KR102160868B1 - Composition including nonane as active ingredients for anti-allergy, improvement of atopic dermatitis, or skin regeneration - Google Patents

Abstract

The present invention relates to a composition for anti-allergic, atopic dermatitis improvement, or skin regeneration comprising nonane as an active ingredient, and more specifically, an allergy comprising nonane or a pharmaceutically acceptable salt thereof as an active ingredient It relates to a composition for preventing or treating sexual diseases or atopic dermatitis, and to a composition for healing skin wounds or promoting skin regeneration.

Description

Anti-allergic, atopic dermatitis improvement, or skin regeneration composition containing nonein as an active ingredient {COMPOSITION INCLUDING NONANE AS ACTIVE INGREDIENTS FOR ANTI-ALLERGY, IMPROVEMENT OF ATOPIC DERMATITIS, OR SKIN REGENERATION}

The present invention relates to a composition for anti-allergic, atopic dermatitis improvement, or skin regeneration comprising nonane as an active ingredient, and more specifically, allergies comprising nonane or a pharmaceutically acceptable salt thereof as an active ingredient It relates to a composition for preventing or treating sexual diseases or atopic dermatitis, and to a composition for healing skin wounds or promoting skin regeneration.

Atopy is derived from the ancient Greek word'atopia', which means'strange, abnormal'. In 1923, Cooke and Coca first began to call a tendency to cause a genetically specific immune antibody response to an allergen as'atopic'. With a steadily increasing trend worldwide, the incidence rate is increasing in developed countries with industrial development.

The cause of the onset of atopy has not been accurately identified yet, but is not limited to one factor such as family history, changes in diet, penetration of allergens, and abnormal skin barriers. It occurs mainly in infancy and infancy and may persist or begin in adulthood. Typical symptoms of atopy appear on the hands, scalp, face, neck, and elbows, but there are differences in the patterns that appear by period. Symptoms of infancy are rough skin and dryness, dermatitis on the outside of limbs, cheeks and foreheads, and sores or scabs sit after scratching with hands. In childhood, it mainly appears on the folds of arms, legs and neck rather than the face, and the skin becomes dry. In puberty and adulthood, symptoms of thickening of the skin on areas such as the face and hands appear.

Local steroids, local immunomodulators, systemic steroids, systemic immunosuppressants, and antihistamines are used as atopic drugs. Topical steroids are used when atopic symptoms are severe and are the most basic method to manage bacterial or viral infections. However, steroids have been introduced in 1950 and have been used for many years, but long-term use is restricted due to problems of skin safety and tolerance depending on the frequency, concentration, and duration of use. In addition, potential skin side effects such as skin, atrophy, telangiectasia, and steroid acne, as well as hyperhalamic-pituitary-adrenal (HPA) suppression and Cushing's syndrome. Sufficient care should be taken when using it as it may cause side effects.

The local immunomodulators tacrolimus and pimecrolimus are known to be used over a long period of time for the purpose of preventing recurrence of lesions as they have a relatively low possibility of side effects even when used for a long time, unlike conventional topical steroids. It is suitable for use as a treatment and maintenance therapy. However, tacrolimus may have side effects such as decreased kidney function, hand tremor, and hair loss, and pimecrolimus may have serious side effects such as acne and burning as well as skin cancer and lymphoma. When steroids worsen in the acute phase, local immunomodulators are suitable for use as treatment and maintenance therapy for mild atopy, but safety against side effects has not yet been secured, so there is an urgent need for alternative supplements.

Accordingly, the applicant of the present invention has endeavored to develop a material effective in alleviating the symptoms of atopic dermatitis with less side effects, and as a result, it has been confirmed that Nonane relieves the symptoms of atopic and improves the inflammatory response, anti-allergic, The present invention was completed by confirming that there is a wound healing effect.

Republic of Korea Patent Publication No. 10-2018-0128602

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, comprising Nonane or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising nonein or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for stimulating skin wound healing or skin regeneration comprising nonein or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for promoting skin wound healing or skin regeneration comprising nonein or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis comprising nonane or a pharmaceutically acceptable salt thereof as an active ingredient in order to solve the above problems.

According to one aspect of the present invention, the allergic disease is edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, 　 contact It may be selected from the group consisting of sexual dermatitis, urticaria, pruritus, insect allergy, food allergy and drug allergy, but is not limited thereto.

According to an aspect of the present invention, the active ingredient expresses IL-4 (Interleukin-4), IL-13, TNF-α (tumor necrosis factor-alpha), IL-1β, IL-6, or IL-8. By reducing the anti-allergic effect, atopic dermatitis prevention or treatment effect can be exhibited.

In addition, the present invention provides a composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.

According to one embodiment of the present invention, the composition may be a health functional food composition, a cosmetic composition, or a fragrance composition.

In addition, the present invention provides a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising nonein or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a quasi-drug composition for promoting skin wound healing or skin regeneration, comprising nonein or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a cosmetic composition for promoting skin wound healing or skin regeneration comprising nonein or a salt thereof as an active ingredient.

The composition containing nonanein of the present invention as an active ingredient has an effect of improving atopic dermatitis due to an allergic reaction, and can be used as a composition for preventing or treating various allergic diseases by reducing the inflammatory reaction. In addition, since the composition of the present invention has a skin regeneration effect, it can be usefully used as a wound healing medicine or a functional cosmetic for skin regeneration.

1 is a graph showing the expression change of inflammatory cytokine-related molecules (IL-4, IL-13 and TNF-α) in mast cells treated with nonein (each value is 3 times obtained from 3 independent wells) Mean ± SEM; letters on the bars represent statistically significant differences at P<0.05).
FIG. 2 is a graph showing changes in expression of inflammatory cytokine-related molecules (IL-1β, IL-6, and IL-8) in keratinocytes treated with nonein (each value is 3 obtained from three independent wells). Means of meetings ± SEM; letters on bars represent statistically significant differences at P<0.05).

The present inventors found that nonein relieves atopic symptoms and expresses IL-4, IL-13, TNF-α, IL-1β, IL-6, or IL-8, which are inflammatory cytokines secreted due to the immune response of cells. By confirming the significant reduction, the present invention was completed.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for the prevention or treatment of allergic diseases or atopic dermatitis, including nonane or a salt thereof as an active ingredient.

Specifically, the nonane is contained in plants such as Pittosporum and Hypericum, and is also called N-Nonane. The structural formula of nonane is C ₉ H ₂₀ , the molecular weight is 128.26, and the chemical formula is the same as [Chemical Formula 1]. Nonaine is a colorless, transparent liquid component. Its melting point is 31℃ and its boiling point is 150.8℃.

The physiological activities and general functions of nonein have not been reported to date.

[Formula 1]

Nonein of the present invention may include a nonein hydrate, a nonein derivative, and the like within a range having the same efficacy as the above nonein, and may also include a solvate or stereoisomer thereof.

The method for obtaining the nonanein is not particularly limited, and may be isolated from a plant containing the nonanein, chemically synthesized using a known manufacturing method, or a commercially available one may be used.

In the present invention, the term “cosmetically acceptable salt”, “food pharmaceutically acceptable salt”, “pharmaceutically acceptable salt” or “salt thereof” may be an acid addition salt formed by a free acid. have. The acid addition salt can be prepared by a conventional method, for example, dissolving the compound in an excess aqueous acid solution, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. In addition, the same molar amount of the compound and an acid or alcohol (eg glycol monomethyl ether) in water may be heated, and then the mixture may be evaporated to dryness, or the precipitated salt may be suction filtered.

As the free acid, an inorganic acid or an organic acid may be used. Non-limiting examples of the inorganic acid may be hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like, which may be used alone or in combination of two or more. Non-limiting examples of the organic acid include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid (propionic acid). acid), citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid (glucuronic acid), aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid, and the like can be used. These may be used alone or in combination of two or more.

In addition, the nonanein can be made cosmetically or food acceptable metal salt using a base. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. As the metal salt, it is particularly preferable to prepare a sodium, potassium or calcium salt, but is not limited thereto. Further, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with an appropriate silver salt (eg, silver nitrate).

The salt of nonane, unless otherwise indicated, may include all salts of acidic or basic groups that may be present in the compound of nonane. For example, the salt of nonane may include sodium, calcium and potassium salts of the hydroxy group, and other cosmetically acceptable salts of the amino group include hardbromide, sulfuric acid, hydrogen sulfate, phosphate, hydrogen phosphate , Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like, and salts known in the art It can be manufactured through a manufacturing method.

In the present invention, "allergic disease" refers to a disease caused by an allergy reaction in which the body's immune response to an external antigen is excessive, and specifically, edema, hypersensitivity (anaphylaxis), allergic rhinitis (allergic) rhinitis), asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insect allergy, food allergy, and drug allergy. However, it is not limited thereto.

In the present invention, "atopic dermatitis" is one of allergic diseases and is a skin disease accompanied by symptoms such as itching, dry skin, increased skin thickness, and characteristic eczema.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention is not particularly limited in its content as long as it contains nonein or a pharmaceutically acceptable salt thereof, but preferably the dose of nonein is 0.1 It may be included in a concentration of μM to 1000 μM, but is not limited thereto. At this time, when the nonein is less than the above concentration range, there is a problem that it is difficult to exert a desirable preventive or therapeutic effect, and when the nonein exceeds the above concentration range, there may be concerns of toxicity including cytotoxicity.

The pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention, according to a conventional method, respectively, oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories and It may be formulated and used in the form of a sterile injectable solution, and may include a suitable carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions for formulation.

As the carrier or excipient or diluent, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, undecided And various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

In the case of formulation, it can be prepared using diluents or excipients such as fillers, weight agents, binders, wetting agents, disintegrants, and surfactants that are usually used.

Solid preparations for oral administration may be prepared by mixing the nonanein with at least one excipient, such as starch, calcium bonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used.

Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerol gelatin, and the like can be used.

The preferred dosage of the pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention varies depending on the patient's condition, weight, degree of disease, drug form, route and duration of administration, but may be appropriately selected by those skilled in the art. I can. However, for a desirable effect, it may be administered at 0.0001 to 2,000 mg/kg per day, preferably 0.001 to 2,000 mg/kg. Administration may be administered once a day, or may be divided several times. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention can be administered to mammals such as mice, mice, livestock, and humans by various routes. All modes of administration can be administered by, for example, oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

The composition comprising the active ingredient according to the present invention reduces the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 that is excessively secreted due to an immune response, thereby reducing the expression of allergic diseases or Atopic dermatitis symptoms can be improved and prevented.

In one embodiment of the present invention, as a result of nonein treatment, the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 and IL-8, which are inflammatory cytokines secreted by the immune response of cells By confirming that the remarkably decreased, it was possible that nonein could suppress excessive immune response and treat inflammation (FIGS. 1 and 2).

In addition, the present invention provides a composition for preventing or improving allergic diseases or atopic dermatitis comprising Nonane or a salt thereof as an active ingredient.

The specific contents of the Nonain are as described above.

The composition for preventing or improving allergic diseases or atopic dermatitis of the present invention may be a health functional food composition, a cosmetic composition, or a perfume composition.

In the present invention, the term "health functional food" refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. Here, "functionality" means obtaining useful effects for health purposes such as controlling nutrients or physiological effects on the structure and function of the human body. The health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food may be prepared without limitation as long as it is a formulation recognized as a health functional food. The health functional food composition of the present invention has the advantage of not having side effects that may occur when taking the drug for a long period of time, unlike general drugs, using food as a raw material, and is excellent in portability, enhancing the anti-allergic effect or the relief effect of atopic dermatitis symptoms. It can be ingested as a supplement to make.

In the health functional food for the prevention or improvement of allergic diseases or atopic dermatitis according to the present invention, when the nonanein is used as an additive to a health functional food, it can be added as it is or used with other foods or food ingredients, and is usually It can be used appropriately according to the method of phosphorus. The mixing amount of the active ingredient can be appropriately determined according to each purpose of use, such as prevention, health or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as general foods or beverages.

The type of food is not particularly limited, and examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and dairy products including ice cream. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, and may include all foods in the usual sense.

In general, when preparing food or beverage, the nonane may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on 100 parts by weight of raw materials. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. It can be used in the above amount.

Among the functional foods according to the present invention, the beverage may contain various flavoring agents or natural carbohydrates as an additional component, like a conventional beverage. The natural carbohydrates described above may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for the prevention or improvement of allergic diseases or atopic dermatitis according to the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloids. It may contain thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages. In addition, the health functional food composition for preventing or improving allergic diseases or atopic dermatitis of the present invention may contain flesh for the manufacture of natural fruit juice, fruit juice drink, and vegetable drink. These ingredients may be used independently or in combination. The ratio of these additives is not limited, but it is generally selected from 0.01 to 0.1 parts by weight based on 100 parts by weight of the functional food of the present invention.

The term "cosmetic composition" used in the present invention is a composition including the compound, and the formulation may be in any form. For example, cosmetic products prepared using the above composition include creams such as nutritional cream, eye cream, massage cream, cleansing cream, packs, lotions such as nutritional lotion, essences, softening lotion, lotion such as nutritional lotion. Types, powders, foundations, makeup bases, and the like, and can be manufactured and commercialized in any of these formulations to achieve the object of the present invention, and are not limited to the above examples. In addition, the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method. Specifically, the cosmetics of the present invention are skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet , Soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder, and eye shadow.It may have any one formulation selected from the group consisting of.

The cosmetic composition of the present invention may contain other additives such as excipients, carriers, etc. in addition to nonane or a salt thereof, and it is possible to apply and mix ordinary ingredients to be blended in general skin cosmetics as needed.

Specifically, the cosmetic composition of the present invention may further include a transdermal penetration enhancer. The term used in the present invention, a transdermal penetration enhancer, is a composition that allows a desired component to penetrate into blood vessel cells of the skin at a high absorption rate. Preferably, other phospholipid components, liposome components, and the like used in lecithin cosmetics are included, but are not limited thereto.

In addition, as an oil that can be mainly used as an oily component, at least one selected from vegetable oils, mineral oils, silicone oils, and synthetic oils may be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis vinifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dime Chicon, cyclopentasiloxane, and sunflower seed oil can be used.

In addition, 0.1 to 5% by weight of a surfactant, a higher alcohol, and the like may be added to reinforce the emulsifying ability. As such surfactants, conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, etc. may be used, and specifically, sorbitansquinoleate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, DIA-cetyl phosphate, sorbitan stearate/ sucrosecoate, glyceryl stearate/polyethylene glycol-100 Stearate, ceteareth-6 olivate, arachidyl alcohol/behenyl alcohol/arachidyl glucoside, polypropylene glycol-26-butes-26/polyethylene glycol-40 hydrogenated castor oil, etc. can be used. have. As the higher alcohol, an alcohol having 12 to 20 carbon atoms, such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, and the like may be used alone or in combination of one or more.

The aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate, etc. to adjust the viscosity or hardness of the aqueous phase.

In addition, the cosmetic composition of the present invention includes medicinal ingredients such as higher fatty acids and vitamins, sunscreen, and antioxidants (butylhydroxyanisole, propyl gallic acid, lysorbic acid, tocopheryl acetate, butylated hydroxy) as needed. Toluene), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, etc.) Sodium Malate, Pmalic Acid, Sodium Fmalate, Succinic Acid, Sodium Succinate, Sodium Hydroxide, Sodium Monohydrogen Phosphate, etc.), Moisturizing Agents (Glycerin, Sorbitol, Propylene Glycol, Butylene Glycol, Hexylene Glycol, Diglycerin , Betaine, glyceres-26, methylgluces-20, etc.), lubricants and the like can be added.

In addition, the cosmetic composition of the present invention further includes a substance capable of auxiliaryly providing essential nutrients to the skin, preferably, it may contain a natural scent, a cosmetic scent, or an auxiliary agent including, but not limited to, herbal medicines. have.

The effective content of nonane or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited, and may be included in an amount of 0.0001 to 20% by weight based on the total weight of the composition. Less than 0.0001% by weight of nonane or a salt thereof in the cosmetic may have a small dose and thus may not have an effect of improving wrinkles, and nonane or a salt thereof of 20% by weight or more may exhibit known toxicity.

The term "fragrance composition" of the present invention may be formulated as a base for skin external use such as perfume, cosmetics, and bath, or food, pharmaceuticals, etc., and the blending amount is appropriately selected in order to achieve the desired effect according to conventional techniques in the art. Can be blended.

The formulation of the perfume 　 composition of the present invention is not particularly limited, but may be any one selected from powder, granule, liquid spray, solid and gel type formulations.

The 　 perfume 　 composition includes cosmetic products including perfume, soap cleaning products including bath soap, indoor cleaning products including glass cleaners, fragrance products including car air fresheners, bath products including herbal bath products, and stationery It can be used to manufacture a fragrance product, an environmental product including an office fragrance, or an industrial product including a synthetic resin.

The perfume composition of the present invention contains nonane, the active ingredient, based on the total weight of the perfume composition, from 0.00001% to 10% by weight, preferably from 0.00001% by weight, depending on the product type in which the perfume composition of the present invention is embodied. It may contain 1.0% by weight, more preferably in the range of 0.00001% by weight to 0.5% by weight.

Product types in which the fragrance composition is specified above include soap, cosmetics, bath agents, aroma oils, etc., specifically body lotion, shampoo, hair rinse, hair conditioner, hair treatment, antiperspirant, skin lotion, skin cream, deodorant , Perfume (spray or fumigant), lipstick, lip cream, bath agent, etc., but are not limited thereto.

These products may contain various additives such as blood circulation accelerators, anti-inflammatory agents, moisturizing agents, astringents, inorganic salts, organic salts, oily ingredients, surfactants, herbal medicines, colors, fragrances, sulfur, sinter deposits, disinfectants, etc. .

In particular, the perfume composition of the present invention will generally be used as an external application for the skin of cosmetic formulations such as makeup products, skin lotions, and skin creams. In this case, it may contain ingredients commonly used in these cosmetic formulations.

Particularly, the fragrance composition of the present invention is preferably used by being incorporated into a bathing agent in that the active ingredient, nonein, has atopic dermatitis improving activity. In this case, the active ingredient may preferably be included in the range of 0.00001 to 1% by weight, more preferably 0.0001 to 0.1% by weight, based on the total weight of the bath agent. When the fragrance composition of the present invention is incorporated into a bathing agent and used, the bathing agent may be added to the bath water in a concentration of 0.015 to 15 ppm and used.

The bath agent may contain inorganic salts, organic acids, oily ingredients, etc. in addition to the active ingredients of the perfume composition of the present invention.

As inorganic salts, sodium chloride, sodium hydrogen carbonate, sodium carbonate, borax, sodium sulfate, sodium sulfide, sodium sesquicarbonate, sodium nitrate, sodium thiosulfate, sodium polyphosphate, sodium phosphate, calcium oxide, magnesium oxide, calcium carbonate, magnesium carbonate, potassium chloride, sulfide Potassium and the like may be exemplified, and these may be used alone or as a mixture of two or more. These inorganic salts may be added to the bath agent in an amount of 5% by weight or more, preferably 10% by weight or more, based on the total weight of the bath agent.

As the organic acid, succinic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid and the like can be exemplified, and these may be used alone or in a mixture of two or more. These organic acids may be added to the bath agent in the range of 0.1 to 50% by weight, based on the total weight of the bath agent.

Examples of the oily component include wax, hydrocarbon, higher fatty acid, higher alcohol, ester, and silicone oil.

The bath agent may also contain additional ingredients commonly used in the art. Examples of these components include inorganic acids such as boric acid, metasilicic acid, and silicic anhydride; Herbal powders such as fennel, ginkgo, ginger, citrus peel, valerian root, mint, ginseng, and oats; Natural pigments, such as coal tar dye, chlorophyll, riboflavin, safflower, and anthraquinone, which have been found to be harmless to the human body; Vitamins such as vitamin A, vitamin C, vitamin D, and vitamin E; Sulfur, mica powder, clay powder, loess powder, rice bran carbide, fungicides, and preservatives.

These bathing agents may be prepared in any form such as granules, tablets, liquids, powders, and the like.

In addition, the present invention provides a pharmaceutical composition for promoting skin wound healing or skin regeneration, a quasi-drug composition, and a cosmetic composition comprising Nonane or a pharmaceutically acceptable salt thereof as an active ingredient.

Below, The present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example: Evaluation of secretion and expression of inflammation-related cytokines after nonane treatment on mast cells and keratinocytes

1-1. Experiment method

1) mast cell culture

Mast cells (rat basophilic leukemia cell line, RBL-2H3) were purchased and used from ATCC (Manassas, VA, USA). DMEM (Dulbecco modified eagle medium) (Gibco BRL, USA) containing 10% heat-inactivated feta bovine serum (FBS) (Gibco BRL, USA) and 1% penicillin and streptomycin (Gibco BRL, USA) Cells were cultured in the culture medium. Cells were tested by culturing under conditions of 37°C and 5% CO ₂ . After the mast cells were suspended in DMEM containing 10% FBS, they were dispensed into a 6-well plate (Corning, USA) to a cell number of 1×10 ⁶ cells/ml.

Then, it was sensitized with anti DNP (dinitrophenyl)-IgE (30 ng/ml) and incubated in an incubator at 37° C. and 5% CO ₂ for 24 hours. After washing twice with PBS (phosphate buffered saline), DNP-HSA (dinitrophenylated human serum albumin; 10 μg/ml) was treated for 4 hours to induce an immune response. In addition, in order to evaluate the atopic improvement effect by Nonane, mast cells cultured for 24 hours by treatment with anti DNP (dinitrophenyl)-IgE were treated with 100 μM of Nonane and cultured for 1 hour and then immunized with DNP-HSA. The reaction was induced. Normal cells were treated with DMSO instead of nonein under the same conditions as nonein-treated cells, and in the case of positive control cells, treated with 10 μM of Tacrolimus instead of nonein, incubated for 1 hour, and induced an immune response with DNP-HSA. .

2) Cell culture of keratinocytes

Keratinocytes (human keratinocyte cell line, HaCaT) were purchased and used from ATCC (Manassas, VA, USA). For cell culture, a DMEM culture solution containing 10% FBS (fetal bovine serum) and antibiotics was used. The culture vessel used a 75T-flask and a 6-well plate, and cultured in a 37°C incubator supplied with 5% CO2. The culture medium was changed every 3 to 4 days, and when cells were excessively proliferated, they were subcultured. The dispensed HaCaT cells (5×10 ⁵ /well) were cultured for 24 hours and washed with PBS. To induce an immune response to keratinocytes, TNF-α (tumor necrosis factor-α) (10 ng/ml) and IFN-γ (interferon gamma) (10 ng/ml) were treated together in DMEM medium without FBS. And incubated for 24 hours. At this time, 100 μM of nonein was treated at the same time to evaluate the efficacy of improving the immune response by nonein, and DMSO was used instead of nonein for normal cells, and 10 μM of tacrolimus instead of nonein was used for positive control cells with the immune response inducing substance Treatment and incubation for 24 hours.

3) RNA isolation and real-time PCR (quantitative reverse-transcription polymerase chain reacion) using the Trizol method

After removing the supernatant of the mast cells that induced the immune response, add 1 ml of trizol, leave for 2 minutes, add chloroform, vortex for 10 seconds, and centrifuge at 5,000 rpm for 10 minutes, and then the upper layer The solution was taken, and the same amount of isopropanol was mixed and shaken. The supernatant was removed by centrifugation at 13,000 rpm for 25 minutes, and the pellet was dissolved in 20 μl of DEPC (diethyl pyrocarbonate)-DW and stored at -20°C before use in the experiment. RT-PCR uses one-step RT-PCR PreMixkit (iNtRON Biotechnology, Korea) to react at 45°C for 30 minutes and 94°C for 5 minutes, and then denatures at 94°C for 30 seconds and then at 55°C for 30 seconds. After annealing, the cycle of stretching at 72°C for 1 minute was repeated 32 times, and the last extension was performed at 72°C for 5 minutes and PiQ SYBR green supermix (Bio-Rad) And CFX Connect™ Real-Time PCR Detection System (Bio-Rad) was used to perform quantitative PCR, and the primer sequence used at this time is as shown in [Table 1].

Primer sequence used for RT-PCR Gene description Primers Sequences (5'→3') Annealing
temperature
(℃) PCR
product (bp) IL-4 F CAGGGTGCTTCGCAAATTTTAC 55 104 R ACCGAGAACCCCAGACTTGTT IL-13 F GGTGGCCTCACCTCCCCAAG 60 234 R GATGACACTGCAGTTGGAGATGCTG TNF-α F CAGCCGATTTGCCACTTCATA 60 168 R TCCTTAGGGCAAGGGCTCTT IL-1β F TTACAGTGGCAATGAGGATGA 57 250 R TGTAGTGGTGGTCGGAGATT IL-6 F CCTGAGAAAGGAGACATGTAACAAGA 58 460 R TGGAAGGTTCAGGTTGTTTTCTG IL-8 F CTGGCCGTGGCTCTCTTG 65 292 R TTAGCACTCCTTGGCAAAACTG β-actin F ACCGTGAAAAGATGACCCAG 60 619 R TGTCAGCTGTGGTGGTGAAG

1-2. Experiment result

1) Changes in inflammatory cytokine production in mast cells

In control cells sensitized with anti-DNP (dinitrophenyl)-IgE and induced an immune response with DNP-HSA, the expression of inflammatory cytokines IL-4, IL-13, and TNF-α was significantly increased compared to normal mast cells. . On the other hand, as a result of treatment with nonane or tacrolimus while inducing an immune response by anti-DNP (dinitrophenyl)-IgE and DNP-HSA, increased inflammatory cytokines (IL-4, IL-13 and TNF-α ) Were all significantly reduced (Fig. 1).

2) Changes in inflammatory cytokine production in keratinocytes

In control cells induced immune response with TNF-α and IFN-γ, the expression of inflammatory cytokines IL-1β, IL-6 and IL-8 was significantly increased compared to normal keratinocytes. On the other hand, as a result of treatment of keratinocytes with nonein or tacrolimus together with TNF-α and IFN-γ, the expression of inflammatory cytokines (IL-1β, IL-6 and IL-8) increased due to an immune response All were significantly reduced (Fig. 2).

Hereinafter, examples of preparation of pharmaceuticals, foods or cosmetics containing the nonanein as an active ingredient according to the present invention will be described, but the present invention is not intended to limit this, but is intended to be described in detail. The pharmaceutical, food, or cosmetic compositions of Preparation Examples 1 to 3 according to the following compositional ingredients and composition ratios having an excellent ingredient in the prevention and treatment (or prevention and improvement effect) of the allergic disease or atopic dermatitis according to a conventional method Was prepared.

[Production Example 1] Preparation of pharmaceutical composition

<1-1> Preparation of powder

Nonaine 20 mg

100 mg of lactose hydrate

Talc 10 mg

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

<1-2> Preparation of tablets

Nonaine 10 mg

Corn starch 100 mg

100 mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above ingredients, tablets were prepared by tableting according to a conventional tablet preparation method.

<1-3> Preparation of capsules

Nonaine 10 mg

Microcrystalline cellulose 3 mg

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above ingredients, the capsules were prepared by filling them into gelatin capsules according to a conventional capsule preparation method.

<1-4> Preparation of injection

Nonaine 10 mg

Mannitol 180 mg

2974 mg of sterile distilled water for injection

Sodium monohydrogen phosphate 26 mg

After mixing the above ingredients, it was prepared with the above ingredient content per ampoule (2 mL) according to a conventional method for preparing injections.

<1-5> Preparation of liquid formulation

Nonaine 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water appropriate amount

Lemon flavor appropriate amount

The above ingredients are dissolved by adding each ingredient to purified water according to a conventional manufacturing method, added an appropriate amount of lemon flavor, adjusted to 100 mL by adding purified water, sterilized, and filled in a brown bottle to prepare a liquid formulation.

[Production Example 2] Preparation of health food

<2-1> Manufacture of health supplement food

Nonaine 10 mg

Vitamin mixture right amount

Vitamin A acetate 70 ㎍

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

Vitamin B ₁₂ 0.2 ㎍

Vitamin C 10 mg

Biotin 10 ㎍

Nicotinic acid amide 1.7 mg

Folic acid 50 ㎍

0.5 mg of calcium pantothenate

Suitable amount of inorganic mixture

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dicalcium phosphate 55 mg

Potassium citrate 30 mg

100 mg of calcium carbonate

Magnesium chloride 24.8 mg

The composition ratio of the vitamin and mineral mixture is relatively suitable for health food, but it may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. , To prepare granules, and can be used to prepare a health food composition according to a conventional method.

<2-2> Manufacture of health drinks

10 mg nonane

15 g of vitamin C

100 g of vitamin E (powder)

19.75 g of iron lactate

Zinc oxide 3.5 g

3.5 g of nicotinic acid amide

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified water quantification

After mixing the above ingredients according to a conventional health drink manufacturing method, stirring and heating at 85°C for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 liter container, sealed and sterilized, and then stored in a refrigerator. It is used in the manufacture of health beverage composition.

The above composition ratio is made by mixing ingredients suitable for a relatively preferred beverage in a preferred embodiment, but the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as the demand class, the country of demand, and the purpose of use.

[Production Example 3] Preparation of cosmetic composition

Hereinafter, a preparation example of a cosmetic composition containing the extract of the present invention will be described, but the present invention is not intended to limit it, but is intended to be described in detail.

<3-1> Nutritional lotion (milk lotion)

Nonaine 2.0% by weight

5.0% by weight of squalane

4.0 wt% beeswax

1.5% by weight of polysorbate 60

1.5% by weight of sorbitansquioleate

0.5% by weight of liquid paraffin

Caprylic/Capric Triglyceride 5.0% by weight

3.0% by weight of glycerin

Butylene glycol 3.0% by weight

Propylene glycol 3.0% by weight

0.1% by weight of carboxyvinyl polymer

0.2% by weight of triethanolamine

Preservative, color, and fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for a relatively nutrient lotion in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-2> Flexible lotion (skin lotion)

Nonane 2.0% by weight

3.0% by weight of glycerin

2.0% by weight of butylene glycol

2.0% by weight of propylene glycol

0.1% by weight of carboxyvinyl polymer

PEG 12 nonylphenyl ether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0% by weight

0.1% by weight of triethanolamine

Preservative, color, and fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for a relatively flexible lotion in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-3> Nutrition cream

Nonane 2.0% by weight

Polysorbate 60 1.5% by weight

0.5% by weight of sorbitansquioleate

PEG60 hydrogenated castor oil 2.0% by weight

Liquid paraffin 10% by weight

5.0% by weight of squalane

Caprylic/Capric Triglyceride 5.0% by weight

5.0% by weight of glycerin

Butylene glycol 3.0% by weight

Propylene glycol 3.0% by weight

0.2% by weight of triethanolamine

Appropriate amount of preservative

Appropriate amount of pigment

Suitable amount of fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for a nutritional cream in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-4> Massage cream

1.0% by weight of nonane

10.0 wt% beeswax

Polysorbate 60 1.5% by weight

PEG 60 hydrogenated castor oil 2.0% by weight

Sorbitansquioleate 0.8% by weight

Liquid paraffin 40.0% by weight

5.0% by weight of squalane

Caprylic/Capric Triglyceride 4.0% by weight

5.0% by weight of glycerin

Butylene glycol 3.0% by weight

Propylene glycol 3.0% by weight

0.2% by weight of triethanolamine

Preservative, color, and fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for a massage cream in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-5> pack

1.0% by weight of nonane

13.0% by weight of polyvinyl alcohol

Sodium carboxymethylcellulose 0.2% by weight

5.0% by weight of glycerin

0.1% by weight allantoin

Ethanol 6.0% by weight

PEG 12 nonylphenyl ether 0.3% by weight

Polysorbate60 0.3% by weight

Preservative, color, and fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for the pack in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-6> gel

Nonane 0.5% by weight

Sodium ethylenediamine acetate 0.05% by weight

5.0% by weight of glycerin

0.3% by weight of carboxyvinyl polymer

Ethanol 5.0% by weight

PEG 60 hydrogenated castor oil 0.5% by weight

0.3% by weight of triethanolamine

Preservative, color, and fragrance

Purified water to 100% by weight

The above blending ratio is a mixture of ingredients suitable for a gel in a preferred embodiment, but the blending ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

The blending ratio is a mixture of ingredients suitable for a cosmetic composition in a preferred embodiment, but it can be applied to cosmetics for various purposes including other colored cosmetics, and according to its efficacy, a drug that can be applied thinly to the human body, that is, It can be used for manufacturing as an ointment, and the blending ratio can be arbitrarily modified according to regional and ethnic preferences such as the demand class, the country of demand, and the purpose of use.

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> COMPOSITION INCLUDING NONANE AS ACTIVE INGREDIENTS FOR ANTI-ALLERGY, IMPROVEMENT OF ATOPIC DERMATITIS, OR SKIN REGENERATION <130> 1065067 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-4_F primer <400> 1 cagggtgctt cgcaaatttt ac 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-4_R primer <400> 2 accgagaacc ccagacttgt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-13_F primer <400> 3 ggtggcctca cctccccaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-13_R primer <400> 4 gatgacactg cagttggaga tgctg 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_F primer <400> 5 cagccgattt gccacttcat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_R primer <400> 6 tccttagggc aagggctctt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F primer <400> 7 ttacagtggc aatgaggatg a 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R primer <400> 8 tgtagtggtg gtcggagatt 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F primer <400> 9 cctgagaaag gagacatgta acaaga 26 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R primer <400> 10 tggaaggttc aggttgtttt ctg 23 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-8_F primer <400> 11 ctggccgtgg ctctcttg 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-8_R primer <400> 12 ttagcactcc ttggcaaaac tg 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F primer <400> 13 accgtgaaaa gatgacccag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R primer <400> 14 tgtcagctgt ggtggtgaag 20

Claims (8)

Nonane (Nonane) or a pharmaceutical composition for the prevention or treatment of allergic disease or atopic dermatitis comprising as an active ingredient a pharmaceutically acceptable salt thereof.
The method of claim 1,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, and insects. Allergic disease or atopic dermatitis prevention or treatment pharmaceutical composition comprising at least one selected from the group consisting of allergy, food allergy and drug allergy.
The method of claim 1,
The active ingredient is a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, characterized in that it reduces the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 .
A composition for preventing or improving allergic diseases or atopic dermatitis comprising nonane or a salt thereof as an active ingredient.
The method of claim 4,
The composition is a composition for preventing or improving allergic diseases or atopic dermatitis, characterized in that the composition is a functional food composition, a cosmetic composition or a perfume composition.
delete delete delete

Images