US20030049736A1 - Expression control sequence - Google Patents

Expression control sequence Download PDF

Info

Publication number
US20030049736A1
US20030049736A1 US10/068,851 US6885102A US2003049736A1 US 20030049736 A1 US20030049736 A1 US 20030049736A1 US 6885102 A US6885102 A US 6885102A US 2003049736 A1 US2003049736 A1 US 2003049736A1
Authority
US
United States
Prior art keywords
expression control
control sequence
amino acid
segment
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/068,851
Other languages
English (en)
Inventor
Sergei Mashko
Danila Zimenkov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ajinomoto Co Inc
Original Assignee
Ajinomoto Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ajinomoto Co Inc filed Critical Ajinomoto Co Inc
Assigned to AJINOMOTO CO., INC. reassignment AJINOMOTO CO., INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MASHKO, SERGEI VLADIMIROVICH, ZIMENKOV, DANILA VADIMOVICH
Publication of US20030049736A1 publication Critical patent/US20030049736A1/en
Priority to US11/002,141 priority Critical patent/US7989611B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C12N15/71—Expression systems using regulatory sequences derived from the trp-operon

Definitions

  • the present invention relates to microbiological industry, in particular, to the development of the new approach of the regulated gene expression in bacterial cells.
  • the molecular mechanism of transcription attenuation in amino acid operons is based on the possibility of the alternative mRNA secondary structures formation in the so-called “attenuator” region depending on the translation of the “leader” peptide of which gene is located upstream from the first structural gene of the operon.
  • the coding part of the leader peptide gene is enriched by the codons of the sense amino acid (the codons of those amino acids whose biosynthesis are provided by the corresponding operons protein products: for the trp-operon there are the Trp-codons, for the his-operon —His-codons, for the thr-operon —Thr-and Ile-codons, etc).
  • the alternative mRNA secondary structures can be formed in case of transcription of the corresponding DNA fragments: the hairpins t1:t2 and t3:t4, or their alternative —t2:t3, can be formed for trp-leader, analogously, h1:h2, h3:h4 and h5:h6, or h2:h3 and h4:h5 can be formed for his-leader.
  • the hairpins t3:t4 and h5:h6 are the typical p-independent transcription terminators, so their formation during the elongation of transcription leads to termination in the attenuator regions of the corresponding operon preventing the expression of the structural genes of the operon.
  • the hairpins t1:t2 and then t3:t4 are formed step by step (its alternative —the hairpin t2:t3 could not be formed because t1:t2 has been appeared earlier) in case of trp-attenuator when the leader peptide has not been translated.
  • the faster obtaining of the hairpins h1:h2, h3:h4 and then h5:h6 prevents the formation of their alternative h2:h2 and h4:h5 in case of the synthesis of his-attenuator mRNA without translation of the corresponding leader peptide.
  • the ribosome translating the N-terminal part of the leader peptide releases the RNA polymerase followed by continuation of the elongation of transcription, so the alternative hairpin of the mRNA-2:3, can be formed.
  • the following events depend on the intracellular concentration of the charged-tRNA(s) of the sense amino acid, because the corresponding codons of the leader peptide gene have to be translated by the ribosome at this moment.
  • An object of the present invention is the creation of the new prokaryotic artificial regulatory system providing increase of the controlled gene expression as the result of increase of an intracellular concentration of the sense amino acid.
  • the present inventors have succeeded in creating a new artificial regulatory system depending on the intracellular amino acid concentration by the exploiting of the native regulatory mechanism based on the formation of the alternative secondary structures of mRNA in dependence on the efficiency of the leader peptide translation.
  • the new system unlike the natural attenuators of amino acid operons, provides not decrease, but increase of the controlled gene expression in case of excess of the sense amino acid intracellular concentration.
  • the level of expression of genes under the control of the new expression control sequence is decreased in the conditions of the sense amino acid starvation.
  • the present invention provides the expression control sequence as well as the expression control method and the production method using the expression control sequence, as mentioned below:
  • An expression control sequence which controls expression of a target gene linked downstream of the expression control sequence depending on an intracellular concentration of an amino acid, wherein in a bacterium which harbors a DNA construct comprising the expression control sequence, a promoter linked upstream of the expression control sequence and the target gene linked downstream of the expression control sequence, frequency of termination in the expression control sequence, of transcription starting from the promoter is lowered by increase of an intracellular concentration of an amino acid, whereby expression of the target gene increases.
