KR20200085165A - Composition including nonane as active ingredients for anti-allergy, improvement of atopic dermatitis, or skin regeneration - Google Patents

Abstract

The present invention relates to a composition for anti-allergy, atopic dermatitis alleviation, or skin regeneration containing nonane as an active component. More specifically, the present invention relates to a composition for preventing or treating allergic diseases or atopic dermatitis, and a composition for healing skin wounds or promoting skin regeneration, all of which contain nonane or a pharmaceutically acceptable salt thereof as an active component.

Description

A composition for improving anti-allergic, atopic dermatitis, or regenerating skin that contains nonine as an active ingredient TECHNICAL FIELD

The present invention relates to an anti-allergic, atopic dermatitis improvement, or skin regeneration composition comprising nonane as an active ingredient, more specifically, an allergy comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient It relates to a composition for the prevention or treatment of sexual diseases or atopic dermatitis, a composition for promoting skin wound healing or skin regeneration.

Atopy comes from the ancient Greek word'topia', meaning'strange, unusual'. In 1923, Cooke and Coca first began to call atopic the tendency to genetically trigger specific immune antibody responses to allergens. Increasingly, the incidence rate is increasing in developed countries with industrial development.

The cause of atopy has not been determined, but it is not limited to one factor, such as family history, changes in diet, allergen penetration, or abnormality of the skin protective layer. It mainly affects infants and toddlers and may persist or begin in adulthood. The typical symptoms of atopy appear on the hands, scalp, face, neck, and elbows, but there are differences in the appearance of each period. Symptoms of infancy are skin roughness and dryness, dermatitis on the outside of the limbs, and often appear on the cheeks or forehead. In childhood, it appears mainly on the folds of the arms, legs, and neck, rather than the face, and the skin becomes dry. In adolescence and adulthood, symptoms of thickening of the skin in areas such as the face or hands appear.

Topical steroids, topical immunomodulators, systemic steroids, systemic immunosuppressants, and antihistamines are used as therapeutic agents for atopic drugs. Topical steroids are used when atopic symptoms are severe and are the most basic method of managing bacterial or viral infections. However, steroids were introduced in 1950 and have been used for many years, but long-term use is limited due to the safety and tolerance of the skin according to the frequency, concentration, and duration of use. In addition, skin side effects such as skin atrophy, telangiectasia, and steroid acne, as well as potential HPA (hypothalamic-pituitary-adrenal) inhibition, and Cushing's syndrome Be careful when using it because it can cause side effects.

The topical immunomodulators tacrolimus and pimecrolimus are known to be used over a long period of time for the purpose of preventing recurrence of the lesion because they have a relatively small possibility of side effects even when used for a long time, unlike conventional topical steroids. It is suitable for use as a treatment and maintenance therapy. However, tacrolimus can cause side effects such as decreased kidney function, tremors, and hair loss, and pimecrolimus can cause serious side effects such as skin cancer and lymphoma, as well as acne and burning. When steroids are exacerbated in the acute phase, topical immunomodulators are suitable for use as mild atopic treatments and maintenance therapy, but the safety of side effects is not yet secured, and there is an urgent need for alternative supplements.

As a result, the present applicant has tried to develop a material that is effective in alleviating the symptoms of atopic dermatitis with few side effects, and confirms that Nonane relieves the atopy symptoms and improves the inflammatory response, anti-allergic, The present invention was completed by confirming that there is a wound healing effect.

Republic of Korea Patent Publication No. 10-2018-0128602

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of allergic disease or atopic dermatitis, including nonane (Nonane) or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a composition for the prevention or improvement of allergic disease or atopic dermatitis comprising nonine or a salt thereof as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for promoting skin wound healing or skin regeneration, comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for promoting skin wound healing or skin regeneration, comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for promoting skin wound healing or skin regeneration, comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention is to solve the above-mentioned problems, and provides a pharmaceutical composition for the prevention or treatment of allergic disease or atopic dermatitis, including Nonane or a pharmaceutically acceptable salt thereof as an active ingredient.

According to an aspect of the present invention, the allergic disease is edema, hypersensitivity (anaphylaxis), allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact Sex dermatitis, hives, pruritus, insect allergies, food allergies and drug allergies may be selected from the group consisting of, but is not limited to.

According to one aspect of the invention, the active ingredient is IL-4 (Interleukin-4), IL-13, TNF-α (tumor necrosis factor-alpha), IL-1β, IL-6 or IL-8 expression By reducing, it can exhibit an anti-allergic effect, a preventive or therapeutic effect of atopic dermatitis.

