Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Sposób wykrywania Paecilomyces variotii, z użyciem sondy molekularnej i starterów w amplifikacji DNA, które na zasadzie hybrydyzacji specyficznie łączą się z sekwencją docelową, polegający na wykorzystaniu występującej u Paecilomyces variotii sekwencji docelowej charakteryzuje się tym, że oparty jest na wykrywaniu sekwencji docelowej, stanowiącej sekwencję nukleotydów CACGCTTCAATAGAACCGGCCGGCTTGCTGGCCA, będącej markerem obecności Paecilomyces variotii w materiale biologicznym.The method of detecting Paecilomyces variotii, using a molecular probe and primers in DNA amplification, which hybridize specifically to the target sequence, based on the use of the target sequence found in Paecilomyces variotii is characterized by the fact that it is based on the detection of the target sequence, which is a nucleotide sequence CACGCTTCAATAGAACCGGCCGGCTTGCTGGCCA, which is a marker of the presence of Paecilomyces variotii in biological material.
PL413388A2015-08-032015-08-03Method for detecting Paecilomyces variotii
PL232043B1
(en)
Pair of starter oligonucleotides for molecular detection of the dwarfism gene dw8 presence in rye plants and method for molecular detection of the dwarfism gene dw8 presence in rye plants
PCR primer kits for amplifying bacterial DNA, test kits for the measurement and/or classification of bacterial species, and, methods for the measurement and/or classification of bacterial species. Bacterial species
Pair of starter oligonucleotides for detecting dwarfism gene Dw2 and method for molecular identification of Dw2 gene that conditions the dominating rye dwarfism (Secale cereale L.)