KR102076936B1 - Composition including thiazole or salt thereof as active ingredients for preventing or treating allergic disease or atopic dermatitis - Google Patents

Abstract

The present invention relates to a composition for preventing or treating allergic diseases or atopic dermatitis containing thiazole as an active component. The composition containing thiazole as an active component of the present invention has an effect of alleviating atopic dermatitis due to allergic reactions, and can be used as the composition for preventing or treating various allergic diseases by reducing inflammatory response.

Description

COMPOSITION INCLUDING THIAZOLE OR SALT THEREOF AS ACTIVE INGREDIENTS FOR PREVENTING OR TREATING ALLERGIC DISEASE OR ATOPIC DERMATITIS}

The present invention relates to a composition for preventing or treating allergic diseases or atopic dermatitis comprising thiazole or a salt thereof as an active ingredient.

Atopy is derived from the ancient Greek word "topia," meaning "weird or unusual." In 1923, Cooke and Coca first called atopy a trend that could cause genetically specific immune antibody responses to allergens. As the world continues to increase, the incidence rate of industrialized countries is increasing.

The cause of atopic dermatitis is not known yet, but it is not limited to one factor such as family history, dietary changes, infiltration of allergens, and abnormality of skin barrier. It occurs mainly in childhood and childhood and may persist or begin in adulthood. Typical symptoms of atopy appear on the hands, scalp, face, neck, and elbows, but differ in appearance. Symptoms of infancy are rough, dry skin, dermatitis on the outside of the limbs, and often appear on the cheeks or forehead. In childhood, the skin appears mainly on the folded parts of the arms, legs, and neck, rather than the face, and the skin becomes dry. In puberty and adulthood, thickening of the skin on areas such as the face and hands occurs.

Topical steroids, topical immunomodulators, systemic steroids, systemic immunosuppressants, and antihistamines are used as atopic drugs. Topical steroids are used for severe atopic symptoms and are the most basic way to manage bacterial or viral infections. However, the steroid was introduced in 1950 and has been used for many years, but its use for a long time is limited due to problems of skin safety and resistance depending on the frequency, concentration, and duration of use. In addition, skin side effects such as skin atrophy, telangiectasia, steroid acne, as well as potential hypothalamic-pituitary-adrenal (HPA) inhibition and Cushing's syndrome Use caution when using it because it can cause side effects.

Unlike conventional topical steroids, tacrolimus and pimecrolimus are known to be used over a long period of time for the prevention of recurrence of lesions. Suitable for use as a treatment and maintenance therapy. However, tacrolimus may have side effects such as kidney function deterioration, shaking, and hair loss, and pimecrolimus may have serious side effects such as acne and burning, as well as skin cancer and lymphoma. In the acute phase of steroids, topical immunomodulators are suitable for use in mild atopy treatment and maintenance therapy. However, safety of side effects is not yet secured, and there is an urgent need for alternative supplements.

Accordingly, the present inventors endeavored to develop a material that has fewer side effects and is effective in alleviating the symptoms of atopic dermatitis. As a result, the present invention was confirmed that thiazole relieves atopic symptoms and improves the inflammatory response. Completed.

Republic of Korea Patent Publication No. 10-2018-0128602

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, including thiazole or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a composition for preventing or improving allergic diseases or atopic dermatitis, including thiazole or a salt thereof as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention is to solve the above problems, and provides a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, including thiazole or a pharmaceutically acceptable salt thereof as an active ingredient.

According to one aspect of the invention, the allergic disease is edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact It may be selected from the group consisting of sexual dermatitis, urticaria, pruritus, insect allergy, food allergy and drug allergy, but is not limited thereto.

According to one aspect of the invention, the active ingredient is IL-4 (Interleukin-4), IL-13, TNF-α (tumor necrosis factor-alpha), IL-1β, IL-6 or IL-8 expression Reducing or reducing the amount of histamine secretion can have an antiallergic effect, a prophylactic or therapeutic effect of atopic dermatitis.

The present invention also provides a quasi-drug composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising thiazole or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a cosmetic composition for the prevention or improvement of allergic diseases or atopic dermatitis, including thiazole or a cosmetically acceptable salt thereof as an active ingredient.

The present invention also provides a fragrance composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising thiazole or a cosmetically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for preventing or improving allergic disease or atopic dermatitis, including thiazole or a food acceptable salt thereof as an active ingredient.

The composition containing the thiazole of the present invention as an active ingredient has an effect of improving atopic dermatitis due to an allergic reaction, and can be used as a composition for preventing or treating (alleviating) various allergic diseases by reducing an inflammatory response.

1 is a graph showing changes in histamine secretion in thiazole-treated mast cells (RBL-2H3 cells) (each value is three mean ± SEM obtained from three independent wells; the letters on the bars are P Statistically significant difference at <0.05).
FIG. 2 is a graph showing the expression changes of inflammatory cytokine related molecules (IL-4, IL-13 and TNF-α) in thiazole-treated mast cells (each value being 3 times obtained from 3 independent wells) Mean ± SEM; letters above the bars show statistically significant difference at P <0.05).
3 is a graph showing the expression changes of inflammatory cytokine related molecules (IL-1β, IL-6 and IL-8) in thiazole-treated keratinocytes (each value is 3 obtained from three independent wells). Council mean ± SEM; letters above the bar show statistically significant differences at P <0.05).

The inventors have found that thiazoles alleviate atopic symptoms and express the expression of inflammatory cytokines IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8, which are secreted by cellular immune responses. The present invention was completed by confirming a significant reduction and a decrease in the amount of histamine secretion.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for the prevention or treatment of allergic diseases or atopic dermatitis comprising thiazole or a salt thereof as an active ingredient.

Specifically, the thiazole is a heterocyclic compound, the IUPAC name is 1,3-thiazole, thiazole, 5H-thiazole-1 -Has the tinnitus (5H-Thiazol-1-ium), 5H-1,3-thiazole (5H-1,3-thiazole). The structural formula of thiazole is C ₃ H ₃ NS and the molecular weight is 85.12 g / mol, the structure is as shown in [Formula 1].

Thiazole is a colorless or pale yellow clear liquid with a fishy odor. Thiazoles are known as safe substances that can be used as fragrances and are flavored agents by Flavor and Extract Manufacturers' Association (FEMA), Food and Drug Administration (FDA), and Joint FAO / WHO Expert Committee on Food Additives (JECFA). It is approved as an ingredient and has been used industrially for flavor and aroma.

[Formula 1]

The thiazole of the present invention may include thiazole hydrate, thiazole derivative, and the like within the range having the same efficacy as the thiazole, and may also include a solvent compound or stereoisomer thereof.

The method for obtaining the thiazole is not particularly limited, and may be isolated from the plant containing the thiazole, chemically synthesized using a known production method, or commercially available.

In the present invention, the term "cosmetic acceptable salt", "food acceptable salt", "pharmaceutically acceptable salt" or "salt thereof" may be an acid addition salt formed by free acid. have. Acid addition salts can be prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent, such as methanol, ethanol, acetone or acetonitrile. In addition, equimolar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.

As the free acid, an inorganic acid or an organic acid may be used. Non-limiting examples of the inorganic acid may be hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like, which may be used alone or in combination of two or more. Non-limiting examples of the organic acid are methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid acid, citric acid, lactic acid, glycolic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid (glucuronic acid), aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid and the like can be used. These may be used alone or in combination of two or more thereof.

In addition, the thiazole can be used to make a cosmetically or food acceptable metal salt. Alkali metal or alkaline earth metal salts can be obtained, for example, by dissolving the compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. As the metal salt, it is particularly preferable to prepare sodium, potassium or calcium salts, but is not limited thereto. Corresponding silver salts can also be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg silver nitrate).

Salts of the thiazoles may include all salts of acidic or basic groups which may be present in the compound of the thiazoles unless otherwise indicated. For example, the salt of the thiazole may include sodium, calcium and potassium salts of the hydroxy group, and other cosmetically acceptable salts of the amino group include hardbromide, sulfuric acid, hydrogen sulphate, phosphate, and hydrogen phosphate. , Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts and the like. It may be prepared through a manufacturing method.

In the present invention, "allergic disease" refers to a disease caused by an allergy reaction in which the body's immune response to an external antigen is excessive, and specifically, edema, anaphylaxis, and allergic rhinitis one or more disease days selected from the group consisting of rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, epidermal contact dermatitis, urticaria, pruritus, insect allergy, food allergy and drug allergy But it is not limited thereto.

In the present invention, "atopic dermatitis" is one of allergic diseases and is a skin disease accompanied by symptoms such as itching, dry skin, increased skin thickness, and characteristic eczema.

The pharmaceutical composition for the prophylaxis or treatment of allergic diseases or atopic dermatitis according to the present invention is not particularly limited as long as it contains thiazole or a pharmaceutically acceptable salt thereof, preferably the dose of thiazole is 0.1 It may include a concentration of μM to 1000 μM, but is not limited thereto. At this time, if the thiazole is less than the concentration range, there is a problem that it is difficult to exert a desirable prophylactic or therapeutic effect, and if the thiazole exceeds the concentration range, there may be a concern of toxicity including cytotoxicity.

Pharmaceutical compositions for the prophylaxis or treatment of allergic diseases or atopic dermatitis according to the present invention are powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. It can be formulated and used in the form of sterile injectable solutions and can include suitable carriers, excipients or diluents commonly used in the manufacture of pharmaceutical compositions for formulation.

The carrier or excipient or diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, undetermined. And various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like.

In the case of formulation, it may be prepared by using diluents or excipients such as fillers, weights, binders, wetting agents, disintegrating agents, and surfactants which are commonly used.

Solid preparations for oral administration may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like with the thiazole. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to commonly used simple diluents such as water and liquid paraffin. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As a base of suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for the prophylaxis or treatment of allergic disease or atopic dermatitis according to the present invention depends on the patient's condition, body weight, degree of disease, drug form, route of administration and duration, but may be appropriately selected by those skilled in the art. Can be. However, for the desired effect, it may be administered at 0.0001 to 2,000 mg / kg, preferably at 0.001 to 2,000 mg / kg. Administration may be administered once a day or may be divided several times. However, the scope of the present invention is not limited by the above dosage.

Pharmaceutical compositions for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention can be administered to mammals such as rats, mice, livestock, humans by various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

The composition comprising the active ingredient according to the present invention reduces the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 that is excessively secreted due to an immune response, Reducing the amount of secretion can improve and prevent symptoms of allergic disease or atopic dermatitis.

Histamine, a representative itch carrier, was proposed by Lewis in 1927 to cause itching in inflammatory skin diseases. The major source of histamine in the skin is mast cells, where histamine synthesized and stored is secreted in response to stimuli. Secreted histamine causes erythema, pain, vasodilation and swelling due to its direct action on blood vessels and the release of neuropeptides from sensory nerves in addition to itching through histamine receptors present in keratinocytes.

In one embodiment of the present invention, as a result of the thiazole treatment, it was confirmed that the secretion amount of histamine, which is a representative itch mediator, was significantly reduced, and it was confirmed that thiazole can improve and prevent symptoms of allergic disease or atopic dermatitis (FIG. 1).

In addition, in one embodiment of the present invention, the expression of inflammatory cytokines IL-4, IL-13, TNF-α, IL-1β, IL-6 and IL-8 secreted by the cell's immune response as a result of thiazole treatment By confirming this marked decrease, it was possible that the thiazoles can suppress excessive immune responses and cure inflammation (FIGS. 2 and 3).

The present invention also provides a composition for the prevention or improvement of allergic diseases or atopic dermatitis, including thiazole or a salt thereof as an active ingredient.

Specific contents of the thiazole are as described above.

The composition for the prevention or improvement of allergic diseases or atopic dermatitis of the present invention may be a dietary supplement, cosmetic composition, fragrance composition or quasi-drug composition.

In the present invention, the term "health functional food" refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. Here, 'functional' means to obtain a useful effect for health purposes such as nutrient control or physiological action on the structure and function of the human body. The health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food may also be prepared without limitation as long as the formulation is recognized as a health functional food. Unlike the general medicine, the health functional food composition of the present invention has the advantage that there is no side effect that may occur when taking a long-term use of the drug, as a raw material, and has excellent portability, and promotes an antiallergic effect or atopic dermatitis symptomatic effect. It can be taken as a supplement.

In the dietary supplement for the prevention or improvement of allergic diseases or atopic dermatitis according to the present invention, when the thiazole is used as an additive of the dietary supplement, it may be added as it is or used with other foods or food ingredients, and It can use suitably according to phosphorus method. The mixed amount of the active ingredient can be appropriately determined depending on the purpose of use, such as prevention, health or treatment.

Formulations of dietary supplements may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of general foods or beverages.

