KR101984195B1 - Composition including jasmone as active ingredients for anti-allergy, prevention or treatment of atopic dermatitis, or skin regeneration - Google Patents

Abstract

The present invention relates to a composition for anti-allergy, alleviation of atopic dermatitis, or skin regeneration, which contains jasmone as an active component. More particularly, the present invention relates to a composition for preventing or treating allergic diseases or atopic dermatitis and a composition for healing skin wounds or promoting skin regeneration, which contain jasmone or a pharmaceutically acceptable salt thereof as an active component.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for improving allergy, atopic dermatitis, or skin regeneration comprising jasmone as an active ingredient,

The present invention relates to a composition for the treatment of allergies, improvement of atopic dermatitis, or skin regeneration comprising jasmone as an active ingredient, and more particularly, to a composition for the treatment of allergic diseases including jasmone or a pharmaceutically acceptable salt thereof as an active ingredient Or a composition for preventing or treating atopic dermatitis, a composition for promoting skin wound healing or skin regeneration.

Atopy is derived from the ancient Greek word 'atopia' which means 'strange, abnormal'. In 1923, Cooke and Coca first began to refer to the tendency to genetically cause a specific immune antibody response to an allergic antigen as 'atopy'. The incidence is increasing in the developed countries where industry is developed steadily in the world.

The etiology of atopy has not yet been elucidated. However, it is not limited to one factor such as family history, change of diet, infiltration of allergen, skin barrier, etc. It usually develops in childhood and may persist or begin in adulthood. Typical symptoms of atopy appear on the hands, scalp, face, neck, elbow, etc., but there are differences in the appearance of each type. Symptoms of infancy are rough and dry skin, dermatitis on the outside of the limbs, common on cheeks and foreheads, scratching with hands, dirt and scabs. In the case of childhood, it mainly appears on the folds of the arms, legs and necks rather than the face, and the skin becomes dry. During puberty and adulthood, there is a thickening of the skin in areas such as the face and hands.

Atopic drug therapy includes topical steroids, local immunomodulators, systemic steroids, systemic immunosuppressants, and antihistamines. Topical steroids are used when the symptoms of atopic symptoms are severe, and they are the most basic way to manage bacterial or viral infections. However, steroids have been introduced in 1950 and have been in use for many years, but their long-term use is limited due to problems with safety and tolerance of skin due to frequency, concentration and duration. In addition to the skin adverse effects such as skin atrophy, telangiectasia and steroid acne, there is a potential to cause hypothalamic-pituitary-adrenal suppression (HPA), Cushing's syndrome Care should be taken when using it, as it can cause side effects.

Unlike conventional topical steroids, tacrolimus and pimecrolimus, which are topical immunomodulators, are less likely to cause side effects, and therefore, they can be used over a long period of time for the prevention of recurrence of lesions. It is suitable for use as treatment and maintenance therapy. However, tacrolimus may cause side effects such as kidney dysfunction, hand shake and hair loss, and Pimecrolimus may cause serious side effects such as skin cancer and lymphoma as well as acne and burning. Although steroids are suitable for use as mild atopic and maintenance therapy when the acute phase deteriorates, local immunomodulators are still unsafe for side effects, and therefore there is a need for alternative supplementary products.

The present applicant has made efforts to develop a material effective for alleviating the symptoms of atopic dermatitis which has a low side effect. As a result, it has been confirmed that jasmone alleviates the symptoms of atopy and improves the inflammatory reaction, The present invention has been completed by confirming that there is a healing effect.

Korean Patent Publication No. 10-2018-0128602

An object of the present invention is to provide a pharmaceutical composition for preventing or treating an allergic disease or atopic dermatitis comprising jasmone or a pharmaceutically acceptable salt thereof as an active ingredient.

It is still another object of the present invention to provide a composition for preventing or ameliorating an allergic disease or atopic dermatitis comprising jasmon or a salt thereof as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising jasmon or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for promoting skin wound healing or skin regeneration comprising jasmon or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for promoting skin wound healing or skin regeneration comprising jasmon or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a pharmaceutical composition for preventing or treating an allergic disease or atopic dermatitis comprising jasmone or a pharmaceutically acceptable salt thereof as an active ingredient.

According to one aspect of the present invention, the allergic disease is selected from the group consisting of edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, Rheumatoid arthritis, food allergies, and drug allergies, but are not limited thereto.

According to one aspect of the present invention, the active ingredient can be used to inhibit the expression of IL-4 (Interleukin-4), IL-13, TNF-α, IL-1β, IL-6 or IL- The anti-allergic effect, prevention or treatment effect of atopic dermatitis can be shown.

The present invention also provides a composition for preventing or ameliorating an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.

According to one embodiment of the present invention, the composition may be a health functional food composition, a cosmetic composition or a perfume composition.

The present invention also provides a pharmaceutical composition for promoting skin wound healing or skin regeneration comprising jasmon or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a quasi-drug composition for promoting skin wound healing or skin regeneration comprising jasmone or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a cosmetic composition for promoting skin wound healing or skin regeneration comprising jasmone or a salt thereof as an effective ingredient.

The composition containing jasmine of the present invention as an active ingredient has an effect of improving atopic dermatitis due to an allergic reaction and can be used as a composition for preventing or treating various allergic diseases by reducing an inflammatory reaction. In addition, the composition of the present invention has a skin regenerating effect, and can be usefully used for medicines for wound healing or functional cosmetics for skin regeneration.

1 is a graph showing changes in the expression of inflammatory cytokine-related molecules (IL-4, IL-13 and TNF-a) in mast cells-treated mast cells (each value was calculated from three independent wells ± SEM; the letters on the bar showed a statistically significant difference at P <0.05).
FIG. 2 is a graph showing changes in the expression of inflammatory cytokine-related molecules (IL-1 ?, IL-6 and IL-8) in keratinocyte-treated keratinocytes (each value was obtained from three independent wells Mean ± SEM; letters on the bar indicate statistically significant difference at P <0.05).

The present inventors have found that jasmone alleviates atopic symptoms and induces the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8, which are inflammatory cytokines secreted by cellular immune responses The present invention has been completed.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for preventing or treating an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.

Specifically, the above-mentioned Jasmone is contained in plants such as Jasmin and Yarrow, and is also called cis-jasmone. The structural formula of jasmone is C ₁₁ H ₁₆ O and its molecular weight is 164.248, which is represented by the following formula (1).

[Chemical Formula 1]

JASMON is listed as a usable ingredient in the Food and Drug Administration (FDA) and Korea Food and Drug Administration (KFDA) database and is safe as a food additive to Joint FAO / WHO Expert Committe on Food Additives (JECFA) It has been approved.

The physiological and general functions of jasmone have been reported to help calcium absorption. It has been reported that the treatment of microsomes with microsomes of the skeletal muscles of dogs results in an increase in the calcium absorption rate of the microsomes and an increase in the content thereof (Antipenko et al., "Comparison of the Effects of Phospholamban and Jasmone on the Calcium Pump of Cardiac Sarcoplasmic Reticulum Evidence for Modulation" phospolamban of both Ca affinity and Vmax (Ca) of calcium transport. " Journal of Biological Chemistry 272.5, 1997.). Food and Cosmetics Toxicology 2 (1964) reported that the LD ₅₀ value of jasmone was safe at 5,000 mg / kg or more when administered orally to rats (Jenner, et al., "Food flavors and compounds of related structure I. Acute oral toxicity. : 327-343.).

The jasmine of the present invention may include a jasmone hydrate, a jasmone derivative, and the like, and may also include a solvent or a stereoisomer thereof within the range having the same efficacy as the above-mentioned jasmone.

The method of obtaining the above-mentioned jasmine is not particularly limited, and may be separated from plants containing the above-mentioned jasmine, chemically synthesized using a known production method, or commercially available.

In the context of the present invention, the term "cosmetically acceptable salt", "pharmaceutically acceptable salt", "pharmaceutically acceptable salt" or "salt thereof" refers to an acid addition salt formed by a free acid have. Acid addition salts can be prepared in a conventional manner, for example, by dissolving the compound in an excess amount of an aqueous acid solution and precipitating the salt with a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It is also possible to heat an equimolar amount of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water, and then evaporate the mixture to dryness, or the precipitated salt may be subjected to suction filtration.

As the free acid, an inorganic acid or an organic acid can be used. The inorganic acid may be, for example, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. These may be used alone or in admixture of two or more. Non-limiting examples of the organic acid include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, mandelic acid, The present invention also relates to the use of a compound of formula (I) as an acid, citric acid, lactic acid, glycollic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillyric acid, hydroiodic acid and the like. These may be used alone or in combination of two or more.

In addition, the above-mentioned jasmine can be used to make a cosmetically or pharmaceutically acceptable metal salt using a base. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. The metal salt is preferably, but not limited to, sodium, potassium or calcium salt. The corresponding silver salt can also be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The salt of the above-mentioned jasmone may contain all of the salts of the acidic or basic group which may exist in the compound of the above-mentioned jasmone unless otherwise indicated. For example, the salt of the above-mentioned jasmone may include sodium, calcium and potassium salts of a hydroxy group, and other cosmetically acceptable salts of amino groups include hardro-bromide, sulfuric acid, hydrogen sulfate, phosphate, hydrogen phosphate, (Mesylate), p-toluenesulfonate (tosylate) salts, and the like, and can be used in the production of salts known in the art, such as hydrochloric acid, hydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate &Lt; / RTI &gt;

The term " allergic disease " in the present invention means a disease caused by an allergy reaction in which an immune response to an external antigen is excessive in the body. Specifically, it means edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insect allergies, food allergies and drug allergies. But is not limited thereto.

In the present invention, " atopic dermatitis " is one of the allergic diseases and is a skin disease accompanied by symptoms such as itching, skin dryness, increase in skin thickness and characteristic eczema.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention is not particularly limited as long as it contains jasmon or a pharmaceutically acceptable salt thereof, 1000 [mu] M, but is not limited thereto. At this time, when the concentration of jasmine is less than the concentration range, there is a problem that it is difficult to exert a desirable preventive or therapeutic effect. When the concentration of jasmone exceeds the concentration range, there may be concern about toxicity including cytotoxicity.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention may be formulated into oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations, Excipient, or diluent, which may be formulated and used in the form of a sterile injectable solution, and which are routinely used in the manufacture of pharmaceutical compositions for formulation.

The carrier or the excipient or diluent includes lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

In the case of formulation, a diluent or excipient such as a commonly used filler, a weight agent, a binder, a wetting agent, a disintegrant or a surfactant may be used.

The solid preparation for oral administration can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the above-mentioned jasmone. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of the liquid preparation for oral administration include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis according to the present invention varies depending on the condition of the patient, the body weight, the degree of the disease, the drug form, the administration route and the period of time, . However, for a desired effect, the dose may be 0.0001 to 2,000 mg / kg, preferably 0.001 to 2,000 mg / kg per day. The administration may be carried out once a day or divided into several doses. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for preventing or treating allergic diseases or atopic dermatitis according to the present invention can be administered to mammals such as rats, mice, livestock, humans, and the like in various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

The composition comprising the active ingredient according to the present invention is useful for the treatment of allergic diseases or diseases by decreasing the expression of IL-4, IL-13, TNF- ?, IL-1 ?, IL-6 or IL- Atopic dermatitis symptoms can be improved and prevented.

In one embodiment of the present invention, the expression of IL-4, IL-13, TNF- ?, IL-1 ?, IL-6 and IL-8, which are inflammatory cytokines secreted by the immune response of cells, (Fig. 1, Fig. 2). As shown in Fig. 1 and Fig. 2, it can be seen that jasmone suppresses excessive immune response and treat inflammation.

The present invention also provides a composition for preventing or ameliorating an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.

The specific contents of the above-mentioned jasmone are as described above.

The composition for preventing or ameliorating an allergic disease or atopic dermatitis of the present invention may be a health functional food composition, a cosmetic composition or a perfume composition.

The term " health functional food " in the present invention refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and rings using raw materials and components having useful functions in the human body. Here, 'functional' refers to the structure and function of the human body to obtain nutritional effects and obtain useful effects for health use such as physiological action. The health functional food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients that are conventionally added in the art. In addition, the formulations of the above health functional foods may also be manufactured without limitations as long as they are acceptable as health functional foods. The health functional food composition of the present invention is advantageous in that it does not have side effects that may occur when a drug is taken for a long time by using a food as a raw material, unlike a general medicine, and is excellent in portability and promotes anti-allergy effect or atopic dermatitis It is possible to ingest it as an adjuvant.

In the health functional food for preventing or ameliorating an allergic disease or atopic dermatitis according to the present invention, when the above-mentioned jasmine is used as an additive for a health functional food, it can be added as it is or used together with other food or food ingredients, It can be used appropriately according to the method. The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, the jasmine may be added in an amount of not more than 15 parts by weight, preferably not more than 10 parts by weight, based on 100 parts by weight of the raw material. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. Further, since the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.

The beverage in the functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for preventing or ameliorating an allergic disease or atopic dermatitis according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, A thickening agent, a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, and a carbonating agent used in a carbonated drink. In addition, the health functional food composition for preventing or ameliorating allergic diseases or atopic dermatitis of the present invention may contain flesh for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the functional food of the present invention.

The term " cosmetic composition " used in the present invention is a composition containing the above-mentioned compound, and the formulation can be in any form. Examples of such formulations include cosmetic preparations made using the above composition, such as creams such as nutritional creams, eye creams, massage creams, cleansing creams, lotions such as packs, nutritional lotions, essences, softening longevity, A powder, a foundation, a makeup base, and the like, and may be manufactured and commercialized in any form of these formulations in order to achieve the object of the present invention, and the present invention is not limited thereto. Further, the cosmetic composition according to the present invention can be formulated into a usual cosmetic preparation method. Specifically, the cosmetic composition of the present invention can be used as a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, And may be any one selected from the group consisting of soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, milky lotion, press powder, loose powder and eye shadow.

The cosmetic composition of the present invention may contain, in addition to jasmone or a salt thereof, an excipient, carrier, and other additives, and it is possible to apply a common ingredient to be blended with a common skin cosmetic composition as necessary.

Specifically, the cosmetic composition of the present invention may further comprise a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into vascular cells of the skin at a high absorption rate. But are not limited to, other phospholipid components, liposomal components, and the like, preferably used in lecithin cosmetics.

As the oil which can be mainly used as an oil component, at least one selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, there may be mentioned mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitisviniferase seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, Chicone, cyclopentasiloxane, sunflower seed oil and the like can be used.

Further, 0.1 to 5% by weight of a surfactant, a higher alcohol and the like may be added to reinforce the emulsifying ability. As such surfactants, conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids and the like can be used. Specific examples thereof include sorbitan sesquiunorate, polysorbate 60 Sorbitan stearate, sorbitan stearate, sucrose stearate / sucrose cocoate, glyceryl stearate / polyethylene glycol-100 Stearate, cetearyl-6 olivate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside, polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, have. As the higher alcohol, an alcohol having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in admixture of one or more.

In order to control the viscosity or hardness of the water phase, 0.001 to 5% by weight of at least one thickening agent such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like may be further added.

In addition, the cosmetic composition of the present invention may contain, if necessary, a medicinal ingredient such as higher fatty acids and vitamins, an ultraviolet screening agent, an antioxidant (butylhydroxyanisole, gallic acid propylate, eicosorbic acid, tocopheryl acetatide, (Triethanolamine, citric acid, citric acid, sodium citrate, malic acid, citric acid, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinyl urea, chlorphenesin and the like) And the like), a humectant (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, etc.), sodium hydrogen carbonate , Betaine, glycereth-26, methylglucose-20, etc.), lubricant, and the like.

In addition, the cosmetic composition of the present invention further comprises a substance capable of supplementally providing an essential nutrient to the skin, and preferably it may contain an auxiliary agent including, but not limited to, a natural flavor, a cosmetic flavor, have.

The effective content of jasmone or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited and may be from 0.0001 to 20% by weight based on the total weight of the composition. Less than 0.0001% by weight of jasmone or a salt thereof in cosmetics may have little wrinkle-improving effect due to its small amount, and more than 20% by weight of jasmone or its salt may exhibit the previously known toxicity.

The term " fragrance composition " of the present invention can be incorporated into external skin preparations such as perfume, cosmetics, bath salts, etc., foods, medicines and the like. The amount of the fragrance composition may be appropriately selected depending on the technique Can be compounded.

The formulation of the perfume composition of the present invention is not particularly limited, but may be any one selected from powders, granules, liquid spray, solid and gel type formulations.

The perfume composition may include cosmetics including perfumes, soap cleansing products including bath soaps, indoor cleaning products including glass cleaners, aroma products including car perfumes, bath products including herbal bath salts, stationery Such as perfumes, fragrances, perfumes for offices, perfumes for office use, or industrial products containing synthetic resins.

The perfume composition of the present invention contains 0.00001% by weight to 10% by weight, preferably 0.00001% by weight to 1.0% by weight, of the active ingredient jasmone, based on the total weight of the perfume composition, By weight, more preferably 0.00001% by weight to 0.5% by weight.

The product form in which the perfume composition is embodied includes soaps, cosmetics, bath salts, aroma oils and the like, and specifically includes body lotions, shampoos, hair rinses, hair conditioners, hair treatments, antiperspirants, skin lotions, , Perfume (spray or fumigant), lipstick, lip balm, bath salts, and the like.

These products may contain various additives such as blood circulation promoters, antiinflammatory agents, moisturizers, astringents, inorganic salts, organic salts, oily components, surfactants, herbal medicines, coloring matters, fragrances, sulfur, sinter deposits, .

In particular, the perfume composition of the present invention is generally used as an external preparation for skin of cosmetic formulations such as a makeup product, a skin lotion, and a skin cream. In this case, the perfume composition may contain components commonly used in these cosmetic formulations.

In particular, the perfume composition of the present invention is preferably used in a bathing agent in that it has an activity of improving atopic dermatitis, which is an active ingredient of jasmone. In this case, the active ingredient may be contained in an amount of preferably 0.00001 wt.% To 1 wt.%, More preferably 0.0001 wt.% To 0.1 wt.%, Based on the total weight of the bath composition. When the perfume composition of the present invention is incorporated in a bath agent, the bath agent may be added to bath water at a concentration of 0.015 to 15 ppm.

The bath agent may contain an inorganic salt, an organic acid, an oily component and the like in addition to the effective component of the perfume composition of the present invention.

Examples of inorganic salts include sodium chloride, sodium hydrogen carbonate, sodium carbonate, borax, sodium sulfate, sodium sulfide, sodium sesquicarbonate, sodium nitrate, sodium thiosulfate, sodium polyphosphate, sodium phosphate, calcium oxide, magnesium oxide, calcium carbonate, magnesium carbonate, Potassium, and the like, which may be used alone or as a mixture of two or more. These inorganic salts may be added to the bathing agent in an amount of 5% by weight or more, preferably 10% by weight or more, based on the total weight of the bathing agent.

Examples of the organic acid include succinic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid, etc. These may be used alone or in a mixture of two or more. These organic acids may be added to the bathing agent in the range of 0.1 to 50% by weight based on the total weight of the bathing agent.

Examples of the oily component include wax, hydrocarbon, higher fatty acid, higher alcohol, ester, silicone oil and the like.

The bath salts may also contain other ingredients commonly used in the art. These components include inorganic acids such as boric acid, meta silicic acid, silicic anhydride; Herbal medicine powder such as fenugreek, bank, ginger, citrus peel, ginger root, peppermint, ginseng, oats; Natural pigments found to be harmless to humans such as coal tar dyes, chlorophyll, riboflavin, safflower and anthraquinone; Vitamins such as vitamin A, vitamin C, vitamin D and vitamin E; Sulfur, mica powder, white clay powder, loess powder, rice bran carbide, bactericide, preservative and the like.

Such a bathing agent may be prepared by any desired means such as granules, tablets, liquids, powders, and the like.

The present invention also provides a pharmaceutical composition, a quasi-drug composition and a cosmetic composition for skin-healing or skin regeneration promotion comprising jasmone or a pharmaceutically acceptable salt thereof as an active ingredient.

Below, The present invention will be described in more detail by way of examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example: Assessment of secretion and expression regulation of inflammation-related cytokines by Jasmone in mast cells and keratinocytes

1-1. Experimental Method

1) Cell culture of mast cell

The rat basophilic leukemia cell line (RBL-2H3) was purchased from ATCC (Manassas, VA, USA). (Dulbecco's modified eagle medium (Gibco BRL, USA) containing 10% heat-inactivated fetal bovine serum (FBS) (Gibco BRL, USA) and 1% penicillin and streptomycin (Gibco BRL, USA) Cells were cultured in culture. The cells were cultured under the condition of 37 ° C and 5% CO ₂ . Mast cells were suspended in DMEM containing 10% FBS 6-well plate; was dispensed such that the number of cells of 1 × 10 ⁶ cells / ml in (well plate Corning, USA).

Then, the cells were sensitized with anti-DNP (dinitrophenyl) -IgE (30 ng / ml) and cultured in a 5% CO ₂ incubator at 37 ° C for 24 hours. After washing twice with PBS (phosphate buffered saline), DNP-HSA (dinitrophenylated human serum albumin; 10 μg / ml) was treated for 4 hours to induce an immune response. In addition, in order to evaluate the effect of Jasmone on atopy, anti-DNP (dinitrophenyl) -IgE was cultured for 24 hours and then treated with 100 μM jasmon for 1 hour. Respectively. In the case of normal cells, the cells were treated with DMSO instead of jasmine in the same condition as that of the jasmon-treated cells, and 10 μM of tacrolimus instead of jasmine in the case of positive control cells. After incubation for 1 hour, the immune response was induced by DNP-HSA.

2) keratinocyte cell culture

Human keratinocyte cell line (HaCaT) was purchased from ATCC (Manassas, VA, USA). Cells were cultured in DMEM medium supplemented with 10% FBS (fetal bovine serum) and antibiotics. The cells were cultured in a 75 ° C flask and a 6-well plate at 37 ° C with 5% CO 2. The culture medium was changed every 3 to 4 days. When the cells were overproduced, they were subcultured. Dissociated HaCaT cells (5 × 10 ⁵ / well) were incubated for 24 hours and then washed with PBS. (10 ng / ml) and IFN-γ (interferon gamma) (10 ng / ml) were added to the DMEM medium without FBS to induce an immune response to keratinocytes And cultured for 24 hours. In order to evaluate the effect of improving the immune response by jasmine, 100 μM of jasmine was treated at the same time. In the case of normal cells, DMSO was used instead of jasmine. In the case of positive control cells, 10 μM of tacrolimus was treated simultaneously with immune reaction inducer Lt; / RTI &gt;

3) RNA isolation using a Trizol method and real-time PCR (quantitative reverse-transcription polymerase chain reacion)

After removing the supernatant from the mast cells inducing the immune response, 1 ml of the tripol was added, and the mixture was allowed to stand for 2 minutes. Then, chloroform was added thereto, vortexing for 10 seconds, centrifugation at 5,000 rpm for 10 minutes, The solution was mixed with an equal amount of isopropanol and shaken. The supernatant was removed by centrifugation at 13,000 rpm for 25 min. The pellet was dissolved in 20 μl of DEPC (diethyl pyrocarbonate) -DW and stored at -20 ° C. RT-PCR was performed by using one-step RT-PCR PreMixkit (iNtRON Biotechnology, Korea) at 45 ° C for 30 minutes, 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, Annealing and then repeating 32 cycles of extension at 72 ° C for 1 minute and final extension at 72 ° C for 5 minutes and then adding PiQ SYBR green supermix (Bio-Rad) And the CFX Connect ™ Real-Time PCR Detection System (Bio-Rad). The primer sequences used were as shown in [Table 1].

 Primer sequences used for RT-PCR Gene description Primers Sequences (5 '- &gt; 3') Annealing
온도
(° C) PCR
product (bp) IL-4 F CAGGGTGCTTCGCAAATTTTAC 55 104 R ACCGAGAACCCCAGACTTGTT IL-13 F GGTGGCCTCACCTCCCCAAG 60 234 R GATGACACTGCAGTTGGAGATGCTG TNF-a F CAGCCGATTTGCCACTTCATA 60 168 R TCCTTAGGGCAAGGGCTCTT IL-1? F TTACAGTGGCAATGAGGATGA 57 250 R TGTAGTGGTGGTCGGAGATT IL-6 F CCTGAGAAAGGAGACATGTAACAAGA 58 460 R TGGAAGGTTCAGGTTGTTTTCTG IL-8 F CTGGCCGTGGCTCTCTTG 65 292 R TTAGCACTCCTTGGCAAAACTG β-actin F ACCGTGAAAAGATGACCCAG 60 619 R TGTCAGCTGTGGTGGTGAAG

1-2. Experiment result

1) Inflammatory cytokine production in mast cells

The expression of IL-4, IL-13 and TNF-α, which are inflammatory cytokines, was significantly increased in the control cells stimulated with anti-DNP (dinitrophenyl) -IgE and immunoreacted with DNP-HSA . IL-4, IL-13, and TNF-α, which are increased due to immune responses, were induced by treatment with jasmon or tacrolimus while inducing an immune response by anti-DNP (dinitrophenyl) -IgE and DNP- (Fig. 1). &Lt; tb &gt; &lt; TABLE &gt;

2) Inflammatory cytokine production changes in keratinocytes

The expression of IL-1β, IL-6 and IL-8, which are inflammatory cytokines, was significantly increased in the control cells induced by TNF-α and IFN-γ compared with normal keratinocytes. On the other hand, treatment of keratinocytes with jasmon or tacrolimus together with TNF-α and IFN-γ resulted in increased expression of inflammatory cytokines (IL-1β, IL-6 and IL-8) (Fig. 2).

Hereinafter, a preparation example of a medicament, a food or a cosmetic product containing the above-mentioned jasmone as an active ingredient according to the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained. The pharmaceutical, food or cosmetic composition of Production Examples 1 to 3 is prepared according to a conventional method according to the following composition components and composition ratios, with ingredients having excellent properties of preventing or treating (or preventing and improving) allergic diseases or atopic dermatitis .

[Preparation Example 1] Preparation of pharmaceutical composition

<1-1> Preparation of powder

20 mg of jasmone

100 mg of lactose hydrate

10 mg of talc

The above ingredients were mixed and filled in an airtight container to prepare powders.

<1-2> Preparation of tablets

10 mg of jasmone

Corn starch 100 mg

100 mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

&Lt; 1-3 > Preparation of capsules

10 mg of jasmone

3 mg of microcrystalline cellulose

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the usual preparation method of capsules.

&Lt; 1-4 > Preparation of injection

10 mg of jasmone

180 mg mannitol

2974 mg of sterile distilled water for injection

26 mg of sodium monohydrogenphosphate

After the above components were mixed, they were prepared with the above ingredient contents per 1 ampoule (2 mL) according to the usual injection preparation method.

<1-5> Preparation of liquid agent

10 mg of jasmone

10 mg of isomerized sugar

5 mg mannitol

Purified water quantity

Lemon incense quantity

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

[Preparation Example 2] Preparation of health food

<2-1> Production of health supplement foods

10 mg of jasmone

Vitamin mixture quantity

Vitamin A Acetate 70 ㎍

Vitamin E 1.0 mg

0.13 mg of vitamin B ₁

0.15 mg of vitamin B ₂

0.5 mg of vitamin B ₆

Vitamin B ₁₂ 0.2 g

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 30 mg

100 mg of calcium carbonate

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

<2-2> Manufacture of health drinks

Jasmon 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B1 0.25 g

Vitamin B2 0.3 g

Purified water quantitation

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated for about 1 hour at 85 DEG C with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, &Lt; / RTI &gt;

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

[Preparation Example 3] Preparation of cosmetic composition

Hereinafter, a preparation example of a cosmetic composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

<3-1> Nourishing lotion (milk lotion)

&Lt; tb &gt;

Squalane 5.0 wt%

4.0 wt%

Polysorbate 60 1.5 wt%

1.5% by weight of sorbitan sesquioleate

0.5% by weight liquid paraffin

Caprylic / capric triglyceride 5.0 wt%

Glycerin 3.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

Carboxyvinyl polymer 0.1 wt%

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional lotion, the compounding ratio thereof may be arbitrarily varied, and the preparation may be carried out according to a conventional method in the field of cosmetics.

<3-2> Flexible longevity (skin lotion)

&Lt; tb &gt;

Glycerin 3.0 wt%

Butylene glycol 2.0 wt%

Propylene glycol 2.0 wt%

Carboxyvinyl polymer 0.1 wt%

PEG 12 nonyl phenyl ether 0.2 wt%

Polysorbate 80 0.4 wt%

Ethanol 10.0 wt%

0.1% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-described components is a mixture of the components suitable for the relatively long softening time, it may be arbitrarily varied in its blending ratio, and it can be produced according to a conventional production method in the field of cosmetics.

<3-3> Nourishing cream

&Lt; tb &gt;

Polysorbate 60 1.5 wt%

0.5% by weight of sorbitan sesquioleate

PEG 60 hardened castor oil 2.0 wt%

10% by weight liquid paraffin

Squalane 5.0 wt%

Caprylic / capric triglyceride 5.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Antiseptic

Pigment amount

Fragrance quantity

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional cream, the compounding ratio of the ingredient may be arbitrarily varied, and can be manufactured according to a conventional method in the field of cosmetics.

<3-4> Massage Cream

1.0% by weight of jasmine

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0 wt%

0.8% by weight of sorbitan sesquioleate

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 4.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparatively suitable for the massage cream, the compounding ratio thereof may be arbitrarily modified, and can be manufactured according to a conventional manufacturing method in the field of cosmetics.

<3-5> Pack

1.0% by weight of jasmine

Polyvinyl alcohol 13.0 wt%

0.2% by weight of sodium carboxymethylcellulose,

Glycerin 5.0 wt%

Allantoin 0.1 wt%

6.0% by weight of ethanol

PEG 12 nonyl phenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above components is comparatively comparatively compatible with the pack, the compounding ratio thereof may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

<3-6> Gel

0.5% by weight of jasmone

0.05% by weight of sodium ethylenediaminetetraacetate

Glycerin 5.0 wt%

Carboxyvinyl polymer 0.3 wt%

5.0% by weight of ethanol

PEG 60 hardened castor oil 0.5 wt%

Triethanolamine 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the gel, the blending ratio may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Although the compounding ratio is comparatively comparable to a composition suitable for a cosmetic composition as a preferred embodiment, it can be applied to cosmetics for various purposes including other color cosmetics. Depending on the efficacy of the cosmetics, a medicine which can be applied thinly on the human body, It can be used for manufacturing in ointment, and it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as demand level, demand country, use purpose, and the like.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> BOTANICSENS <120> COMPOSITION INCLUDING JASMONE AS ACTIVE INGREDIENTS FOR          ANTI-ALLERGY, PREVENTION OR TREATMENT OF ATOPIC DERMATITIS, OR          SKIN REGENERATION <130> 1063619 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-4_F primer <400> 1 cagggtgctt cgcaaatttt ac 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-4_R primer <400> 2 accgagaacc ccagacttgt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-13_F primer <400> 3 ggtggcctca cctccccaag 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-13_R primer <400> 4 gatgacactg cagttggaga tgctg 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_F primer <400> 5 cagccgattt gccacttcat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha_R primer <400> 6 tccttagggc aagggctctt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F primer <400> 7 ttacagtggc aatgaggatg a 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R primer <400> 8 tgtagtggtg gtcggagatt 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F primer <400> 9 cctgagaaag gagacatgta acaaga 26 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R primer <400> 10 tggaaggttc aggttgtttt ctg 23 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-8_F primer <400> 11 ctggccgtgg ctctcttg 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-8_R primer <400> 12 ttagcactcc ttggcaaaac tg 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F primer <400> 13 accgtgaaaa gatgacccag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R primer <400> 14 tgtcagctgt ggtggtgaag 20

Claims (8)

A pharmaceutical composition for preventing or treating an allergic disease or atopic dermatitis comprising jasmone or a pharmaceutically acceptable salt thereof as an active ingredient.
The method according to claim 1,
The allergic disease is selected from the group consisting of edema, anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, contact dermatitis, urticaria, pruritus, insect An allergic disease, an allergic disease, a food allergen, and a drug allergy.
The method according to claim 1,
A pharmaceutical composition for the prevention or treatment of allergic diseases or atopic dermatitis characterized in that the active ingredient decreases the expression of IL-4, IL-13, TNF-α, IL-1β, IL-6 or IL-8 .
A cosmetic composition for preventing or ameliorating an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.
A food composition for preventing or ameliorating an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.
A perfume composition for preventing or improving an allergic disease or atopic dermatitis comprising jasmone or a salt thereof as an active ingredient.
delete delete

Images