  • the expression control sequence according to (9), the leader peptide has been modified to contain not less than 2 of tryptophan residues.
  • a method for producing a target substance comprising the steps of cultivating a bacterium capable of producing the substance to produce the substance and collecting the substance,
  • the bacterium harbors a DNA construct comprising the expression control sequence as defined in any of (1) to (10), a promoter linked upstream of the expression sequence and a target gene which has relationship to production of the target substance and is linked downstream of the expression control sequence, and an intracellular concentration of an amino acid on which expression control by the expression control sequence depend, is changed to control expression of the target gene.
  • the intracellular concentration of the amino acid is changed by synthesis or degradation of the amino acid by the bacterium.
  • an expression control sequence providing increase of the controlled gene expression by increasing an intracellular concentration of the sense amino acid.
  • expression of the target gene can be increased by increasing the intracellular concentration of the sense amino acid.
  • the production amount of the target substance can be increased by increasing the intracellular concentration of the sense amino acid, thus the target substance can be efficiently produced.
  • FIG. 1 shows the explanatory scheme of the structures and properties of the native attenuators and the expression control sequence (artificial anti-attenuator) of the present invention.
  • FIG. 2 shows detailed structures of the native attenuators and the artificial anti-attenuator.
  • a and B represent the proposed “downstream” boarder of the parts of mRNA which are protected by the ribosome stalling at “sense” codons (A) and terminating at the stop codon (B) of the “leader” peptide, respectively.
  • C represents the pause site of DNA transcription by E. coli RNA polymerase.
  • FIG. 3 shows the general scheme of construction of the artificial anti-attenuator.
  • the cross-in-circle mark represents nucleotide changing in comparison to the native sequence.
  • BI BamHI
  • Bg BglII
  • NI NdeI
  • XI XbaI
  • XI* XbaI(dam ⁇ ).
  • FIG. 4 shows the scheme of construction of the plasmid in Example 1.
  • FIG. 5 shows the structure of the P tac promoter from the plasmid pDR540.
  • the sequences of the “upstream” (III) and “downstream” (IV) primers for PCR are dot-meshed.
  • FIG. 6 shows the structure of chemically synthesized an3:an4(an4:an5) fragment and the way the fragment was inserted in the cloning vector.
  • FIG. 7 shows the structure of the native attenuator region of the E. coli trp-operon. Leader peptide is shown in capital italic letters.
  • FIG. 8 shows the structure of the intermediate construction including fusion between RBS of bacteriophage T7 gene10 and the leader region of trp operon. Leader peptide is shown in capital italic letters.
  • the expression control sequence of the present invention is an expression control sequence which controls expression of a target gene linked downstream of the expression control sequence depending on an intracellular concentration of an amino acid (sense amino acid),
  • the sense amino acid is not restricted provided that its aminoacyl tRNA can be synthesized and the synthesized aminoacyl tRNA can be used for translation of a protein in a bacterium for which the expression control sequence of the present invention is used.
  • the sense amino acid is tryptophan, histidine, phenylalanine, threonine, leucine, isoleucine, or valine.
  • Examples of the target gene include chloramphenicolacetyltransferase gene (cat), amino acid operons, genes of which protein products are involved in the biosynthesis of amino acids, nucleosides and nucleotides, and genes encoding the foreign protein products.
  • cat chloramphenicolacetyltransferase gene
  • amino acid operons genes of which protein products are involved in the biosynthesis of amino acids, nucleosides and nucleotides, and genes encoding the foreign protein products.
  • Examples of the promoter include P tac , and any other regulated and constitutive prokaryotic promoters.
  • Examples of the bacterium which harbors the DNA construct include bacteria belonging to the genuses Escherichia, Salmonella , and Serratia.
  • the lowering of frequency of termination in the expression control sequence, of transcription starting from the promoter by increase of an intracellular concentration of an amino acid, whereby expression of the target gene increases can be also determined according to the standard gene engineering techniques.
  • the intracellular concentration of the sense amino acid if a relationship between the intracellular and extracellular concentrations in the bacterium is known, the intracellular concentration is not necessary to be directly measured and the intracellular-concentration may be estimated based on the extracellular concentration such as a concentration in a medium.
  • the frequency of termination in the expression control sequence, of transcription starting from the promoter is not necessary to be directly measured either and it is sufficient to determine increase of the target gene expression.
  • the increase of the target gene expression can be determined by measuring an amount of the gene product of the target gene, or an activity of the gene product when the gene product has the activity.
  • An embodiment of the lowering of frequency of termination in the expression control sequence, of transcription starting from the promoter by increase of an intracellular concentration of an amino acid, whereby expression of the target gene increases is exemplified by an embodiment in which the transcription starting from the promoter is terminated in the expression control sequence when the intracellular concentration of the sense amino acid is not higher than a certain level, and the transcription is elongated when the intracellular concentration of the sense amino acid is higher than the certain level, thereby expressing the target gene.
  • the expression control sequence of the present invention preferably comprises a region coding for a leader peptide comprising the sense amino acid and a p-independent terminator, wherein when translation of the leader peptide stops at codon of the sense amino acid (sense codon) in the course of the translation in case of starvation of the sense amino acid, a base paring structure of the p-independent terminator is formed in a transcript of the expression control sequence, whereby the frequency of termination in the expression control sequence, of the transcription increases.
  • the length of the leader peptide is usually 14 to 32 residues.
  • the leader peptide usually contains 14 to 57%, preferably 30 to 45% of sense amino acid residues based on the total amino acid residues. As the proportion of the sense amino acid becomes large, control by the intracellular concentration of the sense amino acid becomes strict.
  • the p-independent terminator has a sequence which can form a base paring structure (hairpin) and terminates the transcription when the base paring structure is formed.
  • the p-independent terminator is preferably one which is capable of functioning in a bacterium belonging to the genus Escherichia, Salmonella , or Serratia.
  • the means of allowing the base paring structure of the p-independent terminator to be formed in the transcript of the expression control sequence when translation of the leader peptide stops at the sense codons in the course of the translation is exemplified by making the expression control sequence to comprise an odd number of not less than 3, of segments, wherein each of the segments can form a base paring structure together with its adjacent segment, and wherein in the transcript of the expression control sequence, when a segment or segments other than terminal segments each form a base paring structure with one of its two adjacent segments, the segment or segments each do not form a base paring structure with the other of the two adjacent segments; a first segment at an upstream terminal overlaps with the region interacting with the ribosome translating the leader peptide; a second segment adjacent to the first segment forms a base paring structure with a third segment adjacent to the second segment in the course of the translation of the leader peptide; and a base paring structure formed from the downstream terminal segment and its adjacent segment is the base paring structure of the
  • the formation of the base paring structure between the first segment and the second segment is blocked by stopping of the ribosome at the codon of the sense amino acid. Because of the mass of the ribosome, the ribosome covers a region of from about 17 bp upstream from the codon of the sense amino acid where the ribosome stops, to about 13 bp downstream from the codon of the sense amino acid. The region interacting with the ribosome means such a region which is covered by the ribosome.
  • the formation of the base paring structure between the first segment and the second segment is sufficiently blocked by stopping of the ribosome at the codon of the sense amino acid. For example, if the codon of the sense amino acid exists immediately before the termination codon of the leader peptide and the distance from the codon of the sense amino acid to the starting point of the first segment is within about 13 bp, the formation of the base paring structure between the first segment and the second segment can be blocked.
  • the first segment overlaps with the codon of the sense amino acid in the leader peptide.
  • the base paring structures between the second and the third, the forth and the fifth, . . . are formed and the final base paring structure functions as a terminator to terminate the transcription.
  • the sense amino acid is sufficiently provided and ribosome moves along mRNA to a stop codon at a sufficient rate to follow the progress of the transcription, resulting in block of up to the second segment by ribosome, the base paring structures between the third and the forth, . . . are formed to prevent formation of a terminator.
  • a pause site for RNA polymerase exists in the region encoding the C-terminal region of the leader peptide, or downstream from the region encoding the leader peptide, more preferably in a region from the second segment to the third segment.
  • the expression of the target gene may not be sufficiently controlled if translation associated with transcription does not sufficiently occur.
  • the number of the segments is, for example, 5.
  • the nucleotide sequence of each segment may be one which can form a base paring structure with its adjacent segment.