In addition, the present invention provides a composition for preventing or improving allergic disease or atopic dermatitis comprising nonine or a salt thereof as an active ingredient.

According to one embodiment of the present invention, the composition may be a health functional food composition, a cosmetic composition, or a fragrance composition.

In addition, the present invention provides a pharmaceutical composition for promoting skin wound healing or skin regeneration, comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a quasi-drug composition for promoting skin wound healing or skin regeneration, comprising nonine or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a cosmetic composition for promoting skin wound healing or skin regeneration, including nonine or a salt thereof as an active ingredient.

The composition comprising nonine as an active ingredient of the present invention has an effect of improving atopic dermatitis due to an allergic reaction, and can be used as a composition for preventing or treating various allergic diseases by reducing an inflammatory response. In addition, the composition of the present invention has a skin regeneration effect, it can be usefully used as a wound healing drug or functional cosmetic use for skin regeneration.

1 is a graph showing changes in expression of inflammatory cytokine-related molecules (IL-4, IL-13, and TNF-α) in mastoid cells treated with nonine (each value is 3 times obtained from 3 independent wells) Mean ± SEM; the letters on the bars show statistically significant differences at P<0.05).
FIG. 2 is a graph showing changes in expression of inflammatory cytokine-related molecules (IL-1β, IL-6 and IL-8) in keratinocytes treated with nonine (each value is 3 obtained from 3 independent wells) Mean of the meeting ± SEM; the letters on the bars show statistically significant differences at P<0.05).

The present inventors express the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6, or IL-8, which are inflammatory cytokines secreted by the immune response of cells by the elderly to relieve atopic symptoms. By confirming a significant reduction, the present invention was completed.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for the prevention or treatment of allergic disease or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.

Specifically, the nonane is contained in plants such as Pittosporum and Hypericum, and is also called N-Nonane. The structural formula of nonine is C ₉ H ₂₀ , the molecular weight is 128.26, and the formula is as shown in [Formula 1]. Nonine is a colorless, transparent liquid component with a melting point of 31 °C and a boiling point of 150.8 °C.

Physiological activity and general function of elderly people have not been reported to date.

[Formula 1]

The nonine of the present invention may include nonine hydrate, nonine derivative, and the like within a range having the same efficacy as the nonine, and may also include a solvent compound or a stereoisomer thereof.

The method for obtaining the nonein is not particularly limited, and may be used for separation from a plant containing the nonein, chemically synthesized using a known manufacturing method, or commercially available one.

In the present invention, the terms "cosmetic acceptable salt", "food acceptable salt", "pharmaceutically acceptable salt" or "salt thereof" may be an acid addition salt formed by a free acid. have. Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. In addition, the same molar amount of the compound and the acid or alcohol in water (eg, glycol monomethyl ether) can be heated and then the mixture is evaporated to dryness or the precipitated salt can be suction filtered.

As the free acid, an inorganic acid or an organic acid can be used. Non-limiting examples of the inorganic acid may be used hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc., these may be used alone or in combination of two or more. Non-limiting examples of the organic acid is methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid (propionic acid) acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid (glucuronic acid), aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid, and the like can be used. These may be used alone or in combination of two or more.

In addition, the nonine can make a metal salt that is cosmetically or foodologically acceptable using a base. Alkali metal or alkaline earth metal salts can be obtained, for example, by dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the salt of the inexpensive compound, and then evaporating and drying the filtrate. The metal salt is particularly preferably prepared sodium, potassium or calcium salt, but is not limited thereto. Further, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The salt of the nonane may include all salts of acidic or basic groups that may be present in the compound of the nonine unless otherwise indicated. For example, the salt of nonine may include sodium, calcium, and potassium salts of hydroxy groups, and other cosmetically acceptable salts of amino groups include hard bromide, sulfuric acid, hydrogen sulfate, phosphate, and hydrogen phosphate. , Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts. It can be manufactured through a manufacturing method.

In the present invention, “allergic disease” refers to a disease caused by an allergy reaction in which an immune response in the body overexposes to an external antigen, specifically, edema, anaphylaxis, and allergic rhinitis. one or more disease selected from the group consisting of rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insect allergy, food allergy and drug allergy However, it is not limited thereto.

"Atopic dermatitis" in the present invention is one of allergic diseases, it is a skin disease accompanied by symptoms such as itching, dry skin, increased skin thickness, and characteristic eczema.

The pharmaceutical composition for the prevention or treatment of allergic disease or atopic dermatitis according to the present invention does not specifically limit its content if it contains nonine or a pharmaceutically acceptable salt thereof, but preferably the dose of nonine is 0.1 It may include a concentration of μM to 1000 μM, but is not limited thereto. At this time, when the non-neine is less than the above concentration range, there is a problem that it is difficult to exert a desirable preventive or therapeutic effect, and when the non-neine exceeds the above-described concentration range, there may be toxicity concerns including cytotoxicity.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention is an oral dosage form, external preparation, suppository, and the like, according to a conventional method, such as powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, etc. It may be formulated and used in the form of a sterile injectable solution, and may include suitable carriers, excipients, or diluents commonly used in the manufacture of pharmaceutical compositions for formulation.

Examples of the carrier or excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, and crude Various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it can be prepared using diluents or excipients such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants, etc., which are usually used.

Solid preparations for oral administration may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the nonine. In addition, lubricants such as magnesium stearate and talc may be used in addition to simple excipients.

Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are common diluents, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, can be included. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerol gelatin can be used.

The preferred dosage of the pharmaceutical composition for the prevention or treatment of allergic disease or atopic dermatitis according to the present invention varies depending on the patient's condition, body weight, degree of disease, drug form, administration route and duration, but may be appropriately selected by those skilled in the art. Can. However, for a desired effect, it can be administered at 0.0001 to 2,000 mg/kg per day, preferably at 0.001 to 2,000 mg/kg per day. Administration may be administered once a day, or may be divided into several times. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention can be administered to various mammals, such as rats, mice, livestock, and humans. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrathecal dura or intracerebroventricular injection.

The composition comprising the active ingredient according to the present invention reduces allergic diseases by reducing the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 that is excessively secreted due to an immune response or It can improve and prevent atopic dermatitis symptoms.

In one embodiment of the present invention, as a result of treatment with nonine, the expression of inflammatory cytokines IL-4, IL-13, TNF-α, IL-1β, IL-6 and IL-8 secreted by the cellular immune response By confirming the marked reduction, it was possible that the elderly were able to suppress excessive immune responses and treat inflammation (FIGS. 1 and 2 ).

In addition, the present invention provides a composition for preventing or improving allergic disease or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.

The details of the elderly are as described above.

The composition for preventing or improving an allergic disease or atopic dermatitis of the present invention may be a health functional food composition, a cosmetic composition, or a fragrance composition.

In the present invention, the term "health functional food" refers to food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills, etc. using ingredients or ingredients having useful functionality for the human body. Here, the term'functional' refers to obtaining a useful effect for health use such as adjusting nutrients or physiological effects on the structure and function of the human body. The health functional food of the present invention can be manufactured by a method conventionally used in the art, and at the time of manufacture, it may be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food. The health functional food composition of the present invention has the advantage that there is no side effect or the like that may occur when taking the drug for a long time by using food as a raw material, unlike a general drug, and is excellent in portability, and promotes an anti-allergic effect or atopic dermatitis symptom relief effect It can be consumed as a supplement to prescribe.

In the health functional food for preventing or improving allergic disease or atopic dermatitis according to the present invention, when the nonine is used as an additive in the health functional food, it can be added as it is or used together with other foods or food ingredients, usually It can be suitably used depending on the phosphorus method. The mixing amount of the active ingredient can be appropriately determined according to each purpose of use, such as prevention, health, or treatment.

The formulation of the dietary supplement can be in the form of powders, granules, pills, tablets, capsules, as well as in the form of regular food or beverages.

The type of the food is not particularly limited, and examples of foods to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, and ice cream. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, and may include all foods in the ordinary sense.

In general, when producing food or beverage, the nonine may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material. However, in the case of long-term intake for the purpose of health and hygiene or for health control, the amount may be below the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. It can also be used in the above amount.

Among the functional foods according to the present invention, the beverage may contain various flavoring agents or natural carbohydrates, etc., as additional components, like a conventional beverage. The natural carbohydrates described above may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g per 100 mL of the beverage according to the present invention, preferably about 0.02 to 0.03 g.

In addition to the above, the health functional food for prevention or improvement of allergic disease or atopic dermatitis according to the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, and protective colloids It may contain thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonic acid used in carbonated beverages. In addition, the health functional food composition for preventing or improving allergic disease or atopic dermatitis of the present invention may contain natural fruit juice, fruit juice drinks and fruit flesh for the production of vegetable drinks. These ingredients can be used independently or in combination. The ratio of these additives is not limited, but is generally selected from 0.01 to 0.1 parts by weight compared to 100 parts by weight of the functional food of the present invention.

The term "cosmetic composition" used in the present invention is a composition containing the compound, and the formulation may be in any form. For example, in the case of such a formulation, the cosmetic product prepared using the composition includes nutrient cream, eye cream, massage cream, creams such as cleansing cream, packs, lotions such as nutrient lotions, essences, softening lotion, and nourishing lotion They are powders, powders, foundations and makeup bases, and can be manufactured and commercialized in any form of these formulations to achieve the object of the present invention, and are not limited to the above examples. In addition, the cosmetic composition according to the present invention can be formulated in a conventional cosmetic manufacturing method. Specifically, the cosmetic of the present invention is a skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet , Soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, rust powder and eye shadow may be any one selected from the group.

The cosmetic composition of the present invention may contain other additives such as excipients and carriers in addition to nonine or a salt thereof, and it is possible to apply and mix the usual ingredients to be blended into a general skin cosmetic as necessary.

Specifically, the cosmetic composition of the present invention may further include a transdermal penetration enhancer. The term used in the present invention, transdermal penetration enhancer is a composition that allows the desired component to penetrate into the vascular cells of the skin with a high absorption rate. Preferably, other phospholipid components and liposome components used in lecithin cosmetics are included, but are not limited thereto.

In addition, one or more selected from vegetable oils, mineral oils, silicone oils and synthetic oils may be used as oils that can be mainly used as the oil component. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis vinifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dime Chicon, cyclopentasiloxane and sunflower seed oil can be used.

In addition, surfactants, higher alcohols, etc. may be added in an amount of 0.1 to 5% by weight to enhance the emulsifying ability. Conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, and phospholipids can be used as such surfactants. Specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate/ sucrose cocoate, glyceryl stearate/polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol/behenyl alcohol/arachidyl glucoside, polypropylene glycol-26-butes-26/polyethylene glycol-40 hydrogenated castor oil, etc. can be used. have. As the higher alcohol, alcohols having 12 to 20 carbon atoms, such as cetyl alcohol, stearyl alcohol, octyldodecanol, and isostearyl alcohol, may be used alone or in combination of one or more.

The aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate, etc. in order to adjust the viscosity or hardness of the aqueous phase.

In addition, in the cosmetic composition of the present invention, if necessary, pharmaceutical ingredients such as high-grade fatty acids, vitamins, sunscreens, and antioxidants (butyl hydroxyanisole, propyl gallic acid, elisoric acid, tocopheryl acetate, butylated hydroxy) Toluene, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesine, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malate, phthalic acid, sodium phthalate, succinic acid, sodium succinate, sodium hydroxide, sodium hydrogen phosphate, etc., moisturizers (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycereth-26, methylglucose-20, etc.), lubricants, and other components.

In addition, the cosmetic composition of the present invention further comprises a substance capable of supplementally providing essential nutrients to the skin, and may preferably contain auxiliaries including but not limited to natural, cosmetic, or herbal medicines. have.

The effective content of nonine or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited, and may be included in 0.0001 to 20% by weight based on the total weight of the composition. In cosmetics, less than 0.0001% by weight of nonine or a salt thereof may have no wrinkle improvement effect due to a small amount thereof, and more than 20% by weight of nonine or a salt thereof may exhibit a known toxicity.

The term "perfume composition" of the present invention may be blended in external skin preparations such as perfumes, cosmetics, bathing agents, foods, pharmaceuticals, etc., and the blending amount is appropriately selected in order to achieve the desired effect according to conventional techniques in the art. It can be combined.

The formulation of the perfume composition of the present invention is not particularly limited, but may be any one selected from powder, granule, liquid spray, solid and gel type formulations.

The 　fragrance　composition includes cosmetic products containing perfume, soap cleaning products including bath soap, indoor cleaning products including glass cleaner, fragrance products including car air fresheners, bath products including herbal bath products, and stationery It can be used to manufacture fragrance products, environmental products including office fragrances, or industrial products containing synthetic resins.

The fragrance composition of the present invention is based on the total weight of the fragrance composition, the active ingredient is nonine, according to the product form in which the fragrance composition of the present invention is specified, 0.00001 wt% to 10 wt%, preferably 0.00001 wt% to 1.0% by weight, more preferably 0.00001% by weight to 0.5% by weight.

