US20060040261A1 - Primers for isothermal amplification of hepatitis C virus - Google Patents

Primers for isothermal amplification of hepatitis C virus Download PDF

Info

Publication number
US20060040261A1
US20060040261A1 US11/132,286 US13228605A US2006040261A1 US 20060040261 A1 US20060040261 A1 US 20060040261A1 US 13228605 A US13228605 A US 13228605A US 2006040261 A1 US2006040261 A1 US 2006040261A1
Authority
US
United States
Prior art keywords
primers
seq
nos
pair
hcv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/132,286
Other languages
English (en)
Inventor
Maiko Tanabe
Chihiro Uematsu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hitachi High Tech Corp
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Assigned to HITACHI HIGH-TECHNOLOGIES CORPORATION reassignment HITACHI HIGH-TECHNOLOGIES CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TANABE, MAIKO, UEMATSU, CHIHIRO
Publication of US20060040261A1 publication Critical patent/US20060040261A1/en
Priority to US11/976,232 priority Critical patent/US8008045B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/706Specific hybridization probes for hepatitis
    • C12Q1/707Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D

Definitions

  • the present invention relates to primers for isothermal amplification of subtypes of hepatitis C virus (hereinafter briefly referred to as “HCV”), and methods for detecting or determining HCV using the primers.
  • HCV hepatitis C virus
  • HCV Chiron Corporation, Emeryville, Calif. identified the gene of HCV in 1988.
  • the genome sequence of HCV including about 9,500 bases has been identified, and it has been revealed that HCV has a single strand RNA as its genome.
  • HCV is often accompanied with mutation in its gene sequence, is classified as four to six subgroups based on gene sequences in regions accompanied with frequent mutation, and is further classified as, for example, subtypes 1 a , 1 b , 2 a , 2 b and 3 a (P. Simmonds, et al., J. Gen Virol., 74, 661-668 (1993))
  • HCV Only two- to three-tenths of subjects infected with HCV have subjective symptoms such as malaise, and most of them undergo chronic inflammation without subjective symptoms and may further undergo liver cirrhosis and liver cancer. It is difficult to detect HCV at initial stage of HCV infection by immunoassay using antibodies and to prevent the symptoms from becoming worse and/or the infected blood completely from contaminating into blood for transfusion.
  • an object of the present invention is to provide a technique for genotyping HCV by isothermal amplification.
  • Another object of the present invention is to provide primers specific to HCV subtypes 1 a , 1 b , 2 a , 2 b and 3 a for use in the technique.
  • the present inventors have successfully designed primers that enable genotype-specific isothermal amplification in a core region of gene sequences belonging to HCV subtypes 1 a , 1 b , 2 a , 2 b and 3 a genes.
  • the isothermal amplification of a HCV sample using these primers results in genotype-specific amplification and thereby enables detection and genotyping of HCV subtypes 1 a , 1 b , 2 a , 2 b and 3 a genes based on whether or not amplification occurs.
  • the present invention provides, in an aspect, a primer for isothermal amplification of HCV, comprising at least eighteen consecutive bases corresponding to a 3′ end region of one base sequence selected from the group consisting of SEQ ID NOs: 1-10, 21 and 22.
  • the primer can further include a T7 promoter sequence in its 5′-end region typically when used in NASBA.
  • the present invention further provides, in another aspect, a pair of primers for isothermal amplification of hepatitis C virus, selected from the following pairs of primers (1) to (5):
  • a pair of primers comprising at least eighteen consecutive bases corresponding to a 3′ end region of the base sequences of SEQ ID NOs: 1 and 2, respectively;
  • a pair of primers comprising at least eighteen consecutive bases corresponding to a 3′ end region of the base sequences of SEQ ID NOs: 7 and 8, respectively;
  • a pair of primers comprising at least eighteen consecutive bases corresponding to a 3′ end region of the base sequences of SEQ ID NOs: 21 and 22, respectively.
  • At least one of the pair of primers can further include a T7 promoter sequence in its 5′-end region.
  • the present invention further provides, in yet another aspect, a method for detecting HCV, including the steps of subjecting a clinical sample to isothermal amplification with at least one of the pairs of primers according to the present invention, and determining a HCV subtype based on the resulting amplified product.
  • the method for detecting HCV enables determination of a HCV subtype.
  • at least one of the pair of primers can further include a T7 promoter sequence.
  • the detection method of the present invention can simultaneously detect two or more HCV subtypes by using two or more pairs of primers of the present invention.
  • the present invention provides a kit for use in the method for detecting HCV.
  • the kit essentially includes at least one pair of primers of the present invention, and at least one probe containing a sequence complementary to an amplified product amplified by the action of the at least one pair of primers and serving to detect the amplified product and may further include, as needed, any of components that can be used in gene amplification and determination of amplified products, such as molecular weight markers, enzymes, dNTPs, NTPs and sterilized water, as well as any other components.
