PL417771A1 - Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) - Google Patents
Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.)Info
- Publication number
- PL417771A1 PL417771A1 PL417771A PL41777116A PL417771A1 PL 417771 A1 PL417771 A1 PL 417771A1 PL 417771 A PL417771 A PL 417771A PL 41777116 A PL41777116 A PL 41777116A PL 417771 A1 PL417771 A1 PL 417771A1
- Authority
- PL
- Poland
- Prior art keywords
- gene
- dwarfism
- pair
- rye
- detecting
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Przedmiotem zgłoszenia jest para oligonukleotydowych starterów do wykrywania genu karłowatości Dw2 w roślinach żyta, o sekwencjach: Rye3353164pp2F ACACTCGGCCTGTCAATAGC Rye3353164pp2R CTGAAGCGGGGAGGTTTCAA. Zgłoszenie obejmuje też sposób wykrywania obecności genu karłowatości Dw2 w roślinach żyta, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, charakteryzuje się tym, że parę starterów stanowi para oligonukleotydowych starterów o sekwencjach: Rye3353164pp2F ACACTCGGCCTGTCAATAGC Rye3353164pp2R CTGAAGCGGGGAGGTTTCAA, przy czym stosuje się marker Rye3353164pp2.The subject of the application is a pair of oligonucleotide primers for the detection of the Dw2 dwarf gene in rye plants, with the sequences: Rye3353164pp2F ACACTCGGCCTGTCAATAGC Rye3353164pp2R CTGAAGCGGGGAGGTTTCAA. The application also includes a method of detecting the presence of the Dw2 dwarf gene in rye plants, in which method the polymorphic DNA fragment coupled to the tested gene is amplified by PCR using a pair of primers, followed by detection of the amplification product, characterized by the fact that the pair of primers is a pair of oligonucleotide primers with the following sequences: Rye3353164pp2F ACACTCGGCCTGTCAATAGC Rye3353164pp2R CTGAAGCGGGGAGGTTTCAA, with the marker Rye3353164pp2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL417771A PL230800B1 (en) | 2016-06-30 | 2016-06-30 | Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL417771A PL230800B1 (en) | 2016-06-30 | 2016-06-30 | Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| PL417771A1 true PL417771A1 (en) | 2018-01-03 |
| PL230800B1 PL230800B1 (en) | 2018-12-31 |
Family
ID=60787910
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PL417771A PL230800B1 (en) | 2016-06-30 | 2016-06-30 | Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) |
Country Status (1)
| Country | Link |
|---|---|
| PL (1) | PL230800B1 (en) |
-
2016
- 2016-06-30 PL PL417771A patent/PL230800B1/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| PL230800B1 (en) | 2018-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| MX2021003712A (en) | Nuclease-based rna depletion. | |
| MX2021000946A (en) | Nucleic acid detection method. | |
| WO2015123430A3 (en) | Single molecule electronic multiplex snp assay and pcr analysis | |
| BR112017008082A2 (en) | compositions and methods for detecting an rna virus | |
| NZ723570A (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample | |
| GB201200658D0 (en) | Methods,compositions,and kits for determining the presence/absence of a variant nucleic acid sequence | |
| MY182940A (en) | Pcr primer set for bacterial dna amplification, kit for detecting and/or identifying bacterial species, and method for detecting and/or identifying bacterial species | |
| WO2016059474A3 (en) | Sequence conversion and signal amplifier dna having poly dna spacer sequences and detection methods using same | |
| SG10201808952WA (en) | Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications | |
| WO2015114469A3 (en) | Covered sequence conversion dna and detection methods | |
| PH12016502411A1 (en) | Method for methylation analysis | |
| ZA202007173B (en) | Polynucleotides for the amplification and detection of chlamydia trachomatis | |
| WO2018089942A8 (en) | Polynucleotides for the amplification and detection of chlamydia trachomatis | |
| MY184632A (en) | A method of identifying parentage in freshwater prawn macrobrachium rosenbergii | |
| UA110815C2 (en) | Detection of nucleic acid sequences of the target in the analysis of the splitting and extension pto | |
| WO2016051177A3 (en) | Methods and kits | |
| PL417771A1 (en) | Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.) | |
| PL426258A1 (en) | Pair of oligonucleotide primers for detecting the ct2 dwarf gene and method for detecting the recessive ct2 dwarf gene in rye (Secale cereale L.) plants | |
| PL417583A1 (en) | Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants | |
| PL416192A1 (en) | Pair of starter oligonucleotides for detecting dwarfism gene Dw3 in rye plants and method for detecting a presence of dwarfism gene Dw3 in rye plants | |
| PL418161A1 (en) | Pair of starter oligonucleotides for molecular detection of dwarfism gene Dw 1 in rye plants and method for molecular detection of the presence of dwarfism gene Dw 1 in rye plants | |
| MY174088A (en) | A method of detecting porcine markers for identifying pork content in a sample | |
| WO2019177684A8 (en) | Methods of quantifying rna and dna variants through sequencing employing phosphorothioates | |
| PL413388A1 (en) | Method for detecting Paecilomyces variotii | |
| WO2015164635A3 (en) | Methods and compositions for detecting anti-drug antibodies |