CA3199840A1 (en) Car t-cell adjuvant therapies
Radiosensitizer Azelnidipine Antihypertensive
WO2012045114A1 (en) Agents and methods for treating hematologic conditions

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE INTERTHYR CORPORATION, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KOHN, LEONDARD D.;HARII, NORIKAZU;BENAVIDES-PERALTA, URUGUAYSITO LORELEY;AND OTHERS;REEL/FRAME:017289/0073;SIGNING DATES FROM 20051128 TO 20060127

Owner name: THE INTERTHYR CORPORATION, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KOHN, LEONDARD D.;HARII, NORIKAZU;BENAVIDES-PERALTA, URUGUAYSITO LORELEY;AND OTHERS;SIGNING DATES FROM 20051128 TO 20060127;REEL/FRAME:017289/0073

AS Assignment

Owner name: HARII, NORIKAZU, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: NAPOLITANO, GIORGIO, ITALY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: BENAVIDES-PERALTA, URUGUAYSITO LORELEY, URUGUAY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: GONZALEZ-MURGUIONDO, MARIANA, URUGUAY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: OHIO UNIVERSITY, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KOHN, LEONARD D.;HARII, NORIKAZU;BENAVIDES-PERALTA, URUGUAYSITO LORELEY;AND OTHERS;REEL/FRAME:022563/0283;SIGNING DATES FROM 20081208 TO 20090310

Owner name: LEWIS, CHRISTOPHER, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: GOETZ, DOUGLAS J., OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: MALGOR, RAMIRO, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: KOHN, LEONARD D., WASHINGTON

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

Owner name: GIULIANI, CESIDIO, ITALY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTERTHYR CORPORATION;REEL/FRAME:022563/0228

Effective date: 20081230

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION