PL419484A1 - Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it - Google Patents
Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting itInfo
- Publication number
- PL419484A1 PL419484A1 PL419484A PL41948416A PL419484A1 PL 419484 A1 PL419484 A1 PL 419484A1 PL 419484 A PL419484 A PL 419484A PL 41948416 A PL41948416 A PL 41948416A PL 419484 A1 PL419484 A1 PL 419484A1
- Authority
- PL
- Poland
- Prior art keywords
- detecting
- oligonucleotide primers
- fungal pathogen
- puccinia striiformis
- application
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Zgłoszenie dotyczy oligonukleotydów, umożliwiających stwierdzanie obecności materiału genetycznego patogenu grzybowego Puccinia striiformis w badanym materiale biologicznym z wykorzystaniem łańcuchowej reakcji polimerazy lub jej modyfikacji. Przedmiot zgłoszenia stanowi para specyficznych gatunkowo starterów oligonukleotydowych do zastosowania w reakcji łańcuchowej polimerazy lub jej modyfikacji, o sekwencjach: LidPs9: 5' TCGGTAAAACTGCACCAATACCT 3' LidPs10: 5' TCCCAACAGTCCCCTTCTGT 3' komplementarnych do specyficznych gatunkowo fragmentów sekwencji genomu Puccinia striiformis. Zgłoszenie obejmuje też sposób wykrywania patogenu grzybowego pszenicy Puccinia striiformis, w którym dochodzi do amplifikacji określonego fragmentu DNA o długości 220 - 260 par zasad w reakcji PCR z zastosowaniem pary starterów oligonukleotydowych.The application relates to oligonucleotides enabling the presence of the genetic material of the fungal pathogen Puccinia striiformis to be tested in the biological material tested using the polymerase chain reaction or its modification. The subject of the application is a pair of species-specific oligonucleotide primers for use in the polymerase chain reaction or its modification, with the sequences: LidPs9: 5 'TCGGTAAAACTGCACCAATACCT 3' LidPs10: 5 'TCCCAACAGTCCCCTTCTGT 3' complementary to the species-specific genomic stain fragment fragments. The application also includes a method of detecting the fungal pathogen of wheat Puccinia striiformis in which a specific fragment of DNA with a length of 220 - 260 base pairs is amplified in a PCR reaction using a pair of oligonucleotide primers.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PL419484A PL232090B1 (en) | 2016-11-17 | 2016-11-17 | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PL419484A PL232090B1 (en) | 2016-11-17 | 2016-11-17 | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it |
Publications (2)
Publication Number | Publication Date |
---|---|
PL419484A1 true PL419484A1 (en) | 2018-05-21 |
PL232090B1 PL232090B1 (en) | 2019-05-31 |
Family
ID=62142448
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PL419484A PL232090B1 (en) | 2016-11-17 | 2016-11-17 | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it |
Country Status (1)
Country | Link |
---|---|
PL (1) | PL232090B1 (en) |
-
2016
- 2016-11-17 PL PL419484A patent/PL232090B1/en unknown
Also Published As
Publication number | Publication date |
---|---|
PL232090B1 (en) | 2019-05-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP2016195614A5 (en) | ||
EP4410978A3 (en) | Methods for quantitative genetic analysis of cell free dna | |
WO2015123430A3 (en) | Single molecule electronic multiplex snp assay and pcr analysis | |
SA516371691B1 (en) | Methods and compositions for dna profiling | |
NZ723570A (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample | |
MX2017001405A (en) | Detection of target nucleic acids using hybridization. | |
EA201692157A1 (en) | SYNTHESIS OF TWO-CELLULAR NUCLEIC ACIDS | |
WO2015114469A3 (en) | Covered sequence conversion dna and detection methods | |
GB2519465A (en) | Solid matrix for one step nucleic acid amplification | |
EA201491821A1 (en) | MODIFIED oligonucleotides, including thiol functional groups, and their use for the detection of nucleic acids | |
PL419484A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it | |
PL419483A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it | |
PL419488A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it | |
PL419482A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it | |
PL419487A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it | |
PL419486A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it | |
PL419485A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it | |
PL419489A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it | |
PL419494A1 (en) | Oligonucleotide primers for detecting wheat fungal pathogen Puccinia striiformis and method for detecting it | |
EP2562254A4 (en) | Novel dna methylation analysis method | |
PL431170A1 (en) | Oligonucleotide primers hybridizing within the Cyp51 gene for detecting the wheat fungal pathogen Zymoseptoria tritici causing septoria leaf blotch, and method of its detection | |
UA103102U (en) | Method of detecting of dna bacteria yersinia enterocolitica by polymerase chain reaction | |
AR109017A1 (en) | METHODS FOR USING LONG SINGLE CHAIN DNA POLYUCLEOTIDES AS PRIMERS IN PCR TESTS | |
EP3305913A4 (en) | Nucleic acid detection method, nucleic acid quantitative determination method, nucleic acid base sequence identification method, nucleic acid mutation or polymorphism identification method, nucleic acid detection kit, and reaction chip | |
UA110546C2 (en) | Method for the detection of dna of bacteria chlamydia abortus, chlamydia pecorum, chlamydia psittaci in polymerase chain reaction by amplification of gene fragment encoding endoribonuclease p (rnase p rna) |