  • the primers of the present invention enable the detection and genotyping of a HCV subtype by isothermal amplification.
  • the present invention therefore enables easy and rapid detection (determination) and genotyping of HCV without requiring complicated temperature control as in PCR.
  • FIG. 1 is a flow chart of HCV genotyping
  • FIG. 2 is a flow chart of amplification by NASBA
  • FIG. 3 shows an electropherogram obtained by genotyping of HCV samples using oligonucleotide primers of the present invention
  • FIG. 4 is a flow chart of real-time genotyping of HCV gene
  • FIGS. 5A and 5B illustrate real-time genotyping of HCV using oligonucleotide primers according to the present invention using a HCV RNA of subtype 1 b and a HCV RNA of subtype 2 a as a sample, respectively;
  • FIG. 6 shows an electropherogram obtained by genotyping of HCV subtypes 1 b and 2 b using oligonucleotide primers of the present invention
  • FIG. 7 shows an electropherogram obtained by the amplification of a HCV subtype 1 a sample using oligonucleotide primers according to the present invention
  • FIG. 8 shows an electropherogram obtained by the amplification of HCV subtype 1 b sample using oligonucleotide primers of SEQ ID NOs: 1 and 11;
  • FIG. 9 schematically illustrates the configuration of primers for isothermal amplification selective to the HCV subtype 1 a gene.
  • the present inventors have designed various primers in specific regions (SEQ ID NOs: 40, 41, 42, 43 and 44, respectively) in the core regions of HCV subtypes 1 a , 1 b , 2 a , 2 b and 3 a and determined whether or not each of the primers enables selective isothermal amplification of the corresponding subtype.
  • FIG. 9 shows the sequence of a region from the 5′-non-translated region (5′-NTR) to the core region of the HCV subtype 1 a RNA.
  • the region of 318th to 676th bases (SEQ ID NO: 40) in the sequence shown in FIG. 9 is a region suitable for genotyping. It has been revealed that primers having the sites 33 and 34 as priming sites, respectively, are optimal for HCV subtype 1 a -specific isothermal amplification. Specifically, the primers corresponding to these priming sites have base sequences of SEQ ID NOs: 1 and SEQ ID NO: 2, respectively.
  • the oligonucleotides of SEQ ID NOs: 1 and 2 can be used as a sense primer and an antisense primer, respectively, in the amplification of HCV subtype 1 a RNA.
  • the oligonucleotides of SEQ ID NOs: 3 and 4 or 9 can be used as a sense primer and an antisense primer, respectively, in the amplification of HCV subtype 1 b RNA.
  • the oligonucleotides of SEQ ID NOs: 5 and 6 or 10 can be used as a sense primer and an antisense primer, respectively, in the amplification of HCV subtype 2 a RNA.
  • the oligonucleotides of SEQ ID NOs: 21 and 22 can be used as a sense primer and an antisense primer, respectively, in the amplification of HCV subtype 2 b RNA.
  • the oligonucleotides of SEQ ID NOs: 7 and 8 can be used as a sense primer and an antisense primer, respectively, in the amplification of HCV subtype 3 a RNA.
  • sequences of primers for use in the present invention are not limited to the above-listed sequences. It is also possible that a primer having several bases, e.g., about one to about five bases, preferably about one to three bases more or less than the above-specified sequence at the 5′-end of the corresponding primer, namely in a direction not the elongation direction of the primer, can enables isothermal amplification of the target HCV subtype 1 a .
  • the primer herein may not contain all the bases in the sequence and may include at least eighteen consecutive bases in its 3′ end region for selective isothermal amplification of HCV subtype 1 a.
  • Each of the primers of the present invention may further comprise, as needed, any of other sequences in its 5′ end region, in addition to the template-specific sequence specifically hybridizing with a template represented by the sequence number.
  • the primer when used, for example, in NASBA (J. Compton: Nucleic acid sequence-based amplification. Nature, 1991, 350, p91-92), at least one of the pair of primers may have a T7 promoter sequence in its 5′ end region.
  • the primers may be appropriately modified typically with a labeling material such as a radioisotope, enzyme or fluorophore, and such modified primers are also included in the primers of the present invention.
  • the primers of the present invention preferably each have 18 to 30 bases in a region to hybridize with a template.
  • the base length of the primers herein does not include the length of a region which does not hybridize with a template.
  • the T7 promoter sequence region of the primer for use in NASBA is not included in the base length of 18 to 30 bases.
  • the primers of the present invention may further comprise one to several base substitutions (mismatches for the template) within ranges not adversely affecting the advantages of the present invention.
  • the primers should preferably include such mismatches (base substitutions) in their 5′ end region, because base substitutions residing at the 3′ end may adversely affect the precision of genotyping.
  • the primers of the present invention can be used in isothermal amplification such as NASBA, but can also be used in other primer extension amplification processes such as PCR (R. K. Saiki, et al., Science, 239, 487-491 (1988)), self-sustained sequence replication (3SR) (J. C. Guatelli, et al., Proc Natl Acad Sci USA, 87, 1874-1878 (1990)), and transcription-based amplification systems (TAS) (D. Y. Kwoh, et al., Proc Natl Acad Sci USA, 86, 1173-1177 (1989)).
  • PCR R. K. Saiki, et al., Science, 239, 487-491 (1988)
  • 3SR self-sustained sequence replication
  • TAS transcription-based amplification systems
  • FIG. 1 is a flow chart of the method for detecting or genotyping HCV according to the present invention.
  • a virus RNA 2 is extracted from a sample 1 , is mixed with a primer amplification reagent 5 , is amplified by an amplification device 3 and is detected by a detection device 4 .
  • the primer amplification reagent 5 contains an amplification reagent comprising dNTPs, NTPs and a buffer solution, and a primer mixture containing a primer of SEQ ID NO: 1, 3, 5, 7 or 21 in combination with a corresponding primer of SEQ ID NOs: 2, 4, 6, 8, 9, 10 or 22.
  • the detection can be carried out, for example, by a method in which an amplified product is subjected to electrophoresis and lengths of amplified fragments (sizes of amplification) are compared, or a method of real-time detection of an amplified product typically using fluorophore-labeled probes.
  • isothermal amplification techniques for use in the present invention include LAMP (T. Notomi et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res., 28(12): e63, (2000)) and ICAN (Isothermal and Chimeric Primer-initiated Amplification of Nucleic acids; Japanese Patent No. 3433929), in addition to above-mentioned NASBA.
  • LAMP T. Notomi et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res., 28(12): e63, (2000)
  • ICAN Isothermal and Chimeric Primer-initiated Amplification of Nucleic acids; Japanese Patent No. 3433929
  • the method for detecting HCV according to the present invention enables simultaneous detection of two or more HCV subtypes with two or more corresponding primers for isothermal amplification.
  • the present invention provides a kit for the detection (genotyping) of HCV.
  • the kit essentially comprises all or part of the pairs of primers of the present invention, and one or more probes for detecting HCV subtype-specific amplified products amplified with the primers.
  • the probe for detecting a HCV subtype-specific amplified product is labeled with an appropriate labeling material such as a radioisotope, enzyme or fluorophore and comprises a sequence complementary to a sequence including about 18 to about 30 bases on a sample HCV gene fragment which is specifically amplified by the primer of the present invention.
  • an appropriate labeling material such as a radioisotope, enzyme or fluorophore
  • the probe are probes having base sequences of SEQ ID NOs: 19 and 20, respectively.
  • the probe may be labeled with a fluorophore such as FAM or ROX at one end and with a quencher such as BHQ 1 or BHQ 2 at the other end.
  • the kit for the detection (genotyping) of HCV of the present invention essentially comprises the primers and the probes and may further comprise, as needed, any of components that can be used in gene amplification and determination of amplified products, such as molecular weight markers, enzymes, dNTPs, NTPs and sterilized water, as well as any other components.
  • An optimal pair of oligonucleotide primers for genotype-specific isothermal amplification by NASBA was determined by designing sense primers and antisense primers in regions in the core region of the HCV subtype 1 a gene which are capable of highly specifically typing, setting pairs of the oligonucleotide primers in various combinations and subjecting the pairs of primers to NASBA.
  • the sense primers are oligonucleotide primers of SEQ ID NOs: 1, 24, 25, 26, 27, 28, 29, 30, 31 and 32
  • the antisense primers are oligonucleotide primers of SEQ ID NOs: 11, 33, 34, 35, 36, 37, 38 and 39 listed in Table 2.
  • Each of the antisense primer further had a sequence (AATTCTAATACGACTCACTATAGGGAGAAGG: SEQ ID NO: 45) including a T7 promoter sequence at the 5′ end.
  • S1 HCV1p202 5′-CACCATGAGCACGAATCCTA-3′(20bp) 21-40bp 1
  • S2 HCV1p2O3 5′-TCAGATCGTTGGTGGAGTTTA-3′(21bp) 108-12Tbp
  • S3 HCV1p2O4 5′-TCGTTGGTGGAGTTTACTTGTT-3′(22bp) 171 -292bp
  • S4 HCV1p205 5′-AGGAAGACTTCCGAGCGGTC-3′(20bp) 172-291bp
  • S5 HCV1p206 5′-GGA
  • FIG. 2 is a flow chart of the amplification by NASBA.
  • NASBA can be suitably carried out with a commercially available kit, such as NUCLISENSTM Basic Kit (bioMerieux, Inc.).
  • a solution 6 for use in the reaction contains a HCV subtype 1 a gene sample, a tested primer, reagents and other components.
  • the solution 6 was subjected to a reaction by NASBA by holding the solution at 65° C. for 5 minutes and at 41° C. for 5 minutes; adding an enzyme 9 to the solution, followed by a reaction at 41° C. for 90 minutes in an isothermal amplification device 7 .
  • the resulting reaction product was detected with a detection device 8 by subjecting the reaction product to electrophoresis with SV1210 Cosmo-i (Hitachi High-Technologies Corporation) as the detection device 8 and determining the presence or absence of, and the position of the amplified product.
  • FIG. 7 shows an electropherogram of amplified products of amplification reaction using an oligonucleotide primer of SEQ ID NO: 1 as a sense primer, and those of SEQ ID NOs: 11, 33, 34, 35, 36, 37, 38 and 39 as an antisense primer, respectively.
  • Apair of oligonucleotide primers of SEQ ID NOs: 1 and 11 was designed so as to yield, as a result of the reaction, an amplified product having a size of amplification of 217 bp.
  • pairs of oligonucleotide primers of SEQ ID NOs: 1 and 33, 1 and 34, 1 and 35, 1 and 36, 1 and 37, 1 and 38, and 1 and 39 were designed so as to yield amplified products having a size of amplification of 84 bp, 116 bp, 217 bp, 64 bp, 200 bp, 194 bp and 224 bp, respectively.
  • the product as a result of the reaction with the oligonucleotide primers of SEQ ID NOs: 1 and 33 was subjected to electrophoresis in Lane 1 .
  • the reaction products as a result of the reactions of the oligonucleotide primers of SEQ ID NOs: 1 and 34, 1 and 35, 1 and 11, 1 and 36, 1 and 37, 1 and 38, and 1 and 39 were subjected to electrophoreses in Lanes 2 , 3 , 4 , 5 , 6 , 7 and 8 , respectively.
  • Amplified products 21 and 22 were detected at a base length of 317 bp and a base length of 78 bp, respectively, in Lane 1 . Specifically, a non-specific amplified product was detected at another portion than at 78 bp which is in the vicinity of the set base length, 84 bp. An amplified product 23 was detected at a base length of 116 bp in Lane 2 . An amplified product 24 was detected at a base length of 217 bp in Lane 3 . An amplified product 25 was detected at a base length of 217 bp in Lane 4 . An amplified product 26 was detected at a base length of 64 bp in Lane 5 .
  • an amplified product 27 was detected at a base length of 51 bp. Namely, no amplified product was detected at a designed base length of 200 bp.
  • amplified products 28 and 29 were detected at a base length of 167 bp and a base length of 210 bp, respectively. Specifically, no amplified product was detected at the designed base length of 194 bp, but non-specific amplified products were detected at other positions.
  • An amplified product 30 was detected at a base length of 224 bp in Lane 8 .
  • the pairs of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 34, 1 and 35, 1 and 36, 1 and 39, and 1 and 11, respectively, were subjected to determination of amplified products by NASBA using a HCV subtype 1 b sample. This test was carried out to determine whether or not these oligonucleotide primers yield amplification specific only to the HCV subtype 1 a gene, since they were designed so as to genotype the HCV subtype 1 a gene and not to yield amplified products in the other subtypes.
  • FIG. 8 shows an electropherogram of amplified products of amplification reaction of the HCV subtype 1 b sample with the oligonucleotide primer of SEQ ID NO: 1 as a sense primer, and those of SEQ ID NOs: 11 and 39 as an antisense primer, respectively.
  • the reaction products as a result of amplification of the subtype 1 b sample with the pair of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 11, and with the pair of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 39 were subjected to electrophoresis in Lanes 1 and 2 , respectively.
  • An amplified product 31 was detected at a base length of 100 bp in Lane 1 . Namely, this pair of oligonucleotide primers yielded no amplified product in the case of the HCV subtype 1 b sample at the designed base length of 217 bp, demonstrating that this pair specifically amplifies the HCV subtype 1 a gene alone.
  • An amplified product 32 was detected at a base length of 219 bp in Lane 2 . This position of the amplified product is different from that of the HCV subtype 1 a sample, at a base length of 224 bp, only by 5 bp, showing that this pair of oligonucleotide primers does not enable genotyping based on the base length of the amplified product.
  • the pair of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 11 enables genotyping between the HCV subtype 1 a and HCV subtype 1 b genes based on the base length of the amplified product
  • Table 3 shows that the pair of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 11 is suitable for the genotyping of the HCV subtype 1 a gene.
  • the sense primer corresponding to SEQ ID NO: 1 is considered to be capable of isothermally amplifying the HCV subtype 1 a even if the priming site is narrowed by about two bases or less, or extended by about five bases or less at the 5′ end and to be capable of genotyping the HCV subtype 1 a even if the priming site is narrowed by about one or two bases at the 5′ end.
  • the antisense primer corresponding to SEQ ID NO: 11 is considered to be capable of isothermally amplifying the HCV subtype 1 a even if the priming site is extended by about twelve bases or less at the 5′ end and to be capable of genotyping the HCV subtype 1 a even if the priming site is extended by about five bases or less at the 5′ end.
  • Optimal pairs of oligonucleotide primers for genotype-specific isothermal amplification of HCV subtypes 1 b , 2 a , 2 b and 3 a genes by NASBA were determined by the procedure of Example 1.
  • Primers listed in Table 4 were designed based on the sequence of a specific region capable of typing the core region of the HCV subtype 1 b gene (SEQ ID NO: 41 corresponding to 1 to 325 bp of the core region of HCV subtype 1 b ). Different pairs of these primers were subjected to isothermal amplification by NASBA under the same conditions as in Example 1 using, as a template, a HCV subtype 1 b gene sample, and the presence or absence of, and the position of amplified product were determined by electrophoresis.
  • Table 4 shows that the oligonucleotide primers corresponding to SEQ ID NOs: 3, 4 and 9 are suitable for the genotyping of the HCV subtype 1 b gene.
  • the sense primer corresponding to SEQ ID NO: 3 is considered to be capable of isothermally amplifying the HCV subtype 1 b gene even if the priming site is narrowed by about two bases or less, or extended by about five bases or less at the 5′ end and to be capable of genotyping the HCV subtype 1 b gene even if the priming site is narrowed by about one or two bases at the 5′ end.
  • the antisense primer corresponding to SEQ ID NO: 4 or 9 is considered to be capable of isothermally amplifying the HCV subtype 1 b gene even if the priming site is extended by about ten bases or less at the 5′ end and to be capable of genotyping the HCV subtype 1 b gene even if the priming site is extended by about six bases or less at the 5′ end.
  • Primers listed in Table 5 were designed based on the sequence of a specific region capable of typing the core region of the HCV subtype 2 a gene (SEQ ID NO: 42 corresponding to 21 to 295 bp of the core region of HCV subtype 2 a ). Different pairs of these primers were subjected to isothermal amplification by NASBA under the same conditions as in Example 1 using, as a template, a HCV subtype 2 a gene sample, and the presence or absence of, and the position of amplified product were determined by electrophoresis.
  • Table 5 shows that the oligonucleotide primers corresponding to SEQ ID NOs: 5, 6 and 10 are suitable for the genotyping of the HCV subtype 2 a gene.
  • the sense primer corresponding to SEQ ID NO: 5 is considered to be capable of isothermally amplifying and genotyping the HCV subtype 2 a gene even if the priming site is narrowed by about four bases or less, or extended by about three bases or less at the 5′ end.
  • the antisense primer corresponding to SEQ ID NO: 6 or 10 is considered to be capable of isothermally amplifying the HCV subtype 2 a gene even if the priming site is narrowed by about four bases or less, or extended by about eight bases or less at the 5′ end and to be capable of genotyping the HCV subtype 2 a gene even if the priming site is narrowed by about four bases or less or extended by about one base or less at the 5′ end.
  • Primers listed in Table 6 were designed based on the sequence of a specific region capable of typing the core region of the HCV subtype 2 b gene (SEQ ID NO: 43 corresponding to 1 to 305 bp of the core region of HCV subtype 2 b ). Different pairs of these primers were subjected to isothermal amplification by NASBA under the same conditions as in Example 1 using, as a template, a HCV subtype 2 b gene sample, and the presence or absence of, and the position of amplified product were determined by electrophoresis.
  • Table 6 shows that the oligonucleotide primers corresponding to SEQ ID NOs: 21 and 22 are suitable for the genotyping of the HCV subtype 2 b gene.
  • the sense primer corresponding to SEQ ID NO: 21 is considered to be capable of isothermally amplifying the HCV subtype 2 b gene even if the priming site is narrowed by about two bases or less, or extended by about seventeen bases or less at the 5′ end and to be capable of genotyping the HCV subtype 2 b gene even if the priming site is narrowed by about two bases or less at the 5′ end.
  • the antisense primer corresponding to SEQ ID NO: 22 is considered to be capable of isothermally amplifying the HCV subtype 2 b gene even if the priming site is narrowed by about five bases or less at the 5′ end and to be capable of genotyping the HCV subtype 2 b gene even if the priming site is narrowed by about five bases or less at the 5′ end.
  • Primers listed in Table 7 were designed based on the sequence of a specific region capable of typing the core region of the HCV subtype 3 a gene (SEQ ID NO: 44 corresponding to 1 to 366 bp of the core region of HCV subtype 3 a ). Pairs of these primers were subjected to isothermal amplification by NASBA under the same conditions as in Example 1 using, as a template, a HCV subtype 3 a gene sample, and the presence or absence of, and the position of amplified product were determined by electrophoresis.
  • Table 7 shows that the oligonucleotide primers corresponding to SEQ ID NOs: 7 and 8 are suitable for the genotyping of the HCV subtype 3 a gene.
  • the sense primer corresponding to SEQ ID NO: 7 is considered to be capable of isothermally amplifying the HCV subtype 3 a gene even if the priming site is narrowed by about two bases or less, or extended by about five bases or less at the 5′ end and to be capable of genotyping the HCV subtype 3 a gene even if the priming site is narrowed by about two bases or less at the 5′ end.
  • the antisense primer corresponding to SEQ ID NO: 8 is considered to be capable of isothermally amplifying and genotyping the HCV subtype 3 a gene even if the priming site is narrowed by about five bases or less at the 5′ end.
  • Genotyping of HCV was carried out by isothermal amplification according to NASBA and electrophoresis by the procedure of Example 1. More specifically, the sense primers used are oligonucleotide primers corresponding to SEQ ID NOs: 1, 3, 5 and 7, and the antisense primers are oligonucleotide primers corresponding to SEQ ID NOs: 11, 12, 13 and 14 each further having a sequence including a T7 promoter sequence at the 5′ end.
  • a pair of oligonucleotide primers corresponding to SEQ ID NOs: 1 and 2 was so designed as to yield an amplified product having a size of 217 bp as a result of the amplification of a sample HCV subtype 1 a RNA.
  • a pair of oligonucleotide primers corresponding to SEQ ID NOs: 3 and 4 a pair of oligonucleotide primers corresponding to SEQ ID NOs: 5 and 6, and a pair of oligonucleotide primers corresponding to SEQ ID NOs: 7 and 8 were so designed as to yield amplified products having sizes of 209 bp, 234 bp and 229 bp as a result of the amplification of HCV subtype 1 b RNA sample, HCV subtype 2 a RNA sample, and HCV subtype 3 a RNA sample respectively.
  • FIG. 3 shows the resulting electropherogram.
  • Amplified products 10 , 11 , 12 and 13 in Lanes 1 , 2 , 3 and 4 as a result of amplification of the HCV subtypes 1 a , 1 b , 2 a and 3 a RNA samples were detected at base lengths of 217 bp, 304 bp, 234 bp and 229 bp, respectively.
  • the samples of HCV subtypes 1 a , 1 b , 2 a and 3 a RNAs yield amplified products having different sizes of amplification of 217 bp, 304 bp, 234 bp and 229 bp, respectively, with the oligonucleotide primers capable of carrying out genotype-specifically amplification.
  • HCV subtypes 1 b and 2 a which invite many infections in Japan, were genotyped with a real-time detection device.
  • oligonucleotide primers corresponding to SEQ ID NOs: 15 and 16 which correspond to oligonucleotide primers of SEQ ID NOs: 9 and 10, except with a Tag sequence added at the 5′ end, were used as antisense primers
  • oligonucleotide primers corresponding to SEQ ID NO: 17 and 18, which correspond to oligonucleotide primers of SEQ ID NOs: 3 and 5, except with a T7 promoter added at the 5′ end were used as sense primers.
  • Molecular beacon probes (S. Tyagi, et al., Nature Biotechnol, 14, 303-308(1996)) were used as a probe in the real-time detection.
  • the molecular beacon probes were designed so as to have a Tag sequence and base sequences corresponding to SEQ ID NOs: 19 and 20, respectively, for distinguishing the Tag sequence.
  • the molecular beacon corresponding to SEQ ID NO: 19 was modified with FAM as a fluorophore and with BHQ 1 as a quencher.
  • the molecular beacon corresponding to SEQ ID NO: 20 was modified with ROX as a fluorophore and with BHQ 2 as a quencher.
  • the sample HCV gene was amplified by NASBA by the procedure of Example 1, except for using NUCLISENSTM Basic Kit (bioMerieux, Inc.).
  • FIG. 4 is a flow chart of real-time detection (genotyping) of the HCV gene. Specifically, a solution 14 containing, for example, a sample, primers and reagents was mixed with an enzyme 16 , was subjected to amplification, and the amplified product was detected in real-time in an isothermal amplification/detection device 15 .
  • the isothermal amplification/detection device 15 used herein was Mx 3000p (Stratagene). The results are shown in FIGS. 5A and 5B .
  • FIGS. 5A and 5B The results are shown in FIGS.
  • FIG. 5A and 5B show results 17 and 18 in which a HCV subtype 1 b gene RNA and a HCV subtype 2 a gene RNA as samples were amplified, respectively, with the ordinate indicating the fluorescent intensity and the abscissa indicating the time.
  • the fluorescent intensity of FAM capable of identifying the HCV subtype 1 b amplified product is indicated by solid lines
  • the fluorescent intensity of ROX capable of identifying the HCV subtype 2 a amplified product is indicated by dashed lines.
  • FIG. 5A shows that only the fluorescent intensity of FAM increases with time, indicating that the sample is of the HCV subtype 1 b .
  • FIG. 5A shows that only the fluorescent intensity of FAM increases with time, indicating that the sample is of the HCV subtype 1 b .
  • HCV genotyping was carried out using oligonucleotide primers corresponding to SEQ ID NOs: 3 and 21 as sense primers, and oligonucleotide primers corresponding to SEQ ID NOs: 12 and 23 as antisense primers.
  • the antisense primers correspond to SEQ ID NOs: 4 and 22, except for further having a T7 promoter sequence at the 5′ end.
  • FIG. 6 shows the resulting electropherogram.
  • the oligonucleotide primers corresponding to SEQ ID NOs: 3 and 12 were so designed as to yield an amplified product having a size of amplification of 209 bp as a result of the amplification of the HCV subtype 1 b RNA.
  • the oligonucleotide primers corresponding to SEQ ID NOs: 21 and 23 were so designed as to yield an amplified product having a size of 214 bp as a result of the amplification of the HCV subtype 2 b RNA.
  • the results of the amplification reaction with the oligonucleotide primers corresponding to SEQ ID NOs: 3 and 12 are shown in Lanes 1 and 2.
  • the results of the amplification reaction using with oligonucleotide primers corresponding to SEQ ID NOs: 21 and 23 are shown in Lanes 3 and 4 .
  • An amplified product 19 was detected at a base length of 209 bp in Lane 1 as a result of the amplification of the HCV subtype 1 b RNA as a sample.
  • no amplified product was detected in Lane 2 as a result of the amplification of the HCV subtype 2 b as a sample.
  • An amplified product 20 was detected at a base length of 214 bp in Lane 4 as a result of the amplification of the HCV subtype 2 b RNA as a sample. In contrast, no amplified product was detected in Lane 3 as a result of the amplification of the HCV subtype 1 b as a sample.
  • oligonucleotide primers of the present invention are usable in the detection and genotyping of hepatitis C virus and can thereby be widely used in researches on HCV, such as studies on pathoses, estimation and determination of efficacies of agents depending on the subtypes of HCV.
  • SEQ ID NO: 1 Description of Artificial Sequence: sense primer for the amplification of HCV subtype 1 a
  • SEQ ID NO: 2 Delivery of Artificial Sequence: antisense primer for the amplification of HCV subtype 1 a
  • SEQ ID NO: 3 Description of Artificial Sequence: sense primer for the amplification of HCV subtype 1 b
  • SEQ ID NO: 4 Description of Artificial Sequence: antisense primer for the amplification of HCV subtype 1 b
  • SEQ ID NO: 5 Description of Artificial Sequence: sense primer for the amplification of HCV subtype 2 a
  • SEQ ID NO: 6 Delivery of Artificial Sequence: antisense primer for the amplification of HCV subtype 2 a
  • SEQ ID NO: 7 Description of Artificial Sequence: sense primer for the amplification of HCV subtype 3 a
  • SEQ ID NO: 8 Delivery of Artificial Sequence: antisense primer for the amplification of HCV subtype 3 a
  • SEQ ID NO: 9 Description of Artificial Sequence: antisense primer for the amplification of HCV subtype 1 b
  • SEQ ID NO: 10 Delivery of Artificial Sequence: antisense primer for the amplification of HCV subtype 2 a
  • SEQ ID NO: 11 Delivery of Artificial Sequence: antisense primer with T7 promoter sequence for the amplification of HCV subtype 1 a
  • SEQ ID NO: 12 Delivery of Artificial Sequence: antisense primer with T7 promoter sequence for the amplification of HCV subtype 1 b
  • SEQ ID NO: 13 Delivery of Artificial Sequence: antisense primer with T7 promoter sequence for the amplification of HCV subtype 2 a
  • SEQ ID NO: 14 Delivery of Artificial Sequence: antisense primer with T7 promoter sequence for the amplification of HCV subtype 3 a
  • SEQ ID NO: 15 Delivery of Artificial Sequence: antisense primer with Tag sequence for the amplification of HCV subtype 1 b
  • SEQ ID NO: 16 Delivery of Artificial Sequence: antisense primer with Tag sequence for the amplification of HCV subtype 2 a
  • SEQ ID NO: 17 Description of Artificial Sequence: sense primer with T7 promoter sequence for the amplification of HCV subtype 1 b
  • SEQ ID NO: 18 Description of Artificial Sequence: sense primer with T7 promoter sequence for the amplification of HCV subtype 2 a
  • SEQ ID NO: 19 Description of Artificial Sequence: molecular beacon sequence with Tag sequence
  • SEQ ID NO: 20 Description of Artificial Sequence: molecular beacon sequence with Tag sequence
  • SEQ ID NO: 21 Description of Artificial Sequence: sense primer for the amplification of HCV subtype 2 b
  • SEQ ID NO: 22 Description of Artificial Sequence: antisense primer for the amplification of HCV subtype 2 b
  • SEQ ID NO: 23 Description of Artificial Sequence: antisense primer with T7 promoter sequence for the amplification of HCV subtype 2 b
  • SEQ ID NO: 24 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 25 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 26 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 27 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 28 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 29 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 30 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 31 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 32 Description of Artificial Sequence: HCV subtype 1 a sense primer
  • SEQ ID NO: 33 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 34 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 35 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 36 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 37 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 38 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 39 Description of Artificial Sequence: HCV subtype 1 a antisense primer with T7 promoter sequence
  • SEQ ID NO: 40 HCV subtype 1 a -specific core region
  • SEQ ID NO: 42 HV subtype 2 a -specific core region
  • SEQ ID NO: 44 HCV subtype 3 a -specific core region
  • SEQ ID NO: 45 Description of Artificial Sequence: sequence with T7 promoter sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US11/132,286 2004-05-19 2005-05-19 Primers for isothermal amplification of hepatitis C virus Abandoned US20060040261A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/976,232 US8008045B2 (en) 2004-05-19 2007-10-23 Primers for isothermal amplification of hepatitis C virus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2004149448A JP4474198B2 (ja) 2004-05-19 2004-05-19 C型肝炎ウイルス恒温増幅用プライマー
JP2004-149448 2004-05-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/976,232 Division US8008045B2 (en) 2004-05-19 2007-10-23 Primers for isothermal amplification of hepatitis C virus

