New! View global litigation for patent families

US20030100527A1 - Immunostimulatory nucleic acid molecules for activating dendritic cells - Google Patents

Immunostimulatory nucleic acid molecules for activating dendritic cells Download PDF

Info

Publication number
US20030100527A1
US20030100527A1 US10161229 US16122902A US2003100527A1 US 20030100527 A1 US20030100527 A1 US 20030100527A1 US 10161229 US10161229 US 10161229 US 16122902 A US16122902 A US 16122902A US 2003100527 A1 US2003100527 A1 US 2003100527A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
cells
dendritic
cpg
cell
nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10161229
Inventor
Arthur Krieg
Gunther Hartmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation (UIRF)
Original Assignee
University of Iowa Research Foundation (UIRF)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues ; Not used, see subgroups
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0639Dendritic cells, e.g. Langherhans cells in the epidermis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine, rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine, rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/47064-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/05Adjuvants
    • C12N2501/056Immunostimulating oligonucleotides, e.g. CpG

Abstract

The present invention relates generally to methods and products for activating dendritic cells. In particular, the invention relates to oligonucleotides which have a specific sequence including at least one unmethylated CpG dinucleotide which are useful for activating dendritic cells. The methods are useful for in vitro, ex-vivo, and in vivo methods such as cancer immunotherapeutics, treatment of infectious disease and treatment of allergic disease.