The product form in which the fragrance composition is embodied includes soap, cosmetics, bathing agent, aroma oil, etc., specifically, body lotion, shampoo, hair rinse, hair conditioner, hair treatment, antiperspirant, skin lotion, skin cream, deodorant , Perfume (spray or fumigant), lipstick, lip balm, bath, and the like, but are not limited to these.

These products can contain various additives such as blood circulation accelerators, anti-inflammatory agents, moisturizers, astringents, inorganic salts, organic salts, oily ingredients, surfactants, herbal medicines, pigments, fragrances, sulfur, sinter deposits, fungicides, etc. .

In particular, the fragrance composition of the present invention will be generally used as an external preparation for skin in cosmetic formulations such as makeup products, skin lotions, and skin creams. In this case, it may contain ingredients commonly used in these cosmetic formulations.

Particularly, the fragrance composition of the present invention is preferably used by being incorporated into a bathing agent in that the active ingredient nonine has atopic dermatitis-improving activity. In this case, the active ingredient may be preferably included in the range of 0.00001 to 1% by weight, more preferably 0.0001 to 0.1% by weight, based on the total weight of the bathing agent. When the fragrance composition of the present invention is incorporated into a bathing agent and used, the bathing agent may be used in a concentration of 0.015 to 15 ppm in the bath water.

Bathing agents may contain inorganic salts, organic acids, oily components, etc. in addition to the active ingredients of the perfume composition of the present invention.

As the inorganic salt, sodium chloride, sodium hydrogen carbonate, sodium carbonate, borax, sodium sulfate, sodium sulfide, sodium sesquicarbonate, sodium nitrate, sodium thiosulfate, sodium polyphosphate, sodium phosphate, calcium oxide, magnesium oxide, calcium carbonate, magnesium carbonate, potassium chloride, sulfide Potassium and the like can be exemplified, and these may be used alone or as a mixture of two or more. These inorganic salts may be added to the bathing agent in an amount of 5% by weight or more, preferably 10% by weight or more based on the total weight of the bathing agent.

As an organic acid, succinic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid, etc. can be exemplified, and these can be used alone or in a mixture of two or more. These organic acids may be added to the bathing agent in a range of 0.1 to 50% by weight based on the total weight of the bathing agent.

Examples of the oily component include wax, hydrocarbons, higher fatty acids, higher alcohols, esters, and silicone oils.

Bathing agents may also contain other ingredients commonly used in the art. Examples of these components include inorganic acids such as boric acid, metasilicic acid, and silicic anhydride; Medicinal herb powders such as fennel, ginkgo, ginger, citrus peel, Valerian root, mint, ginseng, and oats; Natural pigments that have been found to be harmless to the human body, such as coal tar dyes, chlorophyll, riboflavin, saffflower, and anthraquinone; Vitamins such as vitamin A, vitamin C, vitamin D, and vitamin E; Sulfur, mica powder, white clay powder, ocher powder, rice bran carbide, fungicide, preservative, and the like.

These bathing agents can be prepared in any form such as granules, tablets, liquids, powders, and the like.

In addition, the present invention provides a pharmaceutical composition, a quasi-drug composition and a cosmetic composition for promoting skin wound healing or skin regeneration, including nonane or a pharmaceutically acceptable salt thereof as an active ingredient.

Below, The present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example: Evaluation of secretion and expression of cytokines related to inflammation after nonane treatment on mast cells and keratinocytes

1-1. Experiment method

1) Mast cell cell culture

Mast cells (rat basophilic leukemia cell line, RBL-2H3) were purchased from ATCC (Manassas, VA, USA). Dulbecco modified eagle medium (DMEM) (Gibco BRL, USA) with 10% heat-inactivated feta bovine serum (FBS) (Gibco BRL, USA) and 1% penicillin and streptomycin (Gibco BRL, USA) Cells were cultured in culture. Cells were tested by culturing under 37°C and 5% CO ₂ conditions. Mast cells were suspended in DMEM containing 10% FBS, and then divided into 6 well plates (Corning, USA) to have a cell count of 1×10 ⁶ cells/ml.

After that, the cells were sensitized with anti DNP (dinitrophenyl)-IgE (30 ng/ml) and cultured in a 37°C, 5% CO ₂ incubator for 24 hours. After washing twice with PBS (phosphate buffered saline), DNP-HSA (dinitrophenylated human serum albumin; 10 μg/ml) was treated for 4 hours to induce an immune response. In addition, in order to evaluate the effect of improving atopy caused by nonane, anti-DNP (dinitrophenyl)-IgE was treated with mast cells cultured for 24 hours to treat 100 μM of nonine for 1 hour, followed by incubation for 1 hour, followed by immunization with DNP-HSA The reaction was induced. In normal cells, treated with DMSO instead of nonine under the same conditions as nonane treated cells, and in the case of positive control cells, treated with 10 μM of tacrolimus instead of nonine, and incubated for 1 hour to induce an immune response with DNP-HSA. .

2) keratinocytes cell culture

Keratinocytes (human keratinocyte cell line, HaCaT) were purchased from ATCC (Manassas, VA, USA) and used. For cell culture, a DMEM culture solution containing 10% fetal bovine serum (FBS) and antibiotics was used. The culture vessel used a 75T-flask and a 6-well plate and cultured in a 37°C incubator supplied with 5% CO2. The culture medium was changed every 3-4 days, and when the cells proliferated excessively, they were passaged. The dispensed HaCaT cells (5×10 ⁵ /well) were cultured for 24 hours, and then washed with PBS. To induce an immune response in keratinocytes, TMEM-α (tumor necrosis factor-α) (10 ng/ml) and IFN-γ (interferon gamma) (10 ng/ml) are treated together in DMEM medium without FBS. And incubated for 24 hours. At this time, in order to evaluate the efficacy of improving the immune response by nonine, 100 μM of nonine was treated simultaneously, DMSO instead of nonine for normal cells, and 10 μM of tacrolimus instead of nonine for positive control cells at the same time Treated and incubated for 24 hours.

3) RNA isolation and real-time PCR (quantitative reverse-transcription polymerase chain reacion) using the Trizol method

After removing the supernatant of the mast cells that induced the immune response, add 1 ml of trisol, leave for 2 minutes, add chloroform, vortex for 10 seconds, centrifuge at 5,000 rpm for 10 minutes, and then the upper layer. The liquid was taken and the same amount of isopropanol was mixed and shaken. The supernatant was removed by centrifugation at 13,000 rpm for 25 minutes, and the pellet was dissolved in 20 μl of diethyl pyrocarbonate (DEPC)-DW and stored at -20°C for use in the experiment. RT-PCR was reacted at 45°C for 30 minutes and 94°C for 5 minutes using one-step RT-PCR PreMixkit (iNtRON Biotechnology, Korea), and then denatured at 94°C for 30 seconds, and then at 55°C for 30 seconds. After annealing, and then repeating the cycle of extending 32 minutes at 72°C for 32 minutes, the final extension was performed at 72°C for 5 minutes and PiQ SYBR green supermix (Bio-Rad) And CFX Connect™ Real-Time PCR Detection System (Bio-Rad) was used to perform quantitative PCR, wherein the primer sequences used are as shown in [Table 1].

Primer sequences used for RT-PCR Gene description Primers Sequences (5'→3') Annealing
temperature
(℃) PCR
product (bp) IL-4 F CAGGGTGCTTCGCAAATTTTAC 55 104 R ACCGAGAACCCCAGACTTGTT IL-13 F GGTGGCCTCACCTCCCCAAG 60 234 R GATGACACTGCAGTTGGAGATGCTG TNF-α F CAGCCGATTTGCCACTTCATA 60 168 R TCCTTAGGGCAAGGGCTCTT IL-1β F TTACAGTGGCAATGAGGATGA 57 250 R TGTAGTGGTGGTCGGAGATT IL-6 F CCTGAGAAAGGAGACATGTAACAAGA 58 460 R TGGAAGGTTCAGGTTGTTTTCTG IL-8 F CTGGCCGTGGCTCTCTTG 65 292 R TTAGCACTCCTTGGCAAAACTG β-actin F ACCGTGAAAAGATGACCCAG 60 619 R TGTCAGCTGTGGTGGTGAAG

1-2. Experiment result

1) Changes in inflammatory cytokine production in mast cells

In control cells sensitized with anti DNP (dinitrophenyl)-IgE and induced immune response with DNP-HSA, the expression of inflammatory cytokines IL-4, IL-13 and TNF-α was significantly increased compared to normal mast cells. . Meanwhile, as a result of treating nonine or tacrolimus while inducing an immune response by anti DNP (dinitrophenyl)-IgE and DNP-HSA, increased inflammatory cytokines (IL-4, IL-13 and TNF-α due to the immune response) ) All of the expression was significantly reduced (Fig. 1).

