PL417583A1 - Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants - Google Patents
Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plantsInfo
- Publication number
- PL417583A1 PL417583A1 PL417583A PL41758316A PL417583A1 PL 417583 A1 PL417583 A1 PL 417583A1 PL 417583 A PL417583 A PL 417583A PL 41758316 A PL41758316 A PL 41758316A PL 417583 A1 PL417583 A1 PL 417583A1
- Authority
- PL
- Poland
- Prior art keywords
- pair
- molecular detection
- rye plants
- gene
- dwarfism gene
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Przedmiotem zgłoszenia jest para oligonukleotydowych starterów do wykrywania molekularnego obecności genu karłowatości dw8 w roślinach żyta, o sekwencjach: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG. Zgłoszenie zawiera też sposób wykrywania molekularnego obecności genu karłowatości dw8 w roślinach żyta, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji. Sposób charakteryzuje się tym, że parę starterów stanowi para oligonukleotydowych starterów o sekwencjach: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG,The subject of the application is a pair of oligonucleotide primers for detecting the molecular presence of the dw8 dwarf gene in rye plants, with the sequences: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG. The application also contains a method of detecting the molecular presence of the dw8 dwarf gene in rye plants, in which method the polymorphic DNA fragment coupled to the studied gene is amplified by PCR using a pair of primers, followed by detection of the amplification product. The method is characterized in that the pair of primers is a pair of oligonucleotide primers with the sequences: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG,
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL417583A PL230419B1 (en) | 2016-06-15 | 2016-06-15 | Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL417583A PL230419B1 (en) | 2016-06-15 | 2016-06-15 | Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| PL417583A1 true PL417583A1 (en) | 2017-12-18 |
| PL230419B1 PL230419B1 (en) | 2018-10-31 |
Family
ID=60655789
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PL417583A PL230419B1 (en) | 2016-06-15 | 2016-06-15 | Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants |
Country Status (1)
| Country | Link |
|---|---|
| PL (1) | PL230419B1 (en) |
-
2016
- 2016-06-15 PL PL417583A patent/PL230419B1/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| PL230419B1 (en) | 2018-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| SA516371691B1 (en) | Methods and compositions for dna profiling | |
| MX2017005159A (en) | Compositions and methods for detecting an rna virus. | |
| EP4303314A3 (en) | Polypeptide tagged nucleotides and use thereof in nucleic acid sequencing by nanopore detection | |
| WO2015081229A3 (en) | Selective amplification of nucleic acid sequences | |
| MX2017003228A (en) | Methods for pathogen detection and disease management on meats, plants, or plant parts. | |
| WO2015123430A3 (en) | Single molecule electronic multiplex snp assay and pcr analysis | |
| MX2021000946A (en) | Nucleic acid detection method. | |
| MX353840B (en) | Detection of nucleic acids. | |
| SG11201903066RA (en) | Method for multiplex detection of methylated dna | |
| WO2014052487A8 (en) | Two-primer pcr for microrna multiplex assay | |
| DE602008006254D1 (en) | DOUBLE-OLIGONUCLEOTIDE NUCLEIC DETECTION METHOD | |
| WO2016059474A3 (en) | Sequence conversion and signal amplifier dna having poly dna spacer sequences and detection methods using same | |
| WO2013126793A3 (en) | Detection of shiga toxin genes in bacteria | |
| AU2015215750A2 (en) | Nucleic acid detection or quantification method using mask oligonucleotide, and device for same | |
| PL417583A1 (en) | Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants | |
| WO2016051177A3 (en) | Methods and kits | |
| PL418161A1 (en) | Pair of starter oligonucleotides for molecular detection of dwarfism gene Dw 1 in rye plants and method for molecular detection of the presence of dwarfism gene Dw 1 in rye plants | |
| PL416192A1 (en) | Pair of starter oligonucleotides for detecting dwarfism gene Dw3 in rye plants and method for detecting a presence of dwarfism gene Dw3 in rye plants | |
| PL417771A1 (en) | Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) | |
| PL426258A1 (en) | Pair of oligonucleotide primers for detecting the ct2 dwarf gene and method for detecting the recessive ct2 dwarf gene in rye (Secale cereale L.) plants | |
| PL413388A1 (en) | Method for detecting Paecilomyces variotii | |
| PL422536A1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) | |
| PL431159A1 (en) | Oligonucleotide primers hybridizing within the Rpb2 gene for detecting the wheat fungal pathogen Zymoseptoria tritici causing septoria leaf blotch, and method of its detection | |
| UA103102U (en) | Method of detecting of dna bacteria yersinia enterocolitica by polymerase chain reaction | |
| PL422537A1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the dominant allele of immunity gene to crown rust Pc39 in the plants of common oat (Avena sativa L.) |