Description

    RELATED APPLICATIONS
  • [0001]
    This application is a divisional of co-pending U.S. Ser. No. 09/191,170, filed on Nov. 13, 1998, now allowed which is a continuation-in-part of U.S. Ser. No. 08/960,774, filed Oct. 30, 1997, now issued as U.S. Pat. No. 6,239,116B1 on May 29, 2001, which is a continuation-in-part of U.S. Ser. No. 08/738,652, filed Oct. 30, 1996 and which is now issued as U.S. Pat. No. 6,207,646B1 on Mar. 27, 2001, and which patent is a continuation-in-part of U.S. Ser. No. 08/386,063, filed Feb. 7, 1995 and which is now issued as U.S. Pat. No. 6,194,388B1 on Feb. 27, 2001, and which patent is a continuation-in-part of U.S. Ser. No. 08/276,358, filed Jul. 15, 1994 and which is abandoned, each of which are incorporated by reference.
  • FIELD OF THE INVENTION
  • [0002]
    The present invention relates generally to methods and products for activating dendritic cells. In particular, the invention relates to oligonucleotides which have a specific sequence including at least one unmethylated CpG dinucleotide which are useful for activating dendritic cells.
  • BACKGROUND Of THE INVENTION
  • [0003]
    In the 1970s, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R.A., et al., 1971, Proc. Natl. Acad. Sci. USA, 68:1212; Aggarwal, S. K., et al., 1975, Proc. Natl. Acad. Sci. USA, 72:928 ). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction; binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., et al., J. Clin. Invest., 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., et al. and J. S. Cohen, 1991, Advanced Drug Delivery Reviews, 6:235; Akhtar, et al., 1992, in: “Gene Regulation: Biology of Antisense RNA and DNA,” R. P. Erickson, Eds, Raven Press, Ltd., New York, p. 133; and Zhao, et al., 1994, Blood, 84:3660 ). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.
  • [0004]
    Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen (LPS) had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen ConA showed enhanced ODN uptake by T but not B cells (Krieg, A. M., et al., 1991, Antisense Research and Development, 1:161 ).
  • [0005]
    Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly(IC) which is a potent inducer of interferon (IFN) production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., et al., 1985, Cancer Res., 45:1058; Wiltrout, et al., 1985, J. Biol. Resp. Mod., 4:512; Krown, S. E., 1986, Sem. Oncol., 13:207; and Ewel, C. H., et al., 1992, Canc. Res., 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron, 1993, J. Immunol., 150:3713 ). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro anti-tumor activity led to several clinical trials using poly(IC) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, et al., cited supra; Wiltrout, et al., cited supra; Krown, et al., cited supra, and Ewel, et al., cited supra). Unfortunately, toxic side effects has thus far prevented poly(IC) from becoming a useful therapeutic agent.
  • [0006]
    Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas, 1985, J. Immunol., 134:3204; and Goodman, M. J., 1986, J. Immunol., 136:3335 ). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., cited supra), augment murine NK activity (Koo, G. C., et al., 1988, J. Immunol., 140:3249 ) and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas, 1990, J. Immunol., 145:3524 ). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, cited supra). Recently a 5 triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., et al., 1994, Science, 264:267 ). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.
  • [0007]
    Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell, et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., et al., 1990, J. Clin. Invest., 85:1487 ). In other cases, naked DNA has been reported to have immune effects. For example, Messina, et al. have recently reported that 260-800 bp fragments of poly(dG).(dC) and poly(dG)(dC) were mitogenic for B cells (Messina, J. P., et al., 1993, Cell. Immunol., 147:148 ). Tokunaga, et al. have reported that poly(dG,dC) induces the γ-IFN and NK activity (Tokunaga, et al., 1988, Jpn. J. Cancer Res., 79:682 ). Aside from such artificial homopolymer sequences, Pisetsky, et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, et al., 1991, J. Immunol., 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of microbacterial DNA sequences have demonstrated that ODN, which contains certain palindrome sequences can activate NK cells (Yamamoto, et al., 1992, J Immunol., 148:4072; and Kuramoto, et al., 1992, Jpn. J. Cancer Res., 83:1128).
  • [0008]
    Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, et al., 1992, J. Exp. Med., 175:597; Branda, R. S., et al., 1993, Biochem. Pharmacol., 45:2037; McIntyre, K., et al., 1993, Antisense Res. Develop., 3:309; and Pisetsky, et al., 1994, Life Sciences, 54:101 ). These reports do not suggest a common structure motif or sequence element in these ODN that might explain their effects.
  • [0009]
    Dendritic cells are considered to be the most potent professional antigen-presenting cells (APC) (Guery, J. C., et al., 1995, J. Immunol, 154:536 ). Dendritic cells capture antigen and present them as peptide fragments to T cells, stimulating T cell dependent immunity. These powerful APCs have been found in skin, blood, dense tissue, and mucosa, and spleen. Several studies have demonstrated that after human dendritic cells which are isolated from peripheral blood are presented peptide antigen they can be used to stimulate and expand antigen specific CD4+and CD8+T cells, in vitro and ex vivo (Engleman, E. G., 1997, Cytotechnology, 25:1 ). Several clinical trials are currently underway, based on these findings, using ex vivo manipulation of dendritic cells to generate specific anti-tumor dendritic cells for reimplantation. There has been a growing interest in using dendritic cells ex vivo as tumor or infectious disease vaccine adjuvants (Nestle FO, et al., “Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells”, Nat Med, 1998; 4:328-332; Rosenberg SA, et al., “Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma”, Nat Med, 1998; 4:321 -327; Hsu FJ, et al., “Vaccination of patients with B-cell lymphoma using autologous antigen- pulsed dendritic cells”, Nat Med, 1996; 2:52 -58; Tjoa BA, et al., “Evaluation of phase I/II clinical trials in prostate cancer with dendritic cells and PSMA peptides”, Prostate, 1998; 36: 39-44. Numerous animal models demonstrate conclusively that ex vivo generated DC pulsed with protein antigen can be successfully applied for the immunotherapy of cancer and infectious diseases. (Fields RC, et al., “Murine dendritic cells pulsed with whole tumor lysates mediate potent antitumor immune responses in vitro and in vivo”, Proc Natl Acad Sci, USA, 1998; 95:9482-9487; Okada H, et al., “Bone marrow-derived dendritic cells pulsed with a tumor-specific peptide elicit effective anti-tumor immunity against intracranial neoplasms”, Int J Cancer, 1998; 78: 196-201; Su H, et al., “Vaccination against chlamydial genital tract infection after immunization with dendritic cells pulsed ex vivo with nonviable Chlamydiae”, J Exp Med, 1998; 188:809-818; DeMatos P., et al., “Pulsing of dendritic cells with cell lysates from either B16 melanoma or MCA-106 fibrosarcoma yields equally effective vaccines against B16 tumors in mice”, J Surg Oncol, 1998; 68:79-91; “Yang S, et al., “Immunotherapeutic potential of tumor antigen-pulsed and unpulsed dendritic cells generated from murine bone marrow”, Cell Immunol, 1997; 179:84-95; Nair SK, et al., “Regression of tumors in mice vaccinated with professional antigen- presenting cells pulsed with tumor extracts”, Int J Cancer, 1997; 70:706-715.
  • SUMMARY Of THE INVENTION
  • [0010]
    As described in co-pending parent patent application U.S. Ser. No. 08/960,774 the vertebrate immune system has the ability to recognize the presence of bacterial DNA based on the recognition of so-called CpG-motifs, unmethylated cytidine-guanosine dinucleotides within specific patterns of flanking bases. According to these disclosures CpG functions as an adjuvant and is as potent at inducing B-cell and T-cell responses as the complete Freund's adjuvant, but is preferable since CpG induces a higher Th1 response and is less toxic. Alum, the adjuvant which is used routinely in human vaccination, induces the less favorable Th2 response. Compared to alum, CpG is a more effective adjuvant. The combination of CpG and alum was found to produce a synergistic adjuvant effect.
  • [0011]
    CpG oligonucleotides also show adjuvant effects towards various immune cells. For instance, CpG enhances the efficacy of monoclonal antibody therapy, thus functioning as an effective immune adjuvant for antigen immunization in a B cell lymphoma model. Cytotoxic T cell responses to protein antigen also are induced by CpG. Furthermore, the presence of immunostimulatory DNA sequences in plasmids was found to be necessary for effective intradermal gene immunization.
  • [0012]
    It was discovered according to an aspect of the invention that the adjuvant activity of CpG is based on the direct activation of dendritic cells by CpG. Potent immunostimulatory CpG oligonucleotides and control oligonucleotides were found to cause dramatic changes in dendritic cells isolated from peripheral blood by immunomagnetic cell sorting. CpG oligonucleotides provided excellent Dendritic cell survival, differentiation, activation and maturation, and were superior to the combination of GM-CSF and LPS. In fact, the combination of CpG and GM-CSF produced unexpected synergistic effects on the activation of dendritic cells. The invention thus encompasses both CpG oligonucleotides and the combination of CpG oligonucleotides and cytokines such as GM-CSF as well as in vitro, ex vivo, and in vivo methods of activating dendritic cells for various assays and immunotherapeutic strategies.
  • [0013]
    In one aspect the invention is a method for activating a dendritic cell. The method includes the steps of contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to activate a dendritic cell. In one embodiment the dendritic cell is an isolated dendritic cell.
  • [0014]
    The isolated nucleic acid is one which contains at least one unmethylated CpG dinucleotide and which is from about 8-80 bases in length. In one embodiment the unmethylated CpG dinucleotide has a formula:
  • 5′N1X1CGX2N23′
  • [0015]
    wherein at least one nucleotide separates consecutive CpGs; X1 is adenine, guanine, or thymine; X2 is cytosine, adenine, or thymine; N is any nucleotide and N1+N2 is from about 0-25 nucleotides. In another embodiment the unmethylated CpG dinucleotide has a formula:
  • 5′NX1X2CGX3X4N3′
  • [0016]
    wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of TpT, CpT, TpC, and ApT; X3X4 is selected from the group consisting of GpT,GpA, ApA and ApT; N is any nucleotide and N1+N2 is from about 0-25 nucleotides. In a preferred embodiment N1 and N2 of the nucleic acid do not contain a CCGG quadmer or more than one CCG or CGG trimer. In an illustrative embodiment the isolated nucleic acid is selected from the group consisting of SEQ ID Nos. 20, 24, and 38-46. In another embodiment the isolated nucleic acid is SEQ ID NO.: 84 or 85.
  • [0017]
    In yet another embodiment the nucleotide of the isolated nucleic acid has a phosphate backbone modification, such as, for example, a phosphorothioate or phosphorodithioate modification. In one embodiment the phosphate backbone modification occurs at the 5′ end of the nucleic acid. Preferably the phosphate backbone modification occurs at the first two internucleotide linkages of the 5′ end of the nucleic acid. According to another embodiment the phosphate backbone modification occurs at the 3′ end of the nucleic acid. Preferably, the phosphate backbone modification occurs at the last five internucleotide linkages of the 3′ end of the nucleic acid.
  • [0018]
    The method for activating the dendritic cell may be performed in vitro, ex vivo, or in vivo. The method in some aspects is a method for cancer immunotherapy, treating an infectious disease, or treating an allergy. When these methods are performed ex vivo they are performed by administering an activated dendritic cell that expresses a specific cancer antigen, microbial antigen, or allergen to a subject in need thereof, wherein the activated dendritic cell is prepared by the methods described above. In a preferred embodiment the isolated nucleic acid is administered to a human subject.
  • [0019]
    In other embodiments the method includes the step of contacting the dendritic cell with a cytokine selected from the group consisting of GM-CSF, IL-4, TNFα, INF-γ, IL-6, Flt3 ligand, and IL-3. In yet other embodiments the method includes the step of contacting the dendritic cell with an antigen prior to the isolated nucleic acid.
  • [0020]
    The invention in another aspect is an isolated antigen-expressing dendritic cell population produced by the process of: exposing an isolated dendritic cell to an antigen; contacting the isolated dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the isolated nucleic acid is from about 8-80 bases in length; and allowing the isolated dendritic cell to process and express the antigen.
  • [0021]
    The isolated nucleic acid is one which contains at least one unmethylated CpG dinucleotide and which is from about 8-80 bases in length. In one embodiment the unmethylated CpG dinucleotide has a formula:
  • 5′N1X1CGX2N23′
  • [0022]
    wherein at least one nucleotide separates consecutive CpGs; X1 is adenine, guanine, or thymine; X2 is cytosine, adenine, or thymine; N is any nucleotide and N1 +N2 is from about 0-25 nucleotides. In another embodiment the unmethylated CpG dinucleotide has a formula:
  • 5′NX1X2CGX3X4N3′
  • [0023]
    wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of TpT, CpT, TpC, and ApT; X3X4 is selected from the group consisting of GpT,GpA, ApA and ApT; N is any nucleotide and N1+N2 is from about 0-25 nucleotides. In a preferred embodiment N1 and N2 of the nucleic acid do not contain a CCGG quadmer or more than one CCG or CGG trimer. In an illustrative embodiment the isolated nucleic acid is selected from the group consisting of SEQ ID Nos. 20, 24, and 38-46. In another embodiment the isolated nucleic acid is SEQ ID NO.: 84or85.
  • [0024]
    In yet another embodiment the nucleotide of the isolated nucleic acid has a phosphate backbone modification, such as, for example, a phosphorothioate or phosphorodithioate modification. In one embodiment the phosphate backbone modification occurs at the 5′ end of the nucleic acid. Preferably the phosphate backbone modification occurs at the first two internucleotide linkages of the 5′ end of the nucliec acid. According to another embodiment the phosphate backbone modification occurs at the 3′ end of the nucleic acid. Preferably, the phosphate backbone modification occurs at the last five internucleotide linkages of the 3′ end of the nucleic acid.
  • [0025]
    According to another embodiment the isolated antigen-expressing dendritic cell is prepared by contacting the isolated dendritic cell with a cytokine selected from the group consisting of GM-CSF, IL-4, TNFα, INF-γ, IL-6, Flt3 ligand, and IL-3.
  • [0026]
    In yet another embodiment the isolated antigen-expressing dendritic cell is prepared by contacting the isolated dendritic cell with the antigen prior to the isolated nucleic acid.
  • [0027]
    The invention in another aspect is a composition, including an effective amount for synergistically activating a dendritic cell of an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length; and an effective amount for synergistically activating a dendritic cell of a cytokine selected from the group consisting of GM-CSF, IL-4, TNFα, Flt3 ligand, and IL-3. In an illustrative embodiment the cytokine is GM-CSF. In another embodiment the composition also includes an antigen, such as, for example a cancer antigen, a microbial antigen, or an allergen.
  • [0028]
    In another aspect the invention is a screening assay for identifying compounds that are effective for preventing dendritic cell maturation. The assay includes the following steps: contacting an immature dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length; exposing the dendritic cell to a putative drug; and detecting the presence or absence of a maturation marker on the dendritic cell, wherein the absence of the maturation marker indicates that the putative drug is an effective compound for preventing dendritic cell maturation. In one illustrative embodiment the maturation marker is CD83.
  • [0029]
    The invention in another aspect is a method for generating a high yield of dendritic cells. The method includes the following steps administering an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective for activating dendritic cells to a subject; allowing the isolated nucleic acid to activate dendritic cells of the subject; and isolating dendritic cells from the subject.
  • [0030]
    In another aspect the invention is a method for producing a CD40 expressing dendritic cell. The method includes the following steps: contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to produce a CD40 expressing dendritic cell.
  • [0031]
    A method for causing maturation of a dendritic cell is provided according to another aspect of the invention. The method includes the step of contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to cause maturation of the dendritic cell.
  • [0032]
    Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
  • BRIEF DESCRIPTION Of THE DRAWINGS
  • [0033]
    [0033]FIG. 1 shows FACS chart depicting CpG oligonucleotide promoted survival of dendritic precursor cells. Freshly isolated dendritic precursor cells were incubated for 2 days in the presence of either oligonucleotides or GMCSF (800 U/ml). Flow cytometric analysis of morphology (forward scatter, FSC; sideward scatter, SSC) showed that CpG oligonucleotides (2006: CpG phosphorothioate oligonucleotide, 1×2 μg/ml, 2080 CpG phosphodiester oligonucleotide, 3×+μg/ml) promote survival of dendritic precursor cells, while the non CpG controls (2117: 2006 with methylated CpG; 2078: identical to 2080 but GpCs instead of CpGs) showed no positive effect on cell survival compared to the sample without oligonucleotides and GMCSF (no addition). Morphologically (FSC and SSC), viable cells were found in region A, non-viable cells in region B (regions drawn in lower left dot plot).
  • [0034]
    [0034]FIG. 2 is a graph showing that the combination of CpG and GMCSF enhances viability of dendritic cells. Dendritic precursor cells were isolated from peripheral blood and incubated for 48 hours with GMCSF (800 U/ml) and oligonucleotides (2006: CpG phosphorothioate; 2117: CpGs in 2006 methylated; 2 μg/ml) as indicated. Viability was examined by flow cytometry. Data represent the mean of two independent experiments.
  • [0035]
    [0035]FIG. 3 shows FACS charts demonstrating that an increase in dendritic cell size is associated with enhanced MHC II expression. Dendritic precursor cells are incubated for 48 hours in the presence of GMCSF (800 U/ml) and oligonucleotides as indicated and examined by flow cytometry (sideward scatter, SSC). Viable cells (2500 per sample) were counted. Phosphodiester oligonucleotides (2080: CpG; 2078: non-CpG) were added at 0 hours, 12 hours and 24 hours (30 μg/ml each time point).
  • [0036]
    [0036]FIG. 4 shows FACS charts demonstrating that ICAM-1 and MHC II expression of dendritic cells in response to GMCSF and CpG. Dendritic precursor cells were incubated for 48 hours in the presence of GMCSF (800 U/ml) and 2006 (CpG phosphorothioate; 6 μg/ml). Expression of ICAM-1 (CD54) and MHC II was examined by flow cytometry (2500 viable cells are counted in each sample).
  • [0037]
    [0037]FIG. 5 is graphs depicting induction of co-stimulatory molecule expression on dendritic cells by CpG. Dendritic precursor cells were incubated for 48 hours in the presence of GMCSF (800 U/ml) and oligonucleotides (2006: CpG phosphorothioate, 6 μg/ml) as indicated. Expression of CD54 (ICAM-1) (panel A), CD86 (B7-2) (panel B) and CD40 (panel C) was quantified by flow cytometry (MFI, mean fluorescence intensity). The combination of GMCSF and 2006 shows synergy for increasing the expression of CD86 and CD40, while the effect on CD54 was additive. Results represent the mean of 5 independent experiments (CD54 and CD86) and 4 experiments (CD40). Statistical significance of the increase compared to the cell only sample is indicated by * (P<0.05). Statistical evaluation is performed by the unpaired t-test, error bars indicate SEM.
  • [0038]
    [0038]FIG. 6 is graphs depicting the enhancement of CD40 expression on dendritic cells is CpG specific and not induced by LPS. Dendritic precursor cells are cultured for 48 hours in the presence of GMCSF (800 U/ml), LPS (10 ng/ml) and oligonucleotides (2006, CpG phosphorothioate, 6 μg/ml: 2117, methylated 2006; 2080 CpG phosphodiester, 30 μg/ml at 0 hours, 12 hours and 24 hours; 2078 GpC version of 2080). CD40 expression is examined by flow cytometry (MFI, mean fluorescence intensity). Panel A and panel B show the results of two separate sets of experiments. Panel A shows CpG specificity (methylated control oligonucleotide) for the synergy of CpG and GMCSF for induction of CD40 expression. Panel B shows that CpG is equally effective in enhancing CD40 expression as GMCSF, and that this effect is CpG specific (GpC control oligonucleotide). Panel A and B represent the mean of two independent experiments each.
  • [0039]
    [0039]FIG. 7 is graphs depicting the induction of CD54 and CD86 expression on dendritic cells is CpG specific and not induced by LPS. Dendritic precursor cells are cultured for 48 hours in the presence of GMCSF (800 U/ml), LPS (10 ng/ml) and oligonucleotides (2006, CpG phosphorothioate, 2 μg/ml: 2117, methylated 2006). CD54 (panel A) and CD86 (panel B) expression is examined by flow cytometry (MFI, mean fluorescence intensity). Panel A and B represent the mean of two independent experiments (error bars indicate SEM).
  • [0040]
    [0040]FIG. 8 shows FACS charts demonstrating that CD86 expression on monocyte-derived Dendritic cells is induced by LPS but not by CpG. CD 14-positive monocytes were prepared from PBMC by immunomagnetic separation and incubated in the presence of GMCSF (800 U/ml) and IL-4 (500 U/ml, Genzyme, Cambridge, Mass.). After five days (fresh medium and cytokines added every other day), cells showed the characteristic surface marker pattern of monocyte-derived dendritic cells (lineage marker negative, MHC II bright, CD1a bright, CD40 intermediate, CD54 intermediate, CD80 dim, CD86 dim) and characteristic morphology. From day 5 to day 7, LPS (1 ng/ml), TNF (1000 U/ml) or oligonucleotides in the indicated concentrations were added. CD 86 expression is measured by flow cytometry (numbers represent mean fluorescence intensity). In this series of experiments, the non-CpG phosphorothioate control oligonucleotide 2041 (5′-CTG GTC TTT CTG GTT TTT TTC TGG-3′) (SEQ ID No.: 93) was used. The results are representative for 8 independent experiments, in which CpG did not stimulate monocyte-derived dendritic cells.
  • [0041]
    [0041]FIG. 9 shows FACS charts demonstrating that CpG induces maturation (CD83 expression) of dendritic cells. After 48 hours incubation with GMCSF (800 U/ml), LPS (10 ng/ml) and oligonucleotides (2006: CpG phosphorothioate; 2117 methylated 2006; 2 μ/ml), CD83 and CD86 expression on dendritic cells is determined in flow cytometry. Values (%) represent the percentage of CD83 positive (mature) cells of all viable cells. Results are representative for four independent experiments.
  • [0042]
    [0042]FIG. 10 are electron micrographs depicting CpG induction of morphologic changes in dendritic cells. Dendritic cells were incubated for 2 days in the presence of GMCSF (800 U/ml) and 2006 (2 μg/ml) (panel A), with 2006 (2 μg/ml) (panel B), with GMCSF (800 U/ml) (panel C), and with the control oligonucleotide 2117 (2 μ/ml) (panel D). Cells were fixed and processed for scanning electron microscopy according to standard procedures.
  • [0043]
    [0043]FIG. 11 are electron micrographs depicting Ultrastructural differences due to CpG. Dendritic cells were incubated for 2 days in the presence of GM-CSF (800 U/ml) and 2006 (2 μg/ml) (panel A) or with GMCSF (800 U/ml) panel B) and transmission electron microscopy was performed. In the presence of CpG (panel A) multilamellar bodies (>) and multivesicular structures can be seen.
  • [0044]
    [0044]FIG. 12 are electron micrographs depicting High magnification of CpG-characteristic ultrastructural differences. Dendritic cells incubated with GMCSF (800 IU/ml) and 2006 (2 μg/ml) were examined by transmission electron microscopy. Arrows point to characteristic multilamellar bodies (>) and to multivesicular structures (>>).
  • DETAILED DESCRIPTION Of THE INVENTION
  • [0045]
    Dendritic cells form the link between the innate and the acquired immune system by presenting antigens as well as through their expression of pattern recognition receptors which detect microbial molecules like LPS in their local environment. It has been discovered according to the invention that CpG has the unique capability to promote cell survival, differentiation, activation and maturation of dendritic cells. In fact dendritic precursor cells isolated from human blood by immunomagnetic cell sorting develop morphologic and functional characteristics of dendritic cells during a two day incubation with GM-CSF. Without GM-CSF these cells undergo apoptosis. It was discovered according to the invention that CpG was superior to GM-CSF in promoting survival and differentiation of dendritic cells (MHC II expression, cell size, granularity). As shown in the Examples below, the CpG phosphorothioate oligonucleotide 2006 (2 μg/ml) induced the expression of ICAM-1 (CD54) by 3.6-fold (p=0.02; n=5), the co-stimulatory molecule B7-2 (CD86) by 2.4-fold (p=0.03; n=5) and CD40 by 4.1-fold (p =0.04; n=4). The combination of GM-CSF and 2006 showed a synergistic induction of CD86 and CD 40, and an additive effect for CD54. Induction of CD54, CD86 and CD40 by 2006 alone was higher compared to either GM-CSF alone or GM-CSF combined with LPS. Electron microscopy revealed major ultrastructural changes of dendritic cells in response to CpG, indicating that these cells were differentiated. Additionally CpG was found to induce maturation of dendritic cells. CpG oligonucleotide 2006 was superior to GM-CSF and LPS at inducing maturation marker CD83. A synergistic maturation effect was observed when CpG oligonucleotide 2006 and GM-CSF were used together.
  • [0046]
    All effects of CpG on dendritic cells were CpG-specific as shown by control oligonucleotides with methylated CpG motifs and oligonucleotides containing GpC instead of CpG. Thus, the addition of a CpG oligonucleotide is sufficient for improving survival, differentiation, activation and maturation of human dendritic cells. Since dendritic cells form the link between the innate and the acquired immune system the ability to activate dendritic cells with CpG supports the use of CpG-based strategies for immunotherapy against disorders such as cancer and allergic or infectious diseases.
  • [0047]
    Adjuvants are nonspecific stimulators of the immune response. They are considered to be nonspecific because they only produce an immune response in the presence of an antigen. Adjuvants allow much smaller doses of antigen to be used and are essential to inducing a strong antibody response to soluble antigens (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, N. Y., current edition). It is shown according to the invention that CpG functions as an adjuvant by activating dendritic cells. CpG is a particularly useful adjuvant in humans because of its low toxicity. Many potent adjuvants in mice or other animals, like the Freunds complete adjuvant, cannot be used in humans due to toxicity. Additionally, as demonstrated in the examples below, CpG activates and matures human primary blood dendritic cells where other known adjuvants such as LPS fail to do so. Furthermore, CpG is known to induce a Th1 immune response which is believed to be superior to the immune response induced by alum, the adjuvant currently used in humans.
  • [0048]
    Thus the use of CpG allows the generation of mature dendritic cells from peripheral blood within two days in a well defined system. The application of CpG for this purpose is superior to GM-CSF, which is currently used for this purpose. CpG oligonucleotides have a longer half life, are less expensive, and show a greater magnitude of immune effects. The combination of CpG and GM-CSF shows synergistic activity for the induction of co-stimulatory molecules (CD86, CD40).
  • [0049]
    The invention relates in one aspect to methods and products for activating dendritic cells for in vitro, ex vivo and in vivo purposes. It was demonstrated according to the invention that CpG oligodeoxyribonucleotides are potent activators of dendritic cells. Dendritic cells are believed to be essential for the initiation of primary immune responses in immune cells in vivo. It was discovered, according to the invention, that CpG oligodeoxyribonucleotide was capable of activating dendritic cells to initiate primary immune responses in T cells, similar to an adjuvant. It was also discovered the CpG ODN induces the production of large amounts of IL-12 in dendritic cells, indicating its propensity to augment the development of Th1 immune responses in vivo. The findings that CpG oligonucleotides were sufficient for survival, differentiation, activation, and maturation of human dendritic cells demonstrate the potent adjuvant activity of CpG and provide the basis for the use of CpG oligodeoxyribonucleotides as immunotherapeutics in the treatment of disorders such as cancer, infectious diseases, and allergy. In one aspect, the invention is a method for activating a dendritic cell by contacting the dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide, wherein the nucleic acid is from about 8-80 bases in length.
  • [0050]
    The methods and products of the invention are useful for a variety of purposes. For instance, the invention is particularly useful as an adjuvant for stimulating specific B and T cell responses to immunization. This is accomplished by contacting immature dendritic cells with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide to cause the dendritic cell to become activated and to mature. The activated dendritic cell is then incubated with resting T cells to cause activation of the T cells in order to initiate a primary immune response. In some cases the dendritic cell is also contacted with an antigen. Dendritic cells efficiently internalize process and present the soluble tumor-specific antigen to which it is exposed. The process of internalizing and presenting antigen causes rapid upregulation of the expression of major histocompatibility complex (MHC) and costimulatory molecules, the production of cytokines, and migration toward lymphatic organs where they are believed to be involved in the activation of T cells.
  • [0051]
    One specific use for the CpG nucleic acids of the invention is to activate dendritic cells for the purpose of enhancing a specific immune response against cancer antigens. The immune response may be enhanced using ex vivo or in vivo techniques. An “ex vivo” method as used herein is a method which involves isolation of an immature dendritic cell from a subject, manipulation of the cell outside of the body, and reimplantation of the manipulated cell into a subject. The ex vivo procedure may be used on autologous or heterologous cells, but is preferably used on autologous cells. In preferred embodiments, the immature dendritic cells are isolated from peripheral blood or bone marrow, but may be isolated from any source of dendritic cells. When the ex vivo procedure is performed to specifically produce dendritic cells active against a specific cancer antigen, the dendritic cells may be exposed to the cancer antigen in addition to the CpG. In other cases the dendritic cell may have already been exposed to antigen but may not be expressing the antigen on the surface efficiently. Activation will dramatically increase antigen processing. The activated dendritic cell then presents the cancer antigen on its surface. When returned to the subject, the activated dendritic cell expressing the cancer antigen activates T cells in vivo which are specific for the cancer antigen. Ex vivo manipulation of dendritic cells for the purposes of cancer immunotherapy have been described in several references in the art, including Engleman, E. G., 1997, Cytotechnology, 25:1; Van Schooten, W., et al., 1997, Molecular Medicine Today, June, 255; Steinman, R. M., 1996, Experimental Hematology, 24, 849; and Gluckman, J. C., 1997, Cytokines, Cellular and Molecular Therapy, 3:187. The ex vivo activation of dendritic cells of the invention may be performed by routine ex vivo manipulation steps known in the art, but with the use of CpG as the activator.
  • [0052]
    The dendritic cells may also be contacted with CpG using in vivo methods. In order to accomplish this, CpG is administered directly to a subject in need of immunotherapy. The CpG may be administered in combination with an antigen or may be administered alone. In some embodiments, it is preferred that the CpG be administered in the local region of the tumor.
  • [0053]
    An “antigen” as used herein is a molecule capable of provoking an immune response. Antigens include but are not limited to cells, cell extracts, polysaccharides, polysaccharide conjugates, lipids, glycolipids, carbohydrate, viruses, and viral extracts. A “cancer antigen” as used herein is a peptide associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al., 1994, Cancer Research, 54:1055, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens. Cancer antigens are isolated from a tumor or cancer (e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas).
  • [0054]
    The isolated dendritic cell is contacted with CpG and exposed to an antigen. Although either step may be performed first or the steps may be performed simultaneously, in one preferred embodiment the antigen is exposed to the immature dendritic cell before the cell is contacted with the CpG. It is believed that the antigen is taken up by the dendritic cell and then when the dendritic cell is contacted with the CpG, that the dendritic cell is activated to process and present the antigen. Preferably, the antigen is exposed to the cell within 48 hours of adding CpG. In a more preferred embodiment, the dendritic cell is exposed to the antigen within 24 hours of the CpG.
  • [0055]
    The antigen is exposed to the dendritic cell. As used herein, the term “exposed to” refers to either the active step of contacting the dendritic cell with an antigen in culture under conditions which promote the uptake and processing of the antigen, the passive exposure of antigen to the dendritic cell in vivo prior to isolation of the dendritic cell, or the transfection of the dendritic cell with a gene encoding the antigen, to cause processing and presentation of the antigen through the cytosolic/class I pathway. Methods for the active exposure of dendritic cells to antigen are well-known in the art. In general, purified dendritic cells are pulsed with antigen under culture conditions which promote the uptake and processing of the antigen such that the antigen will be expressed on the cell surface in association with either class I or class II MHC. Methods for transfecting dendritic cells with DNA encoding an antigen are also well-known to those of ordinary skill in the art and require only routine experimentation.
  • [0056]
    The compositions and methods of the invention are also useful for treating infectious diseases. An infectious disease, as used herein, is a disease arising from the presence of a foreign microorganism in the body. CpG is used to stimulate an antigen specific dendritic cell which can activate a T cell response against an antigen of the microorganism. The methods are accomplished in the same way as described above for the tumor except that the antigen is specific for a microorganism using a microbial antigen. A “microbial antigen” as used herein is an antigen from a microorganism and includes but is not limited to infectious virus, infectious bacteria, and infectious fungi.
  • [0057]
    Examples of infectious virus include: Retroviridae (e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae (e.g. equine encephalitis viruses, rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis viruses, yellow fever viruses); Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. reoviruses, orbiviruses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and unclassified viruses (e.g. the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and related viruses, and astroviruses).
  • [0058]
    Examples of infectious bacteria include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, and Actinomyces israelli.
  • [0059]
    Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (i.e., protists) include: Plasmodium falciparum and Toxoplasma gondii.
  • [0060]
    The methods of the invention are also useful for treating allergic diseases. The methods are accomplished in the same way as described above for the tumor immunotherapy and treatment of infectious diseases except that the antigen is specific for an allergen. Currently, allergic diseases are generally treated by the injection of small doses of antigen followed by subsequent increasing dosage of antigen. It is believed that this procedure produces a memory immune response to prevent further allergic reactions. These methods, however, are associated with the risk of side effects such as an allergic response. The methods of the invention avoid these problems.
  • [0061]
    An “allergen” refers to a substance (antigen) that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g. penicillin). Examples of natural, animal and plant allergens include proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum); Dactyl is (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bromus inermis).
  • [0062]
    An “allergy” refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions. A subject having an allergic reaction is a subject that has or is at risk of developing an allergy. “Asthma” refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
  • [0063]
    In addition to the treatment of active disorders, the methods and products of the invention can be used as a prophylactic vaccine. In this case, the CpG nucleic acid sequence is administered in vivo, preferably in the presence of an antigen or dendritic cells are prepared ex vivo and administered.
  • [0064]
    The CpG oligonucleotides of the invention are immunostimulatory molecules. An “immunostimulatory nucleic acid molecule” refers to a nucleic acid molecule, which contains an unmethylated cytosine, guanine dinucleotide sequence (i.e. “CpG DNA” or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates (e.g. has a mitogenic effect on, or induces or increases cytokine expression by) a dendritic cell. An immunostimulatory nucleic acid molecule can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity.
  • [0065]
    A “nucleic acid” or “DNA” means multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). As used herein, the term refers to ribonucleotides as well as oligodeoxyribonucleotides. The term shall also include polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis).
  • [0066]
    In one preferred embodiment the invention provides an isolated immunostimulatory nucleic acid sequence containing a CpG motif represented by the formula:
  • 5′N1X1CGX2N23′
  • [0067]
    wherein at least one nucleotide separates consecutive CpGs; X1 is adenine, guanine, or thymine; X2 is cytosine, adenine, or thymine; N is any nucleotide and N1+N2 is from about 0-25 nucleotides.
  • [0068]
    In another embodiment the invention provides an isolated immunostimulatory nucleic acid sequence containing a CpG motif represented by the formula:
  • 5′NX1X2CGX3X4N3′
  • [0069]
    wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of TpT, CpT, TpC, and ApT; X3X4 is selected from the group consisting of GpT,GpA, ApA and ApT; N is any nucleotide and N1+N2 is from about 0-25 nucleotides. In a preferred embodiment N1and N2 of the nucleic acid do not contain a CCGG quadmer or more than one CCG or CGG trimer.
  • [0070]
    Preferably the immunostimulatory nucleic acid sequences of the invention include X1X2 selected from the group consisting of GpT, GpG, GpA and ApA and X3X4 is selected from the group consisting of TpT, CpT and GpT. For facilitating uptake into cells, CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 30 bases in length. However, nucleic acids of any size (even many kb long) are immunostimulatory if sufficient immunostimulatory motifs are present, since larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5 and/or 3 terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, where the oligonucleotide incorporates a phosphate backbone modification, as discussed in more detail below. For example, the modification is a phosphorothioate or phosphorodithioate modification. More particularly, the phosphate backbone modification occurs at the 5 end of the nucleic acid for example, at the first two nucleotides of the 5 end of the nucleic acid. Further, the phosphate backbone modification may occur at the 3 end of the nucleic acid for example, at the last five nucleotides of the 3 end of the nucleic acid.
  • [0071]
    Preferably the immunostimulatory CpG DNA is in the range of between 8 to 30 bases in size when it is an oligonucleotide. Alternatively, CpG dinucleotides can be produced on a large scale in plasmids, which after being administered to a subject are degraded into oligonucleotides. Preferred immunostimulatory nucleic acid molecules (e.g. for use in increasing the effectiveness of a vaccine or to treat an immune system deficiency by stimulating an antibody (i.e. humoral response in a subject) have a relatively high stimulation index with regard to B cell, dendritic cell and/or natural killer cell responses (e.g. cytokine, proliferative, lytic or other responses).
  • [0072]
    A “nucleic acid delivery complex” shall mean a nucleic acid molecule associated with (e.g. ionically or covalently bound to; or encapsulated within) a targeting means (e.g. a molecule that results in higher affinity binding to target cell (e.g. dendritic cell surfaces and/or increased cellular uptake by target cells). Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g. cholesterol), a lipid (e.g. a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g. a ligand recognized by target cell specific receptor). Preferred complexes must be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell. However, the complex should be cleavable under appropriate conditions within the cell so that the nucleic acid is released in a functional form.
  • [0073]
    “Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as ABCDEE D C B A in which A and A are bases capable of forming the usual Watson-Crick base pairs. In vivo, such sequences may form double-stranded structures.
  • [0074]
    A “stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Unmethylated CpG containing nucleic acid molecules that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter immunostimulatory nucleic acid molecules, secondary structure can stabilize and increase their effect. For example, if the 3 end of a nucleic acid molecule has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the nucleic acid molecule becomes stabilized and therefore exhibits more activity.
  • [0075]
    Preferred stabilized nucleic acid molecules of the instant invention have a modified backbone. It was shown according to the invention that modification of the oligonucleotide backbone provided enhanced activity of the CpG molecules of the invention when administered in vivo. CpG constructs, including at least two phosphorothioate linkages at the 5 end of the oligodeoxyribonucleotide and multiple phosphorothioate linkages at the 3 end, preferably 5, provided maximal activity and protected the oligodeoxyribonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligodeoxyribonucleotides include phosphodiester modified oligodeoxyribonucleotide, combinations of phosphodiester and phosphorothioate oligodeoxyribonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in copending PCT Patent Application U.S. Ser. No. 08/960,774, filed on Oct. 30, 1997, the entire contents of which is hereby incorporated by reference. It is believed that these modified oligodeoxyribonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization.
  • [0076]
    Both phosphorothioate and phosphodiester oligonucleotides containing CpG motifs were active in dendritic cells. However, based on the concentration needed to induce CpG specific effects, the nuclease resistant phosphorothioate backbone CpG oligonucleotides were more potent (2 μg/ml for the phosphorothioate vs. a total of 90 μg/ml for phosphodiester). In the concentration used in this study, phosphorothioate oligonucleotides without CpG motifs showed no background stimulatory activity such as that described earlier for high phosphorothioate oligonucleotide concentrations.
  • [0077]
    Other stabilized nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acid molecules which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • [0078]
    As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of autonomous replication and expression of nucleic acids to which they are linked (e.g. an episome). Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as “expression vectors.” In general, expression vectors of utility in recombinant DNA techniques are often in the form of “plasmids” which refer generally to circular double-stranded DNA loops which, in their vector form, are not bound to the chromosome. In the present specification, “plasmid” and “vector” are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • [0079]
    A “subject” shall mean a human or vertebrate animal including a dog, cat, horse, cow, pig, sheep, goat, chicken, monkey, rat, and mouse.
  • [0080]
    The nucleic acid sequences of the invention which are useful for stimulating dendritic cells are those broadly described above. Exemplary sequences include but are not limited to those sequences shown in Table 1-7 as well as TCCATGTCGCTCCTGATGCT (SEQ ID NO: 42), TCCATGTCGTTCCTGATGCT (SEQ ID NO: 43), TCGTCGTTGTCGTTGTCGTT (SEQ ID NO: 83); TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 84), TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO: 85), GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO: 86), TGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 88), TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 90), TCGTCGTCGTCGTT (SEQ ID NO: 91), TCCTGTCGTTCCTTGTCGTT (SEQ ID NO: 73), TCCTGTCGTTTTTTGTCGTT (SEQ ID NO: 75), TCGTCGCTGTCTGCCCTTCTT (SEQ ID NO: 76), TCGTCGCTGTTGTCGTTTCTT (SEQ ID NO: 77), TCCATGACGTTCCTGACGTT (SEQ ID NO: 97), GTCG(T/C)T and TGTCG(T/C)T.
  • [0081]
    The stimulation index of a particular immunostimulatory CpG DNA can be tested in various immune cell assays. Preferably, the stimulation index of the immunostimulatory CgG DNA with regard to B cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20 as determined by incorporation of 3H uridine in a murine B cell culture, which has been contacted with 20 μM of ODN for 20h at 37° C. and has been pulsed with 1 μCi of 3H uridine; and harvested and counted 4h later as described in detail in copending PCT Patent Application U.S. Ser. No. 08/960,774. For use in vivo, for example to treat an immune system deficiency by stimulating a cell-mediated (local) immune response in a subject, it is important that the immunostimulatory CpG DNA be capable of effectively inducing cytokine secretion by dendritic cells.
  • [0082]
    Preferred immunostimulatory CpG nucleic acids should effect at least about 500 pg/ml of TNF-α, 15 pg/ml IFN-γ, 70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication, as determined by the assays described in the Examples. Other preferred immunostimulatory CpG DNAs should effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30, more preferably at least about 35 and most preferably at least about 40% 2C11 cell specific lysis.
  • [0083]
    It was found that the motifs that stimulate murine cells best differ from those that are more effective with human cells. Certain CpG oligodeoxynucleotides are poor at activating human cells (oligodeoxyribonucleotide 1707, 1708, which contain the palindrome forming sequences GACGTC and CACGTG, respectively).
  • [0084]
    The CpG oligonucleotides are used to induce survival, activation, maturation, and differentiation of dendritic cells. A dendritic cell has its ordinary meaning in the art and includes immature dendritic cells, mature dendritic cells, antigen expressing dendritic cells, non antigen expressing cells, precursor and progenitor dendritic cells. Dendritic cells are known to express different panels of cell surface molecules at different stages of development as described in more detail below. An activated dendritic cell is a dendritic cell which capable of efficiently processing antigen. Activated dendritic cells may or may not have already taken up antigen. A mature dendritic cell as used herein is a dendritic cell which expresses CD83 on the surface.
  • [0085]
    Dendritic cells useful according to the invention may be isolated from any source as long as the cell is capable of being activated by CpG to produce an active antigen expressing dendritic cell. Several in vivo sources of immature dendritic cells may be used according to the methods of the invention. For instance bone marrow dendritic cells and peripheral blood dendritic cells are both excellent sources of immature dendritic cells that are activated by CpG. Other sources may easily be determined by those of skill in the art without requiring undue experimentation, by for instance, isolating a primary source of dendritic cells and testing activation by CpG in vitro (e.g., using assays described in the Examples section). The invention also encompasses the use of any immature dendritic cells maintained in culture as a cell line as long as the cell capable of being activated by CpG. Such cell types may be routinely identified using standard assays known in the art.
  • [0086]
    It was discovered according to the invention, that not all sources of dendritic cells that are known to be activated by cytokines to produce antigen presenting dendritic cells are capable of being activated by CpG. For instance, monocyte-derived dendritic cells are not activated by CpG. Recently, the method of monocyte-derived dendritic cells has attracted major attention because the incubation of purified CD 14-positive monocytes with GM-CSF and IL-4 and subsequent maturation with conditioned medium or TNF provides large numbers of dendritic cells within one week. Romani N, et al. J Immunol Methods 1996; 196: 137-151. Since these cells tend to de-differentiate into macrophages in the absence of IL-4 Hausser G, et al. Immunobiology 1997; 197: 534-542, these dendritic cells may not resemble the physiologic situation. Although these cells are highly responsive to LPS it was discovered that monocyte-derived dendritic cells do not respond to CpG (see Examples). It was also demonstrated that human monocytes, while highly sensitive to LPS, show a minor and delayed response to CpG.
  • [0087]
    Peripheral blood dendritic cells isolated by immunomagnetic cell sorting, which are activated by CpG, represent a more physiologic cell population of dendritic cells than monocyte derived dendritic cells. Immature dendritic cells comprise approximately 1-3% of the cells in the bone marrow and approximately 10-100 fold less in the peripheral blood. Peripheral blood cells can be collected using devices well-known in the art, e.g., Haemonetics model v. 50 apheresis device (Haemonetics, Braintree, Mass.). Red blood cells and neutrophils are removed from the blood by centrifugation. The mononuclear cells located at the interface are isolated. Methods for isolating CD4+dendritic cells from peripheral blood have been described O'Doherty U, et al., J Exp Med 1993; 178: 1067-1076 and are set forth in the Examples. In the presence of GM-CSF these cells differentiate to dendritic cells with characteristic cellular processes within two days. Differentiation is accompanied by an increase in cell size, granularity and MHC II expression, which can be easily followed using flow cytometry. Freshly isolated dendritic cells cultured in the absence of GM-CSF rapidly undergo apoptosis. Strikingly, in the presence of CpG oligonucleotides without addition of GM-CSF, both cell survival and differentiation is markedly improved compared to GM-CSF. In the presence of CpG, dendritic cells form cell clusters which when examined by ultrastructural techniques such as electron microscopy revealed characteristic dense multilamellar intracytoplasmic bodies and multi-vesicular structures, which were not present in dendritic cells incubated with GM-CSF. Scanning electron microscopy showed long veil and sheet-like processes thought to be used for intercellular interactions, and an irregular cell shape. In contrast, cells incubated with GM-CSF were round-shaped and had only minor cellular processes. In addition to promoting survival and differentiation of dendritic cells, a single addition of CpG oligonucleotide led to activation as represented by upregulation of the co-stimulatory molecules ICAM-1 (CD54), B7-2 (CD86) and CD40. The combination of CpG oligonucleotide and GM-CSF enhanced the expression of CD86 and CD40 synergistically, proving that activation is not due to CpG-induced GM-CSF.
  • [0088]
    In addition to activating dendritic cells CpG was capable of causing maturation of the dendritic cells. Maturation is assessed by the appearance of CD83, a specific marker for mature human dendritic cells. The presence of CpG alone for two days was sufficient to cause maturation of a variable percentage of the cells and the combination of GM-CSF and CpG was found to act synergistically to cause maturation of an even greater number of cells.
  • [0089]
    Each of the effects observed by culturing cells in the presence of CpG, improved survival, differentiation, activation and maturation of dendritic cells, were CpG specific since control oligonucleotides with methylated CpGs and oligonucleotides with GpC instead of CpGs were inactive. Additionally, CpG was superior to LPS in inducing both activation and maturation.
  • [0090]
    CD40-mediated activation of dendritic cells plays a key role for the induction of cytotoxic T-cells from naive T-cells. The profound changes observed in CpG-stimulated dendritic cells are similar to those seen after activation by CD40 Lanzavecchia A. Licence to kill. Nature 1998; 393: 413-414. Recently the central role of CD40 ligation for “superactivation” of dendritic cells has been identified. Lanzavecchia A. Licence to kill. Nature 1998; 393: 413-414; Schoenberger SP, et al. Nature 1998; 393: 480-483; Ridge JP, Di Rosa F, Matzinger P. Nature 1998; 393: 474-478. Bennett SR, et al. Nature 1998; 393: 478-480. While TNF and LPS activate dendritic cells by upregulation of co-stimulatory molecules, CD40 ligation on dendritic cells is required for the dendritic cell-dependent induction of cytotoxic T-cells from naive T-cells. CD40 ligand present on the surface of activated T helper cells provides this signal under physiologic circumstances. In addition to the data presented herein the data presented in the parent application indicate that CpG may be substitutes for CD40 ligation on dendritic cells. CD40 and CpG perform a number of parallel actions. First, CpG and CD40 both activate c-Jun NH2-terminal kinase and p38, but do not activate the extracellular receptor kinase in B cells. Second, CD40 and CpG are each sufficient to induce proliferation of B-cells. Finally, both CD40 and CpG activate NK cells in an IL-12 dependent manner.
  • [0091]
    The ability of CpG to activate human dendritic cells differs from that of murine dendritic cells. It has also been discovered that CpG upregulates MHC class II and co-stimulatory molecules on murine Langerhans cells. In another study similar changes were described for murine bone marrow-derived dendritic cells. Sparwasser T, et al. Eur J Immunol 1998; 28: 2045-2054. In both studies the efficacy of CpG to induce co-stimulatory molecules does not exceed the effects seen for LPS, to which monocytic cells are highly sensitive. Murine monocytes/macrophages are known to secrete high amounts of inflammatory cytokines in response to CpG. Since the murine cell preparation may include other myelomonocytic cells in the analysis as well a secondary indirect effect of CpG on Dendritic cells in these cell preparations may have contributed to the described activation of Dendritic cells.
  • [0092]
    It has been shown according to the invention that purified human blood dendritic cells are highly sensitive to CpG, while their response to LPS is barely detectable. The LPS concentration used in this study (10 ng/ml) is 10-fold higher than the concentration found to induce maximal cytokine secretion in human monocytes (1 ng/ml). It is important to note that murine macrophages are approximately 1000-fold less sensitive to LPS than human macrophages. In contrast to human macrophages, the low sensitivity of human blood dendritic cells to LPS and the high sensitivity to CpG is striking.
  • [0093]
    Certain Unmethylated CpG Containing Nucleic Acids were Initially Demonstrated to have B Cell Stimulatory Activity as Shown in Vitro and in Vivo
  • [0094]
    In the course of investigating the lymphocyte stimulatory effects of two antisense oligonucleotides specific for endogenous retroviral sequences, using protocols described in the attached Examples 1 and 2 of Co-pending parent patent application U.S. Ser. No. 08/960,774, it was surprisingly found that two out of twenty-four “controls” (including various scrambled, sense, and mismatch controls for a panel of “antisense” oligodeoxyribonucleotides) also mediated B cell activation and IgM secretion, while the other “controls” had no effect.
  • [0095]
    Two observations suggested that the mechanism of this B cell activation by the “control” oligodeoxyribonucleotides may not involve antisense effects 1) comparison of vertebrate DNA sequences listed in GenBank showed no greater homology than that seen with non-stimulatory oligodeoxyribonucleotide and 2) the two controls showed no hybridization to Northern blots with 10 μg of spleen poly A+RNA. Resynthesis of these oligodeoxyribonucleotide on a different synthesizer or extensive purification by polyacrylamide gel electrophoresis or high pressure liquid chromatography have identical stimulation, eliminating the possibility of impurity. Similar stimulation was seen using B cells from C3H/HeJ mice, eliminating the possibility that lipopolysaccharide (LPS) contamination could account for the results.
  • [0096]
    The fact that two “control” oligodeoxyribonucleotide caused B cell activation similar to that of the two “antisense” oligodeoxyribonucleotide raised the possibility that all four oligodeoxyribonucleotide were stimulating B cells through some non-antisense mechanism involving a sequence motif that was absent in all of the other nonstimulatory control oligodeoxyribonucleotide. In comparing these sequences, it was discovered that all of the four stimulatory oligodeoxyribonucleotide containing CpG dinucleotides that were in a different sequence context from the nonstimulatory control.
  • [0097]
    To determine whether the CpG motif present in the stimulatory oligodeoxyribonucleotide was responsible for the observed stimulation, over 300 oligodeoxyribonucleotide ranging in length from 5 to 42 bases that contained methylated, unmethylated, or no CpG dinucleotides in various sequence contexts were synthesized. These oligodeoxyribonucleotide, including the two original “controls” (ODN 1 and 2) and two originally synthesized as “antisense” (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448 (1989)), were then examined for in vitro effects on spleen cells (representative sequences are listed in Table 1). Several oligodeoxyribonucleotides that contained CpG dinucleotides induced B cell activation and IgM secretion; the magnitude of this stimulation typically could be increased by adding more CpG dinucleotides (Table 1; compare ODN 2 to 2a or 3D to 3 Da and 3 Db). * NB Table 1 is only a sequence listing—comparative data. Stimulation did not appear to result from an antisense mechanism or impurity. Oligodeoxyribonucleotides caused no detectable proliferation of γδ or other T cell populations.
  • [0098]
    Mitogenic oligodeoxyribonucleotide sequences uniformly became nonstimulatory if the CpG dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D to 3 Dc; 3M to 3 Ma; and 4 to 4a) or if the cytosine of the CpG dinucleotide was replaced by 5-methylcytosine (Table 1; ODN 1b, 2b, 3 Dd, and 3 Mb). Partial methylation of CpG motifs caused a partial loss of stimulatory effect (compare 2a to 2c, Table 1). In contrast methylation of other cytosines did not reduce oligodeoxyribonucleotide activity (ODN 1c, 2d, 3 De and 3 Mc). These data confirmed that a CpG motif is the essential element present in oligodeoxyribonucleotide that activate B cells.
  • [0099]
    In the course of these studies, it became clear that the bases flanking the CpG dinucleotide played an important role in determining the murine B cell activation induced by an oligodeoxyribonucleotide. The optimal stimulatory motif was determined to consist of a CpG flanked by two 5 purines (preferably a GpA dinucleotide) and two 3 pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of oligodeoxyribonucleotide to bring the CpG motif closer to this ideal improved stimulation (e.g. Table 1, compare ODN 2 to 2e; 3M to 3 Md) while mutations that disturbed the motif reduced stimulation (e.g. Table 1, compare ODN 3 D to 3 Df; 4 to 4b, 4c and 4d). On the other hand, mutations outside the CpG motif did not reduce stimulation (e.g. Table 1, compare ODN 1 to Id; 3D to 3 Dg; 3M to 3 Me). For activation of human cells, the best flanking bases are slightly different (see Table 3).
  • [0100]
    Of those tested, oligodeoxyribonucleotides shorter than 8 bases were non-stimulatory (e.g. Table 1, ODN 4e). Among the forty-eight 8 base oligodeoxyribonucleotide tested, a highly stimulatory sequence was identified as TCAACGTT (ODN 4) which contains the self complementary “palindrome” AACGTT. In further optimizing this motif, it was found that oligodeoxyribonucleotide containing Gs at both ends showed increased stimulation, particularly if the oligodeoxyribonucleotide were rendered nuclease resistant by phosphorothioate modification of the terminal internucleotide linkages. Oligodeoxyribonucleotide 1585 (5′ GGGGTCAACGTTGAGGGGGG 3′) (SEQ ID NO: 47)), in which the first two and last five internucleotide linkages are phosphorothioate modified caused an average 25.4 fold increase in mouse spleen cell proliferation compared to an average 3.2 fold increase in proliferation induced by oligodeoxyribonucleotide 1638 (5′ AAAATCAACGTTGAAAAAAA 3′; SEQ ID NO: 99), which has the same sequence as ODN 1585 except that the 10 Gs at the two ends are replaced by 10 As. Th effect of the G-rich ends is cis; addition of an oligodeoxyribonucleotide with poly G ends but no CpG motif to cells along with 1638 gave no increased proliferation. For nucleic acid molecules longer than 8 base pairs, non-palindromic motifs containing an unmethylated CpG were found to be more immunostimulatory.
  • [0101]
    Other octamer oligodeoxyribonucleotide containing a 6 base palindrome with a TpC dinucleotide at the 5 end were also active (e.g. Table 1, ODN 4b, 4c). Other dinucleotides at the 5 end gave reduced stimulation (e.g. ODN 4f; all sixteen possible dinucleotides were tested). The presence of a 3 dinucleotide was insufficient to compensate for the lack of a 5 dinucleotide (e.g. Table 1, ODN 4g). Disruption of the palindrome eliminated stimulation in octamer oligodeoxyribonucleotide (e.g. Table 1, ODN 4h), but palindromes were not required in longer oligodeoxyribonucleotide.
  • [0102]
    The kinetics of lymphocyte activation were investigated using mouse spleen cells. When the cells were pulsed at the same time as oligodeoxyribonucleotide addition and harvested just four hours later, there was already a two-fold increase in 3H uridine incorporation. Stimulation peaked at 12-48 hours and then decreased. After 24 hours, no intact oligodeoxyribonucleotide were detected, perhaps accounting for the subsequent fall in stimulation when purified B cells with or without anti-IgM (at a submitogenic dose) were cultured with CpG oligodeoxyribonucleotide, proliferation was found to synergistically increase about 10-fold by the two mitogens in combination after 48 hours. The magnitude of stimulation was concentration dependent and consistently exceeded that of LPS under optimal conditions for both. Oligonucleotides containing a nuclease resistant phosphorothioate backbone were approximately two hundred times more potent than unmodified oligonucleotides.
  • [0103]
    Cell cycle analysis was used to determine the proportion of B cells activated by CpG-oligodeoxyribonucleotide. CpG-oligodeoxyribonucleotide induced cycling in more than 95% of B cells. Splenic B lymphocytes sorted by flow cytometry into CD23-(marginal zone) and CD23+(follicular) subpopulations were equally responsive to oligodeoxyribonucleotide-induced stimulation, as were both resting and activated populations of B cells isolated by fractionation over Percoll gradients. These studies demonstrated that CpG-oligodeoxyribonucleotide induce essentially all B cells to enter the cell cycle.
  • [0104]
    Immunostimulatory Nucleic Acid Molecules Block Murine B Cell Apoptosis
  • [0105]
    Certain B cell lines, such as WEHI-231, are induced to undergo growth arrest and/or apoptosis in response to crosslinking of their antigen receptor by anti-IgM (Jakway, J. P., et al., “Growth regulation of the B lymphoma cell line WEHI-231 by anti-immunoglobulin, lipopolysaccharide and other bacterial products,” J. Immunol. 137:2225 (1986); Tusubata, T., J. Wu and T. Honjo: “B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40, ”Nature, 364:634 (1993)). WEHI-231 cells are rescued from this growth arrest by certain stimuli such as LPS and by the CD40 ligand. oligodeoxyribonucleotide containing the CpG motif were also found to protect WEHI-231 from anti-IgM induced growth arrest, indicating that accessory cell populations are not required for the effect. Subsequent work indicates that CpG oligodeoxyribonucleotide induce Bcl-x and myc expression, which may account for the protection from apoptosis. Also, CpG nucleic acids have been found to block apoptosis in human cells. This inhibition of apoptosis is important, since it should enhance and prolong immune activation by CpG DNA.
  • [0106]
    Method for Making Immunostimulatory Nucleic Acids
  • [0107]
    For use in the instant invention, nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the β-cyanoethyl phosphoramidite method (S. L. Beaucage and M. H. Caruthers, 1981, Tet. Let. 22:1859 ); nucleoside H-phosphonate method (Garegg, et al., 1986, Tet. Let. 27:4051 -4054; Froehler, et al., 1986, Nucl. Acid. Res. 14:5399 -5407; Garegg, et al., 1986, Tet. Let. 27:4055 -4058, Gaffney, et al., 1988), Tet. Let. 29:2619-2622. These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. Alternatively, oligonucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • [0108]
    For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g. via endo- and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made for example as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A., 1990, Chem Rev. 90:544; Goodchild, J., 1990, Bioconjugate Chem. 1:165 ). 2-O-methyl nucleic acids with CpG motifs also cause immune activation, as do ethoxy-modified CpG nucleic acids. In fact, no backbone modifications have been found that completely abolish the CpG effect, although it is greatly reduced by replacing the C with a 5-methyl C.
  • [0109]
    For administration in vivo, nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g. dendritic cell) surfaces and/or increased cellular uptake by target cells to form a “nucleic acid delivery complex.” Nucleic acids can be ionically, or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or crosslinking agents can be used, for example protein A, carbodiimide, and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
  • [0110]
    Therapeutic Uses of Immunostimulatory Nucleic Acid Molecules
  • [0111]
    Based on their immunostimulatory properties, nucleic acid molecules containing at least one unmethylated CpG dinucleotide can be used as described in detail. The nucleic acid molecules may also be used as set forth herein and in co-pending parent patent application U.S. Ser. No. 08/960,774, now issued U.S. Pat. No. 6,239,116B1.
  • [0112]
    Immunostimulatory nucleic acid molecules can also be administered to a subject in conjunction with a vaccine to boost a subject's immune system and thereby effect a better response from the vaccine. Preferably the immunostimulatory nucleic acid molecule is administered slightly before or at the same time as the vaccine. A conventional adjuvant may optionally be administered in conjunction with the vaccine, which is minimally comprised of an antigen, as the conventional adjuvant may further improve the vaccination by enhancing antigen absorption.
  • [0113]
    When the vaccine is a DNA vaccine at least two components determine its efficacy. First, the antigen encoded by the vaccine determines the specificity of the immune response. Second, if the backbone of the plasmid contains CpG motifs, it functions as an adjuvant for the vaccine. Thus, CpG DNA acts as an effective “danger signal” and causes the immune system to respond vigorously to new antigens in the area. This mode of action presumably results primarily from the stimulatory local effects of CpG DNA on dendritic cells and other “professional” antigen presenting cells, as well as from the co-stimulatory effects on B cells.
  • [0114]
    Immunostimulatory oligonucleotides and unmethylated CpG containing vaccines, which directly activate lymphocytes and co-stimulate an antigen-specific response, are fundamentally different from conventional adjuvants (e.g. aluminum precipitates), which are inert when injected alone and are thought to work through absorbing the antigen and thereby presenting it more effectively to immune cells. Further, conventional adjuvants only work for certain antigens, only induce an antibody (humoral) immune response (Th2), and are very poor at inducing cellular immune responses (Th1). For many pathogens, the humoral response contributes little to protection, and can even be detrimental.
  • [0115]
    In addition, an immunostimulatory oligonucleotide can be administered prior to, along with or after administration of a chemotherapy or immunotherapy to increase the responsiveness of the malignant cells to subsequent chemotherapy or immunotherapy or to speed the recovery of the bone marrow through induction of restorative cytokines such as GM-CSF. CpG nucleic acids also increase natural killer cell lytic activity and antibody dependent cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may likewise be beneficial in cancer immunotherapy, alone or in conjunction with other treatments.
  • [0116]
    Another use of the described immunostimulatory nucleic acid molecules is in desensitization therapy for allergies, which are generally caused by IgE antibody generation against harmless allergens. The cytokines that are induced by unmethylated CpG nucleic acids are predominantly of a class called “Th1” which is most marked by a cellular immune response and is associated with IL-12 and IFN-γ. The other major type of immune response is termed as Th2 immune response, which is associated with more of an antibody immune response and with the production of IL-4, IL-5 and IL-10. In general, it appears that allergic diseases are mediated by Th2 type immune responses and autoimmune diseases by Th1 immune response. Based on the ability of the immunostimulatory nucleic acid molecules to shift the immune response in a subject from a Th2 (which is associated with production of IgE antibodies and allergy) to a Th1 response (which is protective against allergic reactions), an effective dose of an immunostimulatory nucleic acid (or a vector containing a nucleic acid) alone or in conjunction with an allergen can be administered to a subject to treat or prevent an allergy.
  • [0117]
    Nucleic acids containing unmethylated CpG motifs may also have significant therapeutic utility in the treatment of asthma. Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotope switching, eosinophil chemotaxis and activation and mast cell growth. Th1 cytokines, especially IFN-γ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines.
  • [0118]
    As described in Co-pending parent patent application U.S. Ser. No. 08/960,774, oligonucleotides containing an unmethylated CpG motif (i.e. TCCATGACGTTCCTGACGTT; SEQ IN NO: 97), but not a control oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO: 98) prevented the development of an inflammatory cellular infiltrate and eosinophilia in a murine model of asthma. Furthermore, the suppression of eosinophilic inflammation was associated with a suppression of Th2 response and induction of a Th1 response.
  • [0119]
    For use in therapy, an effective amount of an appropriate immunostimulatory nucleic acid molecule alone or formulated as a delivery complex can be administered to a subject by any mode allowing the oligonucleotide to be taken up by the appropriate target cells (e.g. dendritic cells). Preferred routes of administration include oral and transdermal (e.g. via a patch). Examples of other routes of administration include injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal, etc.). The injection can be in a bolus or a continuous infusion.
  • [0120]
    A nucleic acid alone or as a nucleic acid delivery complex can be administered in conjunction with a pharmaceutically acceptable carrier. As used herein, the phrase “pharmaceutically acceptable carrier” is intended to include substances that can be coadministered with a nucleic acid or a nucleic acid delivery complex and allows the nucleic acid to perform its indicated function. Examples of such carriers include solutions, solvents, dispersion media, delay agents, emulsions and the like. The use of such media for pharmaceutically active substances are well known in the art. Any other conventional carrier suitable for use with the nucleic acids fall within the scope of the instant invention.
  • [0121]
    The term “effective amount” of a nucleic acid molecule refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a nucleic acid containing at least one unmethylated CpG for treating an immune system deficiency could be that amount necessary to eliminate a tumor, cancer, or bacterial, viral or fungal infection. An effective amount for use as a vaccine adjuvant could be that amount useful for boosting a subject's immune response to a vaccine. An “effective amount” for treating asthma can be that amount useful for redirecting a Th2 type of immune response that is associated with asthma to a Th1 type of response. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular nucleic acid being administered (e.g. the number of unmethylated CpG motifs or their location in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular oligonucleotide without necessitating undue experimentation.
  • [0122]
    The compositions of the invention, including activated dendritic cells, isolated CpG nucleic acid molecules, cytokines, and mixtures thereof are administered in pharmaceutically acceptable compositions. The compositions may be administered by bolus injection, continuous infusion, sustained release from implants, aerosol, or any other suitable technique known in the art.
  • [0123]
    It is also contemplated according to the methods of the invention that any compositions of the invention may also be administered in conjunction with other immune stimulating agents, such as for instance cytokines. Cytokines, include but are not limited to, IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, granulocyte-macrophage colony stimulating factor (GMCSF), granulocyte colony stimulating factor (GCSF), interferon-γ(IFN-γ), tumor necrosis factor (TNF), TGF-β, FLT-3 ligand, and CD40 ligand.
  • [0124]
    As reported herein, in response to unmethylated CpG containing nucleic acid molecules, an increased number of spleen cells secrete IL-6, IL-12, IFN-γ, IFN-α, IFN-β, IL-1, IL-3, IL-10, TNF-α, TNF-β, GM-CSF, RANTES, and probably others. The increased IL-6 expression was found to occur in B cells, CD4+T cells, monocytic cells, as well as dendritic cells.
  • [0125]
    FLT3 ligand is a class of compounds described in EP0627487A2 and WO94/28391. A human FLT3 ligand cDNA was deposited with the American Tissue Type Culture Collection, Rockville, Md., and assigned accession number ATCC 69382. Interleukins have been described extensively in the art, e.g., Mosley, et al., 1989, Cell, 59:335, Idzerda, et al., 1990, J. Exp. Med., 171:861. GM-CSF is commercially available as sargramostine, leukine (Immunex).
  • [0126]
    Systemic administration of CpG alone in some embodiments is useful for immunotherapy against antigens. Alternative agents like GM-CSF have a shorter half life, although their synergistic effects with CpG will likely make this combination useful. On the other hand, some activators of dendritic cells like LPS or inflammatory cytokines (TNF) have dose limiting toxicity, which makes their systemic use for this purpose not practical. The present study provides the functional rationale and methods for the use of CpG for dendritic cell-based immunotherapeutic strategies against cancer and for its use as an adjuvant in humans.
  • [0127]
    Systemically administered CpG oligonucleotides enhances the availability of immature and mature dendritic cells in the blood and in tissues.
  • [0128]
    The invention is also useful for in vitro screening assays. For instance, immature dendritic cells may be used in vitro to identify other CpG specific motifs which are useful for activating or causing maturation of dendritic cells. These motifs may then be used in vivo or ex vivo for activating dendritic cells. Additionally, the same type of assay may be used to identify cytokines or other immunostimulatory molecules which may have synergistic adjuvant effects when combined with isolated CpG nucleic acid sequences of the invention.
  • [0129]
    Another assay useful according to the invention is an assay for identifying compounds which inhibit dendritic cell activation or maturation. The assay would involve the addition of a putative drug to a immature dendritic cell which is activated by CpG. If the putative drug prevents activation, then it may be a compound which is therapeutically capable of inhibiting activation or maturation of the dendritic cell. Such compounds would be useful in methods of gene therapy when it is desirable to specifically inhibit the immune response to prevent an immune response against the therapeutic protein. For instance, when factor VIII is delivered by gene therapy methods, it is desirable to prevent an immune response from developing against the therapeutic factor VIII. It is also useful for preventing immune response to transplanted heterologous tissue.
  • [0130]
    The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference.
  • [0131]
    EXAMPLES
  • Example 1
  • [0132]
    Generation and Characterization of Dendritic Cells
  • [0133]
    Methods
  • [0134]
    Isolation of dendritic cells: Dendritic cells represent a small population of peripheral blood mononuclear cells (0.1 to 0.4%). They express substantial levels of CD4, but lack the T cell molecules CD3, CD8, and T cell receptor, and other lineage markers (CD19, CD14, CD16, CD56) (O'Doherty U, et al., “Dendritic cells freshly isolated from human blood express CD4 and mature into typical immunostimulatory dendritic cells after culture in monocyte-conditioned medium”, J Exp Med, 1993; 178: 1067-1076). Using these characteristics, dendritic cells can be separated by high gradient immunomagnetic cell sorting using the VARIOMACS technique (Miltenyi Biotec Inc., Auburn, Calif.). Peripheral blood mononuclear cells were obtained from buffy coats of healthy blood donors (Elmer L. DeGowin Blood Center, University of Iowa) by Ficoll-Paque density gradient centrifugation (Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G, et al., “Specific suppression of human tumor necrosis factor-alpha synthesis by antisense oligodeoxynucleotides”, Antisense Nucleic Acid Drug Dev, 1996; 6: 291-299). Cells were resuspended in phosphate buffered saline (0.5% bovine serum albumin, 2 mM EDTA, pH 7.4) and incubated with colloidal superparamagnetic microbeads conjugated with CD3, CD14, CD16, CD19 and CD56). Thereafter cells were passed over a depletion column in a strong magnetic field. Cells in the flow through were collected, washed two times, incubated with a microbead-conjugated antibody to CD4, and passed over a positive selection column. CD4-positive cells were eluted from the column by removal of the column from the magnetic device. Eluted cells were passed over a second column to enhance purity of the preparation. By this technique we were able to isolate 6×105 to 2.2×107 dendritic cells from 2×108 to 5×108 peripheral blood mononuclear cells in a purity of 94 to 99% (MHC class II expression, lineage marker negative). Viability was determined by trypan blue exclusion (>95%). In light microscopy, purified cells had the appearance of medium sized lymphocytes.
  • [0135]
    Cell culture Cells were suspended in RPMI 1640 culture medium supplemented with 10% (v/v) heat-inactivated (56° C., 1h) FCS (HyClone, Logan, Utah.), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete medium). All compounds were purchased endotoxin-tested. Freshly prepared dendritic cells (final concentration 4×105 cells/ml) were cultured in 96-well plates in 200 μl complete medium in a 5% CO2 humidified incubator at 37° C. for either 48 hours or 72 hours as indicated. The cell culture medium contained 800 U/ml GMCSF (1.25×104 U/mg; Genzyme, Cambridge, Mass.), 10 ng/ml LPS (from salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or oligonucleotides as indicated.
  • [0136]
    Results
  • [0137]
    Dendritic cells can be obtained in large numbers by incubation of CD14-positive monocytes with GMCSF and IL-4 for 7 days. However, upon withdrawal of IL-4 these cells lose their dendritic cell characteristics and become CD 14 positive macrophages (Hausser G. et al. “Monocyte-derived dendritic cells represent a transient stage of differentiation in the myeloid lineage”, Immunobiology, 1997; 197: 534-542). In addition, IL-4 induces a Th2 immune response which may not be optimal for the induction of a specific cytotoxic T-cell response. Therefore, monocyte-derived dendritic cells, despite their availability in large numbers, may not be optimal for immunotherapeutic purposes. We found that monocyte-derived dendritic cells are sensitive to LPS but surprisingly are not activated by CpG motifs (FIG. 8). It is believed that the inability of monocyte-derived DC to respond to CpG might be due to the unphysiologic methods by which these cells are prepared. Consequently, the effect of CpG oligonucleotides on primary peripheral blood DC was examined.
  • [0138]
    Physiologically, DC are present in small numbers (<0.5%) in peripheral blood mononuclear cells. Blood dendritic cells can be identified by the expression of CD4 and HLA-DR surface antigens and the absence of lineage markers (B cell, T cell, NK cell and monocyte). Immunomagnetic depletion of lineage-positive cells and subsequent positive selection of CD4-positive cells allows the isolation of DC from peripheral blood. In our experiments, we obtained 0.7 to 2.4×106 DC from single buffy coats (2.5 to 5×108 mononuclear cells). The purity of the DC preparation (MHC II bright, lineage marker negative) varied from 93% to 99%. Freshly isolated dendritic cells have the appearance of medium sized lymphocytes. During a two days incubation with GMCSF, the cells gain the specific characteristics of dendritic cells. Morphologically, they enlarge and exhibit sheet like cell processes. They express low levels of the co-stimulatory molecules CD54 (ICAM-1, adhesion molecule), CD80 (B7-1), CD86 (B7-2) and CD40.
  • Example 2
  • [0139]
    CpG Substitutes for GMCSF for DC Survival
  • [0140]
    Methods
  • [0141]
    Oligodeoxynucleotides Unmodified (phosphodiester) and modified nuclease-resistant (phosphorothioate) oligodeoxyribonucleotide were purchased from Operon Technologies (Alameda, Calif.). The optimal motif recognized by human immune cells is different from the optimal mouse motif. Based on other studies in which we tested a large number of oligonucleotides for their ability to activate human B-cells and NK-cells, we selected particularly potent oligonucleotides as examples of a family of active CpG-containing oligonucleotides for the use in the present study. The CpG oligonucleotides used were: 2006 (24-mer), 5′-TCG TCG TTT TGT CGT TTT GTC GTT-3′ (SEQ ID NO: 84), completely phosphorothioate-modified, and 2080 (20-mer), 5′-TCG TCG TTC CCC CCC CCC CC-3′(SEQ ID NO: 94), unmodified phosphodiester. The non-CpG control oligonucleotides used were: 2117 (24-mer), 5′-TQG TQG TTT TGT QGT TTT GTQ GTT-3′(SEQ ID NO: 95), Q=5 methyl cytosine, completely phosphorothioate-modified, and 2078 (20-mer), 5′-TGC TGC TTC CCC CCC CCC CC-3′(SEQ ID NO: 96), un-modified phosphodiester. Oligonucleotides were diluted in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents. Phosphorothioate oligonucleotides (2006 and 2117) were added at a final concentration of either 2 μg/ml or 6 μg/ml as indicated. Based on preliminary experiments in which no effect was seen after a single addition, phosphodiester oligonucleotides were added at 0 hours, 12 hours and 24 hours at 30 μg/ml each (total addition 90 μg/ml).
  • [0142]
    Flow cytometry Flow cytometric data on 2500 viable cells per sample or 4000 total counts were acquired on a FACScan (Beckton Dickinson Immunocytometry systems, San Jose, Calif.). Spectral overlap was corrected by appropriate compensation. Fluorescence detector settings were identical in all experiments. Analysis was performed on viable dendritic cells present within a morphologic gate (FSC, SSC, >94% of cells MHC II positive and lineage marker negative). Data were analyzed using the computer program Flow Jo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).
  • [0143]
    Results
  • [0144]
    The presence of GMCSF is required for the survival of freshly isolated DC from peripheral blood. In the absence of GMCSF, DC undergo apoptosis during the first two days of cell culture. We examined the effect of CpG oligonucleotides on survival of DC in cell culture. Freshly isolated DC were incubated in the presence of GM-CSF or oligonucleotides for 48 hours. Light microscopy showed the formation of cell clusters within one day for both the sample with GMCSF alone and the sample with the CpG phosphorothioate oligonucleotide 2006. While the size of the clusters was not different between these two samples, the DC incubated with 2006 displayed longer processes seen at the surface of the clusters, resembling the morphology of mature dendritic cells. This difference was distinctive between GMCSF and 2006 samples by using light microscopy. Without GMCSF or CpG, no clusters could be found but there was an increasing number of non-viable cells as revealed by trypan blue staining. Viability of DC was quantified by flow cytometry (FIG. 1). Cell survival was dramatically improved in the presence of CpG motifs. This effect was found to be CpG specific for both phosphorothioate (2006, 2117) and phosphodiester (2080, 2078) oligonucleotides, since both non-CpG control oligonucleotides (2117: methylated version of 2006; 2078: CpGs in 2080 inverted to GpCs) showed no improved survival compared to the sample with cells only. While for the nuclease resistant phosphorothioate oligonucleotides a single addition of 2 μg/ml was sufficient, the phosphodiester oligonucleotides were added repeatedly in a higher concentration (30 μg/ml at 0 hours, 12 hours and 24 hours).
  • [0145]
    Quantification of viability (percentage of viable cells of all counted events in flow cytometry) revealed that a single addition of 2006 (2 μg/ml) to freshly prepared DC was superior to GMCSF (800 U/ml) in promoting cell survival (74.3+−5.2% vs. 57.1+−2.3%) (FIG. 2). The combination of GMCSF and 2006 further increased the number of viable cells (81.0+−6.7%). In the presence of the control oligonucleotide 2117 (2 μg/ml) cell survival was low and comparable to the sample with cells only (10.8+−5.2% and 7.4+−4.2%). These results show that CpG can substitute for GMCSF for promoting DC survival, and that the combination of both is favorable over each of them alone.
  • Example 3
  • [0146]
    Increased Size and Granularity of DC Induced by CpG is Associated with Enhanced Expression of MHC II
  • [0147]
    Methods
  • [0148]
    Surface antigen staining At the indicated time points, cells were harvested and surface antigen staining was performed as previously described. Monoclonal antibodies to HLA-DR (Immu-357), CD80 (MAB104) and to CD83 (HB15A) were purchased from Immunotech, Marseille, France. All other antibodies were purchased from Pharmingen, San Diego, Calif.: mABs to CD1a (HI149), CD3 (UCHT1), CD14 (M5E2), CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). FITC-labeled IgG1, κ(MOPC-21) and PE-labeled IgG2b, κ(27-35) were used to control for specific staining.
  • [0149]
    Results
  • [0150]
    Flow cytometric analysis suggested that differentiation of DC is enhanced by CpG and is associated with an increase of cell size (FSC) and granularity (SSC) (FIG. 1). The surface expression of MHC II is known to be positively correlated with differentiation of DC. DC isolated from peripheral blood were cultured in the presence of GMCSF and oligonucleotides for 48 hours, stained for HLA-DR (MHC II) and examined by flow cytometry (2500 viable cells counted) (FIG. 3). In the sample with cells only or the non-CpG oligonucleotide (2078), a large immature population with low granularity (SSC) and lower MHC II expression was found (FIG. 3 region A). A small population showed high SSC and high expression of MHC II representing differentiated DC (FIG. 3, region B). The addition of either GMCSF or the CpG oligonucleotide 2080 enhanced both granularity and MHC II expression on a per cell basis (FIG. 3 left two panels). The CpG oligonucleotide 2080 showed a superior effect compared to GMCSF indicating that CpG promotes differentiation of DC in addition to an enhancement of cell survival.
  • Example 4
  • [0151]
    CpG Increases Co-Stimulatory Molecules on DC
  • [0152]
    Methods
  • [0153]
    Detection of endotoxin The activity of LPS is standardized by the FDA using the limulus amebocyte lysate (LAL) assay (EU/ml). The lower detection limit of the LAL-assay in our hands was 0.03 EU/ml (LAL-assay BioWhittaker, Walkersville, Md.). The LPS sample used in our studies (from salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.) had an activity of 4.35 ng/EU. No endotoxin could be detected in the oligonucleotides (<0.075 EU/mg).
  • [0154]
    Results
  • [0155]
    Differentiation of DC by the criteria of morphology and MHC II expression is not sufficient for the induction of a specific immune response by DC. Functional activation of DC requires by the expression of co-stimulatory molecules. We examined the effect of CpG on the expression of the intercellular adhesion molecule-1 (ICAM-1, CD54), and the co-stimulatory surface molecules B7-2 (CD86) and CD40. First, we were interested if an enhanced expression of MHC II on DC (differentiation) was correlated to activation reflected by CD54 expression. No positive correlation could be found confirming that differentiation is not necessarily associated with activation of DC (FIG. 4). The expression of the co-stimulatory molecules CD54 (FIG. 5, panel A), CD86 (FIG. 5, panel B) and CD40 (FIG. 5, panel C) was quantified in flow cytometry by the mean fluorescence intensity (MFI) of viable DC. In all experiments, CpG was superior to GM-CSF in enhancing expression of co-stimulatory molecules. Compared to the cells only sample, the CpG oligonucleotide 2006 enhanced the expression of CD54 (25.0+−5.7 vs. 7.0+−1.8; p=0.02, n=5), CD 86 (3.9+−0.8 vs. 1.6+−0.3; p=0.01; n=5) and CD40 (3.5+−1.0 vs. 0.9+−0.1; p=0.04, n=4). The combination of GMCSF and 2006 showed an additive effect for CD54 (38.5+−7.9; p=0.03; n=5), and enhanced the expression of CD86 and CD40 synergistically (CD86: 7.0+−1.6; p=0.01; n=5; CD40: 8.5+−1.0; p<0.01; n=4).
  • [0156]
    Specificity was tested using 2117 (methylated version of 2006) and 2078 (GpC version of 2080). As shown in FIG. 6 for CD40, the non-CpG oligonucleotide 2117 showed no synergistic enhancement of CD40 expression when combined with GM-CSF (FIG. 6 panel A). The non-CpG oligonucleotide 2078 alone did not induce CD40 compared to cells only (FIG. 6 B). Induction of CD86 (FIG. 7 panel A) and CD54 (FIG. 7 panel B) was also found to be CpG specific.
  • [0157]
    Interestingly, LPS (10 ng/ml) showed no or only slight activation of DC isolated from peripheral blood (FIG. 6 and FIG. 7). This is surprising, since a ten-fold less concentration of LPS (1 ng/ml) stimulates human CD 14-positive monocytes to express CD54 and CD86, and to produce the proinflammatory cytokines TNF and IL-6. TNF synthesis of monocytes can be found for LPS concentrations as low as 10 pg/ml, and 1 ng/ml already induces the maximal response in terms of cytokine production. Monocyte-derived DC are highly sensitive to LPS but do not respond to CpG suggesting major functional differences between monocyte-derived DC and DC isolated from peripheral blood (FIG. 8).
  • Example 5
  • [0158]
    CpG Induces Maturation (CD83 Expression) of DC
  • [0159]
    Results
  • [0160]
    Mature human DC express the specific DC marker CD83, while immature DC do not. Mature DC effectively present antigen and maintain their stimulatory capacity while migrating from peripheral tissues to lymph nodes. Maturation of DC is thought to be essential if these cells are intended to be used for therapeutic strategies where they would be activated ex vivo, pulsed with antigens, and then reinfused into a patient. We looked at simultaneous expression of CD83 and the co-stimulatory molecule CD86 on viable DC (FIG. 9). Freshly isolated DC were incubated for 3 days with GMCSF, LPS or oligonucleotides. In the absence of either GMCSF or CpG, or with the methylated control oligonucleotide 2117 (2 μg/ml), survival of cells was poor. The remaining viable cells did not express CD83 (<2%) or CD86 (FIG. 9, right dot plot, middle row). Cells incubated with GMCSF showed low expression of CD86, and only 4.1% of the cells expressed CD83 (FIG. 9, left dot plot, lower row). If LPS (10 ng/ml) is present in addition to GMCSF, the percentage of CD83 positive cells is increased to 8.6% (FIG. 9, right dot plot, lower row). In contrast, the single addition of 2006 (2 μg/ml) renders 16 % of the DC CD83 positive (FIG. 9, left dot plot, middle row). The combination of GM-CSF and 2006 even enhances CD83 expression synergistically (37%) (FIG. 9, left dot plot, upper row). This induction of CD83 expression was CpG specific as shown by the control oligonucleotide 2117 in combination with GM-CSF (9.7%) (FIG. 9, right dot plot, upper row). Independently of the percentage of CD83 positive cells, cells positive for CD83 also expressed higher levels of CD86. The results of FIG. 9 are representative of four independent experiments.
  • Example 6
  • [0161]
    Ultrastructural Changes of DC in Response to CpG
  • [0162]
    Results
  • [0163]
    We examined DC by electron microscopy to detect ultrastructural differences due to CpG. In scanning electron microscopy (FIG. 10), DC cultivated with either GM-CSF and CpG (FIG. 10A) or with CpG alone (FIG. 10B) displayed a more irregular shape, longer veil processes and sheet-like projections, and more intercellular contacts than cells cultivated with GM-CSF alone (FIG. 10C) or in combination with the non-CpG control oligonucleotide (FIG. 10D). Transmission electron microscopic imaging revealed striking differences between DC generated with GMCSF combined with CpG (FIG. 11A) and GMCSF alone (FIG. 11B). DC generated in the presence of CpG showed multilamellar intracytoplasmic bodies of high density (FIG. 11A, FIG. 12, indicated by >), which are absent without CpG (FIG. 11B). In addition, CpG-generated DC showed prominent multivesicular bodies (FIG. 11A, FIG. 12, indicated by >>), and a less heterochromatin in the nucleus. The functional significance of these ultrastructural differences is unclear.
  • [0164]
    Statistical analysis
  • [0165]
    Data were expressed as means +/−SEM. Statistical significance of differences was determined by the unpaired two-tailed Student's t-test. Differences were considered statistically significant for p<0.05. Statistical analyses were performed by using StatView 4.51 software (Abacus Concepts Inc., Calabasas, Calif.).
    TABLE 1
    ODN Sequence (5′ to 3′)
    1 (SEQ ID NO:1) GCTAGACGTTAGCGT
    1a (SEQ ID NO:2) ......T........
    1b (SEQ ID NO:3) ......Z........
    1c (SEQ ID NO:4) ............Z..
    1d (SEQ ID NO:5) ..AT......GAGC.
    2 (SEQ ID NO:6) ATGGAAGGTCCAGCGTTCTC
    2a (SEQ ID NO:7) ..C..CTC..G.........
    2b (SEQ ID NO:8) ..Z..CTC.ZG..Z......
    2c (SEQ ID NO:9) ..Z..CTC..G.........
    2d (SEQ ID NO:10) ..C..CTC..G......Z..
    2e (SEQ ID NO:11) ............A.......
    3D (SEQ ID NO:12) GAGAACGCTGGACCTTCCAT
    3Da (SEQ ID NO:13) .........C..........
    3Db SEQ ID NO:14) .........C.......G..
    3Dc (SEQ ID NO:15) ...C.A..............
    3Dd (SEQ ID NO:16) .....Z..............
    3De (SEQ ID NO:17) .............Z......
    3Df (SEQ ID NO:18) .......A............
    3Dg (SEQ ID NO:19) .........CC.G.ACTG..
    3M (SEQ ID NO:20) TCCATGTCGGTCCTGATGCT
    3Ma (SEQ ID NO:21) ......CT............
    3Mb (SEQ ID NO:22) .......Z............
    3Mc (SEQ ID NO:23) ...........Z........
    3Md (SEQ ID NO:24) ......A..T..........
    3Me (SEQ ID NO:25) ...............C..A.
    4 (SEQ ID NO:26) TCAACGTT
    4a (SEQ ID NO:27) ....GC..
    4b (SEQ ID NO:28) ...GCGC.
    4c (SEQ ID NO:29) ...TCGA.
    4d (SEQ ID NO:30) ..TT..AA
    4e (SEQ ID NO:31) -.......
    4f (SEQ ID NO:32) C.......
    4g (SEQ ID NO:33) --......CT
    4h (SEQ ID NO:34) .......C
  • [0166]
    [0166]
    TABLE 2
    5a SEQ ID NO:35 ATGGACTCTCCAGCGTTCTC
    5b SEQ ID NO:11 .....AGG....A.......
    5c SEQ ID NO:7 ..C.......G.........
    5d SEQ ID NO:36 ....AGG..C..T....... ≦10
    5e SEQ ID NO:37 ..C.......G..Z......
    5f SEQ ID NO:8 ..Z......ZG..Z...... ≦10
    5g SEQ ID NO:10 ..C.......G......Z..
    5′GCATGACGTTGAGCT3′ (SEQ ID NO:5)
    5′GCTAGATGTTAGCGT3′ (SEQ ID NO:2)
  • [0167]
    [0167]
    TABLE 3
    512 SEQ ID NO:20 TCCATGTCGGTCCTGATGCT
    1637 SEQ ID NO:38 ......C.............
    1615 SEQ ID NO:39 ......G.............
    1614 SEQ ID NO:40 ......A.............
    1636 SEQ ID NO:41 .........A..........
    1634 SEQ ID NO:42 .........C..........
    1619 SEQ ID NO:43 .........T..........
    1618 SEQ ID NO:24 ......A..T..........
    1639 SEQ ID NO:44 .....AA..T..........
    1707 SEQ ID NO:45 ......A..TC.........
    1708 SEQ ID NO:46 .....CA..TG.........
  • [0168]
    [0168]
    TABLE 4
    1585 ggGGTCAACGTTGAGggggg (SEQ ID NO:47)
    1629 --------------gtc------------- (SEQ ID NO:48)
    1613 GCTAGACGTTAGTGT (SEQ ID NO:49)
    1769 -------------Z------------ (SEQ ID NO:50)
    1619 TCCATGTCGTTCCTGATGCT (SEQ ID NO:43)
    1765 --------------Z------------------- (SEQ ID NO:51)
  • [0169]
    [0169]
    TABLE 5
    ODN Sequence (5′-3′) SEQ ID NO:
    1754 ACCATGGACGATCTGTTTCCCCTC 52
    1758 TCTCCCAGCGTGCGCCAT 53
    1761 TACCGCGTGCGACCCTCT 54
    1776 ACCATGGACGAACTGTTTCCCCTC 55
    1777 ACCATGGACGAGCTGTTTCCCCTC 56
    1778 ACCATGGACGACCTGTTTCCCCTC 57
    1779 ACCATGGACGTACTGTTTCCCCTC 58
    1780 ACCATGGACGGTCTGTTTCCCCTC 59
    1781 ACCATGGACGTTCTGTTTCCCCTC 60
    1823 GCATGACGTTGAGCT 5
    1824 CACGTTGAGGGGCAT 61
    1825 CTGCTGAGACTGGAG 62
    1828 TCAGCGTGCGCC 63
    1829 ATGACGTTCCTGACGTT 64
    18302 RANDOM SEQUENCE -
    1834 TCTCCCAGCGGGCGCAT 65
    1836 TCTCCCAGCGCGCGCCAT 66
    1840 TCCATGTCGTTCCTGTCGTT 67
    1841 TCCATAGCGTTCCTAGCGTT 68
    1842 TCGTCGCTGTCTCCGCTTCTT 69
    1851 TCCTGACGTTCCTGACGTT 70
  • [0170]
    [0170]
    TABLE 6
    ODN1 Sequence (5′-3′) SEQ ID NO:
    1840 TCCATGTCGTTCCTGTCGTT 67
    1960 TCCTGTCGTTCCTGTCGTT 71
    1961 TCCATGTCGTTTTTGTCGTT 72
    1962 TCCTGTCGTTCCTTGTCGTT 73
    1963 TCCTTGTCGTTCCTGTCGTT 74
    1965 TCCTGTCGTTTTTTGTCGTT 75
    1966 TCGTCGCTGTCTCCGCTTCTT 69
    1967 TCGTCGCTGTCTGCCCTTCTT 76
    1968 TCGTCGCTGTTGTCGTTTCTT 77
     19792 TCCATGTZGTTCCTGTZGTT 78
    1982 TCCAGGACTTCTCTCAGGTT 79
    1990 TCCATGCGTGCGTGCGTTTT 80
    1991 TCCATGCGTTGCGTTGCGTT 81
    2002 TCCACGACGTTTTCGACGTT 82
    2005 TCGTCGTTGTCGTTGTCGTT 83
    2006 TCGTCGTTTTGTCGTTTTGTCGTT 84
    2007 TCGTCGTTGTCGTTTTGTCGTT 85
    2008 GCGTGCGTTGTCGTTGTCGTT 86
    2010 GCGGCGGGCGGCGCGCGCCC 87
    2012 TGTCGTTTGTCGTTTGTCGTT 88
    2013 TGTCGTTGTCGTTGTCGTTGTCGTT 89
    2014 TGTCGTTGTCGTTGTCGTT 90
    2015 TCGTCGTCGTCGTT 91
    2016 TGTCGTTGTCGTT 92
    1841 TCCATAGCGTTCCTAGCGTT 68
  • [0171]
    [0171]
    TABLE 7
    ODN1 Sequence (5′-3′) SEQ ID NO:
    1962 TCCTGTCGTTCCTTGTCGTT 73
    1965 TCCTGTCGTTTTTTGTCGTT 75
    1967 TCGTCGCTGTCTGCCCTTCTT 76
    1968 TCGTCGCTGTTGTCGTTTCTT 77
    2005 TCGTCGTTGTCGTTGTCGTT 83
    2006 TCGTCGTTTTGTCGTTTTGTCGTT 84
    2014 TGTCGTTGTCGTTGTCGTT 90
    2015 TCGTCGTCGTCGTT 91
    2016 TGTCGTTGTCGTT 92
    1668 TCCATGACGTTCCTGATGCT 24
    1758 TCTCCCAGCGTGCGCCAT 53
  • [0172]
    The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
  • [0173]
    All references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference.
  • 1 99 1 15 DNA Artificial Sequence Synthetic Oligonucleotide 1 gctagacgtt agcgt 15 2 15 DNA Artificial Sequence Synthetic Oligonucleotide 2 gctagatgtt agcgt 15 3 15 DNA Artificial Sequence Synthetic Oligonucleotide 3 gctagangtt agcgt 15 4 15 DNA Artificial Sequence Synthetic Oligonucleotide 4 gctagacgtt agngt 15 5 15 DNA Artificial Sequence Synthetic Oligonucleotide 5 gcatgacgtt gagct 15 6 20 DNA Artificial Sequence Synthetic Oligonucleotide 6 atggaaggtc cagcgttctc 20 7 20 DNA Artificial Sequence Synthetic Oligonucleotide 7 atcgactctc gagcgttctc 20 8 20 DNA Artificial Sequence Synthetic Oligonucleotide 8 atngactctn gagngttctc 20 9 20 DNA Artificial Sequence Synthetic Oligonucleotide 9 atngactctc gagcgttctc 20 10 20 DNA Artificial Sequence Synthetic Oligonucleotide 10 atcgactctc gagcgttntc 20 11 20 DNA Artificial Sequence Synthetic Oligonucleotide 11 atggaaggtc caacgttctc 20 12 20 DNA Artificial Sequence Synthetic Oligonucleotide 12 gagaacgctg gaccttccat 20 13 20 DNA Artificial Sequence Synthetic Oligonucleotide 13 gagaacgctc gaccttccat 20 14 20 DNA Artificial Sequence Synthetic Oligonucleotide 14 gagaacgctc gaccttcgat 20 15 20 DNA Artificial Sequence Synthetic Oligonucleotide 15 gagcaagctg gaccttccat 20 16 20 DNA Artificial Sequence Synthetic Oligonucleotide 16 gagaangctg gaccttccat 20 17 20 DNA Artificial Sequence Synthetic Oligonucleotide 17 gagaacgctg gacnttccat 20 18 20 DNA Artificial Sequence Synthetic Oligonucleotide 18 gagaacgatg gaccttccat 20 19 20 DNA Artificial Sequence Synthetic Oligonucleotide 19 gagaacgctc cagcactgat 20 20 20 DNA Artificial Sequence Synthetic Oligonucleotide 20 tccatgtcgg tcctgatgct 20 21 20 DNA Artificial Sequence Synthetic Oligonucleotide 21 tccatgctgg tcctgatgct 20 22 20 DNA Artificial Sequence Synthetic Oligonucleotide 22 tccatgtngg tcctgatgct 20 23 20 DNA Artificial Sequence Synthetic Oligonucleotide 23 tccatgtcgg tnctgatgct 20 24 20 DNA Artificial Sequence Synthetic Oligonucleotide 24 tccatgacgt tcctgatgct 20 25 20 DNA Artificial Sequence Synthetic Oligonucleotide 25 tccatgtcgg tcctgctgat 20 26 8 DNA Artificial Sequence Synthetic Oligonucleotide 26 tcaacgtt 8 27 8 DNA Artificial Sequence Synthetic Oligonucleotide 27 tcaagctt 8 28 8 DNA Artificial Sequence Synthetic Oligonucleotide 28 tcagcgct 8 29 8 DNA Artificial Sequence Synthetic Oligonucleotide 29 tcatcgat 8 30 8 DNA Artificial Sequence Synthetic Oligonucleotide 30 tcttcgaa 8 31 7 DNA Artificial Sequence Synthetic Oligonucleotide 31 caacgtt 7 32 8 DNA Artificial Sequence Synthetic Oligonucleotide 32 ccaacgtt 8 33 8 DNA Artificial Sequence Synthetic Oligonucleotide 33 aacgttct 8 34 8 DNA Artificial Sequence Synthetic Oligonucleotide 34 tcaacgtc 8 35 20 DNA Artificial Sequence Synthetic Oligonucleotide 35 atggactctc cagcgttctc 20 36 20 DNA Artificial Sequence Synthetic Oligonucleotide 36 atggaggctc catcgttctc 20 37 20 DNA Artificial Sequence Synthetic Oligonucleotide 37 atcgactctc gagngttctc 20 38 20 DNA Artificial Sequence Synthetic Oligonucleotide 38 tccatgccgg tcctgatgct 20 39 20 DNA Artificial Sequence Synthetic Oligonucleotide 39 tccatggcgg tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic Oligonucleotide 40 tccatgacgg tcctgatgct 20 41 20 DNA Artificial Sequence Synthetic Oligonucleotide 41 tccatgtcga tcctgatgct 20 42 20 DNA Artificial Sequence Synthetic Oligonucleotide 42 tccatgtcgc tcctgatgct 20 43 20 DNA Artificial Sequence Synthetic Oligonucleotide 43 tccatgtcgt tcctgatgct 20 44 20 DNA Artificial Sequence Synthetic Oligonucleotide 44 tccataacgt tcctgatgct 20 45 20 DNA Artificial Sequence Synthetic Oligonucleotide 45 tccatgacgt ccctgatgct 20 46 20 DNA Artificial Sequence Synthetic Oligonucleotide 46 tccatcacgt gcctgatgct 20 47 20 DNA Artificial Sequence Synthetic Oligonucleotide 47 ggggtcaacg ttgagggggg 20 48 20 DNA Artificial Sequence Synthetic Oligonucleotide 48 ggggtcagtc ttgagggggg 20 49 15 DNA Artificial Sequence Synthetic Oligonucleotide 49 gctagacgtt agtgt 15 50 15 DNA Artificial Sequence Synthetic Oligonucleotide 50 gctagangtt agtgt 15 51 20 DNA Artificial Sequence Synthetic Oligonucleotide 51 tccatgtngt tcctgatgct 20 52 24 DNA Artificial Sequence Synthetic Oligonucleotide 52 accatggacg atctgtttcc cctc 24 53 18 DNA Artificial Sequence Synthetic Oligonucleotide 53 tctcccagcg tgcgccat 18 54 18 DNA Artificial Sequence Synthetic Oligonucleotide 54 taccgcgtgc gaccctct 18 55 24 DNA Artificial Sequence Synthetic Oligonucleotide 55 accatggacg aactgtttcc cctc 24 56 24 DNA Artificial Sequence Synthetic Oligonucleotide 56 accatggacg agctgtttcc cctc 24 57 24 DNA Artificial Sequence Synthetic Oligonucleotide 57 accatggacg acctgtttcc cctc 24 58 24 DNA Artificial Sequence Synthetic Oligonucleotide 58 accatggacg tactgtttcc cctc 24 59 24 DNA Artificial Sequence Synthetic Oligonucleotide 59 accatggacg gtctgtttcc cctc 24 60 24 DNA Artificial Sequence Synthetic Oligonucleotide 60 accatggacg ttctgtttcc cctc 24 61 15 DNA Artificial Sequence Synthetic Oligonucleotide 61 cacgttgagg ggcat 15 62 15 DNA Artificial Sequence Synthetic Oligonucleotide 62 ctgctgagac tggag 15 63 12 DNA Artificial Sequence Synthetic Oligonucleotide 63 tcagcgtgcg cc 12 64 17 DNA Artificial Sequence Synthetic Oligonucleotide 64 atgacgttcc tgacgtt 17 65 17 DNA Artificial Sequence Synthetic Oligonucleotide 65 tctcccagcg ggcgcat 17 66 18 DNA Artificial Sequence Synthetic Oligonucleotide 66 tctcccagcg cgcgccat 18 67 20 DNA Artificial Sequence Synthetic Oligonucleotide 67 tccatgtcgt tcctgtcgtt 20 68 20 DNA Artificial Sequence Synthetic Oligonucleotide 68 tccatagcgt tcctagcgtt 20 69 21 DNA Artificial Sequence Synthetic Oligonucleotide 69 tcgtcgctgt ctccgcttct t 21 70 19 DNA Artificial Sequence Synthetic Oligonucleotide 70 tcctgacgtt cctgacgtt 19 71 19 DNA Artificial Sequence Synthetic Oligonucleotide 71 tcctgtcgtt cctgtcgtt 19 72 20 DNA Artificial Sequence Synthetic Oligonucleotide 72 tccatgtcgt ttttgtcgtt 20 73 20 DNA Artificial Sequence Synthetic Oligonucleotide 73 tcctgtcgtt ccttgtcgtt 20 74 20 DNA Artificial Sequence Synthetic Oligonucleotide 74 tccttgtcgt tcctgtcgtt 20 75 20 DNA Artificial Sequence Synthetic Oligonucleotide 75 tcctgtcgtt ttttgtcgtt 20 76 21 DNA Artificial Sequence Synthetic Oligonucleotide 76 tcgtcgctgt ctgcccttct t 21 77 21 DNA Artificial Sequence Synthetic Oligonucleotide 77 tcgtcgctgt tgtcgtttct t 21 78 20 DNA Artificial Sequence Synthetic Oligonucleotide 78 tccatgtngt tcctgtngtt 20 79 20 DNA Artificial Sequence Synthetic Oligonucleotide 79 tccaggactt ctctcaggtt 20 80 20 DNA Artificial Sequence Synthetic Oligonucleotide 80 tccatgcgtg cgtgcgtttt 20 81 20 DNA Artificial Sequence Synthetic Oligonucleotide 81 tccatgcgtt gcgttgcgtt 20 82 20 DNA Artificial Sequence Synthetic Oligonucleotide 82 tccacgacgt tttcgacgtt 20 83 20 DNA Artificial Sequence Synthetic Oligonucleotide 83 tcgtcgttgt cgttgtcgtt 20 84 24 DNA Artificial Sequence Synthetic Oligonucleotide 84 tcgtcgtttt gtcgttttgt cgtt 24 85 22 DNA Artificial Sequence Synthetic Oligonucleotide 85 tcgtcgttgt cgttttgtcg tt 22 86 21 DNA Artificial Sequence Synthetic Oligonucleotide 86 gcgtgcgttg tcgttgtcgt t 21 87 20 DNA Artificial Sequence Synthetic Oligonucleotide 87 gcggcgggcg gcgcgcgccc 20 88 21 DNA Artificial Sequence Synthetic Oligonucleotide 88 tgtcgtttgt cgtttgtcgt t 21 89 25 DNA Artificial Sequence Synthetic Oligonucleotide 89 tgtcgttgtc gttgtcgttg tcgtt 25 90 19 DNA Artificial Sequence Synthetic Oligonucleotide 90 tgtcgttgtc gttgtcgtt 19 91 14 DNA Artificial Sequence Synthetic Oligonucleotide 91 tcgtcgtcgt cgtt 14 92 13 DNA Artificial Sequence Synthetic Oligonucleotide 92 tgtcgttgtc gtt 13 93 24 DNA Artificial Sequence Synthetic Oligonucleotide 93 ctggtctttc tggttttttt ctgg 24 94 20 DNA Artificial Sequence Synthetic Oligonucleotide 94 tcgtcgttcc cccccccccc 20 95 24 DNA Artificial Sequence Synthetic Oligonucleotide 95 tngtngtttt gtngttttgt ngtt 24 96 20 DNA Artificial Sequence Synthetic Oligonucleotide 96 tgctgcttcc cccccccccc 20 97 20 DNA Artificial Sequence Synthetic Oligonucleotide 97 tccatgacgt tcctgacgtt 20 98 20 DNA Artificial Sequence Synthetic Oligonucleotide 98 tccatgagct tcctgagtct 20 99 20 DNA Artificial Sequence Synthetic Oligonucleotide 99 aaaatcaacg ttgaaaaaaa 20

Claims (39)

    We claim:
  1. 1. A method for activating a dendritic cell, comprising:
    contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to activate a dendritic cell.
  2. 2. The method of claim 1, wherein the dendritic cell is an isolated dendritic cell.
  3. 3. The method of claim 1, wherein the at least one unmethylated CpG dinucleotide has a formula:
    5′N1X1CGX2N23′
    wherein at least one nucleotide separates consecutive CpGs; X1 is adenine, guanine, or thymine; X2 is cytosine, adenine, or thymine; N is any nucleotide and N1+N2 is from about 0-25 nucleotides.
  4. 4. The method of claim 2, wherein the method is performed ex vivo.
  5. 5. The method of claim 1, wherein the method is performed in vivo.
  6. 6. The method of claim 5, wherein the isolated nucleic acid is administered to a human subject.
  7. 7. The method of claim 1, further comprising contacting the dendritic cell with a cytokine selected from the group consisting of GM-CSF, IL-4, TNFαINF-γIL-6, Flt3 ligand, and IL-3.
  8. 8. The method of claim 4, further comprising contacting the dendritic cell with an antigen prior to the isolated nucleic acid.
  9. 9. The method of claim 1, wherein at least one nucleotide of the isolated nucleic acid has a phosphate backbone modification.
  10. 10. The method of claim 9, wherein the phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.
  11. 11. The method of claim 10, wherein the phosphate backbone modification occurs at the 5′ end of the nucleic acid.
  12. 12. The method of claim 11, wherein the phosphate backbone modification occurs at the first two internucleotide linkages of the 5′ end of the nucleic acid.
  13. 13. The method of claim 10, wherein the phosphate backbone modification occurs at the 3′ end of the nucleic acid.
  14. 14. The method of claim 13, wherein the phosphate backbone modification occurs at the last five internucleotide linkages of the 3′ end of the nucleic acid.
  15. 15. The method of claim 1, wherein the at least one unmethylated CpG dinucleotide has a formula:
    5′NX1X2CGX3X4N3′
    wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of TpT, CpT, TpC, and ApT; X3X4 is selected from the group consisting of GpT,GpA, ApA and ApT; N is any nucleotide and N1+N2 is from about 0-25 nucleotides.
  16. 16. The method of claim 1, wherein the isolated nucleic acid is selected from the group consisting of SEQ ID Nos. 97 and 98.
  17. 17. A method for cancer immunotherapy, comprising:
    administering an activated dendritic cell that expresses a specific cancer antigen to a subject having a cancer including the cancer antigen, wherein the activated dendritic cell is prepared by the method of claim 1.
  18. 18. A method for treating an infectious disease, comprising:
    administering an activated dendritic cell that expresses a specific microbial antigen to a subject having an infection with a microorganism including the microbial antigen, wherein the activated dendritic cell is prepared by the method of claim 1.
  19. 19. A method for treating an allergy, comprising:
    administering an activated dendritic cell that expresses a specific allergy causing antigen to a subject having an allergic reaction to the allergy causing antigen, wherein the activated dendritic cell is prepared by the method of claim 1.
  20. 20. An isolated antigen-expressing dendritic cell population produced by the process of:
    exposing an isolated dendritic cell to an antigen;
    contacting the isolated dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the isolated nucleic acid is from about 8-80 bases in length; and
    allowing the isolated dendritic cell to process and express the antigen.
  21. 21. The isolated antigen-expressing dendritic cell of claim 20, wherein the at least one unmethylated CpG dinucleotide has a formula:
    5′N1X1CGX2N23′
    wherein at least one nucleotide separates consecutive CpGs; X1 is adenine, guanine, or thymine; X2 is cytosine, adenine, or thymine; N is any nucleotide and N1+N2 is from about 0-25 nucleotides.
  22. 22. The isolated antigen-expressing dendritic cell of claim 20, wherein the isolated dendritic cell is contacted with a cytokine selected from the group consisting of GM-CSF, IL-4, TNFα, INF-γIL-6, Flt3 ligand, and IL-3.
  23. 23. The isolated antigen-expressing dendritic cell of claim 20, wherein the dendritic cell is contacted with the antigen prior to the isolated nucleic acid.
  24. 24. The isolated antigen-expressing dendritic cell of claim 20, wherein at least one nucleotide of the isolated nucleic acid has a phosphate backbone modification.
  25. 25. The isolated antigen-expressing dendritic cell of claim 20, wherein the phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.
  26. 26. The isolated antigen-expressing dendritic cell of claim 25, wherein the phosphate backbone modification occurs at the 5′ end of the nucleic acid.
  27. 27. The isolated antigen-expressing dendritic cell of claim 26, wherein the phosphate backbone modification occurs at the first two internucleotide linkages of the 5′ end of the nucleic acid.
  28. 28. The isolated antigen-expressing dendritic cell of claim 25, wherein the phosphate backbone modification occurs at the 3′ end of the nucleic acid.
  29. 29. The isolated antigen-expressing dendritic cell of claim 28, wherein the phosphate backbone modification occurs at the last five internucleotide linkages of the 3′ end of the nucleic acid.
  30. 30. The isolated antigen-expressing dendritic cell of claim 20, wherein the at least one unmethylated CpG dinucleotide has a formula:
    5′NX1X2CGX3X4N3′
    wherein at least one nucleotide separates consecutive CpGs; X1X2 is selected from the group consisting of TpT, CpT, TpC, and ApT; X3X4 is selected from the group consisting of GpT,GpA, ApA and ApT; N is any nucleotide and N1+N2 is from about 0-25 nucleotides.
  31. 31. A composition, comprising:
    an effective amount for synergistically activating a dendritic cell of an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length; and
    an effective amount for synergistically activating a dendritic cell of a cytokine selected from the group consisting of GM-CSF, IL-4, TNFαFlt3 ligand, and IL-3.
  32. 32. The composition of claim 31, wherein the cytokine is GM-CSF.
  33. 33. The composition of claim 31, further comprising an antigen.
  34. 34. The composition of claim 33, wherein the antigen is selected from the group consisting of a cancer antigen, a microbial antigen, and an allergen.
  35. 35. A screening assay for identifying compounds that are effective for preventing dendritic cell maturation, comprising:
    contacting an immature dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length;
    exposing the dendritic cell to a putative drug; and
    detecting the presence or absence of a maturation marker on the dendritic cell, wherein the absence of the maturation marker indicates that the putative drug is an effective compound for preventing dendritic cell maturation.
  36. 36. The assay of claim 34, wherein the maturation marker is CD83.
  37. 37. A method for generating a high yield of dendritic cells, comprising:
    administering an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective for activating dendritic cells to a subject;
    allowing the isolated nucleic acid to activate dendritic cells of the subject; and
    isolating dendritic cells from the subject.
  38. 38. A method for producing a CD40 expressing dendritic cell, comprising:
    contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to produce a CD40 expressing dendritic cell.
  39. 39. A method for causing maturation of a dendritic cell, comprising
    contacting a dendritic cell with an isolated nucleic acid containing at least one unmethylated CpG dinucleotide wherein the nucleic acid is from about 8-80 bases in length in an amount effective to cause maturation of the dendritic cell.
US10161229 1994-07-15 2002-06-03 Immunostimulatory nucleic acid molecules for activating dendritic cells Abandoned US20030100527A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US27635894 true 1994-07-15 1994-07-15
US08386063 US6194388B1 (en) 1994-07-15 1995-02-07 Immunomodulatory oligonucleotides
US08738652 US6207646B1 (en) 1994-07-15 1996-10-30 Immunostimulatory nucleic acid molecules
US08960774 US6239116B1 (en) 1994-07-15 1997-10-30 Immunostimulatory nucleic acid molecules
US09191170 US6429199B1 (en) 1994-07-15 1998-11-13 Immunostimulatory nucleic acid molecules for activating dendritic cells
US10161229 US20030100527A1 (en) 1994-07-15 2002-06-03 Immunostimulatory nucleic acid molecules for activating dendritic cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10161229 US20030100527A1 (en) 1994-07-15 2002-06-03 Immunostimulatory nucleic acid molecules for activating dendritic cells
US11503377 US20070065467A1 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules for activating dendritic cells

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09191170 Division US6429199B1 (en) 1994-07-15 1998-11-13 Immunostimulatory nucleic acid molecules for activating dendritic cells

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11503377 Continuation US20070065467A1 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules for activating dendritic cells

Publications (1)

Publication Number Publication Date
US20030100527A1 true true US20030100527A1 (en) 2003-05-29

Family

ID=27539249

Family Applications (3)

Application Number Title Priority Date Filing Date
US09191170 Expired - Lifetime US6429199B1 (en) 1994-07-15 1998-11-13 Immunostimulatory nucleic acid molecules for activating dendritic cells
US10161229 Abandoned US20030100527A1 (en) 1994-07-15 2002-06-03 Immunostimulatory nucleic acid molecules for activating dendritic cells
US11503377 Abandoned US20070065467A1 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules for activating dendritic cells

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09191170 Expired - Lifetime US6429199B1 (en) 1994-07-15 1998-11-13 Immunostimulatory nucleic acid molecules for activating dendritic cells

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11503377 Abandoned US20070065467A1 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules for activating dendritic cells

Country Status (1)

Country Link
US (3) US6429199B1 (en)

Cited By (75)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US20020164341A1 (en) * 1997-03-10 2002-11-07 Loeb Health Research Institute At The Ottawa Hospital Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20030050261A1 (en) * 1994-07-15 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid molecules
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
US20030087848A1 (en) * 2000-02-03 2003-05-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20030104523A1 (en) * 2000-09-15 2003-06-05 Stefan Bauer Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20030148976A1 (en) * 2001-08-17 2003-08-07 Krieg Arthur M. Combination motif immune stimulatory oligonucleotides with improved activity
US20030166001A1 (en) * 2001-10-05 2003-09-04 Lipford Grayson B. Toll-like receptor 3 signaling agonists and antagonists
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20030232074A1 (en) * 2002-04-04 2003-12-18 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040030118A1 (en) * 1998-05-14 2004-02-12 Hermann Wagner Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040105872A1 (en) * 2002-09-18 2004-06-03 The Government Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20040142469A1 (en) * 1994-07-15 2004-07-22 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040157791A1 (en) * 1998-06-25 2004-08-12 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
US20040198680A1 (en) * 2002-07-03 2004-10-07 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040241841A1 (en) * 2001-08-14 2004-12-02 Klinman Dennis M Method for rapid generation of mature dendritic cells
US20040266719A1 (en) * 1998-05-22 2004-12-30 Mccluskie Michael J. Methods and products for inducing mucosal immunity
US20050026245A1 (en) * 2001-12-20 2005-02-03 Klinman Dennis M. Use of cpg oligodeoxynucleotides to induce angiogenesis
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101557A1 (en) * 1994-07-15 2005-05-12 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US6951845B2 (en) * 1993-08-26 2005-10-04 The Regents Of The University Of California Method for treating allergic lung disease
US20050218499A1 (en) * 2004-03-31 2005-10-06 Advanced Semiconductor Engineering, Inc. Method for manufacturing leadless semiconductor packages
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050239734A1 (en) * 2003-10-30 2005-10-27 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20060166923A1 (en) * 2002-05-22 2006-07-27 Bo Young Ahn Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US20060211644A1 (en) * 2005-02-24 2006-09-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20060287263A1 (en) * 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US20080045473A1 (en) * 2006-02-15 2008-02-21 Coley Pharmaceutical Gmbh Compositions and methods for oligonucleotide formulations
US20080226649A1 (en) * 2000-12-08 2008-09-18 Coley Pharmaceutical Gmbh CPG-like nucleic acids and methods of use thereof
US20090117132A1 (en) * 2005-07-07 2009-05-07 Pfizer, Inc. Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
WO2009102465A3 (en) * 2008-02-13 2009-10-29 President And Fellows Of Harvard College Continuous cell programming devices
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20100010193A1 (en) * 1999-02-17 2010-01-14 Csl Limited Immunogenic complexes and methods relating thereto
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20110020216A1 (en) * 2007-06-21 2011-01-27 David James Mooney Scaffolds for cell collection or elimination
US20110117170A1 (en) * 2008-05-30 2011-05-19 Lan Cao Controlled Release of Growth Factors and Signaling Molecules for Promoting Angiogenesis
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US7960356B2 (en) 1999-04-12 2011-06-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8728456B2 (en) 2009-07-31 2014-05-20 President And Fellows Of Harvard College Programming of cells for tolerogenic therapies
US8932583B2 (en) 2005-12-13 2015-01-13 President And Fellows Of Harvard College Scaffolds for cell transplantation
US9297005B2 (en) 2009-04-13 2016-03-29 President And Fellows Of Harvard College Harnessing cell dynamics to engineer materials
US9370558B2 (en) 2008-02-13 2016-06-21 President And Fellows Of Harvard College Controlled delivery of TLR agonists in structural polymeric devices
US9486512B2 (en) 2011-06-03 2016-11-08 President And Fellows Of Harvard College In situ antigen-generating cancer vaccine
US9603894B2 (en) 2010-11-08 2017-03-28 President And Fellows Of Harvard College Materials presenting notch signaling molecules to control cell behavior
US9610328B2 (en) 2010-03-05 2017-04-04 President And Fellows Of Harvard College Enhancement of skeletal muscle stem cell engraftment by dual delivery of VEGF and IGF-1
US9675561B2 (en) 2011-04-28 2017-06-13 President And Fellows Of Harvard College Injectable cryogel vaccine devices and methods of use thereof
US9693954B2 (en) 2010-06-25 2017-07-04 President And Fellows Of Harvard College Co-delivery of stimulatory and inhibitory factors to create temporally stable and spatially restricted zones

Families Citing this family (244)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030109469A1 (en) * 1993-08-26 2003-06-12 Carson Dennis A. Recombinant gene expression vectors and methods for use of same to enhance the immune response of a host to an antigen
US6727230B1 (en) 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
DE69824039D1 (en) * 1997-12-08 2004-06-24 Lexigen Pharm Corp Heterodimeric fusion proteins for use for targeted immunotherapy and general immune excitation
US20030105294A1 (en) * 1998-02-25 2003-06-05 Stephen Gillies Enhancing the circulating half life of antibody-based fusion proteins
ES2267263T3 (en) * 1998-04-15 2007-03-01 Emd Lexigen Research Center Corp. Coadministration of an inhibitor of angiogenesis to enhance the immune response through the mediation of a fusion protein of a cytokine with an antibody.
EP1104306B1 (en) * 1998-08-10 2006-01-11 Antigenics Inc. Compositions of cpg and saponin adjuvants and methods of use thereof
US7198920B1 (en) * 1999-01-29 2007-04-03 Corika Corporation HER-2/neu fusion proteins
FR2790955B1 (en) * 1999-03-19 2003-01-17 Assist Publ Hopitaux De Paris Use of stabilized oligonucleotides as active principle antitumor
EP1176966B1 (en) 1999-04-12 2013-04-03 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Oligodeoxynucleotide and its use to induce an immune response
ES2250151T3 (en) * 1999-06-29 2006-04-16 Glaxosmithkline Biologicals S.A. Cpg use as a vaccine adjuvant against HIV.
US7030097B1 (en) * 1999-07-14 2006-04-18 Cornell Research Foundation, Inc. Controlled nucleic acid delivery systems
US7067110B1 (en) * 1999-07-21 2006-06-27 Emd Lexigen Research Center Corp. Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
WO2001007081A1 (en) 1999-07-21 2001-02-01 Lexigen Pharmaceuticals Corp. Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
KR100917101B1 (en) * 2000-08-04 2009-09-15 도요 보세키 가부시키가이샤 Flexible metal laminate and production method thereof
DK1200479T3 (en) * 1999-08-09 2006-05-15 Emd Lexigen Res Ct Corp Multiple cytokine-antibody complexes
US6737398B1 (en) * 1999-09-30 2004-05-18 National Jewish Medical And Research Center Modulation of γδ T cells to regulate airway hyperresponsiveness
WO2001036489A3 (en) 1999-11-12 2001-11-08 Merck Patent Gmbh Erythropoietin forms with improved properties
DE60131430D1 (en) * 2000-01-14 2007-12-27 Us Health Oligodeoxynucleotides and their use for induction of an immune response
CA2399832C (en) 2000-02-11 2011-09-20 Stephen D. Gillies Enhancing the circulating half-life of antibody-based fusion proteins
US7229623B1 (en) 2000-08-03 2007-06-12 Corixa Corporation Her-2/neu fusion proteins
US20030055014A1 (en) * 2000-12-14 2003-03-20 Bratzler Robert L. Inhibition of angiogenesis by nucleic acids
US7320793B2 (en) * 2001-01-19 2008-01-22 Cytos Biotechnology Ag Molecular antigen array
KR20090010127A (en) 2001-03-07 2009-01-28 메르크 파텐트 게엠베하 Expression technology for proteins containing a hybrid isotype antibody moiety
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US6992174B2 (en) * 2001-03-30 2006-01-31 Emd Lexigen Research Center Corp. Reducing the immunogenicity of fusion proteins
ES2361664T3 (en) * 2001-05-03 2011-06-21 Merck Patent Gmbh Recombinant tumor specific antibody and its use.
US6818787B2 (en) * 2001-06-11 2004-11-16 Xenoport, Inc. Prodrugs of GABA analogs, compositions and uses thereof
US7785610B2 (en) * 2001-06-21 2010-08-31 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—III
ES2487645T3 (en) * 2001-06-21 2014-08-22 Dynavax Technologies Corporation chimeric immunomodulatory compounds and methods of use thereof
WO2003012061A3 (en) * 2001-08-01 2003-07-24 Coley Pharm Gmbh Methods and compositions relating to plasmacytoid dendritic cells
CA2456193A1 (en) * 2001-08-03 2003-03-27 Medarex, Inc. Compositions comprising immunostimulatory oligonucleotides and uses thereof to enhance fc receptor-mediated immunotherapies
EP1427445A4 (en) * 2001-08-30 2006-09-06 3M Innovative Properties Co Methods of maturing plasmacytoid dendritic cells using immune response modifier molecules
US7709451B2 (en) * 2001-09-07 2010-05-04 Trustees Of Boston University Method and composition for treating immune complex associated disorders
WO2003024480A3 (en) * 2001-09-14 2003-10-30 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
DK1450856T3 (en) * 2001-09-14 2010-05-31 Cytos Biotechnology Ag Packaging of immunostimulatory CpG in the virus-like partilker, method and use
WO2003032728A8 (en) * 2001-10-19 2003-08-07 Univ Creighton Methods for preventing or reversing asthma and compositions useful therefor
RU2312677C9 (en) * 2001-12-04 2008-03-27 Мерк Патент Гмбх Immunocytokines possessing modulated selectivity
CA2479187A1 (en) * 2002-03-15 2003-09-25 Astral, Inc. Immunostimulatory double stranded rna and methods of inducing, enhancing or modulating the immune response
EP2258712A3 (en) 2002-03-15 2011-05-04 Multicell Immunotherapeutics, Inc. Compositions and Methods to Initiate or Enhance Antibody and Major-histocompatibility Class I or Class II-restricted T Cell Responses by Using Immunomodulatory, Non-coding RNA Motifs
US20040013649A1 (en) * 2002-05-10 2004-01-22 Inex Pharmaceuticals Corporation Cancer vaccines and methods of using the same
EP1507850A1 (en) * 2002-05-28 2005-02-23 MERCK PATENT GmbH A method for generating antigen-presenting cells
CA2388049A1 (en) * 2002-05-30 2003-11-30 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US8039443B2 (en) * 2002-11-21 2011-10-18 Archemix Corporation Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
WO2004094614A3 (en) 2003-04-21 2006-07-27 Archemix Corp Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US20050124565A1 (en) * 2002-11-21 2005-06-09 Diener John L. Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US20040005338A1 (en) * 2002-06-20 2004-01-08 Cytos Biotechnology Ag Packaged virus-like particles for use as adjuvants: method of preparation and use
CA2501812C (en) 2002-10-11 2012-07-10 Mariagrazia Pizza Polypeptide-vaccines for broad protection against hypervirulent meningococcal lineages
JP2006512942A (en) * 2002-10-25 2006-04-20 ユニバーシティー オブ コネティカット ヘルス センター Apparatus and methods for immunotherapy of cancer by controlling cell lysis
EP1572122A4 (en) * 2002-11-01 2008-04-09 Us Gov Health & Human Serv Method of preventing infections from bioterrorism agents with immunostimulatory cpg oligonucleotides
US20040253679A1 (en) * 2002-11-21 2004-12-16 David Epstein Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
EP3034089A1 (en) 2004-11-02 2016-06-22 Archemix LLC Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
WO2004052293A3 (en) * 2002-12-11 2005-02-24 Hawaii Biotech Inc Recombinant vaccine against flavivirus infection
JP4494977B2 (en) 2002-12-17 2010-06-30 メルク パテント ゲゼルシャフト ミット ベシュレンクテル ハフツングMerck Patent Gesellschaft mit beschraenkter Haftung Mice that bind to gd2 14.18 antibody in the humanized antibody (h14.18) and il-2 fusion protein
DE10258924A1 (en) * 2002-12-17 2004-07-08 Eberhard-Karls-Universität Tübingen Universitätsklinikum With the adhesion-promoting substances of biological material coated device
CN100546998C (en) 2002-12-23 2009-10-07 戴纳伐克斯技术股份有限公司 Immunostimulatory sequence oligonucleotides and methods of using the same
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
JP4827726B2 (en) 2003-01-30 2011-11-30 ノバルティス ヴァクシンズ アンド ダイアグノスティクス エスアールエル Injectable vaccines against multiple meningococcal serogroups
DE602004030541D1 (en) 2003-02-20 2011-01-27 Univ Connecticut Health Ct A process for the preparation of alpha (2) macroglobulin-antigenic molecule complex
US7517520B2 (en) * 2003-03-26 2009-04-14 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
WO2004087877A3 (en) * 2003-03-26 2005-06-16 Astral Inc Selected rna motifs to include cell death and/or apoptosis
US20060210588A1 (en) * 2003-03-26 2006-09-21 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
WO2004092360A3 (en) 2003-04-10 2005-08-04 Chiron Corp The severe acute respiratory syndrome coronavirus
US8080642B2 (en) 2003-05-16 2011-12-20 Vical Incorporated Severe acute respiratory syndrome DNA compositions and methods of use
EP1484064A1 (en) * 2003-06-04 2004-12-08 Gesellschaft für Biotechnologische Forschung Therapeutical composition containing dentritic cells and use thereof
CA2528067C (en) 2003-06-05 2015-08-04 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Poly-gamma-glutamic acid conjugates for eliciting immune responses directed against bacilli
DE602004031017D1 (en) * 2003-07-10 2011-02-24 Cytos Biotechnology Ag Composition packaged virus-like particles comprising for enhancing an immune response
KR101126030B1 (en) 2003-07-15 2012-03-19 이데라 파마슈티칼즈, 인코포레이티드 Synergistic stimulation of the immune system using immunostimulatory oligonucleotides and/or immunomer compounds in conjunction with cytokines and/or chemotherapeutic agents or radiation therapy
WO2005028496A3 (en) 2003-09-12 2005-10-06 Antigenics Inc Vaccine for treatment and prevention of herpes simplex virus infection
WO2005032583A3 (en) 2003-10-02 2006-03-23 Chiron Srl Liquid vaccines for multiple meningococcal serogroups
GB0323103D0 (en) 2003-10-02 2003-11-05 Chiron Srl De-acetylated saccharides
JP2007509040A (en) * 2003-10-11 2007-04-12 イネックス ファーマシューティカルズ コーポレイション Methods and compositions for enhancing the innate immunity and antibody-dependent cellular cytotoxicity
US20050287118A1 (en) * 2003-11-26 2005-12-29 Epitomics, Inc. Bacterial plasmid with immunological adjuvant function and uses thereof
US20050277127A1 (en) * 2003-11-26 2005-12-15 Epitomics, Inc. High-throughput method of DNA immunogen preparation and immunization
JP4817599B2 (en) * 2003-12-25 2011-11-16 独立行政法人科学技術振興機構 The method enhancing immune activity enhancer and immunoreactivity using the same
US20060193821A1 (en) * 2004-03-05 2006-08-31 Diener John L Aptamers to the human IL-12 cytokine family and their use as autoimmune disease therapeutics
JP2007527246A (en) * 2004-03-05 2007-09-27 アーケミックス コーポレイション Their use as therapeutic agents of aptamers and autoimmune diseases against human il-12 cytokine family
US20080254065A1 (en) 2004-03-09 2008-10-16 Chiron Corporation Influenza Virus Vaccines
US7579450B2 (en) * 2004-04-26 2009-08-25 Archemix Corp. Nucleic acid ligands specific to immunoglobulin E and their use as atopic disease therapeutics
GB0409745D0 (en) 2004-04-30 2004-06-09 Chiron Srl Compositions including unconjugated carrier proteins
WO2005105140A3 (en) 2004-04-30 2006-01-19 Chiron Srl Meningococcal conjugate vaccination
GB0410866D0 (en) 2004-05-14 2004-06-16 Chiron Srl Haemophilius influenzae
WO2005116270A3 (en) * 2004-05-18 2007-12-21 Vical Inc Influenza virus vaccine composition and method of use
CA2567446C (en) 2004-05-21 2018-01-02 Chiron Corporation Alphavirus vectors for respiratory pathogen vaccines
US20090317420A1 (en) 2004-07-29 2009-12-24 Chiron Corporation Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
EP2412728B1 (en) 2004-08-03 2015-01-07 Innate Pharma Therapeutic compositions against cancer targeting 4IG-B7-H3
WO2006042156A9 (en) 2004-10-08 2013-12-27 THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS represneted by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES, CENTERS FOR DISEASE CONTROL AND PREVENTION Modulation of replicative fitness by using less frequently used synonymous codons
GB0424092D0 (en) 2004-10-29 2004-12-01 Chiron Srl Immunogenic bacterial vesicles with outer membrane proteins
US9809824B2 (en) * 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
GB0500787D0 (en) 2005-01-14 2005-02-23 Chiron Srl Integration of meningococcal conjugate vaccination
ES2569654T3 (en) 2005-02-18 2016-05-12 Glaxosmithkline Biologicals Sa Proteins and nucleic acids of meningitis / sepsis-associated Escherichia coli
JP2008530245A (en) 2005-02-18 2008-08-07 ノバルティス ヴァクシンズ アンド ダイアグノスティクス, インコーポレイテッド Antigen derived from urinary tract pathogenic strains
GB0507632D0 (en) * 2005-04-15 2005-05-25 Secr Defence Vaccine
RU2442825C2 (en) 2005-04-18 2012-02-20 Новартис Вэксинес Энд Дайэгностикс Инк. Immunogenic compositions, methods for their production and plasmid included in such compositions
US8101385B2 (en) 2005-06-30 2012-01-24 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
EP1907590B1 (en) 2005-06-30 2012-09-19 Archemix LLC T7 rna polymerase and methods for the generation of fully 2'-modified nucleic acid transcripts
DE602006008473D1 (en) * 2005-07-01 2009-09-24 Index Pharmaceuticals Ab Modulating the response to steroids
DE602006015963D1 (en) * 2005-07-01 2010-09-16 Index Pharmaceuticals Ab process immunostimulatory
US20080206276A1 (en) * 2005-07-08 2008-08-28 Michael Otto Targeting Poly-Gamma-Glutamic Acid to Treat Staphylococcus Epidermidis and Related Infections
EP2614709A1 (en) 2005-07-18 2013-07-17 Novartis AG Small animal model for HCV replication
CN101258238B (en) 2005-09-08 2014-07-09 迈世耐特股份公司 Method for activation treatment of antigen-presenting cell
US20070104689A1 (en) * 2005-09-27 2007-05-10 Merck Patent Gmbh Compositions and methods for treating tumors presenting survivin antigens
GB0519871D0 (en) * 2005-09-30 2005-11-09 Secr Defence Immunogenic agents
US20070081972A1 (en) * 2005-09-30 2007-04-12 The University Of Iowa Research Foundation Polymer-based delivery system for immunotherapy of cancer
CN101355960A (en) 2005-10-18 2009-01-28 诺华疫苗和诊断公司 Mucosal and systemic immunizations with alphavirus replicon particles
CA2626547A1 (en) * 2005-10-21 2007-05-03 Medical College Of Georgia Research Institute, Inc. The induction of indoleamine 2,3-dioxygenase in dendritic cells by tlr ligands and uses thereof
US8895522B2 (en) * 2005-10-28 2014-11-25 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
US20110180430A1 (en) 2005-11-04 2011-07-28 Novartis Vaccines And Diagnostics Srl Adjuvanted influenza vaccines including cytokine-inducing agents
EP2368572A3 (en) 2005-11-04 2013-04-24 Novartis Vaccines and Diagnostics S.r.l. Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture
CA2628206A1 (en) 2005-11-04 2007-05-10 Novartis Vaccines And Diagnostics S.R.L. Influenza vaccine with reduced amount of oil-in-water emulsion as adjuvant
ES2377884T3 (en) 2005-11-04 2012-04-02 Novartis Vaccines And Diagnostics S.R.L. Flu vaccines that include combinations of particulate adjuvants and immunopotentiating
JP5215865B2 (en) 2005-11-22 2013-06-19 ノバルティス ヴァクシンズ アンド ダイアグノスティクス インコーポレイテッド Norovirus antigen and support viral antigens
GB0524066D0 (en) 2005-11-25 2006-01-04 Chiron Srl 741 ii
DK2032592T3 (en) 2006-06-12 2013-09-02 Cytos Biotechnology Ag Methods for packaging of oligonucleotides into virus-like particles of RNA-bacteriophages
RU2451523C2 (en) 2005-12-14 2012-05-27 Цитос Биотехнологи Аг Particles packed in immunostimulating nucleic acid that intended for hypersensitivity treatment
EP1976559B1 (en) 2006-01-27 2017-01-04 Novartis Influenza Vaccines Marburg GmbH Influenza vaccines containing hemagglutinin and matrix proteins
KR20080100353A (en) * 2006-02-01 2008-11-17 더 존스 홉킨스 유니버시티 Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders
WO2007106560A3 (en) 2006-03-14 2007-12-13 Univ Oregon Health & Science Methods for detecting a mycobacterium tuberculosis infection
US8063063B2 (en) * 2006-03-23 2011-11-22 Novartis Ag Immunopotentiating compounds
EP2357184B1 (en) 2006-03-23 2015-02-25 Novartis AG Imidazoquinoxaline compounds as immunomodulators
CA2646349A1 (en) 2006-03-24 2007-10-04 Novartis Vaccines And Diagnostics Gmbh & Co Kg Storage of influenza vaccines without refrigeration
WO2007126825A3 (en) 2006-03-31 2008-06-05 Susan W Barnett Combined mucosal and parenteral immunization against hiv
WO2009030978A3 (en) 2006-06-09 2009-06-11 Novartis Ag Conformers of bacterial adhesins
GB0614460D0 (en) 2006-07-20 2006-08-30 Novartis Ag Vaccines
US20080124366A1 (en) * 2006-08-06 2008-05-29 Ohlfest John R Methods and Compositions for Treating Tumors
US20100166788A1 (en) 2006-08-16 2010-07-01 Novartis Vaccines And Diagnostics Immunogens from uropathogenic escherichia coli
KR20090057015A (en) 2006-09-11 2009-06-03 노파르티스 아게 Making influenza virus vaccines without using eggs
ES2493166T3 (en) 2006-11-01 2014-09-11 Ventana Medical Systems, Inc. Haptens, hapten conjugates, compositions thereof and method for their preparation and use
WO2008068631A8 (en) 2006-12-06 2009-07-23 Novartis Ag Vaccines including antigen from four strains of influenza virus
GB0700562D0 (en) 2007-01-11 2007-02-21 Novartis Vaccines & Diagnostic Modified Saccharides
WO2008106551A8 (en) 2007-02-28 2009-08-06 Us Gov Health & Human Serv Brachyury polypeptides and methods for use
WO2008118792A3 (en) * 2007-03-27 2008-11-13 Nat Jewish Med & Res Center Gamma delta t cells and methods of treatment of interleukin-17 related conditions
US8518903B2 (en) 2007-04-19 2013-08-27 University of Pittsburgh—of the Commonwealth System of Higher Education Use of toll-like receptor-9 agonists
DK2170353T3 (en) * 2007-05-18 2015-07-27 Adiutide Pharmaceuticals Gmbh The phosphate-modified oligonucleotide analogs with immunostimulatory activity
EP2167963A2 (en) 2007-05-23 2010-03-31 Ventana Medical Systems, Inc. Polymeric carriers for immunohistochemistry and in situ hybridization
EP2484377A1 (en) 2007-06-27 2012-08-08 Novartis AG Low-additive influenza vaccines
GB0713880D0 (en) * 2007-07-17 2007-08-29 Novartis Ag Conjugate purification
US20090123467A1 (en) * 2007-07-31 2009-05-14 The Johns Hopkins University Polypeptide-Nucleic Acid Conjugate for Immunoprophylaxis or Immunotherapy for Neoplastic or Infectious Disorders
GB0714963D0 (en) 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
US7879812B2 (en) 2007-08-06 2011-02-01 University Of Iowa Research Foundation Immunomodulatory oligonucleotides and methods of use therefor
KR101621837B1 (en) 2007-09-12 2016-05-17 노파르티스 아게 Gas57 mutant antigens and gas57 antibodies
JP2011514881A (en) 2007-11-09 2011-05-12 ザ ソルク インスティテュート フォー バイオロジカル スタディーズ Using tam activator as used and immunosuppressive agents tam receptor inhibitor as an immune enhancer
CN104292312A (en) 2007-12-21 2015-01-21 诺华股份有限公司 Mutant forms of streptolysin o
RU2475496C2 (en) 2008-02-21 2013-02-20 Новартис Аг MENINGOCOCCAL fHBP POLYPEPTIDES
EP2889042A3 (en) 2008-03-18 2015-10-14 Novartis AG Improvements in preparation of influenza virus vaccine antigens
US8313896B2 (en) * 2008-04-04 2012-11-20 The General Hospital Corporation Oncolytic herpes simplex virus immunotherapy in the treatment of brain cancer
WO2009149013A3 (en) 2008-06-05 2010-02-04 Ventana Medical Systems, Inc. Compositions comprising nanomaterials and method for using such compositions for histochemical processes
GB0810305D0 (en) 2008-06-05 2008-07-09 Novartis Ag Influenza vaccination
WO2010018583A1 (en) * 2008-08-14 2010-02-18 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Toll-like receptor 9 agonists for the treatment of anxiety-related disorders and inflammatory disorders
JP2012502972A (en) 2008-09-18 2012-02-02 ノバルティス アーゲー The combination of a vaccine adjuvant
CA2732750A1 (en) 2008-09-22 2010-03-25 The Government Of The United States Of America D.B.A.The Department Of V Eterans Affairs Methods for detecting a mycobacterium tuberculosis infection
GB0818453D0 (en) 2008-10-08 2008-11-12 Novartis Ag Fermentation processes for cultivating streptococci and purification processes for obtaining cps therefrom
US8552165B2 (en) * 2008-12-09 2013-10-08 Heather Davis Immunostimulatory oligonucleotides
EP2376107B1 (en) 2008-12-09 2014-05-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20110256167A1 (en) 2008-12-23 2011-10-20 Carla Christina Schrier Immunostimulating saponins for use in situ tumor-destruction therapy
JP2012515157A (en) 2009-01-12 2012-07-05 ノバルティス アーゲー Cna_B domain antigen in a vaccine against gram-positive bacteria
GB0900455D0 (en) 2009-01-13 2009-02-11 Secr Defence Vaccine
US8664183B2 (en) 2009-02-27 2014-03-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services SPANX-B polypeptides and their use
WO2010100632A3 (en) 2009-03-06 2011-01-20 Novartis Ag Chlamydia antigens
CN102427826B (en) 2009-03-24 2014-11-26 诺华股份有限公司 Adjuvanting meningococcal factor H binding protein
KR101730351B1 (en) 2009-03-25 2017-04-28 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 Compositions for stimulation of mammalian innate immune resistance to pathogens
US20120100173A1 (en) 2009-04-03 2012-04-26 Agenus Inc. Methods for preparing and using multichaperone-antigen complexes
JP5830009B2 (en) 2009-04-14 2015-12-09 ノバルティス アーゲー Composition for immunizing against Staphylococcusaureus
DK2442826T3 (en) 2009-06-15 2015-09-21 Univ Singapore Influenza vaccine, composition and methods of using
JP2012532600A (en) 2009-07-07 2012-12-20 ノバルティス アーゲー Stored E. coli immunogen
US20120164176A1 (en) 2009-07-15 2012-06-28 Kurt Swanson Rsv f protein compositions amd methods for making same
CA2768343A1 (en) 2009-07-16 2011-01-20 Novartis Ag Detoxified escherichia coli immunogens
EP2467167B1 (en) * 2009-08-18 2017-08-16 Baxalta GmbH Aptamers to tissue factor pathway inhibitor and their use as bleeding disorder therapeutics
US8598327B2 (en) 2009-08-18 2013-12-03 Baxter International Inc. Aptamers to tissue factor pathway inhibitor and their use as bleeding disorder therapeutics
WO2012109675A1 (en) 2011-02-11 2012-08-16 Baxter International Inc. Aptamers to tissue factor pathway inhibitor and their use as bleeding disorder therapeutics
EP3017828A1 (en) 2009-08-27 2016-05-11 GlaxoSmithKline Biologicals SA Hybrid polypeptides including meningococcal fhbp sequences
JP2013503148A (en) 2009-08-27 2013-01-31 ノバルティス アーゲー Adjuvant aluminum, oligonucleotides and polycation
WO2011026111A1 (en) 2009-08-31 2011-03-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Oral delivery of a vaccine to the large intestine to induce mucosal immunity
CA2773637A1 (en) 2009-09-10 2011-03-17 Novartis Ag Combination vaccines against respiratory tract diseases
GB0917003D0 (en) 2009-09-28 2009-11-11 Novartis Vaccines Inst For Global Health Srl Purification of bacterial vesicles
GB0917002D0 (en) 2009-09-28 2009-11-11 Novartis Vaccines Inst For Global Health Srl Improved shigella blebs
EP2493510A1 (en) 2009-09-30 2012-09-05 Novartis AG Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides
WO2011039631A3 (en) 2009-09-30 2011-06-16 Novartis Ag Expression of meningococcal fhbp polypeptides
EP2486133B1 (en) 2009-10-07 2016-06-29 UVic Industry Partnerships Inc. Vaccines comprising heat-sensitive transgenes
WO2011047340A1 (en) 2009-10-16 2011-04-21 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Insertion of foreign genes in rubella virus and their stable expression in a live, attenuated viral vaccine
GB0918392D0 (en) 2009-10-20 2009-12-02 Novartis Ag Diagnostic and therapeutic methods
JP5960055B2 (en) 2009-10-27 2016-08-02 ノバルティス アーゲー Modified meningococcal fHBP polypeptide
GB0919690D0 (en) 2009-11-10 2009-12-23 Guy S And St Thomas S Nhs Foun compositions for immunising against staphylococcus aureus
WO2011063336A3 (en) * 2009-11-20 2011-12-01 President And Fellows Of Harvard College Secondary site of antigen stimulation for therapeutic vaccination
WO2011080595A3 (en) 2009-12-30 2012-07-26 Novartis Ag Polysaccharide immunogens conjugated to e. coli carrier proteins
GB201003333D0 (en) 2010-02-26 2010-04-14 Novartis Ag Immunogenic proteins and compositions
WO2011112599A3 (en) 2010-03-12 2011-11-10 The United States Of America, As Represented By The Secretary. Department Of Health & Human Services Immunogenic pote peptides and methods of use
JP2013522287A (en) 2010-03-18 2013-06-13 ノバルティス アーゲー Adjuvanted vaccine for serogroup b Neisseria meningitidis
CA2798136A1 (en) 2010-05-14 2011-11-17 Oregon Health & Science University Recombinant hcmv and rhcmv vectors and uses thereof
GB201005625D0 (en) 2010-04-01 2010-05-19 Novartis Ag Immunogenic proteins and compositions
EP2556151A1 (en) 2010-04-07 2013-02-13 Novartis AG Method for generating a parvovirus b19 virus-like particle
US9597326B2 (en) 2010-04-13 2017-03-21 Glaxosmithkline Biologicals Sa Benzonapthyridine compositions and uses thereof
KR20130121699A (en) 2010-05-28 2013-11-06 테트리스 온라인, 인코포레이티드 Interactive hybrid asynchronous computer game infrastructure
GB201009861D0 (en) 2010-06-11 2010-07-21 Novartis Ag OMV vaccines
EP2585106A1 (en) 2010-06-25 2013-05-01 Novartis AG Combinations of meningococcal factor h binding proteins
CA2804501A1 (en) 2010-07-06 2012-01-12 Novartis Ag Norovirus derived immunogenic compositions and methods
US9192661B2 (en) 2010-07-06 2015-11-24 Novartis Ag Delivery of self-replicating RNA using biodegradable polymer particles
GB201017519D0 (en) 2010-10-15 2010-12-01 Novartis Vaccines Inst For Global Health S R L Vaccines
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
EP2655389A2 (en) 2010-12-24 2013-10-30 Novartis AG Compounds
US20140044751A1 (en) 2011-01-26 2014-02-13 Novartis Ag Rsv immunization regimen
GB201101665D0 (en) 2011-01-31 2011-03-16 Novartis Ag Immunogenic compositions
US20140248314A1 (en) 2011-05-13 2014-09-04 Novartis Ag Pre-fusion rsv f antigens
FR2975600B1 (en) 2011-05-24 2013-07-05 Assist Publ Hopitaux De Paris Agents for the treatment of tumors
US9580475B2 (en) 2011-06-20 2017-02-28 University of Pittsburgh—of the Commonwealth System of Higher Education Computationally optimized broadly reactive antigens for H1N1 influenza
ES2656050T3 (en) 2011-07-06 2018-02-22 Glaxosmithkline Biologicals Sa Immunogenic compositions combination and uses thereof
CA2841047A1 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic compositions and uses thereof
WO2013016460A1 (en) 2011-07-25 2013-01-31 Novartis Ag Compositions and methods for assessing functional immunogenicity of parvovirus vaccines
GB201114923D0 (en) 2011-08-30 2011-10-12 Novartis Ag Immunogenic proteins and compositions
WO2013039792A1 (en) 2011-09-12 2013-03-21 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Immunogens based on an hiv-1 gp120 v1v2 epitope
EP2755683A2 (en) 2011-09-14 2014-07-23 Novartis AG Methods for making saccharide-protein glycoconjugates
US9511130B2 (en) 2011-09-14 2016-12-06 Glaxosmithkline Biologicals Sa Escherichia coli vaccine combination
WO2013049535A3 (en) 2011-09-30 2013-07-11 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Influenza vaccine
EP2776069A1 (en) 2011-11-07 2014-09-17 Novartis AG Carrier molecule comprising a spr0096 and a spr2021 antigen
KR20140101835A (en) 2011-12-08 2014-08-20 노파르티스 아게 Clostridium difficile toxin-based vaccine
WO2013108272A3 (en) 2012-01-20 2013-12-12 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
CA2865028A1 (en) 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
US9421250B2 (en) 2012-03-23 2016-08-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pathogenic phlebovirus isolates and compositions and methods of use
RU2014147491A (en) 2012-04-26 2016-06-20 Новартис Аг Antigens and antigen composition
WO2013174832A1 (en) 2012-05-22 2013-11-28 Novartis Ag Meningococcus serogroup x conjugate
EP2852405A1 (en) 2012-05-23 2015-04-01 The United States of America, as represented by The Secretary, Department of Health and Human Services Salmonella typhi ty21a expressing yersinia pestis f1-v fusion protein and uses thereof
WO2013177397A1 (en) 2012-05-24 2013-11-28 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Multivalent meningococcal conjugates and methods for preparing cojugates
US9687542B2 (en) 2012-06-19 2017-06-27 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Rift valley fever virus replicon particles and use thereof
CN104853770A (en) 2012-07-06 2015-08-19 诺华股份有限公司 Immunogenic compositions and uses thereof
US20150224181A1 (en) 2012-09-14 2015-08-13 The United States Of America As Represented By The Secretary Department Of Health And Human Se Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use
CA2882382A1 (en) 2012-09-18 2014-03-27 Novartis Ag Outer membrane vesicles
US9562066B2 (en) * 2012-09-25 2017-02-07 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Oral therapy of necrotizing enterocolitis
CA2885625A1 (en) 2012-10-02 2014-04-10 Glaxosmithkline Biologicals S.A. Nonlinear saccharide conjugates
KR20150073943A (en) 2012-10-03 2015-07-01 글락소스미스클라인 바이오로지칼즈 에스.에이. Immunogenic composition
EP2948469A4 (en) 2013-01-23 2016-11-02 Univ Leland Stanford Junior Stabilized hepatitis b core polypeptide
WO2014172661A8 (en) 2013-04-19 2015-10-29 The Regents Of The University Of California Lone star virus
CA2914728A1 (en) 2013-06-14 2014-12-18 Intervet International B.V. Pharmaceutical compositions comprising a gpg oligodeoxynucleotide and cyclic di-gmp
EP2870974A1 (en) 2013-11-08 2015-05-13 Novartis AG Salmonella conjugate vaccines
US20160310585A1 (en) 2013-12-13 2016-10-27 The U.S.A., As Represented By The Secretary, Department Of Health And Human Services Multi-epitope tarp peptide vaccine and uses thereof
EP3149479A2 (en) 2014-05-30 2017-04-05 Sanofi Pasteur Inc. Expression and conformational analysis of engineered influenza hemagglutinin
WO2015187966A1 (en) 2014-06-04 2015-12-10 Aurasense Therapeutics, Llc Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
CN107847572A (en) 2015-05-13 2018-03-27 艾吉纳斯公司 Vaccines for cancer treatment and prevention
CA2987939A1 (en) 2015-06-02 2016-12-08 Sanofi Pasteur Inc. Engineered influenza antigenic polypeptides and immunogenic compositions thereof
WO2016201224A1 (en) 2015-06-10 2016-12-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Processes for production and purification of nucleic acid-containing compositions
WO2016207853A3 (en) 2015-06-26 2017-02-23 Seqirus UK Limited Antigenically matched influenza vaccines
US9730989B2 (en) 2015-07-02 2017-08-15 PrimeVax Immuno-Oncology, Inc. Compositions and methods for combination therapy with dengue virus and dendritic cells
WO2017062246A1 (en) 2015-10-05 2017-04-13 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Human rota virus g9p[6] strain and use as a vaccine
WO2017075570A1 (en) 2015-10-30 2017-05-04 The United States Of America, As Represented By Secretary, Department Of Health And Human Sevices Compositions and methods for the treatment of her2-expressing solid tumors
WO2017189448A1 (en) 2016-04-25 2017-11-02 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Bivalent immunogenic conjugate for malaria and typhoid

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US49266A (en) * 1865-08-08 Alonzo hitchcock
US50263A (en) * 1865-10-03 Improved blasting-plug
US55477A (en) * 1866-06-12 Portable door-fastening
US78223A (en) * 1868-05-26 Stephen b
US92663A (en) * 1869-07-13 Daniel sherwood
US98199A (en) * 1869-12-21 Improved wash-boiler
US107212A (en) * 1870-09-13 Improvement in coffin-handles
US109469A (en) * 1870-11-22 Improvement in harvester rakes
US119773A (en) * 1871-10-10 Improvement in chandelier centers
US129251A (en) * 1872-07-16 Improvement in leather scouring machines
US133988A (en) * 1872-12-17 Improvement in saw-sharpening swages
US138413A (en) * 1873-04-29 Improvement in machines for making links for ornamental chains
US142978A (en) * 1873-09-23 Improvement in devices for holding wagon-boxes to the bolsters
US143213A (en) * 1873-09-23 Improvement in fertilizing soils
US147870A (en) * 1874-02-24 Improvement in supplying air to air-chambers
US156033A (en) * 1874-10-20 Improvement in hames
US175731A (en) * 1876-04-04 Improvement in flying tops
US186921A (en) * 1877-02-06 Improvement in fruit-pickers
US199466A (en) * 1878-01-22 Improvement in photographic vignetting devices
US212028A (en) * 1879-02-04 Improvement in seeding-machines
US216340A (en) * 1879-06-10 Improvement in holders for type for hand-stamps
US6174872B1 (en) * 1996-10-04 2001-01-16 The Regents Of The University Of California Method for treating allergic lung disease
US6225292B1 (en) * 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6498148B1 (en) * 1997-09-05 2002-12-24 The Regents Of The University Of California Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US6514948B1 (en) * 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
US6534062B2 (en) * 2000-03-28 2003-03-18 The Regents Of The University Of California Methods for increasing a cytotoxic T lymphocyte response in vivo
US6544518B1 (en) * 1999-04-19 2003-04-08 Smithkline Beecham Biologicals S.A. Vaccines
US6552006B2 (en) * 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US6589940B1 (en) * 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US6610661B1 (en) * 1996-10-11 2003-08-26 The Regents Of The University Of California Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
US6653292B1 (en) * 1994-07-15 2003-11-25 University Of Iowa Research Foundation Method of treating cancer using immunostimulatory oligonucleotides

Family Cites Families (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3906092A (en) 1971-11-26 1975-09-16 Merck & Co Inc Stimulation of antibody response
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
JP2547714B2 (en) 1981-10-23 1996-10-23 モルキユラ− バイオシステムズ インコ−ポレテツド Oligonucleotide therapeutic agents and their preparation
US5766920A (en) 1982-08-11 1998-06-16 Cellcor, Inc. Ex vivo activation of immune cells
CA1339596C (en) 1987-08-07 1997-12-23 New England Medical Center Hospitals, Inc. Viral expression inhibitors
US5750666A (en) * 1988-05-26 1998-05-12 Competitve Technologies, Inc. Polynucleotide phosphorodithioate compounds
US5786189A (en) 1989-11-29 1998-07-28 Smithkline Beecham Biologicals (S.A.) Vaccine
US5514577A (en) 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5248670A (en) 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
DK0544713T3 (en) 1990-08-16 1997-09-29 Isis Pharmaceuticals Inc Oligonukleutider for modulating the effects of cytomegalovirus infections
EP0580754A1 (en) 1991-04-18 1994-02-02 The Salk Institute For Biological Studies Oligodeoxynucleotides and oligonucleotides useful as decoys for proteins which selectively bind to defined dna sequences
EP0587749A4 (en) 1991-05-31 1995-08-30 Genta Inc Compositions and delivery systems for transdermal administration of neutral oligomers
US5585479A (en) 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
EP0688223A4 (en) 1993-03-12 1998-05-13 Cellcor Inc -i(IN VITRO) ASSAY MEASURING DEGREE OF ACTIVATION OF IMMUNE CELLS
WO1994024267A1 (en) 1993-04-20 1994-10-27 Robinson, William, S. Methods and materials for treatment of individuals infected with intracellular infectious agents
EP0714308A4 (en) 1993-08-26 1998-07-29 Univ California Method, compositions and devices for administration of naked polynucleotides which encode biologically active peptides
US20030109469A1 (en) * 1993-08-26 2003-06-12 Carson Dennis A. Recombinant gene expression vectors and methods for use of same to enhance the immune response of a host to an antigen
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
ES2267100T5 (en) * 1994-07-15 2011-04-08 Coley Pharmaceutical Group, Inc. Immunomodulatory oligonucleotides.
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030026782A1 (en) * 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
EP0824588B1 (en) 1995-05-11 2004-07-14 Applied Research Systems ARS Holding N.V. Il-6 activity inhibitor
KR100676792B1 (en) 1995-10-04 2007-02-02 임뮤넥스 코포레이션 Dendritic Cell Stimulatory Factor
CA2244946C (en) 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
CA2259140C (en) 1996-07-10 2008-09-30 Immunex Corporation Method of activating dendritic cells
EP0855184A1 (en) * 1997-01-23 1998-07-29 Klaus Prof.-Dr. Heeg Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
EP1005368B1 (en) 1997-03-10 2009-09-02 Ottawa Hospital Research Institute Use of nucleic acids containing unmethylated CpG dinucleotide in combination with alum as adjuvants
US6406705B1 (en) * 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
CA2301575C (en) * 1997-05-20 2003-12-23 Heather L. Davis Vectors and methods for immunization or therapeutic protocols
US20040006034A1 (en) * 1998-06-05 2004-01-08 Eyal Raz Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
WO1999001154A1 (en) * 1997-07-03 1999-01-14 University Of Iowa Research Foundation Method for inhibiting immunostimulatory dna associated responses
DE69935507D1 (en) * 1998-04-03 2007-04-26 Univ Iowa Res Found Methods and products for stimulating the immune system by means of immunotherapeutic oligonucleotides and cytokines
EP1674574A1 (en) * 1998-05-14 2006-06-28 Coley Pharmaceutical GmbH Methods for Regulating Hematopoiesis using CpG-Oligonucleotides
US6693086B1 (en) * 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
GB9817052D0 (en) * 1998-08-05 1998-09-30 Smithkline Beecham Biolog Vaccine
JP2003510282A (en) * 1999-09-25 2003-03-18 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory nucleic acid
US7585847B2 (en) * 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US6339630B1 (en) * 2000-05-18 2002-01-15 The United States Of America As Represented By The United States Department Of Energy Sealed drive screw operator
DK1296714T3 (en) * 2000-06-22 2009-12-07 Coley Pharm Gmbh Combination of CpG and antibodies directed against CD19, CD20, CD22 or CD40 for the treatment or prevention of cancer
US20030055014A1 (en) * 2000-12-14 2003-03-20 Bratzler Robert L. Inhibition of angiogenesis by nucleic acids
JP4188687B2 (en) * 2000-12-27 2008-11-26 ダイナバックス テクノロジーズ コーポレイション Immune modulation polynucleotides and methods of use thereof
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
WO2003103586A3 (en) * 2002-06-05 2004-09-30 Coley Pharm Group Inc Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory cpg nucleic acids
US7569553B2 (en) * 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) * 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
JP5414961B2 (en) * 2002-08-19 2014-02-12 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory nucleic acid
EP2241325B1 (en) * 2002-10-29 2012-02-08 Coley Pharmaceutical Group, Inc. Use of CPG oligonucleotides in the treatment of hepatitis C virus infection
US6820812B2 (en) * 2002-11-04 2004-11-23 Symbol Technologies, Inc. Battery integrated into a mobile device
CA2528774A1 (en) * 2003-06-20 2005-01-27 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (tlr) antagonists
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
CA2560108A1 (en) * 2004-04-02 2005-11-24 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing il-10 responses
WO2006080946A3 (en) * 2004-06-08 2006-12-21 Coley Pharm Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
CA2574090A1 (en) * 2004-07-18 2006-12-21 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses
RU2393223C2 (en) * 2004-10-20 2010-06-27 Коли Фармасьютикал Груп, Инк. Semi-soft c-class immunostimulatory oligonucleotides
EP1851314A2 (en) * 2005-02-24 2007-11-07 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
JP2009500412A (en) * 2005-07-07 2009-01-08 コーリー ファーマシューティカル グループ,インコーポレイテッド For the treatment of cancer, in combination therapy with anti-CTLA-4 antibody and cpg motif-containing synthetic oligodeoxynucleotides
ES2526879T3 (en) * 2006-02-15 2015-01-16 Adiutide Pharmaceuticals Gmbh Formulations compositions and methods for oligonucleotide

Patent Citations (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US216340A (en) * 1879-06-10 Improvement in holders for type for hand-stamps
US50263A (en) * 1865-10-03 Improved blasting-plug
US55477A (en) * 1866-06-12 Portable door-fastening
US78223A (en) * 1868-05-26 Stephen b
US92663A (en) * 1869-07-13 Daniel sherwood
US98199A (en) * 1869-12-21 Improved wash-boiler
US107212A (en) * 1870-09-13 Improvement in coffin-handles
US109469A (en) * 1870-11-22 Improvement in harvester rakes
US119773A (en) * 1871-10-10 Improvement in chandelier centers
US129251A (en) * 1872-07-16 Improvement in leather scouring machines
US133988A (en) * 1872-12-17 Improvement in saw-sharpening swages
US138413A (en) * 1873-04-29 Improvement in machines for making links for ornamental chains
US142978A (en) * 1873-09-23 Improvement in devices for holding wagon-boxes to the bolsters
US143213A (en) * 1873-09-23 Improvement in fertilizing soils
US147870A (en) * 1874-02-24 Improvement in supplying air to air-chambers
US156033A (en) * 1874-10-20 Improvement in hames
US175731A (en) * 1876-04-04 Improvement in flying tops
US186921A (en) * 1877-02-06 Improvement in fruit-pickers
US199466A (en) * 1878-01-22 Improvement in photographic vignetting devices
US212028A (en) * 1879-02-04 Improvement in seeding-machines
US49266A (en) * 1865-08-08 Alonzo hitchcock
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6653292B1 (en) * 1994-07-15 2003-11-25 University Of Iowa Research Foundation Method of treating cancer using immunostimulatory oligonucleotides
US6426336B1 (en) * 1996-10-04 2002-07-30 The Regents Of The University Of California Method for treating allergic lung disease
US6174872B1 (en) * 1996-10-04 2001-01-16 The Regents Of The University Of California Method for treating allergic lung disease
US6610661B1 (en) * 1996-10-11 2003-08-26 The Regents Of The University Of California Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
US6589940B1 (en) * 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US6225292B1 (en) * 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US6498148B1 (en) * 1997-09-05 2002-12-24 The Regents Of The University Of California Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US6544518B1 (en) * 1999-04-19 2003-04-08 Smithkline Beecham Biologicals S.A. Vaccines
US6514948B1 (en) * 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
US6552006B2 (en) * 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US6534062B2 (en) * 2000-03-28 2003-03-18 The Regents Of The University Of California Methods for increasing a cytotoxic T lymphocyte response in vivo

Cited By (187)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6951845B2 (en) * 1993-08-26 2005-10-04 The Regents Of The University Of California Method for treating allergic lung disease
US20050054602A1 (en) * 1994-07-15 2005-03-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7674777B2 (en) 1994-07-15 2010-03-09 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030050261A1 (en) * 1994-07-15 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid molecules
US20050267057A1 (en) * 1994-07-15 2005-12-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20100125101A1 (en) * 1994-07-15 2010-05-20 Krieg Arthur M Immunostimulatory nucleic acid molecules
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7524828B2 (en) 1994-07-15 2009-04-28 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7517861B2 (en) 1994-07-15 2009-04-14 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7723022B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8008266B2 (en) 1994-07-15 2011-08-30 University Of Iowa Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US20040152656A1 (en) * 1994-07-15 2004-08-05 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050245477A1 (en) * 1994-07-15 2005-11-03 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US7402572B2 (en) 1994-07-15 2008-07-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050244379A1 (en) * 1994-07-15 2005-11-03 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040087538A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US20040106568A1 (en) * 1994-07-15 2004-06-03 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US8258106B2 (en) 1994-07-15 2012-09-04 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20080026011A1 (en) * 1994-07-15 2008-01-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040132685A1 (en) * 1994-07-15 2004-07-08 The University Of Iowa Research Foundation Immunostimulatory nucleic acid
US20040142469A1 (en) * 1994-07-15 2004-07-22 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040147468A1 (en) * 1994-07-15 2004-07-29 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20040152657A1 (en) * 1994-07-15 2004-08-05 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070202128A1 (en) * 1994-07-15 2007-08-30 Coley Pharmaceutical Group, Inc Immunomodulatory oligonucleotides
US7223741B2 (en) 1994-07-15 2007-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040167089A1 (en) * 1994-07-15 2004-08-26 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040171150A1 (en) * 1994-07-15 2004-09-02 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040181045A1 (en) * 1994-07-15 2004-09-16 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070078104A1 (en) * 1994-07-15 2007-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040198688A1 (en) * 1994-07-15 2004-10-07 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040229835A1 (en) * 1994-07-15 2004-11-18 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8058249B2 (en) 1994-07-15 2011-11-15 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060094683A1 (en) * 1994-07-15 2006-05-04 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20070010470A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050239732A1 (en) * 1994-07-15 2005-10-27 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20050004062A1 (en) * 1994-07-15 2005-01-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050004061A1 (en) * 1994-07-15 2005-01-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050009774A1 (en) * 1994-07-15 2005-01-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8114848B2 (en) 1994-07-15 2012-02-14 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US20050049215A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050049216A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7888327B2 (en) 1994-07-15 2011-02-15 University Of Iowa Research Foundation Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US20050233999A1 (en) * 1994-07-15 2005-10-20 Krieg Arthur M Immunostimulatory nucleic acid molecules
US8129351B2 (en) 1994-07-15 2012-03-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050277604A1 (en) * 1994-07-15 2005-12-15 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050101554A1 (en) * 1994-07-15 2005-05-12 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20050101557A1 (en) * 1994-07-15 2005-05-12 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US8148340B2 (en) 1994-07-15 2012-04-03 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US20050148537A1 (en) * 1994-07-15 2005-07-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050171047A1 (en) * 1994-07-15 2005-08-04 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050032736A1 (en) * 1994-07-15 2005-02-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060003955A1 (en) * 1994-07-15 2006-01-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20090060927A1 (en) * 1997-01-23 2009-03-05 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20020164341A1 (en) * 1997-03-10 2002-11-07 Loeb Health Research Institute At The Ottawa Hospital Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20110081366A1 (en) * 1997-10-30 2011-04-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20040030118A1 (en) * 1998-05-14 2004-02-12 Hermann Wagner Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040234512A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regualting hematopoiesis using CpG-oligonucleotides
US20040235778A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040266719A1 (en) * 1998-05-22 2004-12-30 Mccluskie Michael J. Methods and products for inducing mucosal immunity
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US20040157791A1 (en) * 1998-06-25 2004-08-12 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US20100010193A1 (en) * 1999-02-17 2010-01-14 Csl Limited Immunogenic complexes and methods relating thereto
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US8227446B2 (en) 1999-04-12 2012-07-24 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US7960356B2 (en) 1999-04-12 2011-06-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US20060286070A1 (en) * 1999-09-27 2006-12-21 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20110033421A1 (en) * 1999-09-27 2011-02-10 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US7776344B2 (en) 1999-09-27 2010-08-17 University Of Iowa Research Foundation Methods related to immunostimulatory nucleic acid-induced interferon
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US20040235774A1 (en) * 2000-02-03 2004-11-25 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20030087848A1 (en) * 2000-02-03 2003-05-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US7585847B2 (en) 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070037767A1 (en) * 2000-02-03 2007-02-15 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20060154890A1 (en) * 2000-02-03 2006-07-13 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067902A9 (en) * 2000-02-03 2004-04-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US7534772B2 (en) 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US7820379B2 (en) 2000-09-15 2010-10-26 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US6943240B2 (en) 2000-09-15 2005-09-13 Coley Pharmaceuticals Gmbh Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist
US20030104523A1 (en) * 2000-09-15 2003-06-05 Stefan Bauer Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20080226649A1 (en) * 2000-12-08 2008-09-18 Coley Pharmaceutical Gmbh CPG-like nucleic acids and methods of use thereof
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US20040241841A1 (en) * 2001-08-14 2004-12-02 Klinman Dennis M Method for rapid generation of mature dendritic cells
US20080241176A1 (en) * 2001-08-14 2008-10-02 The Gov. Of The U.S.A As Represented By The Secretary Of The Dept. Of Health & Human Services Method for rapid generation of mature dendritic cells
US7959934B2 (en) 2001-08-14 2011-06-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
US20030148976A1 (en) * 2001-08-17 2003-08-07 Krieg Arthur M. Combination motif immune stimulatory oligonucleotides with improved activity
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US20030166001A1 (en) * 2001-10-05 2003-09-04 Lipford Grayson B. Toll-like receptor 3 signaling agonists and antagonists
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20050026245A1 (en) * 2001-12-20 2005-02-03 Klinman Dennis M. Use of cpg oligodeoxynucleotides to induce angiogenesis
US7935351B2 (en) 2001-12-20 2011-05-03 The United States Of America As Represented By The Department Of Health And Human Services Use of CPG oligodeoxynucleotides to induce angiogenesis
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US20060172966A1 (en) * 2002-04-04 2006-08-03 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20030232074A1 (en) * 2002-04-04 2003-12-18 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US9428536B2 (en) 2002-04-04 2016-08-30 Zoetis Belgium Sa Immunostimulatory G, U-containing oligoribonucleotides
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8883987B2 (en) 2002-05-22 2014-11-11 Eyegene Inc. Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US7507802B2 (en) 2002-05-22 2009-03-24 Eyegene, Inc. Immune stimulating and controlling composition comprising bacterial chromosomal DNA fragments and non-toxic lipopolysaccharides
US20060166923A1 (en) * 2002-05-22 2006-07-27 Bo Young Ahn Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8114419B2 (en) 2002-07-03 2012-02-14 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040198680A1 (en) * 2002-07-03 2004-10-07 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8304396B2 (en) 2002-08-19 2012-11-06 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20040105872A1 (en) * 2002-09-18 2004-06-03 The Government Of The Usa As Represented By The Secretary Of The Dept. Of Health & Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US8263091B2 (en) 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US7410975B2 (en) 2003-06-20 2008-08-12 Coley Pharmaceutical Group, Inc. Small molecule toll-like receptor (TLR) antagonists
US7615539B2 (en) 2003-09-25 2009-11-10 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20100183639A1 (en) * 2003-09-25 2010-07-22 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239734A1 (en) * 2003-10-30 2005-10-27 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20050218499A1 (en) * 2004-03-31 2005-10-06 Advanced Semiconductor Engineering, Inc. Method for manufacturing leadless semiconductor packages
US20060287263A1 (en) * 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
US20090137519A1 (en) * 2004-10-20 2009-05-28 Coley Pharmaceutical Group, Inc. Semi-soft c-class immunostimulatory oligonucleotides
US7566703B2 (en) 2004-10-20 2009-07-28 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20110201672A1 (en) * 2004-10-20 2011-08-18 Krieg Arthur M Semi-soft c-class immunostimulatory oligonucleotides
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US7795235B2 (en) 2004-10-20 2010-09-14 Coley Pharmaceutical Gmbh Semi-soft c-class immunostimulatory oligonucleotides
US20080009455A9 (en) * 2005-02-24 2008-01-10 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20060211644A1 (en) * 2005-02-24 2006-09-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20090117132A1 (en) * 2005-07-07 2009-05-07 Pfizer, Inc. Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20110206719A1 (en) * 2005-11-25 2011-08-25 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20100316659A1 (en) * 2005-11-25 2010-12-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US8354522B2 (en) 2005-11-25 2013-01-15 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US8932583B2 (en) 2005-12-13 2015-01-13 President And Fellows Of Harvard College Scaffolds for cell transplantation
US9446107B2 (en) 2005-12-13 2016-09-20 President And Fellows Of Harvard College Scaffolds for cell transplantation
US9132210B2 (en) 2005-12-13 2015-09-15 President And Fellows Of Harvard College Scaffolds for cell transplantation
US20080045473A1 (en) * 2006-02-15 2008-02-21 Coley Pharmaceutical Gmbh Compositions and methods for oligonucleotide formulations
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9382545B2 (en) 2006-09-27 2016-07-05 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US9770535B2 (en) 2007-06-21 2017-09-26 President And Fellows Of Harvard College Scaffolds for cell collection or elimination
US20110020216A1 (en) * 2007-06-21 2011-01-27 David James Mooney Scaffolds for cell collection or elimination
US9821045B2 (en) 2008-02-13 2017-11-21 President And Fellows Of Harvard College Controlled delivery of TLR3 agonists in structural polymeric devices
US9370558B2 (en) 2008-02-13 2016-06-21 President And Fellows Of Harvard College Controlled delivery of TLR agonists in structural polymeric devices
WO2009102465A3 (en) * 2008-02-13 2009-10-29 President And Fellows Of Harvard College Continuous cell programming devices
US9539309B2 (en) 2008-05-30 2017-01-10 President And Fellows Of Harvard College Controlled release of growth factors and signaling molecules for promoting angiogenesis
US20110117170A1 (en) * 2008-05-30 2011-05-19 Lan Cao Controlled Release of Growth Factors and Signaling Molecules for Promoting Angiogenesis
US9012399B2 (en) 2008-05-30 2015-04-21 President And Fellows Of Harvard College Controlled release of growth factors and signaling molecules for promoting angiogenesis
US9297005B2 (en) 2009-04-13 2016-03-29 President And Fellows Of Harvard College Harnessing cell dynamics to engineer materials
US9381235B2 (en) 2009-07-31 2016-07-05 President And Fellows Of Harvard College Programming of cells for tolerogenic therapies
US8728456B2 (en) 2009-07-31 2014-05-20 President And Fellows Of Harvard College Programming of cells for tolerogenic therapies
US9610328B2 (en) 2010-03-05 2017-04-04 President And Fellows Of Harvard College Enhancement of skeletal muscle stem cell engraftment by dual delivery of VEGF and IGF-1
US9693954B2 (en) 2010-06-25 2017-07-04 President And Fellows Of Harvard College Co-delivery of stimulatory and inhibitory factors to create temporally stable and spatially restricted zones
US9603894B2 (en) 2010-11-08 2017-03-28 President And Fellows Of Harvard College Materials presenting notch signaling molecules to control cell behavior
US9675561B2 (en) 2011-04-28 2017-06-13 President And Fellows Of Harvard College Injectable cryogel vaccine devices and methods of use thereof
US9486512B2 (en) 2011-06-03 2016-11-08 President And Fellows Of Harvard College In situ antigen-generating cancer vaccine

Also Published As

Publication number Publication date Type
US6429199B1 (en) 2002-08-06 grant
US20070065467A1 (en) 2007-03-22 application

Similar Documents

Publication Publication Date Title
Gürsel et al. Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide
Krieg CpG DNA: a pathogenic factor in systemic lupus erythematosus?
Krieg An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA
US7615539B2 (en) Nucleic acid-lipophilic conjugates
EP0855184A1 (en) Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
US20070184465A1 (en) Methods for regulating hematopoiesis using CpG-oligonucleotides
Dalpke et al. Phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo
US20040097719A1 (en) Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5&#39; ends
EP1393745A1 (en) Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5&#39;ends
US20040198685A1 (en) Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
Hartmann et al. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells
US20050004061A1 (en) Immunostimulatory nucleic acid molecules
US20020064515A1 (en) Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20020165178A1 (en) Immunostimulatory nucleic acids for the treatment of anemia, thrombocytopenia, and neutropenia
US20030181406A1 (en) CpG-like nucleic acids and methods of use thereof
US6476000B1 (en) Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
Rothenfusser et al. Plasmacytoid dendritic cells: the key to CpG1
US7615227B2 (en) Use of CpG oligodeoxynucleotides to induce angiogenesis
US20060094681A1 (en) Immunostimulatory oligonucleotide multimers
US20050215501A1 (en) Methods and products for enhancing epitope spreading
US20070142315A1 (en) Immunostimulatory oligoribonucleotides
US7405285B2 (en) Immunostimulatory oligonucleotide multimers
US7521063B2 (en) Multiple CPG oligodeoxynucleotides and their use to induce an immune response
Marshall et al. Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions
US20070224210A1 (en) Immunostimulatory nucleic acids

Legal Events

Date Code Title Description
AS Assignment

Owner name: PFIZER INC., NEW YORK

Free format text: CONFIRMATION OF EXCLUSIVE PATENT LICENSE;ASSIGNORS:COLEY PHARMACEUTICAL GROUP, INC.;COLEY PHARMACEUTICAL GROUP, LTD.;COLEY PHARMACEUTICAL, GMBH;REEL/FRAME:017353/0372

Effective date: 20050506

AS Assignment

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, IOWA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KRIEG, ARTHUR M.;HARTMANN, GUNTHER;REEL/FRAME:018256/0807;SIGNING DATES FROM 20020305 TO 20020308

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF IOWA;REEL/FRAME:021670/0798

Effective date: 20020814