2) Changes in inflammatory cytokine production in keratinocytes

In control cells that induced an immune response with TNF-α and IFN-γ, expression of inflammatory cytokines IL-1β, IL-6 and IL-8 was significantly increased compared to normal keratinocytes. On the other hand, as a result of treatment of keratinocytes with nonine or tacrolimus together with TNF-α and IFN-γ, expression of increased inflammatory cytokines (IL-1β, IL-6 and IL-8) due to the immune response All were significantly reduced (Fig. 2).

Hereinafter, an example of manufacturing a pharmaceutical, food or cosmetic product containing the nonine as an active ingredient according to the present invention will be described, but the present invention is not intended to be limited thereto, but only to be specifically described. The pharmaceutical, food or cosmetic compositions of Preparation Examples 1 to 3 according to the following compositional ingredients and compositional ratios, having ingredients having excellent components for preventing and treating (or preventing and improving) allergic diseases or atopic dermatitis according to a conventional method It was prepared.

[Production Example 1] Preparation of pharmaceutical composition

<1-1> Preparation of powder

Norine 20mg

Lactose hydrate 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight fabric to prepare a powder.

<1-2> Preparation of tablets

Norine 10 mg

Corn starch 100 mg

Lactose hydrate 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional tablet manufacturing method.

<1-3> Preparation of capsules

Norine 10 mg

Microcrystalline cellulose 3 mg

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were prepared by filling the gelatin capsules according to a conventional method for preparing capsules.

<1-4> Preparation of Injection

Norine 10 mg

Mannitol 180 mg

2974 mg of sterile distilled water for injection

Sodium monohydrogen phosphate 26 mg

After mixing the above components, it was prepared with the above-mentioned ingredient content per ampoule (2 mL) according to the preparation method of a conventional injection.

<1-5> Preparation of liquid formulation

Norine 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

Dissolve each of the above components by adding each component to purified water according to a conventional manufacturing method, add an appropriate amount of lemon flavor, adjust purified water to 100 mL, and sterilize to fill the brown bottle to prepare a liquid.

[Production Example 2] Preparation of healthy food

<2-1> Preparation of health supplements

Norine 10 mg

Vitamin mixture

Vitamin A Acetate 70 μg

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

Vitamin B ₁₂ 0.2 μg

Vitamin C 10 mg

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ folic acid

Calcium Pantothenate 0.5 mg

Suitable amount of mineral mixture

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium phosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 30 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the vitamin and mineral mixture is a composition suitable for a relatively healthy food in a preferred embodiment, the composition ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for preparing a healthy food. , Granules can be prepared and used in the preparation of healthy food compositions according to conventional methods.

<2-2> Preparation of health drinks

Noine 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

Iron lactate 19.75 g

Zinc oxide 3.5 g

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B1 0.25 g

Vitamin B2 0.3 g

Purified water quantitation

After mixing the above components according to a conventional health drink manufacturing method, and stirring and heating at 85° C. for about 1 hour, the resulting solution is filtered, obtained in a sterilized 2 liter container, sealed and sterilized, then refrigerated and stored in the present invention. It is used for the preparation of healthy beverage compositions.

Although the above composition ratio is a mixture of components suitable for preference beverages in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, country of demand, and usage.

[Production Example 3] Preparation of cosmetic composition

Hereinafter, an example of the preparation of a cosmetic composition containing the extract of the present invention will be described, but the present invention is intended to be described in detail rather than to limit it.

<3-1> Nutrient Cosmetics (Milk Lotion)

Nonine 2.0% by weight

Squalane 5.0 wt%

Wax 4.0 wt%

Polysorbate 60 1.5 wt%

Sorbitan sesquioleate 1.5 wt%

Liquid paraffin 0.5 wt%

Caprylic/Capric Triglyceride 5.0 wt%

Glycerin 3.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Carboxyvinyl polymer 0.1 wt%

Triethanolamine 0.2 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

The above blending ratio is a composition in which a component suitable for nutrient makeup is mixed in a preferred embodiment, but the blending ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

<3-2> Flexible Cosmetics (Skin Lotion)

Nonine 2.0% by weight

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene glycol 2.0% by weight

Carboxyvinyl polymer 0.1% by weight

PEG 12 nonylphenyl ether 0.2% by weight

Polysorbate 80 0.4 wt%

Ethanol 10.0% by weight

Triethanolamine 0.1 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

The above mixing ratio is a composition suitable for a relatively soft cosmetic composition in a preferred embodiment, but the mixing ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

<3-3> Nutrition Cream

Nonine 2.0% by weight

Polysorbate 60 1.5 wt%

Solbitan sesquioleate 0.5% by weight

PEG60 cured castor oil 2.0 wt%

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic/Capric Triglyceride 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Triethanolamine 0.2% by weight

Preservative dosage

Appropriate amount of pigment

Spices

Purified water to 100% by weight

The above blending ratio is a composition in which a component suitable for a nutrient cream is mixed in a preferred embodiment, but the blending ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

<3-4> Massage Cream

Nonane 1.0% by weight

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0% by weight

Solbitan sesquioleate 0.8% by weight

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic/Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above mixing ratio is a composition suitable for a relatively suitable massage cream in a preferred embodiment, the mixing ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

<3-5> Pack

Nonane 1.0% by weight

Polyvinyl alcohol 13.0% by weight

Sodium carboxymethyl cellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0% by weight

PEG 12 nonylphenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

The above mixing ratio is a composition suitable for relatively suitable components in a pack, but the mixing ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

<3-6> Gel

Nonane 0.5% by weight

Sodium ethylenediamine acetate 0.05% by weight

Glycerin 5.0 wt%

Carboxyvinyl polymer 0.3% by weight

Ethanol 5.0 wt%

PEG 60 hardened castor oil 0.5% by weight

Triethanolamine 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above mixing ratio is a composition in which a component suitable for a gel is mixed in a preferred embodiment, the mixing ratio may be arbitrarily modified, and may be prepared according to a manufacturing method in the general cosmetic field.

The above blending ratio is a composition suitable for a relatively cosmetic composition in a preferred embodiment, but can be applied to cosmetics for various uses including other color cosmetics, and a drug that can be applied by being thinly applied to the human body according to its efficacy, namely It can be used for manufacturing ointment furnaces, and its mixing ratio can be arbitrarily modified according to regional and ethnic preferences such as demand class, country of demand, and usage.

The above description of the present invention is for illustration only, and those skilled in the art to which the present invention pertains can understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> COMPOSITION INCLUDING NONANE AS ACTIVE INGREDIENTS FOR ANTI-ALLERGY, IMPROVEMENT OF ATOPIC DERMATITIS, OR SKIN REGENERATION <130> 1065067 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-4_F primer <400> 1 cagggtgctt cgcaaatttt ac 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-4_R primer <400> 2 accgagaacc ccagacttgt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-13_F primer <400> 3 ggtggcctca cctccccaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-13_R primer <400> 4 gatgacactg cagttggaga tgctg 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_F primer <400> 5 cagccgattt gccacttcat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_R primer <400> 6 tccttagggc aagggctctt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F primer <400> 7 ttacagtggc aatgaggatg a 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R primer <400> 8 tgtagtggtg gtcggagatt 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F primer <400> 9 cctgagaaag gagacatgta acaaga 26 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R primer <400> 10 tggaaggttc aggttgtttt ctg 23 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-8_F primer <400> 11 ctggccgtgg ctctcttg 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-8_R primer <400> 12 ttagcactcc ttggcaaaac tg 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F primer <400> 13 accgtgaaaa gatgacccag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R primer <400> 14 tgtcagctgt ggtggtgaag 20

Claims (8)

Nonane (Nonane) or a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis comprising an pharmaceutically acceptable salt thereof as an active ingredient.
According to claim 1,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insects A pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, comprising at least one selected from the group consisting of allergies, food allergies and drug allergies.
According to claim 1,
The active ingredient is IL-4, IL-13, TNF-α, IL-1β, IL-6 or a pharmaceutical composition for the prevention or treatment of atopic dermatitis characterized by reducing the expression of IL-8 or IL-8 .
A composition for preventing or improving allergic disease or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.
According to claim 4,
The composition is a functional food composition, a cosmetic composition or a composition for preventing or improving allergic disease or atopic dermatitis, characterized in that the fragrance composition.
Nonane (Nonane) or a pharmaceutical composition for promoting skin wound healing or skin regeneration, comprising an pharmaceutically acceptable salt thereof as an active ingredient.
Non-ane (Nonane) or a pharmacologically acceptable composition for the treatment of skin wounds or promoting skin regeneration, which includes a pharmaceutically acceptable salt thereof as an active ingredient.
Nonane (Nonane) or a cosmetic composition for promoting skin wound healing or skin regeneration, including a salt thereof as an active ingredient.

Images