There is no restriction | limiting in particular in the kind of said food, The foodstuff which can add the said substance is a dairy product including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, etc. , Various soups, beverages, tea, drinks, alcoholic beverages and vitamin complexes, etc., may include all of the food in the usual sense.

Generally, the thiazole may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material in the manufacture of food or beverage. However, in the case of long-term intake for health and hygiene or for health control, the amount may be below the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. The above amount can also be used.

In the functional food according to the present invention, the beverage may contain various flavors or natural carbohydrates and the like as an additional component as a general beverage. The natural carbohydrates described above may be glucose, monosaccharides such as fructose, maltose, disaccharides such as sucrose and polysaccharides such as dextrin, cyclodextrin, sugar alcohols such as xylitol, sorbitol, erythritol. As the sweetener, natural sweeteners such as tautin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for preventing or improving allergic diseases or atopic dermatitis according to the present invention is various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloids. And thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages. In addition, the nutraceutical composition for the prevention or improvement of allergic diseases or atopic dermatitis of the present invention may contain a pulp for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The ratio of such additives is not limited, but is generally selected from 0.01 to 0.1 parts by weight relative to 100 parts by weight of the functional food of the present invention.

As used herein, the term "cosmetic composition" is a composition comprising the compound, the formulation may be in any form. For example, the cosmetics prepared using the composition may be a nourishing cream, eye cream, massage cream, creams such as cleansing creams, packs, lotions such as nutrient lotions, essences, soft cosmetics, nourishing cosmetics. , Powders, foundations, makeup bases, and the like, and may be prepared and commercialized in any of these formulations to achieve the object of the present invention, and are not limited to the above examples. In addition, the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method. Specifically, the cosmetics of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet It may be one having a formulation selected from the group consisting of soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow.

The cosmetic composition of the present invention may include other additives such as excipients, carriers, etc. in addition to thiazole or salts thereof, and it is possible to apply and blend the usual ingredients necessary for general skin cosmetics as necessary.

Specifically, the cosmetic composition of the present invention may further include a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into blood vessel cells of the skin at a high absorption rate. Preferably other phospholipid components, liposome components and the like used in lecithin cosmetics are included, but are not limited thereto.

In addition, as the oil which can be mainly used as an oil phase component, one or more selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis binifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dimethicone Chicon, cyclopentasiloxane, sunflower seed oil and the like can be used.

In addition, 0.1 to 5% by weight of a surfactant, a higher alcohol, and the like may be added to reinforce the emulsifying ability. Such surfactants may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, and the like, specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate / sucrosecoate, glyceryl stearate / polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside, polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, etc. have. As the higher alcohol, alcohols having 12 to 20 carbon atoms, such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in combination of one or more thereof.

The aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.

In addition, the cosmetic composition of the present invention, if necessary, active ingredients such as higher fatty acids, vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elixolic acid, tocopheryl acetate, butylated hydroxy) Toluene, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH regulators (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malic acid, pmaric acid, sodium pramate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc., moisturizers (glycerine, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycerin-26, methylgluse-20 and the like), lubricants and the like can be further added.

In addition, the cosmetic composition of the present invention further includes a substance capable of auxiliaryly providing essential nutrients to the skin, and may preferably contain auxiliary agents including, but not limited to, natural flavors, cosmetic flavors, or herbal medicines. have.

The effective amount of the thiazole or cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited and may be included in 0.0001 to 20% by weight based on the total weight of the composition. Less than 0.0001% by weight of thiazole or salt thereof in the cosmetic may not have the expected improvement effect due to its small amount, and more than 20% by weight of thiazole or salt thereof may exhibit known toxicity.

The term "fragrance composition" of the present invention may be blended into skin-based bases such as perfumes, cosmetics, bathing agents, foods, pharmaceuticals, and the like, and the blending amount may be appropriately selected to achieve a desired effect according to techniques conventional in the art. It can mix.

The formulation of the fragrance formulation of the present invention is not particularly limited, but may be any one selected from powder, granule, liquid spray, solid and gel type formulations.

The fragrance composition includes a cosmetic article including perfume, a soap cleaning article including a bath soap, a room cleaning article including a glass cleaner, a fragrance article including a car air freshener, a bath article containing a herbal type bath, and stationery It can be used to manufacture industrial products including fragrance products, environmental products containing office fragrances or synthetic resin.

The fragrance composition of the present invention is based on the total weight of the fragrance composition, the active ingredient of thiazole, 0.00001% to 10% by weight, preferably 0.00001% to 10% by weight depending on the product form in which the perfume composition of the present invention is specified. 1.0 wt%, more preferably 0.00001 wt% to 0.5 wt%.

Product forms in which the fragrance composition is embodied include soaps, cosmetics, baths, aroma oils, and the like, specifically, body lotions, shampoos, hair rinses, hair conditioners, hair treatments, antiperspirants, skin lotions, skin creams, deodorants , Perfumes (spray or fumigation), lipsticks, lip creams, baths and the like.

These products may contain various additives such as blood circulation promoters, anti-inflammatory agents, humectants, astringents, inorganic salts, organic salts, oily ingredients, surfactants, herbals, pigments, flavorings, sulfur, sinter deposits, fungicides and the like. .

In particular, the fragrance composition of the present invention will generally be used as a skin external preparation of cosmetic formulations, such as makeup products, skin lotions, skin creams, in which case it may contain components commonly used in these cosmetic formulations.

In particular, the fragrance composition of the present invention is preferably used in combination with the bathing agent in that the active ingredient thiazole has an atopic dermatitis improving activity. In this case, the active ingredient may be included in the range of preferably 0.00001 to 1% by weight, more preferably 0.0001 to 0.1% by weight based on the total weight of the bath. When the fragrance composition of the present invention is used incorporating into the bath, the bath may be added to the bath water at a concentration of 0.015 to 15 ppm.

Bathing agent may contain an inorganic salt, an organic acid, an oily component, etc. in addition to the active ingredient of the fragrance composition of this invention.

Inorganic salts include sodium chloride, sodium bicarbonate, sodium carbonate, borax, sodium sulfate, sodium sulfide, sodium sesquicarbonate, sodium nitrate, sodium thiosulfate, sodium polyphosphate, sodium phosphate, calcium oxide, magnesium oxide, calcium carbonate, magnesium carbonate, potassium chloride, sulfide Potassium and the like, and these may be used alone or as a mixture of two or more thereof. These inorganic salts may be added to the bath at least 5% by weight, preferably at least 10% by weight based on the total weight of the bath.

Examples of the organic acid include succinic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid, and the like, which may be used alone or in a mixture of two or more thereof. These organic acids can be added to the bath in the range of 0.1 to 50% by weight, based on the total weight of the bath.

Examples of the oily component include waxes, hydrocarbons, higher fatty acids, higher alcohols, esters, silicone oils, and the like.

The bath may also further contain other ingredients conventionally used in the art. Such components include inorganic acids such as boric acid, metasilicate and silicic anhydride; Herbal powders such as fennel, ginkgo, ginger, citrus peel, Valerian root, peppermint, ginseng, oats; Natural pigments identified as harmless to humans, such as coal tar dyes, chlorophyll, riboflavin, saffflower, anthraquinone; Vitamins such as vitamin A, vitamin C, vitamin D, and vitamin E; Sulfur, mica powder, clay powder, loess powder, rice bran carbide, fungicide, preservative and the like.

Such bathing agents can be prepared in any form, such as granules, tablets, solutions, powders and the like.

The term "quasi drug" used in the present invention refers to articles that have a lesser action than medicines among articles used for the purpose of diagnosing, treating, ameliorating, reducing, treating, or preventing a disease of a human or animal. According to the quasi-drug product, the product used for the purpose of medicine is excluded, and it is used for the treatment or prevention of diseases of humans and animals, and the products that have little or no direct action on the human body.

The quasi-drug composition of the present invention is used for the purpose of preventing or improving allergic diseases or atopic dermatitis, and is not particularly limited in the formulation, for example, softening water, nourishing cosmetics, massage cream, nutrition cream, pack It may be a cosmetic composition having a formulation of a mask pack, a mask sheet, a gel or a skin adhesive cosmetic, and may also be a transdermal formulation such as a lotion, an ointment, a gel, a cream, a patch or a spray.

In addition, in each formulation, the quasi-drug composition may be optionally selected and blended with other ingredients according to the formulation or purpose of use of the other quasi-drug. The mixed amount of the active ingredient can be suitably determined according to the purpose of use (inhibition or relaxation). For example, thickeners, stabilizers, solubilizers, conventional adjuvants such as vitamins, pigments and flavors, and carriers and the like.

The content of the thiazole or salt thereof of the present invention is preferably 0.0001 to 20% by weight, respectively, based on the total weight of the quasi-drug composition. If the content exceeds 20% by weight, the color and stability of the composition may be degraded. If the content is less than 0.0001%, the effect is minimal.

In addition, in the quasi-drug composition of each formulation, other components than the essential components described above can be appropriately selected and blended by those skilled in the art without difficulty according to the formulation or purpose of use.

Below, Through the examples will be described in more detail the present invention. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example: Evaluation of Secretion and Expression of Inflammation-Related Cytokines After Thiazole Treatment in Mast Cells and Keratinocytes

1-1. Experiment method

1) Mast Cell Culture

Mast cells (rat basophilic leukemia cell line, RBL-2H3) were purchased from ATCC (Manassas, VA, USA). Dulbecco modified eagle medium (Gibco BRL, USA) containing 10% heat-inactivated febo bovine serum (FBS) (Gibco BRL, USA) and 1% penicillin and streptomycin (Gibco BRL, USA) Cells were cultured in culture. Cells were tested by incubating at 37 ° C. and 5% CO ₂ . Mast cells were suspended in DMEM containing 10% FBS and then aliquoted into 6 well plates (Corning, USA) to a cell number of 1 × 10 ⁶ cells / ml.

It was then sensitized with anti DNP (dinitrophenyl) -IgE (100 ng / ml) and incubated for 24 hours in a 37 ℃, 5% CO ₂ incubator. After washing twice with PBS (phosphate buffered saline), DNP-HSA (dinitrophenylated human serum albumin; 100 ng / ml) was treated for 1 hour to induce an immune response. At this time, anti-DNP (dinitrophenyl) -IgE treatment and thiazole (100 μM) were incubated for 24 hours to induce an atopy improvement effect by thiazole. Then, the immune response was induced by DNP-HSA. . Negative control cells were treated with DMSO instead of thiazole and incubated for 24 hours to induce an immune response with DNP-HSA.

2) Keratinocytes Cell Culture

Human keratinocyte cell line (HaCaT) was purchased from ATCC (Manassas, VA, USA). Cells were cultured using DMEM medium containing 10% FBS (fetal bovine serum) and antibiotics. The culture vessel used a 75T-flask and 6 well plates and incubated in a 37 ° C. incubator fed with 5% CO 2. The cultures were exchanged every 3 to 4 days and subcultured when the cells proliferated excessively. Aliquoted HaCaT cells (5 × 10 ⁵ / well) were incubated for 24 hours and washed with PBS. Treatment of TNF-α (tumor necrosis factor-α) (10 ng / ml) and IFN-γ (interferon gamma) (10 ng / ml) in DMEM medium without FBS to induce an immune response to keratinocytes Incubated for 24 hours. At this time, 100 μM of thiazole was simultaneously treated with the immune response inducer to evaluate the effect of improving the immune response by thiazole, and in the case of negative control cells, DMSO was simultaneously treated with the immune response inducer instead of thiazole and incubated for 24 hours. .

3) Histamine release assay

In order to measure the concentration of histamine secreted from the mast cells which induced the immune response, the reaction was terminated by standing in an ice bath for 10 minutes to terminate the immune reaction.The culture solution was centrifuged at 10,000 xg for 10 minutes, and then the supernatant was taken. Transfer to 96-well plate. Histamine quantification was performed using a histamine release assay ELISA kit from ENZO, and measured at 450 nm wavelength of Infinite M200 pro microplate reader (TECAN).

4) RNA isolation and real-time PCR (quantitative reverse-transcription polymerase chain reacion) using Trizol method

After removing the supernatant of the induced immune cells, 1 ml of trizol was added and allowed to stand for 2 minutes, followed by chloroform for 10 seconds, vortexed for 10 seconds, and centrifuged at 2,400 xg for 10 minutes. The solution was taken and the same amount of isopropanol was mixed and shaken. The supernatant was removed by centrifugation at 16,000 xg for 25 minutes, and pellets were dissolved in DEPC (diethyl pyrocarbonate) -DW 20μl and stored at -20 ° C. RT-PCR was reacted for 30 minutes at 45 ° C and 5 minutes at 94 ° C using a one-step RT-PCR PreMix kit (iNtRON Biotechnology, Korea), followed by denaturation at 94 ° C for 30 seconds, and 30 ° at 55 ° C. After annealing for 2 seconds, 32 cycles of 1 minute extension at 72 ° C., the last extension was performed at 72 ° C. for 5 minutes, followed by PiQ SYBR green supermix (Bio-Rad). ) And CFX Connect ™ Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR, wherein the primer sequences used are shown in Table 1.

Primer sequence used for RT-PCR Gene description primer Sequence (5 '→ 3') Annealing temperature
(℃) PCR
Product (bp) IL-4 F CAGGGTGCTTCGCAAATTTTAC 55 104 R ACCGAGAACCCCAGACTTGTT IL-13 F GGTGGCCTCACCTCCCCAAG 60 234 R GATGACACTGCAGTTGGAGATGCTG TNF-α F CAGCCGATTTGCCACTTCATA 60 168 R TCCTTAGGGCAAGGGCTCTT IL-1β F TTACAGTGGCAATGAGGATGA 57 250 R TGTAGTGGTGGTCGGAGATT IL-6 F CCTGAGAAAGGAGACATGTAACAAGA 58 460 R TGGAAGGTTCAGGTTGTTTTCTG IL-8 F CTGGCCGTGGCTCTCTTG 65 292 R TTAGCACTCCTTGGCAAAACTG β-actin F ACCGTGAAAAGATGACCCAG 60 619 R TGTCAGCTGTGGTGGTGAAG

1-2. Experiment result

1) Change in histamine secretion

In order to confirm the effect of thiazole on histamine released by degranulation from activated mast cells, the concentration of histamine from the cell culture was measured by enzyme-immunoassay. As a result, the control cells which sensitized with anti DNP (dinitrophenyl) -IgE and induced the immune response with DNP-HSA significantly increased histamine concentrations compared to normal mast cells. On the other hand, as a result of treatment with thiazole while inducing an immune response by anti DNP (dinitrophenyl) -IgE and DNP-HSA, the concentration of histamine was significantly decreased (FIG. 1).

2) Inflammatory cytokine production in mast cells

In control cells sensitized with anti DNP (dinitrophenyl) -IgE and induced immune response with DNP-HSA, expression of inflammatory cytokines IL-4, IL-13 and TNF-α was significantly increased compared to normal mast cells. . On the other hand, treatment with thiazole while inducing an immune response by anti DNP (dinitrophenyl) -IgE and DNP-HSA resulted in an increase in inflammatory cytokines (IL-4, IL-13 and TNF-α) due to the immune response. Both expressions were significantly reduced (FIG. 2).

3) Inflammatory cytokine production in keratinocytes

In control cells induced with TNF-α and IFN-γ, expression of inflammatory cytokines IL-1β, IL-6 and IL-8 was significantly increased compared to normal keratinocytes. On the other hand, the treatment of keratinocytes with thiazole together with TNF-α and IFN-γ resulted in significantly increased expression of inflammatory cytokines (IL-1β, IL-6 and IL-8) due to immune responses. Decreased (FIG. 3).

Hereinafter, a description will be given of the preparation of medicines, foods or cosmetics containing the thiazole according to the present invention as an active ingredient, but the present invention is not intended to be limited thereto, but is intended to be described in detail. Using the thiazole excellent in the prevention and treatment (or prevention and improvement effect) effect of the allergic disease or atopic dermatitis, the pharmaceutical, food or cosmetic composition of Preparation Examples 1-3 It was prepared according to the conventional method.

Preparation Example 1 Preparation of Pharmaceutical Composition

<1-1> Preparation of Powder

Thiazole 20 mg

Lactose 100 mg

Talc 10 mg

The above ingredients were mixed and filled in airtight cloth to prepare a powder.

<1-2> Preparation of Tablet

Thiazole 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<1-3> Preparation of capsule

Thiazole 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules in accordance with a conventional method for producing a capsule to prepare a capsule.

<1-4> Preparation of Injection

Thiazole 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Sodium dihydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above component content per ampoules (2 mL) according to the conventional method for preparing injections.

<1-5> Preparation of Liquid

Thiazole 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

According to a conventional manufacturing method, each component is added to purified water to dissolve, lemon flavor is added thereto, and then purified water is added to adjust the total amount to 100 mL and sterilized to fill a brown bottle to prepare a liquid formulation.

Preparation Example 2 Preparation of Health Food

<2-1> Preparation of Health Supplements

Thiazole 10 mg

Vitamin Mixture

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

0.2 μg of vitamin B ₁₂

Vitamin C 10 mg

10 μg biotin

Nicotinamide 1.7 mg

50 μg folic acid

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium phosphate monobasic 15 mg

Dicalcium Phosphate 55 mg

Potassium Citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a composition suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

<2-2> Preparation of health drink

Thiazole 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

3.5 g of nicotinic acid amide

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified Water Quantification

After mixing the above components in accordance with a conventional healthy beverage production method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container sealed sterilization and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Preparation Example 3 Preparation of Cosmetic Composition

Hereinafter, an example of preparation of a cosmetic composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto, but is intended to be described in detail.

<3-1> Nutrients (Milk Lotion)

Thiazole 2.0 wt%

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nutritional longevity in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to the manufacturing method in the general cosmetic field.

<3-2> Softener (skin lotion)

Thiazole 2.0% by weight

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed and formulated in a preferred embodiment with a component suitable for a relatively softening longevity, the compounding ratio may be arbitrarily modified, and can be prepared according to the manufacturing method in the general cosmetic field.

<3-3> nutrition cream

Thiazole 2.0% by weight

Polysorbate60 1.5 wt%

Solbitan Sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-4> massage cream

Thiazole 1.0% by weight

Beeswax 10.0 weight%

Polysorbate60 1.5 wt%

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-5> pack

Thiazole 1.0% by weight

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenylether 0.3 wt%

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

<3-6> gel

Thiazole 0.5% by weight

Ethylenediamine sodium acetate 0.05% by weight

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

The blending ratio is a relatively suitable composition for the cosmetic composition in a preferred embodiment, but can be applied to cosmetics of various uses, including other color cosmetics, according to the efficacy of the drug that can be applied to a thin coating on the human body, that is, It can be used for manufacturing as ointment, and the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> COMPOSITION INCLUDING THIAZOLE OR SALT THEREOF AS ACTIVE          INGREDIENTS FOR PREVENTING OR TREATING ALLERGIC DISEASE OR ATOPIC          DERMATITIS <130> 1065541 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-4_F primer <400> 1 cagggtgctt cgcaaatttt ac 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-4_R primer <400> 2 accgagaacc ccagacttgt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-13_F primer <400> 3 ggtggcctca cctccccaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-13_R primer <400> 4 gatgacactg cagttggaga tgctg 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_F primer <400> 5 cagccgattt gccacttcat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_R primer <400> 6 tccttagggc aagggctctt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F primer <400> 7 ttacagtggc aatgaggatg a 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R primer <400> 8 tgtagtggtg gtcggagatt 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F primer <400> 9 cctgagaaag gagacatgta acaaga 26 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R primer <400> 10 tggaaggttc aggttgtttt ctg 23 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-8_F primer <400> 11 ctggccgtgg ctctcttg 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-8_R primer <400> 12 ttagcactcc ttggcaaaac tg 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F primer <400> 13 accgtgaaaa gatgacccag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R primer <400> 14 tgtcagctgt ggtggtgaag 20

Claims (7)

As a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis comprising thiazole or a pharmaceutically acceptable salt thereof as an active ingredient,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, hives, pruritus, insects A pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.
delete The method of claim 1,
The active ingredient is an allergic disease or atopic dermatitis, characterized by reducing the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8, or reducing the amount of histamine Pharmaceutical composition for the prophylaxis or treatment of.
As a quasi-drug composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising thiazole or a pharmaceutically acceptable salt thereof as an active ingredient,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, hives, pruritus, insects A quasi-drug composition for the prevention or improvement of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.
As a cosmetic composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising thiazole or a cosmetically acceptable salt thereof as an active ingredient,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, hives, pruritus, insects Cosmetic composition for the prevention or improvement of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.
As a fragrance composition for the prevention or improvement of allergic diseases or atopic dermatitis, including thiazole or a cosmetically acceptable salt thereof as an active ingredient,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, hives, pruritus, insects Perfume composition for the prevention or improvement of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.
As a health functional food composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising thiazole or a food acceptable salt thereof as an active ingredient,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, hives, pruritus, insects Functional food composition for the prevention or improvement of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.

Images