Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
  • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
  • C12Y302/01014—Chitinase (3.2.1.14)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/10—Antimycotics
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
  • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
  • C12N9/2405—Glucanases
  • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
  • C12N9/2442—Chitinase (3.2.1.14)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the present invention relates generally to human chitinase enzyme and more specifically to novel purified and isolated polynucleotides encoding human chitinase, to the chitinase products encoded by the polynucleotides, to materials and methods for the recombinant production of chitinase products and to antibody substances specific for the chitinase.
• Chitin is a linear homopolymer of ⁇ -(1 ,4)-linked N-acetylglucosamine residues. This polysaccharide is second only to cellulose as the most abundant organic substance.
• the exoskeleton of arthropods is composed of chitin.
• fungi and other parasites contain chitin in their outer cell wall, where it serves important structural and protective roles. Disruption of the fungal cell wall and membrane has been a useful therapeutic strategy against fungi and parasites. For example, Amphotericin B and fluconazole exert their anti-fungal activity by affecting membrane steroids. Despite the existence of anti-fungal therapeutics, fungal infections of humans have increasingly become responsible for life-threatening disorders.
• the fungal species and parasites responsible for these diseases are mainly Candida, Aspergillus, Cryptococcus, Histoplasma, Coccidioides and Pneumocystis. These pathogens are particularly dangerous in immunocompromised individuals, such as patients with AIDS, patients undergoing chemotherapy, and immunosuppressed organ transplant patients.
• Chitin can be degraded by the enzyme chitinase.
• Chitinase enzymes are found in plants, microorganisms, and animals. Bacterial chitinase helps to provide a carbon source for bacterial growth. Insects produce chitinase to digest their cuticle at each molt. In plants, chitinase is thought to provide a protective role against parasitic fungi.
• Chitinases have been cloned from numerous bacterial [e.g., Serratia marcescens , Jones et al., EMBO J., 5:467-473 (1986)], plant [e.g., tobacco, Heitz et al., Mol. Gen. Genet., 245:246-254 (1994)], and insect [e.g., wasp, Krishnan et al., J. Biol. Chem., 269:20971-20976 (1994)] species.
• Renkema et al., J. Biol. Chem., 270:2198-2202 (February 1995) prepared a human chitotriosidase from the spleen of a Gaucher disease patient.
• the present invention provides novel purified and isolated polynucleotides (i.e., DNA and RNA, both sense and antisense strands) encoding human chitinase or fragments and analogs thereof; methods for the recombinant production of chitinase polypeptides, fragments and analogs thereof; purified and isolated chitinase polypeptide fragments and analogs; antibodies to such polypeptides, fragments and analogs; and pharmaceutical compositions comprising these polypeptides, fragments, analogs, or antibodies.
• polynucleotides i.e., DNA and RNA, both sense and antisense strands
• Preferred DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences.
• the nucleotide sequence of two human cDNAs encoding presumed allelic variants of human chitinase, and including noncoding 5′ and 3′ sequences, are set forth in SEQ ID NO: 1 and SEQ ID NO: 3.
• Preferred DNAs of the present invention comprise the human chitinase coding region (corresponding to nucleotides 2 to 1402 of SEQ ID NO: 1 or nucleotides 27 to 1427 of SEQ ID NO: 3), and the putative coding sequence of the mature, secreted human chitinase protein without its signal sequence (nucleotides 65 to 1402 of SEQ ID NO: 1, or nucleotides 90 to 1427 of SEQ ID NO: 3).
• Exemplary stringent hybridization conditions are as follows: hybridization at 42° C. in 50% formamide and washing at 60° C. in 0.1 ⁇ SSC, 0.1% SDS. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
• SEQ ID NOS: 2 and 4 Two amino acid sequences for human chitinase(s) are set forth in SEQ ID NOS: 2 and 4.
• the sequence of SEQ ID NO: 2 is encoded by the nucleotide sequence of SEQ ID NO: 1
• SEQ ID NO: 4 is encoded by the nucleotide sequence of SEQ ID NO: 3.
• Preferred polynucleotides of the present invention include, in addition to those polynucleotides described above, polynucleotides that encode amino acids ⁇ 21 to 445 of SEQ ID NO: 2 or SEQ ID NO: 4, and that differ from the polynucleotides described in the preceding paragraphs only due to the well-known degeneracy of the genetic code.
• polynucleotides include those encoding polypeptides comprising amino acids 1 to 445 of SEQ ID NO: 2 or SEQ ID NO: 4.
• polynucleotides of the present invention is use as a hybridization probe, to identify and isolate genomic DNA encoding human chitinase; to identify and isolate non-human genes encoding proteins homologous to human chitinase; to identify human and non-human proteins having similarity to human chitinase (including those that may be involved in tissue remodeling); and to identify those cells which express human chitinase and the biological conditions under which this protein is expressed.
• the invention includes biological replicas (i.e., copies of isolated DNA sequences made in vivo or in vitro) of DNA sequences of the invention.
• Autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating chitinase polynucleotides, including any of the DNAs described above, are provided.
• Preferred vectors include expression vectors in which the incorporated chitinase-encoding cDNA is operatively linked to an endogenous or heterologous expression control sequence and a transcription terminator.
• Such expression vectors may further include polypeptide-encoding DNA sequences operably linked to the chitinase-encoding DNA sequences, which vectors may be expressed to yield a fusion protein comprising the polypeptide of interest.
• procaryotic or eucaryotic host cells are stably transformed or transfected with DNA sequences of the invention in a manner allowing the desired chitinase product to be expressed therein.
• Host cells expressing chitinase products can serve a variety of useful purposes. Such cells constitute a valuable source of immunogen for the development of antibody substances specifically immunoreactive with chitinase.
• Host cells of the invention are useful in methods for the large scale production of chitinase wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated, e.g., by immunoaffinity purification, from the cells or from the medium in which the cells are grown.
• Chitinase products may be obtained as isolates from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving procaryotic or eucaryotic host cells of the invention.
• Chitinase products of the invention may be full length polypeptides, fragments or analogs thereof.
• Chitinase products having part or all of the amino acid sequence set out in SEQ ID NO: 2 or SEQ ID NO: 4 are contemplated.
• One preferred fragment which lacks the C-terminal seventy-two amino acid residues of the mature protein is set forth in SEQ ID NO: 14. It has been determined that these seventy-two C-terminal residues are not critical to chitinase enzymatic activity.
• Example 5 illustrates production of this C-terminal fragment; the introduction of a stop codon after the codon for amino acid 373 resulted in a recombinant chitinase fragment of about 39 kDa that retained similar specific activity when compared with full length recombinant human chitinase.
• Analogs may comprise chitinase analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of one or more of the enzymatic activities or immunological characteristics specific to chitinase; or (2) with specific disablement of a particular biological activity of chitinase.
• Example 3 illustrates the production of such an analog (SEQ ID NO: 15), in which the proline at position 370 is substituted with a serine, and in which the C-terminal seventy-two amino acid residues have been deleted.
• mammalian host cells is also expected to provide for post-translational modifications (e.g., myristolation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention.
• post-translational modifications e.g., myristolation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation
• Proteins or other molecules that bind to chitinase may be used to modulate its activity.
• antibody substances e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like
• Proteins or other molecules e.g., small molecules which specifically bind to chitinase can be identified using chitinase isolated from plasma, recombinant chitinase, chitinase variants or cells expressing such products.
• Binding proteins are useful, in turn, in compositions for immunization as well as for purifying chitinase, and are useful for detection or quantification of chitinase in fluid and tissue samples by known immunological procedures.
• Anti-idiotypic antibodies specific for chitinase-specific antibody substances are also contemplated.
• DNA/DNA hybridization procedures carried out with DNA sequences of the invention under conditions of stringency standard in the art are likewise expected to allow the isolation of DNAs encoding human allelic variants of chitinase, other structurally related human proteins sharing one or more of the biochemical and/or immunological properties of chitinase, and non-human species proteins homologous to chitinase.
• the DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or “knockout” strategies [see, e.g., Kapecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express a functional chitinase enzyme, overexpress chitinase enzyme, or express a variant chitinase enzyme.
• Polynucleotides of the invention when suitably labelled are useful in hybridization assays to detect the capacity of cells to synthesize chitinase.
• Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in the chitinase locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of chitinase by those cells which ordinarily express the same.
• chitinase preparations of the invention to mammalian subjects, especially humans, for the purpose of ameliorating disease states caused by chitin-containing parasites such as fungi is contemplated by the invention.
• Pathogenic fungi cause serious, often fatal disease in immunocompromised hosts. Cancer patients undergoing chemotherapy, immunosuppressed individuals, and HIV-infected individuals are susceptible to mycoses caused by Candida, Aspergillus, Pneumocystis carinii , and other fungi.
• Amphotericin B and fluconazole are useful therapeutics for fungal infections, but toxicity associated with these drugs causes serious adverse side effects that limit their usefulness.
• chitinase compositions for use in methods for treating a mammal susceptible to or suffering from fungal infections comprising administering chitinase to the mammal in an amount sufficient to supplement endogenous chitinase activity.
• the chitinase may be administered with other conventional anti-fungal agents, including amphotericin B and the structurally related compounds nystatin and pimaricin; 5-fluorocytosine; azole derivatives such as fluconazole, ketoconazole, clotrimazole, miconazole, econazole, butoconazole, oxiconazole, sulconazole, terconazole, itraconazole and tioconazole; allylamines-thiocarbamates, such as tolnaftate, naftifine and terbinafine; griseofulvin; ciclopirox olamine; haloprogin; undecylenic acid; and benzoic acid.
• amphotericin B and the structurally related compounds nystatin and pimaricin including amphotericin B and the structurally related compounds nystatin and pimaricin; 5-fluorocytosine; azole derivatives
• Chitinase may improve the effectiveness of these conventional anti-fungal agents, perhaps by rendering the yeast more susceptible to their action, even in situations where the chitinase alone is not effective for inhibiting growth of fungi. By reducing the amount of conventional anti-fungal agent needed to exert the desired therapeutic effect, chitinase may allow the drugs to be used at less toxic levels.
• Therapeutic/pharmaceutical compositions contemplated by the invention include chitinase and a physiologically acceptable diluent or carrier and may also include other anti-fungal agents. Dosage amounts indicated would be sufficient to supplement endogenous chitinase activity. For general dosage considerations see Remington: The Science and Practice of Pharmacy, 19th ed., Mack Publishing Co., Easton, Pa. (1995). Dosages will vary between about 1 ⁇ g/kg to 100 mg/kg body weight, and preferably between about 0.1 to about 20 mg chitinase/kg body weight. Therapeutic compositions of the invention may be administered by various routes depending on the infection to be treated, including via subcutaneous, intramuscular, intravenous, intrapulmonary, transdermal, intrathecal, topical, oral, or suppository administration.
• the invention also contemplates that the overexpression of chitinase in Gaucher disease or at sites of inflammation (such as in rheumatoid arthritis) may have deleterious effects on the extracellular matrix and, in such disease settings, inhibitors of chitinase activity may provide therapeutic benefit, e.g. by reducing remodeling or destruction of the extracellular matrix.
• the human chitinase CDNA of the present invention was isolated from a macrophage cDNA library. Macrophages are known to be closely associated with rheumatoid arthritis lesions [Feldman et al., Cell, 85:307-310 (1996)], and macrophage products such as TNF- ⁇ are implicated in disease progression. A protein with homology to human chitinase, C-gp39, has been detected in the synovium and cartilage of rheumatoid arthritis patients. While the natural substrate for human chitinase is probably chitin from pathogenic organisms, the enzyme may also exhibit activity on endogenous macromolecules which form the natural extracellular matrix.
• hyaluronic acid a major component of the extracellular matrix, contains a core of chitin oligomers.
• Chitinase may therefore be involved in degradation of extracellular matrix in diseases such as rheumatoid arthritis.
• the role of chitinase may be determined by measuring chitinase levels and/or the effects of chitinase administration or chitinase inhibition in synovial fluid isolated from arthritic joints. Endogenous chitinase levels can be measured by enzymatic assay or with an antibody. Viscosity of synovial fluid can be measured before and after chitinase treatment; a decrease of viscosity associated with chitinase would be consistent with an endogenous chitinase substrate. Modulation of chitinase activity could thereby modulate the progression of joint destruction in rheumatoid arthritis.
• Also contemplated by the invention are methods for screening for inhibitors of chitinase activity, which may be useful in the manner described in the preceding paragraph.
• a method for screening samples to identify agents that inhibit chitinase is reported in, e.g., WO 95/34678 published Dec. 21, 1995.
• chitinase levels are a diagnostic marker for Gaucher's disease.
• Hollak et al., J. Clin. Invest., 93:1288-1292 (1994) report that plasma chitinase levels are a diagnostic marker for Gaucher's disease.
• the recombinant proteins of this invention are expected to be more useful than preparations purified from humans, which have associated problems of yield and contamination with other impurities or infectious agents.
• Example 1 describes the isolation of human chitinase cDNA clones from a human macrophage cDNA library.
• Example 2 addresses the pattern of chitinase gene expression in various human tissues.
• Example 3 describes the recombinant expression of the human chitinase gene in prokaryotic cells and purification of the resulting enzyme.
• Example 4 provides a protocol for the recombinant production of human chitinase in yeast.
• Example 5 describes the recombinant expression of the human chitinase gene in mammalian cells and purification of the resulting protein.
• Example 6 describes production of human chitinase polypeptide analogs by peptide synthesis or recombinant production methods.
• Example 7 provides a protocol for generating monoclonal antibodies that are specifically immunoreactive with human chitinase.
• Example 8 describes an assay for the measurement of chitinase catalytic activity.
• Example 9 addresses determination of the anti-fungal activity of human chitinase in vitro.
• Example 10 addresses determination of the anti-fungal activity of human chitinase in vivo in a mouse model, and Examples 11 through 14 address rabbit models of invasive aspergillosis, disseminated candidiasis, Candida ophthalmitis, and Candida endocarditis.
• a cDNA library was prepared from peripheral blood monocyte-derived macrophages as described in Tjoelker et al., Nature, 374:549-552 (1995). Clones from the library were randomly chosen and plasmid DNA was purified from individual clones. The sequence of approximately 300 to 500 bases from the end of DNA from each clone was determined on an automated sequencer (Model 373, Applied Biosystems, Foster City, Calif.) using primer JHSP6, which hybridizes to the plasmid vector pRc/CMV (Invitrogen, San Diego, Calif. ) adjacent to the cDNA cloning site: JHSP6: 5′-GACACTATAGAATAGGGC-3′ (SEQ ID NO:5)
• the twenty-two amino acids following the putative signal sequence exactly match the amino-terminal sequence of purified human chitotriosidase reported in Renkema et al., supra. Renkema et al. also described a twenty-one amino acid sequence from a tryptic fragment of human chitotriosidase which corresponds exactly to residues 157 to 177 of MO-218 (SEQ ID NO: 2).
• Boot et al., supra report the cloning of a human chitotriosidase cDNA which contains a coding sequence essentially identical to that of MO-218.
• the sequence of MO-218 differs from Boot et al. by an additional fourteen nucleotides at the 5′ end and by a nucleotide change at nucleotide 330 in the coding region.
• probe P-1 TGGGATCATCAGCAGGACCATGAAACCTGCCCAGGCCACAGACCGCACCAT , SEQ ID NO: 6
• Probe P-1 was designed to hybridize with clones that are at least as long as MO-218 at the 5′ end.
• the probe was hybridized with a portion (approximately 30,000 clones) of the human macrophage cDNA library described above, in 40% formamide and hybridization buffer (5 ⁇ SSPE, 10 ⁇ Denhardt's, 100 ⁇ g/ml denatured salmon sperm DNA, and 2% SDS) at 42° C. overnight.
• the filters were washed and three clones that hybridized were chosen for sequence /analysis.
• the longest clone was designated pMO-13B (deposited on Jun. 7, 1996 under the terms of the Budapest Treaty with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852, U.S.A. under Accession No. 98078).
• the DNA sequence of pMO-13B is set forth in SEQ ID NO: 3 and the encoded amino acid sequence is set forth in SEQ ID NO: 4.
• This clone contains 25 additional nucleotides at the 5′ end compared with MO-218; in addition, MO-13B (SEQ ID NO: 3) contains one nucleotide substitution at nucleotide 330 (corresponding to nucleotide 305 of MO-218, SEQ ID NO: 1) which changes the encoded amino acid at position 80 of the mature protein from a glycine (in SEQ ID NO: 2) to a serine (in SEQ ID NO: 4).
• Northern blot analysis was performed to identify tissues in which the human chitinase is expressed.
• a multiple human tissue Northern blot (Clontech, Palo Alto Calif. ) was hybridized with the entire coding region of MO-218 under standard stringent conditions (according to the Clontech laboratory manual). Greatest hybridization was observed to lung tissue (+++) and ovary (+++), with much smaller levels (+) in thymus and placenta.
• the size of the hybridizing mRNA was 2.0 kb for lung, ovary and thymus, which corresponds well with the size of the cloned cDNA (1.6 kb, or about 1.8 kb including the polyA tail).
• the size of the hybridizing placental mRNA was considerably smaller, at 1.3 kb. Chitinase hybridization was not observed in spleen, prostate, testes, small intestine, colon, peripheral blood leukocytes, heart, brain, liver, skeletal muscle, kidney, or pancreas. Chitinase expression in lung is consistent with a protective role against pathogenic organisms that contain chitin, since the lung represents the primary route of entry for fungal pathogens.
• the mature coding region of MO-218 was engineered for expression in E. coli as a C-terminal truncated analog. PCR was used to generate a DNA fragment for expression using a primer corresponding to nucleotides 65 to 88 of the MO-218 chitinase cDNA preceded by an initiating methionine codon and an XbaI restriction endonuclease site (5′-ACATCTAGAATTATGGCAAAACTGGTCTGCTACTTCACC-3′, SEQ ID NO: 7), and a downstream primer encoding nucleotides 1163 to 1183 of MO-218 followed by a stop codon and a HindIII site (5′-AGATCTAACCTTAGGTGCCTGAAGACAAGTATGG-3′, SEQ ID NO: 8).
• the downstream primer contained an adenine at base 25, while the MO-218 sequence contains a guanine at the corresponding nucleotide position. Consequently, the resulting DNA fragment contains a thymine rather than a cytosine at the position corresponding to nucleotide 1172 of the MO-218 sequence, and the encoded chitinase fragment, set forth in SEQ ID NO: 15, is also an analog that contains a serine at mature amino acid position 370 instead of the proline encoded by MO-218.
• the resulting DNA fragment was digested with XbaI and HindIII and cloned into plasmid pAraBAD (which is also known by the designation pAraCB).
• Plasmid pAraCB was prepared as follows. Plasmid pUC19 was modified to include an arabinose promoter and subsequently to include AKAP 79 encoding sequences.
• the arabinose promoter [Wilcox et al., Gene 34:123-128 (1985); Wilcox, et al., Gene 18:157-163 (1982)] and the araC gene were amplified by PCR from the arabinose operon BAD of Salmonella typhimurium as an EcoRI/XbaI fragment with the primers araC-2 (SEQ ID NO: 9) and arab-1 (SEQ ID NO: 10): araC-2 TACA GAATTC TTA TTCACATCCGGCCCTG SEQ ID NO:9 arab-1 TACA TCTAGA CTCC ATCCAGAAAAACAGGTATGG SEQ ID NO:10
• Primer araC-2 encodes an EcoRI site (underlined) and a termination codon (italics) for the araC gene product.
• Primer arab-1 encodes a putative ribosome binding domain (italics) and an XbaI restriction site (underlined). PCR with these primers produced a 1.2 kb fragment which was digested with EcoRI and XbaI and subcloned into pUC19 (New England Biolabs, Beverly, Me.) previously digested with the same two enzymes.
• the resulting plasmid was designated araCB and contained a polylinker region (SEQ ID NO: 11) flanked at the 5′, end with a XbaI restriction site (underlined) and at the 3′ end with a HindIII site (italics).
• Transformants containing the resulting expression plasmid were induced with arabinose and grown at 37° C. These transformants produced inclusion bodies containing a 39 kDa protein which was a truncated form of chitinase (engineered to contain 373 instead of 445 amino acids). This chitinase fragment contains four cysteine residues, while the full length chitinase contains ten cysteine residues.
• the inclusion bodies were separated from the E. coli culture and electrophoresed on SDS-PAGE. The 39 kDa band was transferred to a PVDF membrane and amino terminal sequenced.
• the majority (about two-thirds) of the material contained a sequence corresponding to the amino terminus of human chitinase.
• the remaining material corresponded to a contaminating E. coli protein, porin.
• This recombinant chitinase preparation from E. coli was useful for producing polyclonal and monoclonal antibodies (described below in Example 7).
• Secretion signal peptides include, e.g., SUC2 or equivalent leaders with a functional signal peptidase cleavage site, or pre-pro-alpha factor or other complex leader composed of a pre, or signal peptide, and a pro, or spacer region, exhibiting a KEX2 cleavage site.
• the DNA encoding the signal sequence can be obtained by oligonucleotide synthesis or by PCR.
• the DNA encoding the pre-pro-alpha factor leader is obtained by PCR using primers containing nucleotides 1 through 20 of the alpha mating factor gene and a primer complementary to nucleotides 255 through 235 of this gene [Kurjan and Herskowitz, Cell, 30:933-943 (1982)].
• the pre-pro-alpha leader coding sequence and human chitinase coding sequence fragments are ligated into a plasmid containing the yeast alcohol dehydrogenase (ADH2) promoter, such that the promoter directs the expression of a fusion protein.
• ADH2 yeast alcohol dehydrogenase
• the vector further includes an ADH2 transcription terminator downstream of the cloning site, the yeast “2-micron” replication origin, a selectable marker, for example TRP1, CUP1 or LEU2 (or LEU2-d) or other equivalent gene, the yeast REP1 and REP2 genes, the E. coli beta lactamase gene, and an E. coli origin of replication.
• the beta-lactamase and TRP1 genes provide for selection in bacteria and yeast, respectively.
• the REP1 and REP2 genes encode proteins involved in plasmid copy number replication.
• Truncates of the coding region may be used to increase homogeneity of the product, increase the specific activity or alter the substrate specificity.
• the DNA constructs described in the preceding paragraphs are transformed into yeast cells using a known method, e.g. lithium acetate treatment [Stearns et al., Meth. Enz., supra, pp. 280-297] or by equivalent methods.
• the ADH2 promoter is induced upon exhaustion of glucose in the growth media [Price et al., Gene, 55:287 (1987)].
• the pre-pro-alpha sequence or other leader sequence effects secretion of the fusion protein, releasing the mature human chitinase peptide from the cells.
• the signal peptide leader is processed by signal peptidase or, in the case of pre-pro-alpha removal of the pro region, by the KEX2 protease [Bitter et al., Proc. Natl. Acad. Sci. USA, 81:5330-5334 (1984)].
• Chitinase contains in its mature amino acid sequence two dibasic sequences at positions 107-108 (Lys-Arg) and 209-210 (Arg-Lys) that may be proteolytically clipped by the KEX2 protease during secretion. To stabilize and/or increase the level of product secreted from cells, these sequences could be mutated to eliminate the potential sites for proteolysis as shown by Gillis et al. [ Behring Inst. Mitt. , No. 83:1-7 (1988)] or by expressing chitinase without dibasic modifications in a host that is deficient in KEX2.
• Such hosts can be obtained either by screening for non-KEX2 protease containing mutants, or by manipulation of the genomic KEX2 locus by gene replacement/gene disruption techniques [Orr-Weaver et al., Proc. Natl. Acad. Sci , USA, 78:6354-6358 (1981)].
• Recombinant chitinase may be secreted from Saccharomyces cerevisiae using similar vectors containing alternative promoters PRB1, GAL4, TPI, or other suitably strong promoters bearing fragments or by fusion to a variety of leader sequences [Sleep et al., Bio/Technol., 8:42-46 (1990)].
• Non- Saccharomyces cerevisiae suitable expression hosts include Kluyveromyces lactis, Schizosaccharomyces pombe, Pichia pastoris and members of the Hansenula or Aspergillus geni.
• Analogous recombinant expression systems for these fungi include the organism and their appropriate autonomously replicating vector [e.g. Falcone et al., Plasmid, 15:248-252 (1988)] or multiply integrated expression cassettes. These systems also rely on signal sequences or leaders of the types described above to mediate secretion into the medium.
• the secreted recombinant human chitinase is purified from the yeast growth medium by, e.g., the methods used to purify chitinase from bacterial and mammalian cell supernatants (see Example 3 above and Example 5 below).
• the mature form of the recombinant chitinase product may be expressed in the cytoplasms of the Saccharomyces cerevisiae cells or analogous host, and purified from the lysed host cells.
• the protein may be refolded during the act of purification to obtain appropriate levels of specific activity.
• MO-218 clone and the MO-13B clone both of which contain full length human chitinase cDNA 3′ to the CMV promoter of pRc/CMV, were isolated.
• a third plasmid which corresponded to the same C-terminal fragment expressed in bacterial cells in Example 3 above, was prepared as follows.
• the MO-218 plasmid was amplified by PCR using oligonucleotide primer 218-1 (CGCAAGCTTGAGAGCTCCGTTCCGCCACATGGTGCGGTCTGTGGCCTGGG, SEQ ID NO: 12), which contains a Hind m site and nucleotides 2 through 23 of the MO-218 chitinase cDNA of SEQ ID NO: 1, and with complementary downstream primer T-END (GACTCTAGACTAGGTGCCTGAAGGCAAGTATG, SEQ ID NO: 13), which contains nucleotides 1164 through 1183 of MO-218, a stop codon and an XbaI site.
• oligonucleotide primer 218-1 CGCAAGCTTGAGAGCTCCGTTCCGCCACATGGTGCGGTCTGTGGCCTGGG, SEQ ID NO: 12
• T-END complementary downstream primer T-END
• the amplified DNA was purified by electrophoresis, digested with XbaI and HindIII, and cloned into the pRc/CMV vector (Invitrogen, San Diego, Calif.) previously cut with the same restriction enzymes.
• the junctions of the resulting clone was sequenced on a Model 373 (Applied Biosystems, Foster City, Calif.) and encoded the predicted engineered protein sequence, set forth in SEQ ID NO: 14.
• Recombinant human chitinase was purified as follows. Five days after transfection of COS cells with the pRc/CMV-MO-13B plasmid, conditioned media from the culture was harvested and diluted with an equal volume of water. The diluted conditioned media was applied to a Q-Sepharose Fast Flow column (Pharmacia Biotech, Uppsala, Sweden) which was pre-equilibrated in 25 mM Tris, 10 mM sodium chloride, 1 mM EDTA, at pH 8.0. Approximately 95 % of the chitinase activity flowed through and did not bind to the column.
• This Q-Sepharose flow through was adjusted to 1.2 M ammonium sulfate and applied to a Butyl-Sepharose 4 Fast Flow column (Pharmacia) which was pre-equilibrated in 25 mM Tris, 1.2 M ammonium sulfate, 1 mM EDTA, at pH 8.0. Protein was eluted using a reverse gradient of 1.2 M to 0 M ammonium sulfate in 25 mM Tris, pH 8.0. A single absorbance peak at 280 nm corresponding to the chitinase activity peak was eluted at low salt. This material was greater than 85% pure as determined by SDS-PAGE and contained approximately 60% of the chitinase activity.
• the protein was then concentrated and buffer exchanged into 20 mM Tris, 150 mM sodium chloride, at pH 8.0 using a 10,000 MWCO membrane (Ultrafree 10 K, Millipore Corp., Bedford, Me.). This preparation was then tested for enzymatic and anti-fungal activity in vitro as described in Examples 8 and 9 below.
• the recombinant preparation had a chitotriosidase activity of 90 nm/min per mg protein.
• Recombinant techniques such as those described in the preceding examples may be used to prepare human chitinase polypeptide analogs or fragments. More particularly, polynucleotides encoding human chitinase are modified to encode polypeptide analogs of interest using well-known techniques, e.g., site-directed mutagenesis and polymerase chain reaction. C-terminal and N-terminal deletions may also be prepared by, e.g., deleting the appropriate portion of the polynucleotide coding sequence. See generally Sambrook et al., supra, Chapter 15. The modified polynucleotides are expressed recombinantly, and the recombinant polypeptide analogs or fragments are purified as described in the preceding examples.
• Residues critical for human chitinase activity are identified, e.g., by homology to other chitinases and by substituting alanines for the native human chitinase amino acid residues. Cysteines are often critical for the functional integrity of proteins because of their capacity to form disulfide bonds and restrict secondary structure. To determine whether any of the cysteines in human chitinase are critical for enzymatic activity, each cysteine is mutated individually to a serine.
• a 39 kDa C-terminally truncated fragment of the mature human chitinase protein was prepared as described above in Examples 3 and 5 by introduction of a stop codon after the codon for amino acid 373.
• This 39 kDa fragment lacked seventy-two C-terminal amino acid residues of the mature protein, including six cysteines, yet retained similar specific enzymatic activity compared to the full length recombinant human chitinase. This result indicates that the missing seventy-two C-terminal residues, including the six cysteines, are not required for enzymatic activity.
• C-terminal deletions may be prepared, e.g., by digesting the 3′ end of the truncated human chitinase coding sequence described in Example 3 with exonuclease III for various amounts of time and then ligating the shortened coding sequence to plasmid DNA encoding stop codons in all three reading frames.
• N-terminal deletions are prepared in a similar manner by digesting the 5′ end of the coding sequence and then ligating the digested fragments into a plasmid containing a promoter sequence and an initiating methionine immediately upstream of the promoter site. These N-terminal deletion analogs or fragments may also be expressed as fusion proteins.
• human chitinase polypeptide analogs may also be prepared by full or partial chemical peptide synthesis using techniques known in the art.
• techniques known in the art See, e.g., synthesis of IL-8 in Clark-Lewis et al., J. Biol Chem., 266:23128-34 (1991); synthesis of IL-3 in Clarke-Lewis et al., Science, 231:134-139 (1986); and synthesis by ligation in Dawson et al., Science, 266:776-779 (1994).
• Such synthetic methods also allow the selective introduction of novel, unnatural amino acids and other chemical modifications.
• the following two protocols may be used to generate monoclonal antibodies to human chitinase.
• a mouse is injected periodically with recombinant human chitinase (e.g., 10-20 ⁇ g emulsified in Freund's Complete Adjuvant) obtained as described in any of Examples 3 through 6.
• the mouse is given a final pre-fusion boost of human chitinase in PBS, and four days later the mouse is sacrificed and its spleen removed.
• the spleen is placed in 10 ml serum-free RPMI 1640, and a single cell suspension is formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum-free RPMI 1640, supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 ⁇ g/ml streptomycin (RPMI) (Gibco, Canada).
• RPMI streptomycin
• the cell suspension is filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, N.J.), and is washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum-free RPMI.
• Splenocytes taken from three naive Balb/c mice are prepared in a similar manner and used as a control.
• NS-1 myeloma cells kept in log phase in RPMI with 11 % fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, are centrifuged at 200 g for 5 minutes, and the pellet is washed twice as described in the foregoing paragraph.
• FBS fetal bovine serum
• the pellet After discarding the supernatant, the pellet is resuspended in 200 ml RPMI containing 15% FBS, 100 ⁇ M sodium hypoxanthine, 0.4 ⁇ M aminopterin, 16 ⁇ M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5 ⁇ 10 6 splenocytes/ml and plated into 10 Corning flat-bottom 96-well tissue culture plates (Corning, Corning N.Y.).
• Plates are washed three times with PBS with 0.05% Tween 20 (PBST) and 50 ⁇ l culture supernatant is added. After incubation at 37° C. for 30 minutes, and washing as above, 50 ⁇ l of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pa.) diluted 1:3500 in PBST is added. Plates are incubated as above, washed four times with PBST, and 100 ⁇ L substrate, consisting of 1 mg/ml o-phenylene diamine (Sigma) and 0.1 ⁇ l/ml 30% H 2 O 2 in 100 mM Citrate, pH 4.5, are added.
• PBST 0.05% Tween 20
• the color reaction is stopped after 5 minutes with the addition of 50 ⁇ l of 15% H 2 SO 4 .
• a 490 is read on a plate reader (Dynatech). Selected fusion wells are cloned twice by dilution into 96-well plates and visual scoring of the number of colonies/well after 5 days.
• the monoclonal antibodies produced by hybridomas are isotyped using the Isostrip system (Boehringer Mannheim, Indianapolis, Ind.).
• a second protocol utilizing a single-shot intrasplenic immunization may be conducted generally according to Spitz, Methods Enzymol., 121:33-41 (1986).
• the spleen of the animal is exposed and injected with recombinant human chitinase (e.g., 10-20 ⁇ g in PBS at a concentration of about 0.02% to 0.04%, with or without an aluminum adjuvant) obtained as described in any of Examples 3 through 6, after which the spleen is returned to the peritoneal cavity and the animal is stitched closed.
• the mouse is sacrificed and its spleen removed.
• a spleen cell suspension is prepared, washed twice with RPMI 1640 supplemented with 3 % fetal calf serum (FCS), and resuspended in 25 ml of the same medium.
• Myeloma cells (NS-O) are collected at logarithmic growth phase, washed once and added to the spleen cell suspension in a 50 ml tube, at a ratio of 3:1 or 2:1 (spleen cells:myeloma cells).
• the mixture is pelleted at about 450 g (1500 rpm), the supernatant aspirated, and the pellet loosened by tapping the tube. Fusion is performed at room temperature by adding 1 ml of polyethylene glycol (PEG) 1500 over 1 minute, with constant stirring.
• PEG polyethylene glycol
• the mixture is incubated for another minute, then 1 ml of warm RPMI (30 to 37° C.) is added over 1 minute followed by 5 ml RPMI over 3 minutes and another 10 ml RPMI over another 3 minutes.
• the cell suspension is centrifuged and resuspended in about 200 ml of HAT selective medium consisting of RPMI 1640 supplemented with 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 20% FCS, 100 mM hypoxanthine, 0.4 mM aminopterin and 16 mM thymidine.
• the cell suspension is dispensed in 1 ml volumes into tissue culture plates and incubated at 37° C.
• Chitotriosidase activity was measured using the fluorogenic substrate 4-methylumbelliferyl- ⁇ -D-N,N′,N′′-triacetylchitotriose (4 MU-chitotrioside, Sigma Chemical, St. Louis, Mo.) in McIlvain buffer (Hollak et al., supra).
• Ten ⁇ l samples of the recombinant product were combined with 10 ⁇ l bovine serum albumin (10 mg/ml), 15 ⁇ l fluorogenic substrate (2.71 mM), and 65 ⁇ l buffer (0.1 M citric acid, 0.2 M sodium phosphate, pH 5.2) in a total volume of 100 ⁇ l. Reactions were incubated at 37° C.
• the signal produced with diluted purified recombinant chitinase in the assay was then used to interpolate the nm quantity of substrate cleaved by the enzyme during the reaction time. This number was then divided by the concentration of protein to obtain the nm/min per mg protein (determined by A 280 and calculated molar extinction coefficient).
• the chitotriosidase activity of the recombinant human chitinase from Example 5 was determined to be 90 nm/min per mg protein.
• mice can be sacrificed and fungal load can be determined in specific organs such as kidney, lung, liver and spleen.
• mice are challenged with lower doses of Candida (1'10 6 CFU), in which case survival can be measured at more distant time points, e.g., 45 days.
• Effective anti-fungal agents enhance the long term survival of animals and reduce fungal load in blood and organs.
• the rabbits are given cyclophosphamide (200 mg) intravenously to render them leukopenic, followed by triamcinolone acetonide (10 mg) subcutaneously each day for the duration of the experiment.
• the animals are challenged intravenously with about 10 6 (lethal challenge) or about 10 5 (sublethal challenge) A. fumigatus conidia.
• Anti-fungal therapy (chitinase alone, or in combination with other conventional anti-fungal agents, e.g., amphotericin B, fluconazole, or 5-fluorocytosine) is initiated at 24 hours after challenge or 48 hours before challenge (for prophylaxis) and is continued for 5 to 6 days or until death.
• conventional anti-fungal agents are 1.5 or 0.5 mg/kg/day intravenous amphotericin B, 60 or 120 mg/kg/day oral fluconazole and 100 mg/kg/day oral 5-fluorocytosine. Control rabbits are not treated with any anti-fungal agent.
• pulmonary aspergillosis may be evaluated in this model generally according to Chilvers et al., Mycopathologia, 108:163-71 (1989), in which the immunosuppressed rabbits are challenged with intratracheal instillation of Aspergillus fumigatus conidia, followed by bronchoalveolar lavage on days 1, 2, 4, 7 and 10 following challenge; fungal culture, chitin assay, white cell counts and histopathology are performed on the lavage fluids to determine infective load within the lung. Effective fungal agents reduce the infective load or inflammation within the lung.
• the vitreous turbidity is graded on a scale, and the fundus appearance may be graded and documented by fundus photography.
• the rabbits are then randomized to the following treatment conditions: chitinase alone for 2 to 4 weeks, a combination of chitinase and another conventional anti-fungal agent (e.g., amphotericin B, fluconazole or 5-fluorocytosine) for 2 to 4 weeks, or no treatment (control).
• exemplary doses of conventional anti-fungal agents are 80 mg/kg/day of oral fluconazole and 100 mg/kg every 12 hours of oral 5-fluorocytosine.
• the treatment effect is assessed at 2 and 4 weeks after therapy by indirect ophthalmoscopy, quantitative fungal culture, and histopathology.
• quantitative fungal culture the eyes are dissected and weighed, and a weighed fraction of each sample is homogenized and cultured on brucella agar-5 % horse blood plates for 48 hours at 35° C. in 5 to 10% CO 2 .
• the homogenized sample may also be diluted 10- or 100-fold with sterile saline before plating.
• the colonies are counted and the total CFU in the eye calculated on the basis of the growth yielded from the measured fractions of sample.
• Treatment effect is assessed in terms of a reduction in the total intraocular fungal burden.
• a rabbit model of Aspergillus endophthalmitis may be used generally according to Jain et al., Doc. Ophthalmol. , 69:227-235 (1988). Briefly, New Zealand white rabbits are inoculated in one eye with about forty spores of Aspergillus fumigatus . Their contralateral (control) eyes receive a similar but sterile inoculum. After treatment with the test drug (chitinase alone, or chitinase in combination with another agent), the rabbits' eyes may be evaluated for clinical appearance, electroretinogram waveforms, indirect ophthalmoscopy, quantitative fungal culture, and histopathology. Clinically evident endophthalmitis typically develops within three to seven days after inoculation.
• Infective endocarditis is then established 48 hours after catheterization by intravenous injection of about 2 ⁇ 10 7 C. albicans blastospores .
• C. parapsilosis may be used.
• Anti-fungal therapy (chitinase or chitinase in combination with another conventional anti-fungal agent) is initiated either 24 hours before or 24 to 60 hours after fungal challenge. Therapy is continued daily for 9 or 12 days.
• Exemplary doses of conventional anti-fungal agents are 1 mg/kg/day intravenous amphotericin B, 50 mg/kg/day or 100 mg/kg/day intravenous or intraperitoneal fluconazole. Control rabbits are given no anti-fungal agent.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• Medicinal Chemistry (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Oncology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Communicable Diseases (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)
• Polysaccharides And Polysaccharide Derivatives (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (15)

Applications Claiming Priority (1)

Related Child Applications (1)

Publications (1)

Family

ID=24662596

Family Applications (2)

Family Applications After (1)

Country Status (14)

Cited By (3)

Families Citing this family (8)

Family Cites Families (4)

• 1996
  • 1996-06-14 US US08/663,618 patent/US20030017570A1/en not_active Abandoned
• 1997
  • 1997-06-16 BR BR9709721A patent/BR9709721A/pt not_active Application Discontinuation
  • 1997-06-16 PL PL97337060A patent/PL337060A1/xx unknown
  • 1997-06-16 SK SK1697-98A patent/SK169798A3/sk unknown
  • 1997-06-16 CA CA002257829A patent/CA2257829A1/en not_active Abandoned
  • 1997-06-16 CZ CZ984035A patent/CZ403598A3/cs unknown
  • 1997-06-16 CN CN97197145A patent/CN1236393A/zh active Pending
  • 1997-06-16 AU AU33978/97A patent/AU731203B2/en not_active Ceased
  • 1997-06-16 HU HU0001644A patent/HUP0001644A3/hu unknown
  • 1997-06-16 WO PCT/US1997/010460 patent/WO1997047752A1/en not_active Application Discontinuation
  • 1997-06-16 EP EP97930059A patent/EP0918870A1/en not_active Withdrawn
  • 1997-06-16 IL IL12756897A patent/IL127568A0/xx unknown
  • 1997-06-16 JP JP50188998A patent/JP2001510325A/ja not_active Ceased
  • 1997-06-16 US US08/877,599 patent/US6372212B1/en not_active Expired - Fee Related
• 1998
  • 1998-12-11 NO NO985806A patent/NO985806L/no not_active Application Discontinuation

Also Published As

Similar Documents

Legal Events