PL419484A1 - Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it - Google Patents

Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it

Info

Publication number
PL419484A1
PL419484A1 PL419484A PL41948416A PL419484A1 PL 419484 A1 PL419484 A1 PL 419484A1 PL 419484 A PL419484 A PL 419484A PL 41948416 A PL41948416 A PL 41948416A PL 419484 A1 PL419484 A1 PL 419484A1
Authority
PL
Poland
Prior art keywords
detecting
oligonucleotide primers
fungal pathogen
puccinia striiformis
application
Prior art date
Application number
PL419484A
Other languages
Polish (pl)
Other versions
PL232090B1 (en
Inventor
Adam Kuzdraliński
Anna Kot
Hubert Szczerba
Michał Nowak
Paweł Muzyka
Michał Lechowski
Agnieszka Ostrowska
Marta Muszyńska
Zdzisław TARGOŃSKI
Original Assignee
Uniwersytet Przyrodniczy W Lublinie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Uniwersytet Przyrodniczy W Lublinie filed Critical Uniwersytet Przyrodniczy W Lublinie
Priority to PL419484A priority Critical patent/PL232090B1/en
Publication of PL419484A1 publication Critical patent/PL419484A1/en
Publication of PL232090B1 publication Critical patent/PL232090B1/en

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Zgłoszenie dotyczy oligonukleotydów, umożliwiających stwierdzanie obecności materiału genetycznego patogenu grzybowego Puccinia striiformis w badanym materiale biologicznym z wykorzystaniem łańcuchowej reakcji polimerazy lub jej modyfikacji. Przedmiot zgłoszenia stanowi para specyficznych gatunkowo starterów oligonukleotydowych do zastosowania w reakcji łańcuchowej polimerazy lub jej modyfikacji, o sekwencjach: LidPs9: 5' TCGGTAAAACTGCACCAATACCT 3' LidPs10: 5' TCCCAACAGTCCCCTTCTGT 3' komplementarnych do specyficznych gatunkowo fragmentów sekwencji genomu Puccinia striiformis. Zgłoszenie obejmuje też sposób wykrywania patogenu grzybowego pszenicy Puccinia striiformis, w którym dochodzi do amplifikacji określonego fragmentu DNA o długości 220 - 260 par zasad w reakcji PCR z zastosowaniem pary starterów oligonukleotydowych.The application relates to oligonucleotides enabling the presence of the genetic material of the fungal pathogen Puccinia striiformis to be tested in the biological material tested using the polymerase chain reaction or its modification. The subject of the application is a pair of species-specific oligonucleotide primers for use in the polymerase chain reaction or its modification, with the sequences: LidPs9: 5 'TCGGTAAAACTGCACCAATACCT 3' LidPs10: 5 'TCCCAACAGTCCCCTTCTGT 3' complementary to the species-specific genomic stain fragment fragments. The application also includes a method of detecting the fungal pathogen of wheat Puccinia striiformis in which a specific fragment of DNA with a length of 220 - 260 base pairs is amplified in a PCR reaction using a pair of oligonucleotide primers.

PL419484A 2016-11-17 2016-11-17 Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it PL232090B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PL419484A PL232090B1 (en) 2016-11-17 2016-11-17 Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PL419484A PL232090B1 (en) 2016-11-17 2016-11-17 Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it

Publications (2)

Publication Number Publication Date
PL419484A1 true PL419484A1 (en) 2018-05-21
PL232090B1 PL232090B1 (en) 2019-05-31

Family

ID=62142448

Family Applications (1)

Application Number Title Priority Date Filing Date
PL419484A PL232090B1 (en) 2016-11-17 2016-11-17 Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it

Country Status (1)

Country Link
PL (1) PL232090B1 (en)

Also Published As

Publication number Publication date
PL232090B1 (en) 2019-05-31

Similar Documents

Publication Publication Date Title
JP2016195614A5 (en)
EP4410978A3 (en) Methods for quantitative genetic analysis of cell free dna
WO2015123430A3 (en) Single molecule electronic multiplex snp assay and pcr analysis
SA516371691B1 (en) Methods and compositions for dna profiling
NZ723570A (en) Compositions and methods for quantifying a nucleic acid sequence in a sample
MX2017001405A (en) Detection of target nucleic acids using hybridization.
EA201692157A1 (en) SYNTHESIS OF TWO-CELLULAR NUCLEIC ACIDS
WO2015114469A3 (en) Covered sequence conversion dna and detection methods
GB2519465A (en) Solid matrix for one step nucleic acid amplification
EA201491821A1 (en) MODIFIED oligonucleotides, including thiol functional groups, and their use for the detection of nucleic acids
PL419484A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it
PL419483A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it
PL419488A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it
PL419482A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it
PL419487A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it
PL419486A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it
PL419485A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it
PL419489A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it
PL419494A1 (en) Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it
EP2562254A4 (en) Novel dna methylation analysis method
PL431170A1 (en) Oligonucleotide primers hybridizing within the Cyp51 gene for detecting the wheat fungal pathogen Zymoseptoria tritici causing septoria leaf blotch, and method of its detection
UA103102U (en) Method of detecting of dna bacteria yersinia enterocolitica by polymerase chain reaction
AR109017A1 (en) METHODS FOR USING LONG SINGLE CHAIN DNA POLYUCLEOTIDES AS PRIMERS IN PCR TESTS
EP3305913A4 (en) Nucleic acid detection method, nucleic acid quantitative determination method, nucleic acid base sequence identification method, nucleic acid mutation or polymorphism identification method, nucleic acid detection kit, and reaction chip
UA110546C2 (en) Method for the detection of dna of bacteria chlamydia abortus, chlamydia pecorum, chlamydia psittaci in polymerase chain reaction by amplification of gene fragment encoding endoribonuclease p (rnase p rna)