  • the sequence of each segment or a part thereof and the sequence of the adjacent segment or a part thereof may constitute an inverted repeat sequence.
  • the sequence constituting the inverted repeat may not be continuous. In other words, it may contain a part making no base pair within its sequence.
  • An example of the expression control sequence is one which comprises five segments an1 to an5 in order from an upstream side, wherein the segments an1 and an2, and a coding region coding for the leader peptide are derived from a sequence of an attenuator of a tryptophan operon of Escherichia coli the segments an4 and an5 are derived from a sequence of an attenuator of a histidine operon of Escherichia coli and the segment an3 is derived from a combination of the sequences of the attenuators of the tryptophan operon and the histidine operon.
  • the term “derived from” used herein means to have a sequence which is the same as or similar to the native sequence.
  • the means of obtaining the sequence is not restricted.
  • the sequence may be isolated from a biological material or chemically synthesized.
  • the similar sequence may be a sequence which has substitution, deletion or insertion of one or more nucleotides in the native sequence and which can form a base paring structure equivalent to that formed in the native sequence.
  • the leader peptide is preferably one which has been modified to contain not less than 2 of tryptophan residues. These tryptophan residues are preferably continuous.
  • the present invention is described with reference to the preferred example of the expression control sequence.
  • the expression control sequence is hereinafter referred to as an artificial anti-attenuator for convenience, sake.
  • FIG. 1 The biological properties of the artificial anti-attenuator are schematically presented in the FIG. 1.
  • the undisrupted hairpin an2:an3 of the anti-attenuator would conduct to formation of the hairpin an4:an5 which is the part of the typical p-independent transcription terminator.
  • the efficient translation of the leader peptide in case of excess of the sense amino acid would lead to the disruption of the hairpin an2:an3 of the artificial anti-attenuator followed by the formation of the alternative hairpin an3:an4 that prevents the termination prior to transcription of the distal (downstream) genes, because the terminator hairpin an4:an5 could not be formed.
  • the construction of the artificial anti-attenuator has been designed on the basis of two well-known native attenuators of the E. coli trp-and his-operons. It is used the native leader peptide gene of the trp-operon (trpL) with two controlling Trp-codons in its structural part, as for the leader peptide of the artificial anti-attenuator.
  • trpL native leader peptide gene of the trp-operon
  • TrpL trpL
  • the artificial anti-attenuator has been synthesized using the standard gene engineering techniques (including the PCR-driven amplification of the native fragment of the trp-attenuator, chemical synthesis of the oligonucleotides etc.) as schematically presented in the FIG. 3.
  • Two different types of the artificial anti-attenuators have been obtained.
  • the native ribosome binding site (RBS) of trpL has been used for providing the translation initiation of the leader peptide in the artificial anti-attenuator of the first type —anti-attenuator-I.
  • More efficient RBS of phage T7 gene10 has been inserted in the 5′-region of the leader peptide gene in the second —anti-attenuator-II.
  • the both artificial anti-attenuators have been cloned in the vector plasmid downstream the high-efficient promoter P tac and upstream of the structural part of cat gene with its own RBS.
  • the cat gene encoding the chloramphenicolacetyltransferase (CAT), has been used as a reporter and its level of expression could give the information concerning of the function efficiency of the created regulatory elements in dependence on the intracellular concentration of the sense amino acid —Trp.
  • the several control recombinant plasmids have been constructed on the basis of the same vector.
  • the first plasmid carries the native attenuator of the trp-operon —trpL.
  • the second the potential transcription terminator —the 3′-terminal DNA fragment of the anti-attenuators providing the formation of the terminator hairpin an4:an5.
  • the third plasmid carries the longer 3′-terminal DNA fragment of the anti-attenuators that could not provide the formation of the terminator hairpin an4:an5, because the potential alternative hairpin an3:an4 has to be formed first during the mRNA synthesis.
  • the level of CAT activity does not depend on the addition of the Trp to the cells carrying the plasmids without the coding part of the trpL.
  • the theoretical difference in the achieved level of CAT activities depending on the process of the alternative mRNA secondary structure formation could be evaluated on the basis of the obtained results for the control plasmids encoding the “terminator” and “antiterminator” hairpins.
  • the 20-th fold of transcription increase could be achieved in case of formation of the “antiterminator” structure in comparison with the p-independent transcription termination in the 3′-part of the artificial anti-attenuators.
  • the determined level of CAT activity has been higher in case of exploiting of the plasmid with the native trp-attenuator: the increased level has been achieved in case of Trp-derived starvation, than after addition of Trp to the growing plasmid-carrier bacteria.
  • the concrete achieved level of CAT activity (17 units) could not be compared with the maximum level (60 units). That is because, at first, the Trp-derived starvation in case of bacterial growing, does not guarantee the maximal efficiency of the trpL readthrough transcription.
  • the expression control method of the present invention is a method for controlling an expression of a target gene, comprising the steps of:
  • DNA construct and the bacterium harboring the DNA construct may be as described above with respect to the expression control sequence.
  • the culture conditions are not restricted provided that the bacterium can survive.
  • the conditions are properly selected depending on the bacterium.
  • the method of changing an intracellular concentration of the sense amino acid is exemplified by a method of changing a concentration of the sense amino acid in the medium in which the bacterium is cultured, a method of changing an amount of synthesis or degradation of the sense amino acid in cells.
  • the change of the target gene expression can be determined by measuring an amount of the gene product of the target gene, or an activity of the gene product when the gene product has the activity.
  • the production method of the present invention is a method for producing a target substance comprising the steps of cultivating a bacterium capable of producing the substance to produce the substance and collecting the substance,
  • the bacterium harbors a DNA construct comprising the expression control sequence of the present invention, a promoter linked upstream of the expression sequence and a target gene which has relationship to production of the target substance and is linked downstream of the expression control sequence, and an intracellular concentration of an amino acid (sense amino acid) on which expression control by the expression control sequence depend, is changed to control expression of the target gene.
  • target substance examples include CAT, and other prokaryotic enzymes, foreign protein products, amino acids, nucleotides and nucleosides, vitamins, and other biological active substances.
  • Examples of the bacterium capable of producing the target substance include bacteria belonging to the genuses Escherichia, Salmonella , and Serratia.
  • the culture conditions are not restricted provided that the bacterium capable of producing the target substance can produce the target substance.
  • the conditions are properly selected depending on the bacterium.
  • Cultivation is usually carried out under an aerobic condition for 10 to 50 hours.
  • the cultivation temperature is usually controlled at 28 to 37° C.
  • pH is usually controlled at 6.6 to 7.4 during cultivation.
  • Inorganic or organic, acidic or alkaline substances as well as ammonia gas or the like can be used for pH adjustment.
  • the medium may be an ordinary medium containing a carbon source, a nitrogen source, organic ions and optionally other organic components.
  • the carbon source it is possible to use sugars such as glucose, lactose, galactose, fructose, sucrose or starch hydrolysate; alcohols such as glycerol or sorbitol; or organic acids such as fumaric acid, citric acid or succinic acid.
  • sugars such as glucose, lactose, galactose, fructose, sucrose or starch hydrolysate
  • alcohols such as glycerol or sorbitol
  • organic acids such as fumaric acid, citric acid or succinic acid.
  • the nitrogen source it is possible to use inorganic ammonium salts such as ammonium sulfate, ammonium chloride or ammonium phosphate; organic nitrogen such as soybean hydrolysate; ammonia gas; or aqueous ammonia.
  • inorganic ammonium salts such as ammonium sulfate, ammonium chloride or ammonium phosphate
  • organic nitrogen such as soybean hydrolysate
  • ammonia gas or aqueous ammonia.
  • vitamin B 1 or yeast extract It is desirable to allow required substances such as vitamin B 1 or yeast extract to be contained in appropriate amounts as organic trace nutrients.
  • potassium phosphate, magnesium sulfate, iron ion, manganese ion and the like are added in small amounts, if necessary.
  • Collection of the target substance from a culture such as cells and a culture medium can be usually carried out by combining an ion exchange resin method, a precipitation method and other known methods.
  • the DNA construct may be as described above with respect to the expression control sequence provided that a gene which has relationship to production of the target substance is used as the target gene.
  • the target gene which has relationship to production of the target substance include biosynthesis genes for the target substance, genes for production of energy and related substances such as intermediates used for biosynthesis of the target substance, regulatory genes therefor and the like.
  • Specific examples thereof include L-tryptophan biosynthetic genes, L-serine biosynthetic genes (for L-tryptophan biosynthesis, in particular), pntAB genes, genes of H + -ATPase.
  • L-tryptophan is used as the sense amino acid and an L-serine biosynthetic gene, as the target gene, is linked downstream from the expression control sequence of the present invention in an L-tryptophan-producing bacterium
  • the expression of the L-serine biosynthetic gene increases when an intracellular accumulation amount of L-tryptophan increases.
  • the time when the intracellular accumulation amount of L-tryptophan increases is also a time when L-serine which is one of substrates for L-tryptophan biosynthesis decreases. Therefore, the expression of the L-serine biosynthetic gene can be increased only when L-serine decreases.
  • the L-serine biosynthetic gene can not be always, highly expressed in the L-tryptophan-producing bacterium, because a high concentration of L-serine is harmful to growth of cells. It is accordingly appreciated that the expression control sequence of the present invention is very useful when it is intended to increase the expression of the L-serine biosynthetic gene in the L-tryptophan-producing bacterium.
  • the bacterium which is capable of producing the target substance and harbors the DNA construct may be obtained by allowing a bacterium capable of producing the target substance to harbor the DNA construct or conferring the ability to produce the target substance on a bacterium harboring the DNA construct.
  • the allowing the bacterium to harbor the DNA construct can be carried out according to standard gene engineering techniques.
  • the conferring of the ability to produce the target substance can be carried out according to the known method. For example, when the target substance is CAT, a method of introduction of a DNA encoding the chloramphenicol acetyl transferase can be used.
  • the method of changing an intracellular concentration of the sense amino acid is exemplified by a method of changing a concentration of the sense amino acid in the medium in which the bacterium is cultured, a method of changing an amount of synthesis or degradation of the sense amino acid in cells.
  • the method of changing an amount of synthesis or degradation of the sense amino acid in cells is preferable, because the production of the target substance can be couple with the production of an intermediate and the like for the target substance production.
  • the change of the target gene expression can be determined by measuring an amount of the gene product of the target gene, or an activity of the gene product when the gene product has the activity.
  • Example 1 Construction of the recombinant plasmids carrying the native attenuator and the artificial anti-attenuators and their fragments.
  • the synthetic p-independent transcription terminator of the E. coli thr-operon leader peptide has been constructed due to the annealing of two chemically synthesized oligonucleotides with the following structures: I - 5′-ctagaaagcttaacacagaaaaaagcccgc (SEQ ID NO:4) acctgacagtgcgggctttttttcgaccactgca gg- ⁇ 3′, and II - 5′-gatccctgcagtggtcgaaaaaaaaagcc (SEQ ID NO:5) cgcactgtcaggtgcgggcttttttctgtgttaagc tt ⁇ 3′.
  • This fragment has been phosphorylated by T4 polynucleotidekinase according to the standard procedure and cloned in the plasmid pML-pp-vector cleaved by XbaI and BamHI.
  • the correlation between the desired and obtained plasmid structure has been established due to restriction analysis and DNA sequencing of the inserted fragment.
  • oligonucleotides carried the sequences upstream (III) and downstream (IV) of the promoter as presented in the FIG. 5. Moreover, they carried the sequences recognized by several (KpnI and XbaI) restriction endonucleases (see, FIG. 5) for convenience of the following molecular cloning.
  • the amplified DNA fragment has been treated by KpnI and XbaI followed by its molecular cloning in the previously obtained (see, item 1.2) vector plasmid cleaved by the same restrictases.
  • the selected recombinant plasmid has been named as PML-P tac ⁇ ter_thr_icat and used as a vector in the further experiments.
  • oligonucleotides 5′-cagagctctagaagttcacgtaaaagggtatcgac-3′; (SEQ ID NO:8) olig2: 5′-gtatcgcatatgaaagcaattttcgtactgaaagg-3′; (SEQ ID NO:9) olig3: 5′-gtctgagatctagtatctgattgctttacgcatggtg-3′; (SEQ ID NO:10) olig4: 5′-atcataggatcctaattttgttcaaaaaaaaagcccgctcatt-3′; (SEQ ID NO:11) o
  • oligonucleotides have been used as the primers for the PCR-driven DNA amplification, as described below.
  • This plasmid has been constructed on the basis of pML-P tac ⁇ ter _thr ⁇ cat due to insertion of the double-stranded DNA fragment created from the chemically synthesized oligonucleotides (olig6, olig7, olig8 and olig9), instead of ter_thrL between promoter P tac and the structural part of cat-gene (see, FIG. 6).
  • oligonucleotides olig6, olig7, olig8 and olig9
  • ter_thrL between promoter P tac and the structural part of cat-gene
  • MBI Fermentas T4 DNA ligase
  • the plasmid DNA has to be provided from the E. coli (dam ⁇ ) strain because the XbaI-restriction site in theese plasmids is overlapped with the GATC-sequence, which is a target of the Dam-driven DNA modification, and so the plasmid DNA purified from the E. coli (dam + ) strain could not be cleaved by XbaI. Ligation has been performed with 3 u of T4 DNA Ligase at +4° C.
  • the obtained mixture was treated with BamHI (“MBI Fermentas”, Lithuania) according to the standard protocol.
  • BamHI MBI Fermentas”, Lithuania
  • this DNA mixture has been diluted to 60 ⁇ l volume of T4 DNA Ligase buffer and has been treated with 5 units of T4 DNA Ligase overnight at +4° C.
  • the resulting mixture has been transformed to the strain HB101 and colonies have been screened for desired construction. So, the plasmid pML-P tac -an3:an4(an4:an5)-cat has been obtained and its structure has been confirmed by restriction analysis and DNA sequencing according to the standard Sanger's procedure. We suspect, that the obtained plasmid carries the DNA fragment which is transcribed, could provide the formation of anti-terminator hairpin an3:an4 (the terminator hairpin an4:an5 could not form because an3:an4 being synthesized earlier).
  • the second oligonucleotide, cat3′ corresponds to the fragment of the coding part of the cat-gene (position +219 ⁇ +245, if A from ATG-initiation codon of CAT is numbered as “+1”) (see, FIG. 6).
  • the double-stranded DNA fragment obtained due to PCR has been treated by XbaI, ligated with the vector plasmid pML-P tac ⁇ ter _thrL ⁇ cat cleaved by the same restrictase, followed by BamHI-treatment and recyclization of the product by T4 DNA ligase. So, the plasmid of interest, named pML-P tac -an 4 :an 5 -cat, has been obtained.
  • these primers carry in addition the flanking XbaI and BamHI (in olig1 and olig4, correspondingly) recognition sites for the convenience of the following manipulation.
  • the double-stranded DNA fragment 175 bp in length has been treated by XbaI and BamHI followed by its cloning in the vector plasmid pML-P tac ⁇ ter_thrL ⁇ cat cleaved by the same restrictases.
  • the obtained plasmid carrying the native trpL-gene instead of ter_thrL in the vector plasmid was named as pML-P tac -trpL-cat.
  • the above described plasmid pML-P tac -trpL-cat has been used as a template in PCR for creation of the next recombinant DNA.
  • the previously described oligonucleotide, olig1, as well as the olig3 has been used as the primers.
  • the olig3 corresponds to the central part of the native trpL-gene and carries in addition the Bg/II-recognition site at its 5′-terminus (see, FIG. 7).
  • the obtained double-stranded fragment 133 bp in length has been treated by XbaI, ligated with the plasmid pML-P tac -an3:an4(an4:an5)-cat cleaved by the same restrictase, followed by hydrolysis of the product by Bg/II and recyclization by T4 DNA ligase.
  • the obtained plasmid carrying the artificial anti-attenuator between P tac -promoter and the structural part of the cat-gene was named as pML-P tac -anti_att-I-cat.
  • the restriction site for NdeI has been reconstructed upstream of ATG-initiating codon of the leader peptide (the nucleotides of ATG-codon are the part of the sequence CATATG recognized by NdeI).
  • the obtained DNA fragment cleaved by NdeI has been ligated with the commercially available (“Novagen”, USA) plasmid vector pET- 22 b(+) treated by NdeI.
  • the plasmid pET- 22 b(+) carries RBS of T7 gene10 between XbaI and NdeI restriction sites.
  • the product of this ligation has been used as a template for the PCR at the next stage of construction.
  • the new oligonucleotide cr5′ (see, FIG.
  • Example 2 The detection of the accumulation levels of Cat protein in strains carrying the recombinant plasmids with the native trpL, the artificial anti-attenuators and their fragments.
  • Coil B7248 (trpB ⁇ :Tn 10 , Sty) according to the standard experimental protocols with the selection of the plasmid-carrier cells on the medium with the ampicillin (100 ⁇ g/ml) addition (Sambrook et al., “Molecular cloning. Laboratory manual”. (1989) Second Edition, Cold Spring Harbor Laboratory Press). The obtained cell cultures were grown in the tubes with the liquid medium at 37° C. with good aeration.
  • the L-broth with the ampicillin addition was used for the TG 1 -driven plasmid-carrier strains and the minimal M 9 -media with ampicillin (100 ⁇ g/ml), thiamine (5 ⁇ g/ml) and tryptophan (10 ⁇ g/ml) for the strains constructed on the basis of E. coli B7248.
  • Each of the culture media was divided into two parts and tryptophan (200 ⁇ g/ml) was added to the one of two portions.
  • the chloramphenicol-acetyltransferase activity was measured according to the conventional method (Schottel JL, Sninsky JJ, Cohen SN “Effects of alterations in the translation control region on bacterial gene expression: use of cat gene constructs transcribed from the lac promoter as a model system.” Gene, 28 (1984) 177-193).
  • the 5,5′-dithio-bis(2-nitrobenzoic acid) the Ellman's reagent (“Sigma”) was used as the specific reagent.
  • the obtained results are shown in Table 1 of the main text.
  • SDS-PAGE (0.1%SDS ⁇ 12.5% PAAG electrophoresis) was performed for visualizing the accumulated CAT in the E. coli TGl-driven plasmid-carrier strains. The each strain was grown as described above. Each culture was divided into two parts. The cultures were supplemented with IPTG (up to 0.4 mM of the final concentration) and had been cultured for 2 hours. Then the cells were harvested, resuspended in SDS-sample loading buffer (60 mM Tris-HCl pH6.8/2.3% SDS/10% glycerol/5% ⁇ -mercaptoethanol), and boiled for 15 minutes.
  • SDS-sample loading buffer 60 mM Tris-HCl pH6.8/2.3% SDS/10% glycerol/5% ⁇ -mercaptoethanol
US10/068,851 2001-02-22 2002-02-11 Expression control sequence Abandoned US20030049736A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/002,141 US7989611B2 (en) 2001-02-22 2004-12-03 Expression control sequence

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2001104817 2001-02-22
RU2001104817/13A RU2225442C2 (ru) 2001-02-22 2001-02-22 Рекомбинантная днк для контроля экспрессии, способ контроля экспрессии целевого гена, способ получения целевого вещества

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/002,141 Continuation US7989611B2 (en) 2001-02-22 2004-12-03 Expression control sequence

Publications (1)

Publication Number Publication Date
US20030049736A1 true US20030049736A1 (en) 2003-03-13

Family

ID=20246294

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/068,851 Abandoned US20030049736A1 (en) 2001-02-22 2002-02-11 Expression control sequence
US11/002,141 Expired - Fee Related US7989611B2 (en) 2001-02-22 2004-12-03 Expression control sequence

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/002,141 Expired - Fee Related US7989611B2 (en) 2001-02-22 2004-12-03 Expression control sequence

Country Status (7)

Country Link
US (2) US20030049736A1 (de)
EP (1) EP1234883B1 (de)
JP (1) JP4352650B2 (de)
CN (1) CN1236064C (de)
BR (1) BR0200509A (de)
DE (1) DE60225366T2 (de)
RU (1) RU2225442C2 (de)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EA021205B1 (ru) * 2009-03-10 2015-04-30 ДСМ АйПи АССЕТС Б.В. Способ повышения выхода полипептидов
CN102333870B (zh) * 2011-02-16 2014-01-29 中国水产科学研究院黄海水产研究所 一种提高蛋白表达效率的方法及表达载体
CN107236738B (zh) * 2017-05-27 2020-08-25 中国科学院微生物研究所 色氨酸衰减子突变体及其应用以及解除色氨酸衰减子反馈阻遏的方法
CN107287197B (zh) * 2017-06-01 2020-07-07 中国科学院微生物研究所 组氨酸衰减子突变体和解决反馈阻遏的组氨酸操纵子以及它们的应用

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8431818D0 (en) 1984-12-17 1985-01-30 Bujard H Expression control sequence
FR2666588B1 (fr) 1990-09-10 1994-02-11 Pasteur Institut Sequence nucleotidique regulatrice de l'initiation de transcription.
ATE278788T1 (de) * 1995-07-26 2004-10-15 Pioneer Hi Bred Int Expressionskontrollesequenz zur allgemeinen und effektiven genexpression in pflanzen

Also Published As

Publication number Publication date
RU2225442C2 (ru) 2004-03-10
BR0200509A (pt) 2002-10-01
CN1375556A (zh) 2002-10-23
DE60225366T2 (de) 2009-03-12
DE60225366D1 (de) 2008-04-17
US20050266525A1 (en) 2005-12-01
US7989611B2 (en) 2011-08-02
CN1236064C (zh) 2006-01-11
JP4352650B2 (ja) 2009-10-28
EP1234883A1 (de) 2002-08-28
JP2002320495A (ja) 2002-11-05
EP1234883B1 (de) 2008-03-05

Similar Documents

Publication Publication Date Title
US6291245B1 (en) Host-vector system
EP4105229A1 (de) Mikroorganismus mit varianter lyse und verfahren zur produktion von l-aminosäure unter verwendung derselben
EP1794299B1 (de) Wirt-vektor-system zur antibiotika-freien vermehrung von cole1-plasmiden
CA2549037C (en) Expression vector and use thereof
Yang et al. Translation of trpG in Bacillus subtilis is regulated by the trp RNA-binding attenuation protein (TRAP)
CN111278852A (zh) 重组欧氏杆菌天冬酰胺酶的生产方法
KR101877286B1 (ko) 만노오스 프로모터를 포함하는 벡터 및 만노오스 프로모터
US20080233614A1 (en) Production of recombinant collagenases colg and colh in escherichia coli
CN111278979A (zh) 重组大肠杆菌天冬酰胺酶的生产方法
US20030049736A1 (en) Expression control sequence
Rule et al. Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli
US6617130B1 (en) DNA construct for regulating the expression of a polypeptide coding sequence in a transformed bacterial host cell
WO2023046153A1 (en) Circular rna and preparation method thereof
EP2292769A1 (de) Fermentierungsverfahren
KR20210002575A (ko) 단백질의 분비 생산법
JP3549210B2 (ja) プラスミド
KR102142255B1 (ko) Crm197 단백질 발현 방법
EP1188823B1 (de) Transformierte mikroorganismen und verfahren zur herstellung von d-aminoacylase
JP6697525B2 (ja) キノリン酸を生産する組み換え微生物、及びそれを利用したキノリン酸の生産方法
KR101175725B1 (ko) 신규한 그람 양성균 박테리아 발현 시스템
KR102099342B1 (ko) Crm197 단백질 발현 방법
EP4083064A1 (de) Mikroorganismus zur herstellung von l-aminosäure mit erhöhter cytochrom-c-aktivität und l-aminosäureherstellungsverfahren unter verwendung desselben
JPH0928380A (ja) ニトリラーゼ遺伝子発現に関わる調節因子およびその遺伝子
Trepod et al. Modification of the carboxy-terminal amino acid sequence alters the Escherichia coli expression of a gene encoding multiple repeats of a bovine growth hormone releasing factor analog
KR100220894B1 (ko) 포스포리불로키나제를 융합파트너로 이용하는 대장균용 융합단백질 발현벡터

Legal Events

Date Code Title Description
AS Assignment

Owner name: AJINOMOTO CO., INC., JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MASHKO, SERGEI VLADIMIROVICH;ZIMENKOV, DANILA VADIMOVICH;REEL/FRAME:012857/0583

Effective date: 20020111

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION