PL230419B1

PL230419B1 - Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants

Info

Publication number: PL230419B1
Application number: PL417583A
Authority: PL
Inventors: Katarzyna Molik; Edyta Pawłowska; Paweł Milczarski
Original assignee: Zachodniopomorski Univ Technologiczny W Szczecinie; Zachodniopomorski Uniwersytet Technologiczny W Szczecinie
Priority date: 2016-06-15
Filing date: 2016-06-15
Publication date: 2018-10-31
Also published as: PL417583A1

Abstract

Przedmiotem zgłoszenia jest para oligonukleotydowych starterów do wykrywania molekularnego obecności genu karłowatości dw8 w roślinach żyta, o sekwencjach: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG. Zgłoszenie zawiera też sposób wykrywania molekularnego obecności genu karłowatości dw8 w roślinach żyta, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji. Sposób charakteryzuje się tym, że parę starterów stanowi para oligonukleotydowych starterów o sekwencjach: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG,The subject of the application is a pair of oligonucleotide primers for the molecular detection of the presence of the dw8 dwarf gene in rye plants, with the sequences: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG. The application also includes a method for detecting the molecular presence of the dw8 dwarf gene in rye plants, in which a polymorphic DNA fragment linked to the test gene is amplified in a PCR reaction using a pair of primers, followed by the detection of the amplification product. The method is characterized in that the primer pair is a pair of oligonucleotide primers with the sequences: F - 5'F25439F: CAACATCACCGGAGCGATTT R - 5'F25439R: GTGAAGAAGTACCACTCGCG,

Description

Opis wynalazkuDescription of the invention

Przedmiotem wynalazku jest para oligonukleotydowych starterów do wykrywania molekularnego obecności genu karłowatości dw8 w roślinach żyta i sposób wykrywania molekularnego obecności genu karłowatości dw8w roślinach żyta.The present invention relates to a pair of oligonucleotide primers for detecting the molecular presence of the dw8 dw8 gene in rye plants and a method for detecting the molecular presence of dw8 dwarf gene in rye plants.

Gen karłowatości dw8 występuje w linii wsobnej żyta RXL10, pochodzącej z kolekcji Katedry Genetyki, Hodowli i Biotechnologii Roślin, Zachodniopomorskiego Uniwersytetu Technologicznego w Szczecinie. Linia RXL10 została wyprowadzona z odmiany żyta ozimego Zeelandzkie, zdeponowanej w Krajowym Centrum Roślinnych Zasobów Genowych IHAR w Radzikowie (Accession nr. 30504).The dw8 gene is present in the RXL10 inbred rye line from the collection of the Department of Genetics, Plant Breeding and Biotechnology, West Pomeranian University of Technology in Szczecin. The RXL10 line was derived from the Zeelandzkie winter rye variety, deposited at the IHAR National Center for Plant Genetic Resources in Radzików (Accession no. 30504).

Jedną z metod zapobiegających wylęganiu u zbóż jest hodowla odmian o skróconym źdźble. Rośliny takie uzyskuje się w wyniku krzyżowania form karłowych, odpornych na wylęganie z formami o normalnym wzroście, podatnymi na wylęganie. U żyta zidentyfikowano dotąd trzy dominujące geny warunkujące karłowatość: Dw1, Dw2, Dw3, które zmapowano odpowiednio na chromosomach 5R, 7R i 1R (Melz G. 1989. Beitrage zur Genetik des Roggens (Secale cereale L.). Dsc. Thesis, Berlin: 173; Bórner A., Korzun V. 1998. A consensus linkage map of rye (Secale cereale L.) including 374 RFLPs, 24 isozymes and 15 gene loci. Theor. Appl. Genet. 97: 1279-1288; Bórner A., Korzun V., Voylokov A.V., Weber W.E. 1999. Detection of quantitative trait loci on chromosome 5R of rye (Secale cereale L.). Theor. Appl. Genet. 98: 1087-1090 oraz Stojałowski S., Myśków B., Hanek M., 2015. Phenotypic effect and chromosomal localization of Ddw3, the dominant dwarfing gene in rye (Secale cereale L.). Euphytica, VoL 201, 1: 43-52) oraz 14 genów recesywnych. Szerokie zastosowanie w programach hodowlanych żyta i pszenżyta znalazł gen Dw1, jednak obecnie w Polsce w Krajowym Rejestrze odmian gatunków roślin uprawnych nie ma zarejestrowanej odmiany żyta karłowego, zawierającego którykolwiek ze wspomnianych genów.One of the methods of preventing hatching in cereals is the breeding of varieties with short stems. Such plants are obtained by crossing dwarf forms, resistant to hatching, with forms of normal growth, susceptible to hatching. In rye, three dominant dwarf genes have been identified so far: Dw1, Dw2, Dw3, which have been mapped on the 5R, 7R and 1R chromosomes, respectively (Melz G. 1989. Beitrage zur Genetik des Roggens (Secale cereale L.). Dsc. Thesis, Berlin: 173; Bórner A., Korzun V. 1998. A consensus linkage map of rye (Secale cereale L.) including 374 RFLPs, 24 isozymes and 15 gene loci. Theor. Appl. Genet. 97: 1279-1288; Bórner A., Korzun V., Voylokov AV, Weber WE 1999. Detection of quantitative trait loci on chromosome 5R of rye (Secale cereale L.). Theor. Appl. Genet. 98: 1087-1090 and Stojałowski S., Myśków B., Hanek M ., 2015. Phenotypic effect and chromosomal localization of Ddw3, the dominant dwarfing gene in rye (Secale cereale L.). Euphytica, VoL 201, 1: 43-52) and 14 recessive genes. The Dw1 gene has found wide application in rye and triticale breeding programs, but currently in Poland there is no registered dwarf rye variety containing any of the genes in the National Register of Varieties of Crop Species.

Gen dw8 został wstępnie zmapowany w populacji DS2 x RXL10 na długim ramieniu chromosomu 5R (Devos K. M., Atkinson M. D., Chinoy C. N., Francis H. A., Harcourt R. L., Koebner R. M. D., Liu C. J., Masojc P, Xie D. X., Gale M. D. 1993. Chromosomal rearrangements in the rye genome relative to that of wheat. Theor Appl Genet 85:673-680), w rejonie dystalnym, w obrębie translokacji 4RL/5RL. Jest to obszar chromosomu, który wykazuje homeologię do pszenicznych chromosomów 5AL, 4BL i 4DL. Gen został opisany przez autorów jako częściowo dominujący. Na konsensusowej mapie chromosomu 5R znajduje się on nad genem Dw1, który lokalizuje się pomiędzy genem β-Amy (położonym dystalnie) a genem Hp1 (Gustafson J. R, Ma X-F, Korzun V., Snape J. W. 2009. A consensus map of rye integrating mapping data from five mapping populations. Theor Appl Genet 118: 793-800). Oprócz genu dw8 na chromosomie 5R zidentyfikowano dwa inne, recesywne geny karłowatości: dw6 (Melz G. 1989. Beitrage zur Genetik des Roggens (Secale cereale L.). Dsc. Thesis, Berlin: 173) i ct2, który zmapowano na długim ramieniu chromosomu 5R, powyżej genu a-Amy3 (Plaschke J., Bórner A., Xie D. X., Koebner R. M. D., Schlegel R., Gale M. D. 1993. RFLP-mapping of genes affecting plant height and growth habit in rye. Theor Appl Genet 85:1049-1054). Oba loci mogą być jednak różnymi allelami tego samego genu, co zasugerował Bórner A. 1991. Genetical studies of gibberellic acid insensitivity in rye (Secale cereale L.), Plant Breed 106:53-57).The dw8 gene was pre-mapped in the DS2 x RXL10 population on the long arm of the 5R chromosome (Devos KM, Atkinson MD, Chinoy CN, Francis HA, Harcourt RL, Koebner RMD, Liu CJ, Masojc P, Xie DX, Gale MD 1993. Chromosomal rearrangements in the rye genome relative to that of wheat. Theor Appl Genet 85: 673-680), in the distal region, within the 4RL / 5RL translocation. This is the area of the chromosome that is homeologically to the 5AL, 4BL, and 4DL wheat chromosomes. The gene has been described by the authors as partially dominant. On the consensus map of the 5R chromosome, it is located above the Dw1 gene, which is located between the β-Amy gene (located distally) and the Hp1 gene (Gustafson J. R, Ma XF, Korzun V., Snape JW 2009. A consensus map of rye integrating mapping data from five mapping populations. Theor Appl Genet 118: 793-800). In addition to the dw8 gene, two other recessive dwarf genes have been identified on chromosome 5R: dw6 (Melz G. 1989. Beitrage zur Genetik des Roggens (Secale cereale L.). Dsc. Thesis, Berlin: 173) and ct2, which was mapped to the long arm of the chromosome 5R, upstream of the a-Amy3 gene (Plaschke J., Bórner A., Xie DX, Koebner RMD, Schlegel R., Gale MD 1993. RFLP-mapping of genes affecting plant height and growth habit in rye. Theor Appl Genet 85: 1049 -1054). However, both loci can be different alleles of the same gene, as suggested by Bórner A. 1991. Genetical studies of gibberellic acid insensitivity in rye (Secale cereale L.), Plant Breed 106: 53-57).

Aby określić dokładną lokalizację chromosomową genu dw8, potwierdzić jego odrębność od innych genów karłowatości chromosomu 5R oraz aby identyfikować gen dw8 w roślinach o niskim pokroju niezbędne było znalezienie markera blisko sprzężonego z tym genem. Na początku przeprowadzono test różnych markerów na liniach rodzicielskich 541 i RXL10, następnie określono ich segregację w populacji F2 541 x RXL10. Weryfikację markerów dokonano testując je na 28 karłowych i wysokich, niespokrewnionych liniach wsobnych żyta (w tym linii RXL10).In order to determine the exact chromosomal location of the dw8 gene, confirm its distinctiveness from other genes of the dw8ness of the 5R chromosome, and to identify the dw8 gene in low-habit plants, it was necessary to find a marker closely linked to this gene. First, various markers were tested on parental lines 541 and RXL10, then their segregation in the F2 541 x RXL10 population was determined. The markers were verified by testing them on 28 dwarf and tall, unrelated rye inbred lines (including the RXL10 line).

Celem wynalazku było znalezienie takich markerów, które nie tylko odróżniałyby formy karłowe od wysokich, ale również pozwalały potwierdzić źródło karłowatości.The aim of the invention was to find markers that would not only distinguish dwarf forms from tall, but also confirm the source of dwarfism.

Para oligonukleotydowych starterów do wykrywania molekularnego obecności genu karłowatości dw8w roślinach żyta, według wynalazku, o sekwencjach:A pair of oligonucleotide primers for the molecular detection of the presence of the dw8 dwarf gene in rye plants, according to the invention, with the sequences:

F - 5' F25439F: CAACATCACCGGAGCGATTTF - 5 'F25439F: CAACATCACCGGAGCGATTT

R - 5'F25439R: GTGAAGAAGTACCACTCGCGR - 5'F25439R: GTGAAGAAGTACCACTCGCG

Sposób wykrywania molekularnego obecności genu karłowatości dw 8 w roślinach żyta, według wynalazku, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, charakteryzuje się tym, że parę starterów stanowi para oligonukleotydowych starterów o sekwencjach:The method of detecting the molecular presence of the dw 8 dwarf gene in rye plants, according to the invention, in which a polymorphic DNA fragment linked to the test gene is amplified by PCR using a pair of primers, followed by detection of the amplification product, characterized in that the pair of primers are a pair of oligonucleotide primers with the sequences:

PL230 419 Β1PL230 419 Β1

F - 5' F25439F: CAACATCACCGGAGCGATTTF - 5 'F25439F: CAACATCACCGGAGCGATTT

R - 5' F25439R: GTGAAGAAGTACCACTCGCG przy czym stosuje się marker F25439 (Wzór 1 prążek markera F25439 związany z cechą karłowatości genu dw8).R - 5 'F25439R: GTGAAGAAGTACCACTCGCG where marker F25439 is used (Pattern 1 band of marker F25439 related to dw8 gene dwarf trait).

Wynalazek jest bliżej w przykładzie wykonania i na rysunku, na którym Fig. 1 przedstawia elektroforegramy, na których pokazano segregację markera F25439 w genotypach wysokich i karłowych (Fk) populacji F2 mieszańca 541 x RXL10 oraz linii rodzicielskich (Wzór 1 zaznaczono strzałką). Fig. 2 przedstawia elektroforegram, na którym pokazano segregację markera F25439 wśród niespokrewnionych linii wsobnych (A1-A27). Pełnymi nazwami wyróżniono linię posiadającą gen dw8 (RXL10).The invention is more closely related to the embodiment and the drawing in which Fig. 1 shows electrophoregrams showing the segregation of the marker F25439 in the tall and dwarf (Fk) genotypes of the F2 population of the hybrid 541 x RXL10 and the parental lines (Formula 1 is marked with an arrow). Fig. 2 shows an electrophoregram showing the segregation of the marker F25439 among unrelated inbred lines (A1-A27). The line with the dw8 (RXL10) gene was distinguished by full names.

W pierwszym etapie wytworzono populację mieszańca linii 541 (linia wysoka) i RXL10 (linia karłowa). W trakcie badań opracowano kodominujący marker F25439, który w prosty i szybki sposób identyfikuje rośliny żyta posiadające gen dw8 zarówno w pulach skrajnych genotypów (Fig. 1) jak i w grupie genotypów niespokrewnionych (Fig. 2).In the first step, a hybrid population of line 541 (high line) and RXL10 (dwarf line) was created. In the course of the research, the codominant marker F25439 was developed, which easily and quickly identifies rye plants with the dw8 gene both in pools of extreme genotypes (Fig. 1) and in the group of unrelated genotypes (Fig. 2).

Przeprowadzone przez Zgłaszającego badania markera F25439 wykazały, że jest on znacznikiem genu dw8 w życie.The Applicant's research on the marker F25439 has shown that it is a marker of the dw8 gene.

Metoda identyfikacji markera F25439F25439 marker identification method

Przygotowanie materiału roślinnego: DNA izolowano z liofilizowanych liści z wykorzystaniem komercyjnych zestawów kolumienkowych, wykorzystujących złoża krzemionkowe do wiązania DNA. Dokonano oceny ilościowej i jakościowej izolatów, wyrównano stężenia poszczególnych roztworów DNA do 10 ng/μΙ.Preparation of plant material: DNA was isolated from the freeze-dried leaves using commercial column kits that use silica beds to bind the DNA. The quantitative and qualitative evaluation of isolates was performed, and the concentrations of individual DNA solutions were adjusted to 10 ng / μΙ.

Startery wykorzystane w PCR:Primers used in PCR:

Startery zaprojektowano na podstawie sekwencji własnych, w programie Primer3 (Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., Rożen S. G. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Research 40 (15): e115; Koressaar T., Remm M. 2007. Enhancements and modifications ofprimer design program Primer3 Bioinformatics 23 (10): 1289-91).The primers were designed on the basis of eigenvalues in the Primer3 program (Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth BC, Remm M., Rożen SG 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Research 40 ( 15): e115; Koressaar T., Remm M. 2007. Enhancements and modifications of primer design program Primer3 Bioinformatics 23 (10): 1289-91).

Starter 1: F25439F: CAACATCACCGGAGCGATTTStarter 1: F25439F: CAACATCACCGGAGCGATTT

Starter 2: F25439R: GTGAAGAAGTACCACTCGCGStarter 2: F25439R: GTGAAGAAGTACCACTCGCG

Skład mieszaniny reakcyjnej i warunki przeprowadzenia PCR:Composition of the reaction mixture and conditions for carrying out the PCR:

Składnik Ingredient Objętość Volume Woda Water 7,65 μΙ 7.65 μΙ Bufor TrueStart Hot Start 10x TrueStart Hot Start 10x buffer 1,5 μΐ 1.5 μΐ dNTP 2 mM dNTP 2 mM 1,0 μΐ 1.0 μΐ MgCl₂ 25 mMMgCl ₂ 25 mM 1,2 μΐ 1.2 μΐ Starter F 5 pM Primer F 5 pM 1,0 μΐ 1.0 μΐ Starter R 5 pM Starter R 5 pM 1,0 μ! 1.0 μ! DNA 10 ng/μΐ DNA 10 ng / μΐ 1,5 μΐ 1.5 μΐ Pol i me raz a DNA Taq TrueStart Hot Start Thermo Scientific 5 U/μΙ Pol and me once a DNA Taq TrueStart Hot Start Thermo Scientific 5 U / μΙ 0,15 μΐ 0.15 μΐ Całkowita objętość Total volume 15 μΐ 15 μΐ

PCR przeprowadzano w termocyklerze: T100™ Thermal Cycler (Bio-RAD). Profil temperaturowy reakcji przedstawiono w tabeli poniżej.PCR was performed in a thermal cycler: T100 ™ Thermal Cycler (Bio-RAD). The temperature profile of the reaction is shown in the table below.

Temperatura Temperature Czas Time Liczba cykli Number of cycles 95°C 95 ° C 2 min 2 min 1 1 95°C 95 ° C 30 s 30 s 65°C -FC/ cykl 65 ° C -FC / cycle 30 s 30 s 10 10 72°C 72 ° C 1 min 1 min 95°C 95 ° C 30 s 30 s 55°C 55 ° C 30 s 30 s 30 thirty 72°C 72 ° C 1 min 1 min 72°C 72 ° C 10 min 10 min 1 1

PL230 419 Β1PL230 419 Β1

Rozdział produktów reakcji i wizualizacja wyników:Separation of reaction products and visualization of results:

Produkty rozdzielono metodą elektroforezy poziomej w 2% żelu agarozowym, w buforze 1 x TBE, pH=8,3. Do określenia długości otrzymanych produktów na żel nałożono 10 μΙ wzorca GeneRuler 100 bp Plus DNA Ladder. Parametry rozdziału: 90V/ 2 h. Wizualizacji produktów dokonano przy użyciu systemu G-Box (Syngene), po uprzednim barwienie żelu w roztworze bromku etydyny (0,1%).The products were separated by horizontal electrophoresis on a 2% agarose gel in 1 x TBE buffer, pH = 8.3. To determine the length of the products obtained, 10 µl of the GeneRuler 100 bp Plus DNA Ladder standard was applied to the gel. Separation parameters: 90V / 2 h. Visualization of products was made with the G-Box system (Syngene), after gel staining in ethidium bromide solution (0.1%).

Wyniki:Results:

Przeprowadzony na 94 osobnikach populacji F2 mieszańca 541 x RXL10 test wykazał 97% skuteczność w identyfikacji form karłowych i wysokich (Fig. 1). Dla roślin karłowych uzyskany produkt jest krótszy (<300 pz) niż dla roślin wysokich (ok. 300 pz). Test przeprowadzony na 28 niespokrewnionych liniach wsobnych żyta, w tym jednej linii RXL10 (posiadającej gen dw8) wykazał, że opisana metoda z wykorzystaniem markera F25439 jest w 100% skuteczna w identyfikacji genu karłowatości dw8 (Fig. 2).The test, carried out on 94 individuals of the F2 population of the hybrid 541 x RXL10, showed 97% success in identifying dwarf and tall forms (Fig. 1). For dwarf plants the obtained product is shorter (<300 bp) than for tall plants (approx. 300 bp). The test carried out on 28 unrelated inbred lines, including one RXL10 line (having the dw8 gene), showed that the described method using the F25439 marker is 100% effective in identifying the dw8 dwarf gene (Fig. 2).

Claims

Patent claims

1. Pair of oligonucleotide primers for molecular detection of the dw8 dwarf gene in rye with the sequences:

F - 5 'F25439F: CAACATCACCGGAGCGATTT

R - 5 'F25439R: GTGAAGAAGTACCACTCGCG

2. A method of detecting the molecular presence of the dw8 dw8 gene in rye plants, in which the polymorphic DNA fragment linked to the studied gene is amplified by PCR using a pair of primers, followed by detection of the amplification product, characterized in that the pair of primers is a pair oligonucleotide primers with the sequences: