KR20190113529A - Composition including ionol as active ingredients for anti-allergy, improvement of atopic dermatitis, or skin regeneration - Google Patents

Abstract

The present invention relates to a composition for anti-allergy, alleviation of atopic dermatitis, or skin regeneration containing ionol as an active component. More specifically, the present invention provides: the composition for preventing or treating allergic diseases or atopic dermatitis and a composition for healing skin wounds or promoting skin regeneration containing ionol or a pharmaceutically acceptable salt thereof as an active component. The composition containing ionol as the active component of the present invention has an effect of alleviating atopic dermatitis due to an allergic reaction, and can be used as the composition for preventing or treating various allergic diseases by reducing an inflammatory response. In addition, the composition of the present invention has a skin regeneration effect, thereby being able to be usefully used for wound healing medicines or functional cosmetics for skin regeneration.

Description

COMPOSITION INCLUDING IONOL AS ACTIVE INGREDIENTS FOR ANTI-ALLERGY, IMPROVEMENT OF ATOPIC DERMATITIS, OR SKIN REGENERATION}

The present invention relates to a composition for anti-allergy, atopic dermatitis improvement, or skin regeneration comprising yonol as an active ingredient, and more specifically, the present invention comprises yonol (ionol) or a pharmaceutically acceptable salt thereof as an active ingredient. Provided are compositions for preventing or treating allergic diseases or atopic dermatitis, compositions for healing skin wounds or promoting skin regeneration.

Atopy is derived from the ancient Greek word "topia," meaning "strange and abnormal," and in 1923, Cook (Robert Anderson Cooke) and Coca (Arthur Fernandez Coca) genetically induced specific immune antibody responses to allergens. The tendency to do it was first called atopy. If atopic dermatitis appears as atopic dermatitis (atopic dermatitis), respiratory symptoms are asthma and allergic rhinitis, ophthalmic symptoms are allergic conjunctivitis. Atopy is steadily increasing globally, and the incidence rate is increasing in industrialized countries.

The cause of atopic dermatitis is not known yet, but it is not limited to one factor such as family history, dietary changes, infiltration of allergens, and abnormality of skin barrier. It occurs mainly in childhood and childhood and may persist or begin in adulthood. The typical symptoms of atopic dermatitis appear on the hands, scalp, face, neck, and elbows, but differ in appearance. Symptoms of infancy are rough, dry skin, dermatitis on the outside of the limbs, and often appear on the cheeks or forehead. In childhood, the skin appears mostly in the folding areas of the arms, legs, and neck, rather than the face, and the skin becomes dry. In puberty and adulthood, thickening of the skin on areas such as the face and hands occurs.

Topical steroids, topical immunomodulators, systemic steroids, systemic immunosuppressants, and antihistamines are used as atopic drugs. Topical steroids are used when severe atopic symptoms are the most basic method of managing bacterial or viral infections. However, the steroid was introduced in 1950 and has been used for many years, but its long-term use is limited due to the problems of safety and resistance of the skin according to the frequency, concentration, and duration of use. In addition, skin side effects such as skin atrophy, telangiectasia, steroid acne, as well as potential hypothalamic-pituitary-adrenal (HPA) inhibition, Cushing's syndrome Use caution when using it because it can cause side effects. Unlike conventional topical steroids, tacrolimus and pimecrolimus are known to be used over a long period of time for the prevention of lesion recurrence, as they are relatively unlikely to cause side effects even after long-term use. Suitable for use as a treatment and maintenance therapy. However, tacrolimus may have side effects such as decreased kidney function, shaking and hair loss, and pimecrolimus may have serious side effects such as acne and burning as well as skin cancer and lymphoma. In the acute phase of steroids, topical immunomodulators are suitable for use in mild atopy treatment and maintenance therapy, but there is an urgent need for alternative supplements as safety for side effects is not yet secured.

In this regard, the present inventors have tried to develop a material that is effective in alleviating the symptoms of atopic dermatitis with low side effects.The result is that ionol alleviates atopic symptoms and improves the inflammatory response in an animal model inducing atopic dermatitis. The present invention was completed by confirming that the anti-allergic and wound healing effect was found.

Republic of Korea Patent Publication No. 10-2018-0128602

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, including yonool (ionol) or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a composition for preventing or improving allergic diseases or atopic dermatitis, including yonol or a salt thereof as an active ingredient.

Still another object of the present invention is to provide a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising yonol or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a quasi-drug composition for promoting skin wound healing or skin regeneration comprising yonol or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a cosmetic composition for promoting skin rejuvenation or skin healing comprising yonol or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention is to solve the above-described problems, and provides a pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, including yonool (ionol) or a pharmaceutically acceptable salt thereof as an active ingredient.

According to one aspect of the invention, the allergic disease is edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis It may be selected from the group consisting of sexual dermatitis, urticaria, pruritus, insect allergy, food allergy and drug allergy, but is not limited thereto.

According to one aspect of the invention, the active ingredient is anti-allergic effect, prevention or treatment of atopic dermatitis by reducing the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 Can be effective.

In another aspect, the present invention provides a composition for the prevention or improvement of allergic diseases or atopic dermatitis comprising yonool or a salt thereof as an active ingredient.

According to one embodiment of the invention, the composition may be a nutraceutical composition, cosmetic composition or fragrance composition.

In addition, the present invention provides a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising yonol or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a quasi-drug composition for skin wound healing or skin regeneration promotion comprising yonol or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a cosmetic composition for promoting skin rejuvenation or skin healing comprising yonool or a salt thereof as an active ingredient.

The composition comprising the yonol of the present invention as an active ingredient has an effect of improving atopic dermatitis due to an allergic reaction, and can be used as a composition for preventing or treating various allergic diseases by reducing an inflammatory response. In addition, the composition of the present invention has a skin regeneration effect, it can be usefully used for wound healing medicines or functional cosmetics for skin regeneration.

1 is a graph showing the expression changes of inflammatory cytokine related molecules (IL-4, IL-13 and TNF-α) in mast cells treated with yonol (each value is three averages obtained from three independent wells) ± SEM; letters on the bars show statistically significant difference at P <0.05).
FIG. 2 is a graph showing the change in expression of inflammatory cytokine related molecules (IL-1β, IL-6 and IL-8) in yolen treated keratinocytes (each value being 3 times obtained from 3 independent wells) Mean ± SEM; letters above the bar show statistically significant difference at P <0.05).

The present inventors have found that yonol atopic dermatitis relieves atopic symptoms and that inflammatory cytokines IL-4, IL-13, TNF-α, IL-1β, IL-6, or IL-8 are secreted due to cellular immune responses. The present invention was completed by confirming that the expression was significantly reduced.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for the prophylaxis or treatment of allergic diseases or atopic dermatitis comprising yonol (ionol) or a salt thereof as an active ingredient.

Specifically, the yonole is a compound contained in plants such as Champak, Idaeus raspberry, the structural formula is C ₁₃ H ₂₂ O, molecular weight is 194.31 g / mol, CAS No. 25312-34-9. Yonol is alpha-onol (α-ionol, CAS No. 25312-34-9) and β-ionol (β-ionol, CAS No. 22029-76- Isomers of 1) are included. The name of IUPAC for alphayonol is 4- (2,6,6-trimethyl-2-cyclohexenyl) -3-buten-2-ol buten-2-ol) and betayonol is 4- (2,6,6-trimethyl-1-cyclohexenyl) -3-buten-2-ol (4- (2,6,6-Trimethyl-1- cyclohexenyl) -3-buten-2-ol).

[Formula 1]

[Formula 2]

Yonoll is listed as a flavoring agent in the Food and Drug Administration (FDA) and Korea Food and Drug Administration (KFDA) food additive databases, and includes Flavor and Extract Manufacturers Association (FEMA) and Joint FAO / WHO Expert Committe on Food Additives. (JECFA) is approved as a safe food additive.

The LD ₅₀ value of yonol has been reported to be very safe at 7,400 mg / kg orally in mice and 5,000 mg / kg orally in rats ("Safety evaluation of certain food additives (WHO food additives series: 42)" International program on chemical safety world health organization., http://www.inchem.org/documents/jecfa/jecmono/v042je19.htm), to date no other biological activity or effect is known.

The yonol of the present invention may include a yonol hydrate, a yonol derivative, and the like within the range having the same efficacy as the yonol, and may also include a solvent compound or stereoisomer thereof.

The method for obtaining the above-mentioned yonol is not particularly limited, and may be isolated from the plant containing the above-mentioned yonol, chemically synthesized using a known production method, or commercially available.

In the present invention, the terms "cosmetic acceptable salt", "food acceptable salt", "pharmaceutically acceptable salt" or "salt thereof" may be an acid addition salt formed by free acid. have. Acid addition salts can be prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. In addition, equimolar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.

As the free acid, an inorganic acid or an organic acid may be used. Non-limiting examples of the inorganic acid may be hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like, which may be used alone or in combination of two or more. Non-limiting examples of the organic acid are methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid acid, citric acid, lactic acid, glycolic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid (glucuronic acid), aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid and the like can be used. These may be used alone or in combination of two or more thereof.

In addition, the yonol may use a base to make a cosmetically or food acceptable metal salt. Alkali metal or alkaline earth metal salts can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compounds salt, and then evaporating and drying the filtrate. As the metal salt, it is particularly preferable to prepare sodium, potassium or calcium salts, but is not limited thereto. Corresponding silver salts can also be obtained by reacting an alkali or alkaline earth metal salt with a suitable silver salt (eg silver nitrate).

The salts of yonol may include all salts of acidic or basic groups which may be present in the compound of yonol unless otherwise indicated. For example, the salt of yonol may include sodium, calcium and potassium salts of the hydroxy group, and other cosmetically acceptable salts of the amino group include hardbromide, sulfuric acid, hydrogen sulphate, phosphate, hydrogen phosphate, Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like. It can be prepared through the method.

As used herein, the term "allergic disease" refers to a disease caused by an allergy reaction in which the body's immune response to an external antigen is excessive. Specifically, edema, anaphylaxis, and allergic rhinitis one or more disease days selected from the group consisting of rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insect allergy, food allergy, and drug allergy But it is not limited thereto.

In the present invention, "atopic dermatitis" is one of allergic diseases and is a skin disease accompanied by symptoms such as itching, dry skin, increased skin thickness, and characteristic eczema.

The pharmaceutical composition for the prophylaxis or treatment of allergic diseases or atopic dermatitis according to the present invention is not particularly limited as long as it contains yonol or a pharmaceutically acceptable salt thereof, preferably the dose of the yonole is from 0.1 μM to It may include a concentration of 1000 μM, but is not limited thereto. At this time, if the yoljoin is less than the concentration range, there is a problem that it is difficult to exert a desirable prophylactic or therapeutic effect, if the yawol exceeds the concentration range, there may be concerns of toxicity including cytotoxicity.

Pharmaceutical compositions for the prophylaxis or treatment of allergic diseases or atopic dermatitis according to the present invention are powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. It can be formulated and used in the form of sterile injectable solutions and can include suitable carriers, excipients or diluents commonly used in the manufacture of pharmaceutical compositions for formulation.

The carrier or excipient or diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicide, cellulose, methyl cellulose, undetermined. And various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like.

When formulated, it may be prepared using conventional diluents or excipients, such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants.

Solid preparations for oral administration may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like with the yonol. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to commonly used simple diluents such as water and liquid paraffin. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for the prophylaxis or treatment of allergic disease or atopic dermatitis according to the present invention depends on the patient's condition, body weight, degree of disease, drug form, route of administration and duration, but will be appropriately selected by those skilled in the art. Can be. However, for the desired effect, it may be administered at 0.0001 to 2,000 mg / kg, preferably at 0.001 to 2,000 mg / kg. Administration may be once a day or may be divided several times. However, the scope of the present invention is not limited by the above dosage.

Pharmaceutical compositions for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention can be administered to mammals such as rats, mice, livestock, humans by various routes. All modes of administration may be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

The composition comprising the active ingredient according to the present invention is an allergic disease by reducing the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 excessively secreted due to the immune response or It can improve and prevent symptoms of atopic dermatitis.

In one embodiment of the present invention, the expression of inflammatory cytokines IL-4, IL-13, TNF-α, IL-1β, IL-6, and IL-8, which are secreted by the immune response of the cell, is markedly as a result of yonol treatment. By confirming the decrease, yollol was able to suppress the excessive immune response and treat inflammation (Fig. 1, Fig. 2).

In addition, the present invention provides a composition for the prevention or improvement of allergic diseases or atopic dermatitis, including yonool (ionol) or a salt thereof as an active ingredient.

Specific contents of the yonol are as described above.

The composition for preventing or improving allergic diseases or atopic dermatitis of the present invention may be a dietary supplement composition, cosmetic composition or perfume composition.

In the present invention, the term "health functional food" refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. Here, 'functional' means to obtain a useful effect for health purposes such as nutrient control or physiological action on the structure and function of the human body. The health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food. Unlike the general medicine, the health functional food composition of the present invention has the advantage that there is no side effect that may occur when taking a long-term use of the drug, using food as a raw material, and has excellent portability, thereby improving the anti-allergic effect or atopic dermatitis symptomatic effect. It can be taken as a supplement.

In the dietary supplement for the prevention or improvement of allergic diseases or atopic dermatitis according to the present invention, when the yonole is used as an additive of the dietary supplement, it may be added as it is or used with other foods or food ingredients, and It can use suitably according to a method. The mixed amount of the active ingredient can be appropriately determined depending on the purpose of use, such as prevention, health or treatment.

Formulations of dietary supplements may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of general foods or beverages.

There is no restriction | limiting in particular in the kind of said food, The foodstuff which can add the said substance is a dairy product including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, etc. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, etc., may include all foods in a conventional sense.

In general, the yonole may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on 100 parts by weight of the raw material in the manufacture of food or beverage. However, in the case of long-term intake for health and hygiene or for health control, the amount may be below the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. The above amount can also be used.

In the functional food according to the present invention, the beverage may contain various flavors or natural carbohydrates and the like as an additional component as a general beverage. The natural carbohydrates described above may be glucose, monosaccharides such as fructose, disaccharides such as maltose, sucrose and polysaccharides such as dextrin, cyclodextrin, sugar alcohols such as xylitol, sorbitol, erythritol and the like. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for preventing or improving allergic diseases or atopic dermatitis according to the present invention is various nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloids. And thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages. In addition, the nutraceutical composition for the prevention or improvement of allergic diseases or atopic dermatitis of the present invention may contain a pulp for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The ratio of such additives is not limited, but is generally selected from 0.01 to 0.1 parts by weight relative to 100 parts by weight of the functional food of the present invention.

As used herein, the term "cosmetic composition" is a composition comprising the compound, the formulation may be in any form. Examples of such formulations include cosmetics prepared using the composition, such as nutrition creams, eye creams, massage creams, creams such as cleansing creams, packs, lotions such as nutrient lotions, essences, soft cosmetics, and nutrient cosmetics. , Powders, foundations, makeup bases, and the like, and may be prepared and commercialized in any of these formulations to achieve the object of the present invention, and are not limited to the above examples. In addition, the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method. Specifically, the cosmetics of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet It may be one having a formulation selected from the group consisting of, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow.

The cosmetic composition of the present invention may contain other additives such as excipients, carriers, etc. in addition to yonol or a salt thereof, and it is possible to apply and formulate as needed the usual ingredients to be used in general skin cosmetics.

Specifically, the cosmetic composition of the present invention may further include a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into the blood vessel cells of the skin at a high absorption rate. Preferably other phospholipid components, liposome components and the like used in lecithin cosmetics are included, but are not limited to these.

In addition, as the oil which can be mainly used as an oil phase component, one or more selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis binifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dimethicone Chicon, cyclopentasiloxane, sunflower seed oil and the like can be used.

In addition, 0.1 to 5% by weight of a surfactant, a higher alcohol, and the like may be added to reinforce the emulsifying ability. Such surfactants may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, and the like, specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate / sucrosecoate, glyceryl stearate / polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside, polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, etc. have. As the higher alcohol, alcohols having 12 to 20 carbon atoms, such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in combination of one or more thereof.

The aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.

In addition, the cosmetic composition of the present invention, if necessary, active ingredients such as higher fatty acids, vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elixolic acid, tocopheryl acetate, butylated hydroxy) Toluene, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH regulators (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malic acid, fmaric acid, sodium pramate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc., moisturizers (glycerine, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycerin-26, methylgluse-20 and the like), lubricants and the like can be further added.

In addition, the cosmetic composition of the present invention further comprises a substance capable of auxiliaryly providing essential nutrients to the skin, and may preferably contain auxiliary agents including, but not limited to, natural flavors, cosmetic flavors, or herbal medicines. have.

The effective amount of yonol or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited and may be included in 0.0001 to 20% by weight based on the total weight of the composition. Less than 0.0001% by weight of the yonol or salt thereof in the cosmetics may have a small amount and may not have an anti-wrinkle effect, and more than 20% by weight of the yonol or salt thereof may exhibit known toxicity.

The term "fragrance composition" of the present invention may be blended into skin-based bases such as perfumes, cosmetics, bathing agents, foods, pharmaceuticals, and the like, and the blending amount may be appropriately selected to achieve a desired effect according to techniques conventional in the art. It can mix.

The formulation of the fragrance composition of the present invention is not particularly limited, but may be any one selected from powder, granule, liquid spray, solid and gel type formulations.

The fragrance composition includes a cosmetic article including perfume, a soap cleaning article including a bath soap, a room cleaning article including a glass cleaner, a fragrance article including a car air freshener, a bath article containing a herb-type bathing agent, and stationery It can be used to manufacture industrial products including fragrance products, environmental products containing office fragrances or synthetic resin.

The fragrance composition of the present invention is based on the total weight of the fragrance composition, the active ingredient is yool, 0.00001% to 10% by weight, preferably 0.00001% to 1.0, depending on the product form in which the perfume composition of the present invention is embodied Wt%, more preferably 0.00001 wt% to 0.5 wt%.

Product forms in which the fragrance composition is embodied include soaps, cosmetics, baths, aroma oils, and the like, specifically, body lotions, shampoos, hair rinses, hair conditioners, hair treatments, antiperspirants, skin lotions, skin creams, deodorants , Perfumes (spray or fumigation), lipsticks, lip creams, baths and the like.

These products may contain various additives such as blood circulation promoters, anti-inflammatory agents, humectants, astringents, inorganic salts, organic salts, oily ingredients, surfactants, herbal medicines, pigments, perfumes, sulfur, sinter deposits, fungicides and the like. .

In particular, the fragrance composition of the present invention will generally be used as a skin external preparation of cosmetic formulations, such as makeup products, skin lotions, skin creams, in which case it may contain components commonly used in these cosmetic formulations.

In particular, since the fragrance composition of the present invention has an active ingredient yonool atopic dermatitis improving activity, it is preferable to be used in a bath. In this case, the active ingredient may be included in the range of preferably 0.00001 to 1% by weight, more preferably 0.0001 to 0.1% by weight based on the total weight of the bath. When the fragrance composition of the present invention is incorporated into a bath and used, the bath may be added to the bath water at a concentration of 0.015 to 15 ppm.

Bathing agent may contain an inorganic salt, an organic acid, an oily component, etc. in addition to the active ingredient of the fragrance composition of this invention.

Inorganic salts include sodium chloride, sodium bicarbonate, sodium carbonate, borax, sodium sulfate, sodium sulfide, sodium sesquicarbonate, sodium nitrate, sodium thiosulfate, sodium polyphosphate, sodium phosphate, calcium oxide, magnesium oxide, calcium carbonate, magnesium carbonate, potassium chloride, sulfide Potassium and the like, and these may be used alone or as a mixture of two or more thereof. These inorganic salts may be added to the bath at least 5% by weight, preferably at least 10% by weight based on the total weight of the bath.

Examples of the organic acid include succinic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid, and the like, which may be used alone or in a mixture of two or more thereof. These organic acids can be added to the bath in the range of 0.1 to 50% by weight, based on the total weight of the bath.

Examples of the oily component include waxes, hydrocarbons, higher fatty acids, higher alcohols, esters, silicone oils, and the like.

The bath may also further contain other ingredients conventionally used in the art. Such components include inorganic acids such as boric acid, metasilicate and silicic anhydride; Herbal powders such as fennel, ginkgo, ginger, citrus peel, Valerian root, peppermint, ginseng, oats; Natural pigments identified as harmless to humans, such as coal tar dyes, chlorophyll, riboflavin, saffron, anthraquinone; Vitamins such as vitamin A, vitamin C, vitamin D, and vitamin E; Sulfur, mica powder, clay powder, loess powder, rice bran carbide, fungicide, preservative and the like.

Such bathing agents can be prepared in any form, such as granules, tablets, solutions, powders and the like.

In addition, the present invention provides a pharmaceutical composition, quasi-drug composition, and cosmetic composition for promoting skin wound healing or skin regeneration comprising ionol or a pharmaceutically acceptable salt thereof as an active ingredient.

Below, Through the examples will be described in more detail the present invention. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example: Evaluation of secretion and expression of inflammation-related cytokines by ionol treatment in mast cells and keratinocytes

1-1. Experiment method

1) Mast Cell Culture

Mast cells (rat basophilic leukemia cell line, RBL-2H3) were purchased from ATCC (Manassas, VA, USA). Dulbecco modified eagle medium (Gibco BRL, USA) containing 10% heat-inactivated febo bovine serum (FBS) (Gibco BRL, USA) and 1% penicillin and streptomycin (Gibco BRL, USA) Cells were cultured in culture. Cells were tested by incubating at 37 ° C. and 5% CO ₂ . Mast cells were suspended in DMEM containing 10% FBS and then aliquoted into 6 well plates (Corning, USA) to a cell number of 1 × 10 ⁶ cells / ml.

It was then sensitized with anti DNP (dinitrophenyl) -IgE (30 ng / ml) and incubated for 24 hours in 37 ℃, 5% CO ₂ incubator. After washing twice with PBS (phosphate buffered saline), DNP-HSA (dinitrophenylated human serum albumin; 10 μg / ml) was treated for 4 hours to induce an immune response. In addition, to evaluate the atopic improvement effect by ionol, anti-DNP (dinitrophenyl) -IgE-treated mast cells were treated for 24 hours with 100 μM of yonol for 1 hour, followed by incubation for 1 hour. Induced. Normal cells were treated with DMSO instead of yonol in the same conditions as yonol treated cells and tacrolimus 10 μM instead of yonol for 1 hour, followed by incubation for 1 hour to induce an immune response with DNP-HSA.

2) keratinocyte cell culture

Human keratinocyte cell line (HaCaT) was purchased from ATCC (Manassas, VA, USA). Cells were cultured using DMEM medium containing 10% FBS (fetal bovine serum) and antibiotics. The culture vessel used a 75T-flask and 6 well plates and incubated in a 37 ° C. incubator fed with 5% CO 2. The cultures were exchanged every 3 to 4 days and subcultured when cells proliferated excessively. Aliquoted HaCaT cells (5 × 10 ⁵ / well) were incubated for 24 hours and washed with PBS. Treatment of TNF-α (tumor necrosis factor-α) (10 ng / ml) and IFN-γ (interferon gamma) (10 ng / ml) together in DMEM medium without FBS to induce an immune response to keratinocytes Incubated for 24 hours. At this time, 100 μM of yonol was treated simultaneously to evaluate the effect of improving the immune response by yonol, and DMSO instead of yonol for normal cells and tacrolimus 10 μM instead of yonole for positive control cells were simultaneously treated with an immune response inducing agent for 24 hours. Incubated for

3) RNA isolation and real-time PCR (quantitative reverse-transcription polymerase chain reacion) using Trizol method

After removing the supernatant of the induced immune cells, 1 ml of trizol was added and allowed to stand for 2 minutes, followed by chloroform for 10 seconds, vortexed for 10 seconds, and centrifuged at 5,000 rpm for 10 minutes. The solution was taken and the same amount of isopropanol was mixed and shaken. The supernatant was removed by centrifugation at 13,000 rpm for 25 minutes, and pellets were dissolved in DEPC (diethyl pyrocarbonate) -DW 20μl and stored at -20 ° C before use. RT-PCR was reacted for 30 minutes at 45 ° C and 5 minutes at 94 ° C using one-step RT-PCR PreMixkit (iNtRON Biotechnology, Korea), followed by denaturation at 94 ° C for 30 seconds, and at 55 ° C for 30 seconds. After annealing, 32 cycles of 1 minute extension at 72 ° C. were performed, and the last extension was performed at 72 ° C. for 5 minutes, followed by PiQ SYBR green supermix (Bio-Rad). And quantitative PCR was performed using the CFX Connect ™ Real-Time PCR Detection System (Bio-Rad), wherein the primer sequences used are shown in Table 1.

Primer sequence used for RT-PCR Gene description Primers Sequences (5 '→ 3') Annealing
temperature
(℃) PCR
product (bp) IL-4 F CAGGGTGCTTCGCAAATTTTAC 55 104 R ACCGAGAACCCCAGACTTGTT IL-13 F GGTGGCCTCACCTCCCCAAG 60 234 R GATGACACTGCAGTTGGAGATGCTG TNF-α F CAGCCGATTTGCCACTTCATA 60 168 R TCCTTAGGGCAAGGGCTCTT IL-1β F TTACAGTGGCAATGAGGATGA 57 250 R TGTAGTGGTGGTCGGAGATT IL-6 F CCTGAGAAAGGAGACATGTAACAAGA 58 460 R TGGAAGGTTCAGGTTGTTTTCTG IL-8 F CTGGCCGTGGCTCTCTTG 65 292 R TTAGCACTCCTTGGCAAAACTG β-actin F ACCGTGAAAAGATGACCCAG 60 619 R TGTCAGCTGTGGTGGTGAAG

1-2. Experiment result

1) Changes in Inflammatory Cytokine Production in Mast Cells

In control cells sensitized with anti DNP (dinitrophenyl) -IgE and induced immune response with DNP-HSA, the expression of inflammatory cytokines IL-4, IL-13 and TNF-α was significantly increased compared to normal mast cells. . Meanwhile, the treatment of yonol or tacrolimus while inducing an immune response by anti DNP (dinitrophenyl) -IgE and DNP-HSA resulted in increased inflammatory cytokines (IL-4, IL-13 and TNF-α) due to the immune response. All expressions of were significantly reduced (FIG. 1).

2) Inflammatory cytokine production in keratinocytes

In control cells induced with TNF-α and IFN-γ, the expression of inflammatory cytokines IL-1β, IL-6 and IL-8 was significantly increased compared to normal keratinocytes. On the other hand, treatment of keratinocytes with yonol or tacrolimus together with TNF-α and IFN-γ resulted in increased expression of inflammatory cytokines (IL-1β, IL-6 and IL-8) due to immune responses. Significantly decreased (FIG. 2).

Statistical analysis of all data was carried out using a statistical package for the social sciences (version 21.0, IBM, Armonk, NY, USA) PC package, and the analysis value is expressed as mean ± standard deviation (mean ± SEM). Significant differences between groups were verified by ANOVA.

Hereinafter, the preparation of medicines, foods or cosmetics containing the yonol as an active ingredient according to the present invention will be described, but the present invention is not intended to limit the present invention is to be described in detail only. According to the conventional method, the pharmaceutical, food or cosmetic composition of Preparation Examples 1 to 3 according to the composition and the ratio of the composition having excellent ingredients for preventing and treating (or preventing and improving effect) of the allergic disease or atopic dermatitis Prepared.

Preparation Example 1 Preparation of Pharmaceutical Composition

<1-1> Preparation of Powder

Yonol 20 mg

Lactose Carb 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

<1-2> Preparation of Tablet

Yonol 10 mg

Corn starch 100 mg

Lactose Carb 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<1-3> Preparation of capsule

Yonol 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules in accordance with a conventional method for producing a capsule to prepare a capsule.

<1-4> Preparation of Injection

Yonol 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Sodium monohydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above ingredient content per ampoules (2 mL) according to the conventional method for preparing injections.

<1-5> Preparation of Liquid

Yonol 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

The above components are dissolved in purified water according to a conventional preparation method, dissolved in purified water, and then lemon juice is added in an appropriate amount. After adjusting to 100 mL in total, sterilized and filled in a brown bottle to prepare a liquid formulation.

Preparation Example 2 Preparation of Health Food

<2-1> Preparation of Health Supplements

Yonol 10 mg

Vitamin Mixture

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

0.2 μg of vitamin B ₁₂

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folate 50 ㎍

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

<2-2> Preparation of health drink

Yonol 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

Nicotinamide 3.5 g

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified Water Quantification

After mixing the above components according to a conventional healthy beverage production method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and refrigerated and then stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is mixed and formulated in a preferred embodiment to the components suitable for the preferred beverage, the compounding ratio may be arbitrarily modified according to regional and ethnic preferences, such as the demand hierarchy, the demand country, the intended use.

Production Example 3 Preparation of Cosmetic Composition

Hereinafter, an example of preparation of a cosmetic composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto, but is intended to be described in detail.

<3-1> Nutrients (Milk Lotion)

Jonol 2.0 wt%

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nutritional longevity in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-2> Softener (skin lotion)

Jonol 2.0% by weight

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed and formulated in a preferred embodiment with a component suitable for a relatively softening longevity, the compounding ratio may be arbitrarily modified, and can be prepared according to the manufacturing method in the general cosmetic field.

<3-3> nutrition cream

Jonol 2.0% by weight

Polysorbate 60 1.5% by weight

Sorbitan sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-4> massage cream

Jonol 1.0% by weight

Beeswax 10.0 weight%

Polysorbate 60 1.5% by weight

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

<3-5> pack

Jonol 1.0% by weight

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenyl ether 0.3% by weight

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

<3-6> gel

Jonol 0.5% by weight

0.05% by weight of ethylenediamine sodium acetate

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Although the compounding ratio is a relatively suitable composition for the cosmetic composition is mixed in a preferred embodiment, it can be applied to a variety of cosmetics, including other color cosmetics, according to the efficacy of the drug that can be applied to a thin coating on the human body, that is, It can be used for manufacturing as an ointment, and the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> BOTANICSENS <120> COMPOSITION INCLUDING IONOL AS ACTIVE INGREDIENTS FOR          ANTI-ALLERGY, IMPROVEMENT OF ATOPIC DERMATITIS, OR SKIN          REGENERATION <130> 1065182 <150> KR 10-2018-0035828 <151> 2018-03-28 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-4_F primer <400> 1 cagggtgctt cgcaaatttt ac 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-4_R primer <400> 2 accgagaacc ccagacttgt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-13_F primer <400> 3 ggtggcctca cctccccaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-13_R primer <400> 4 gatgacactg cagttggaga tgctg 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_F primer <400> 5 cagccgattt gccacttcat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_R primer <400> 6 tccttagggc aagggctctt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F primer <400> 7 ttacagtggc aatgaggatg a 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R primer <400> 8 tgtagtggtg gtcggagatt 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F primer <400> 9 cctgagaaag gagacatgta acaaga 26 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R primer <400> 10 tggaaggttc aggttgtttt ctg 23 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-8_F primer <400> 11 ctggccgtgg ctctcttg 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-8_R primer <400> 12 ttagcactcc ttggcaaaac tg 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F primer <400> 13 accgtgaaaa gatgacccag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R primer <400> 14 tgtcagctgt ggtggtgaag 20

Claims (8)

Pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis comprising yonool (ionol) or a pharmaceutically acceptable salt thereof as an active ingredient.
The method of claim 1,
The allergic diseases include edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insects A pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis, characterized in that it comprises at least one selected from the group consisting of allergy, food allergy and drug allergy.
The method of claim 1,
The active ingredient is a pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis, characterized by reducing the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 .
A composition for preventing or improving allergic diseases or atopic dermatitis, including yonol (ionol) or a salt thereof as an active ingredient.
The method of claim 4, wherein
The composition is a functional food composition, a cosmetic composition or a composition for preventing or improving allergic diseases or atopic dermatitis, characterized in that the perfume composition.
A pharmaceutical composition for skin wound healing or skin regeneration promotion comprising yonol (ionol) or a pharmaceutically acceptable salt thereof as an active ingredient.
A quasi-drug composition for skin wound healing or skin regeneration promotion comprising ionol or a pharmaceutically acceptable salt thereof as an active ingredient.
Cosmetic composition for promoting skin rejuvenation or skin healing comprising yonool (ionol) or salts thereof as an active ingredient.

Images