Publications (1)

Publication Number Publication Date
US20060040261A1 true US20060040261A1 (en) 2006-02-23

Family

ID=35276358

Family Applications (2)

Application Number Title Priority Date Filing Date
US11/132,286 Abandoned US20060040261A1 (en) 2004-05-19 2005-05-19 Primers for isothermal amplification of hepatitis C virus
US11/976,232 Expired - Fee Related US8008045B2 (en) 2004-05-19 2007-10-23 Primers for isothermal amplification of hepatitis C virus

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/976,232 Expired - Fee Related US8008045B2 (en) 2004-05-19 2007-10-23 Primers for isothermal amplification of hepatitis C virus

Country Status (3)

Country Link
US (2) US20060040261A1 (cg-RX-API-DMAC7.html)
EP (1) EP1616967B1 (cg-RX-API-DMAC7.html)
JP (1) JP4474198B2 (cg-RX-API-DMAC7.html)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007267636A (ja) * 2006-03-30 2007-10-18 Toshiba Corp 核酸製造法および核酸増幅用プライマーセット
ES2764276T3 (es) 2014-08-04 2020-06-02 Gencell Biosystems Ltd Dispositivo de análisis genómico y métodos de uso
GB201819726D0 (en) * 2018-12-03 2019-01-16 Diagnostics For The Real World Ltd HCV detection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5427909A (en) * 1991-09-09 1995-06-27 Immuno Japan Inc. Oligonucleotides and determination system of HCV genotypes
US6174868B1 (en) * 1992-09-10 2001-01-16 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0510952A1 (en) * 1991-04-26 1992-10-28 Immuno Japan Inc. Oligonucleotide primers and their application for high-fidelity detection of non-a, non-b hepatitis virus
US6297048B1 (en) * 1992-02-04 2001-10-02 Chiron Corporation Hepatitis therapeutics
DK0625204T3 (da) * 1992-02-04 2002-07-15 Chiron Corp Terapeutiske midler mod hepatitis
JPH0975100A (ja) 1995-09-18 1997-03-25 Sanwa Kagaku Kenkyusho Co Ltd C型肝炎ウイルスの簡易な型判定法
JP2004135509A (ja) 2002-10-15 2004-05-13 Hitachi Ltd 遺伝子発現解析法及び遺伝子発現解析用プローブキット
JP2004329209A (ja) 2003-04-18 2004-11-25 Hitachi Ltd 遺伝子検出法及び遺伝子検出用プローブキット

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5427909A (en) * 1991-09-09 1995-06-27 Immuno Japan Inc. Oligonucleotides and determination system of HCV genotypes
US6174868B1 (en) * 1992-09-10 2001-01-16 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases

Also Published As

Publication number Publication date
JP2005328745A (ja) 2005-12-02
EP1616967B1 (en) 2016-11-02
JP4474198B2 (ja) 2010-06-02
EP1616967A2 (en) 2006-01-18
US8008045B2 (en) 2011-08-30
US20090191539A1 (en) 2009-07-30
EP1616967A3 (en) 2006-01-25

Similar Documents

Publication Publication Date Title
JP4638388B2 (ja) 単一プローブ分析を用いるc型肝炎ウイルスタイピングのためのプローブおよび方法
EP2722403B1 (en) Method for preventing high molecular weight products during amplification
JP7469286B2 (ja) C型肝炎ウイルスを検出または定量するための組成物および方法
Antonishyn et al. Rapid genotyping of hepatitis C virus by primer-specific extension analysis
Ilina et al. Matrix-assisted laser desorption ionization-time of flight (mass spectrometry) for hepatitis C virus genotyping
Li et al. Rapid and sensitive detection of Senecavirus A by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick method
US8222389B2 (en) Method for lowering both sequence variations and increase of base line effects in a diagnostic hybridisation assay, assay for performing such a method and probe for use in the assay
US20070281295A1 (en) Detection of human papillomavirus E6 mRNA
US8008045B2 (en) Primers for isothermal amplification of hepatitis C virus
US10041134B2 (en) Dual probe assay for the detection of HCV
Nakatani et al. Development of hepatitis C virus genotyping by real-time PCR based on the NS5B region
US9963737B2 (en) Dual probe assay for the detection of heterogeneous amplicon populations
US20110236892A1 (en) Method for lowering the dependency towards sequence variation of a nucleic acid target in a diagnostic hybridization assay
EP1721015B1 (en) Primer and probe design for efficient amplification and detection of hcv 3' non-translating region
CN101210269A (zh) 用于检测戊型肝炎病毒的lamp扩增用核酸引物组
Xiao et al. Molecular diagnosis of HIV and relevant novel technologies in mutation analysis
CN101415843B (zh) 通过扩增和检测复制酶序列分析sars冠状病毒
Horsman et al. Rapid Genotyping of Hepatitis C Virus by
KR100658606B1 (ko) C형 간염 바이러스의 유전자형 분석방법
CN119776491A (zh) 一种mmlv逆转录酶的酶活性的检测方法

Legal Events

Date Code Title Description
AS Assignment

Owner name: HITACHI HIGH-TECHNOLOGIES CORPORATION, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TANABE, MAIKO;UEMATSU, CHIHIRO;REEL/FRAME:016579/0671

Effective date: 20050318

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION