KR20200083801A - Composition for determining the marbling index of a bovine including an agent capable of detecting or amplifying SNP - Google Patents

Abstract

The present invention relates to a composition for determining a marbling index of cattle, containing an agent capable of detecting or amplifying a SNP, wherein the present invention selects eight SNPs which are highly related to the marbling index of cattle, and confirms the marbling index according to the genotype. Therefore, it is possible to accurately determine the marbling index traits of cattle using the same.

Description

Composition for determining the marbling index of a bovine including an agent capable of detecting or amplifying SNP}

The present invention relates to a composition for determining a cow's marbling index, comprising a formulation capable of detecting or amplifying SNP, a kit for determining a cow's marbling index comprising the composition, and a method for determining a cow's marbling index.

Marbling of beef refers to the distribution of fats that make meat soft and juicy, and is known to be the primary criterion for determining the quality of a cow as one of the traits that directly affects the price of beef. In addition, the marbling index is a numerical value of the marbling trait, and the higher the marbling index, the higher the quality of meat.

In order to easily identify high-quality Korean beef, research using biotechnological methods for discriminating marbling indexes has been actively conducted. Specifically, Korean Patent Publication No. 10-2015-0047672 discloses a method for determining characteristics of Korean beef marbling using SNP, and Korean Patent Publication No. 10-2016-0048316 uses ADIPOQ gene Disclosed is a method for predicting marbling.

The present inventors have completed the present invention by discovering a new SNP for discrimination of marbling index to easily and accurately discriminate Korean beef.

An object of the present invention is to provide a composition for discriminating bovine marbling index, comprising an agent capable of detecting or amplifying SNP.

Another object of the present invention is to provide a kit for determining the marbling index of a cow.

Another object of the present invention is to provide a method for determining cattle marbling index.

To achieve the above object, there is provided a composition for discriminating bovine marbling index, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of monobasic polymorphism (SNP).

In addition, the present invention provides a kit for determining a cow's marbling index.

In addition, the present invention provides a method for determining cattle marbling index.

When the composition for determining the marbling index of a cow of the present invention is used, it is possible to accurately determine the marbling index trait of a cow, through which it is possible to easily and accurately discriminate high-quality meat.

Figure 1 shows the results of a full-length genome association analysis in order to select a new SNP related to the Korean beef marbling index trait.

Hereinafter, the present invention will be described in detail.

The present invention is a single nucleotide polymorphism (SNP) in which the 101st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;

SNP in which the 101st base is G or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;

SNP in which the 101st base is T or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;

SNP in which the 101st base is C or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;

SNP in which the 101st base is T or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;

SNP in which the 101st base is C or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; And

A composition for discriminating bovine marbling index, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 It is about.

The cow may be Korean beef, but is not limited thereto.

The term "nucleotide" in the present invention is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form, and includes analogs of natural nucleotides, unless specifically stated otherwise.

In the present invention, the term, "SNP (Single Nucleotide polymorphism)" refers to a single nucleotide polymorphism, SNP refers to one or dozens of base mutations representing individual variation among the 3 billion base sequences possessed by chromosomes in the cell nucleus, This results in differences in phenotype, drug responsiveness, and disease resistance.

The term "an agent capable of detecting or amplifying a polynucleotide" of the present invention is an agent capable of specifically recognizing and binding to a site containing an SNP in a polynucleotide, or an agent capable of amplifying a site containing the SNP. , Specifically, a probe capable of specifically binding to the site containing the SNP, a polynucleotide comprising the site containing the SNP, or a primer capable of specifically amplifying a complementary polynucleotide thereof.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. These primers can be modified using a number of means known in the art, as long as they exhibit the effect of detecting the site containing the SNP. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer may include a label that can be directly or indirectly detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g. ³² P), fluorescent molecules and chemical groups (e.g. biotin), etc. There is this.

As used herein, the term "probe" refers to nucleic acid fragments corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, oligonucleotide probes, single stranded DNA probes , It can be produced in the form of a double stranded DNA (double stranded DNA) probe or RNA probe.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such a probe can be modified using a number of means known in the art, as long as it has the effect of detecting the site containing the SNP. Examples of such modifications are methylation, capping, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may be further bonded to a reporter at its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, alexa Fluoro(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine. However, any other material known to be used as a reporter in the art can be used.

The probe may further be conjugated with a quencher at its 3'end. The quencher is TAMRA, black hole quencher (BHQ) 1, BHQ2, BHQ3, nonfluorescent quencher (NFQ), dabcyl, Eclipse, deep dark quencher (DDQ), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but may be used as long as it is known in the art to be used as a quencher.

The "an agent capable of detecting or amplifying a polynucleotide" may include a reverse transcriptase, a DNA polymerase, a cofactor such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. Various DNA polymerases can be used in the amplification step of the present invention to amplify reverse-transcribed cDNA, and examples of DNA polymerases include C. lanau fragments of E.coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization There are enzymes. The polymerase can be obtained from cells expressing a high level of the cloning gene encoding the polymerase, either from the bacteria itself or commercially purchased.

The term "Linkage Disequilibrium" as used in the present invention means non-random association of alleles in two or more loci that are not necessarily on the same chromosome in population genetics. do. In other words, linkage disequilibrium is a measure of binding between alleles at different positions, and if each gene is combined completely independently, the gene set will probably maintain linkage equilibrium, but some alleles are found together There are many examples, that is, they are not randomly shuffled, and these alleles are in linkage disequilibrium. This linkage disequilibrium is interpreted as a result of natural selection when alleles are located close to each other or alleles are clustered together.

In addition, the present invention relates to a kit for determining a cow's marbling index comprising the composition for determining the marbling index of the cow.

The composition may have the characteristics as described above. In one example, the composition is a single nucleotide polymorphism (SNP) in which the 101st base is A or G in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1;

SNP in which the 101st base is G or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;

SNP in which the 101st base is T or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;

SNP in which the 101st base is C or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;

SNP in which the 101st base is T or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;

SNP in which the 101st base is C or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; And

In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, the 101st base may be one that contains an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs of G or A.

In addition, an agent capable of detecting or amplifying the polynucleotide is an agent capable of specifically recognizing and binding to an SNP-containing site in a polynucleotide, or specifically, an agent capable of amplifying a site containing the SNP. May be a probe capable of specifically binding to the site containing the SNP, a polynucleotide containing the site containing the SNP, or a primer capable of specifically amplifying a complementary polynucleotide thereof.

The kit may be a PCR kit, a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can be confirmed by amplifying the genotype of the SNP marker provided by the present invention using the composition. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, RT-PCR kits include tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), in addition to specific primer pairs for polynucleotides or complementary polynucleotides containing the SNP-containing site. , Enzymes such as deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water. Meanwhile, the components included in the kit may be manufactured in a liquid form, or may be manufactured in a dried form in order to improve the stability of the product by lowering the degrees of freedom of the components. In order to manufacture the dried form, application of a drying step is necessary, and at this time, heating, natural drying, vacuum drying, freeze drying, or a combination process thereof may be used.

In the present invention, when applied to a PCR amplification process, "kit" is, optionally, a reagent required for PCR amplification, such as a buffer, DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermally stable DNA polymerase obtained from Thermisflavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit can be made of a number of separate packaging or compartments containing the reagent components described above.

In addition, the present invention is 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of the sample isolated from cattle, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, and Amplifying a site comprising the SNP of any one or more polynucleotides or complementary polynucleotides selected from the group consisting of polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 8,

The SNP is the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 1, the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3 , Base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the sequence Step 101, which is the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, or the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; And 2) determining the base type of the SNP at the site containing the amplified SNP.

The step of amplifying the site containing the SNP of step 1) may be any method known to those skilled in the art. For example, it can be obtained by amplifying and purifying the target nucleic acid through PCR. Other ligase chain reactions (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), autologous sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA) can be used.

The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) is sequencing, hybridization by microarray, allele specific PCR, dynamic allele hybridization technique (dynamic allelespecifichybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis) It can be, but is not limited to.

In the method for determining the cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 is A or G, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining a cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 2 is G or T, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining the cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 is G or A, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining a cow's marbling index of the present invention, when the 101st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is T or C, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining a cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5 is C or A, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining the cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6 is T or A, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining the cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7 is C or T, it can be determined that the cow's marbling index or marbling index grade is excellent.

In the method for determining the cow's marbling index of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 8 is G or A, it can be determined that the cow's marbling index or marbling index grade is excellent.

Further, in the present invention, when the marbling index or marbling index grade of cattle is excellent, it can be determined as high-quality meat.

In one embodiment of the present invention, the present inventors conducted a GWAS analysis of 15,489,195 single base polymorphic markers among 25,676,502 single base polymorphic (SNP) markers present in the Illumina 50K SNP Chip (N=4,887) data in 5223 Korean cattle. Eight SNP markers highly related to the marbling index were selected and confirmed to be significant (see Examples, Tables 1 and 2).

Therefore, when using a composition for discriminating a cow's marbling index, which includes an agent capable of detecting or amplifying the SNP of the present invention, the cow's marbling index trait can be accurately determined, and furthermore, high-quality meat can be easily and accurately determined. .

Hereinafter, the present invention will be described in detail by examples.

However, the following examples illustrate the present invention, and the contents of the present invention are not limited by the examples.

Example: Korean cattle marbling index SNP marker screening

Of the 25,676,502 single-base polymorphism (SNP) markers present in the total-genome sequencing of 2,108 Korean cattle, 15,489,195 were passed the criteria of MAF value of 0.01 or higher, MWE value of 0.001 or higher, and R2 of 0.4 or higher. Single base polymorphism (SNP) markers were used for GWAS analysis.

Specifically, in order to select the Hanwoo marbling index SNP markers related to the Hanwoo marbling index trait, the 15,489,195 single base polymorphism (SNP) markers were analyzed using the analysis model of Equation 1 below, followed by a full-length genome linkage analysis based on next-generation base sequence Wide Association Study (GWAS) was conducted.

[Equation 1]

y = Xb + Zq + Wg + e

In the analysis model equation, y is a phenotype observation vector for an individual, X is a vector for a fixed effect (test order), b is an estimate vector for a fixed effect, Z is a random effect vector for an individual, q is a genotype for QTL Vector for fixed effect (fixed effect), g for additive genetic effect for marker effect, e for random error

Significance of the association between the Korean native marbling index trait and the 15,489,195 single nucleotide polymorphism (SNP) markers using a mixed linear model based association analysis (MLMA) and a restricted maximum likelihood (REML) analysis method. At this time, it was corrected by adding gender and slaughter age, which have a large effect on the Korean beef marbling index phenotype, as covariates.

The statistical software of GCTA (version 1.91, https://cnsgenomics.com/software/gcta/#Overview) was used to verify the significance of each selected Korean beef marbling index SNP marker according to the trait. It was provided by the Central Association of Korean Beef Improvement. Significant Korean beef marbling index SNP markers for each trait were screened for a -log ₁₀ P-value value of 6 or higher through a significance test.

As a result, the eight Korean beef marbling index SNP markers having the highest significance (SEQ ID NOs: 1 to 8) were selected (FIG. 1). The selected Korean cattle marbling index SNP marker showed a high significance (P-value, -log ₁₀ P-value, %Vg) with the Korean cattle marbling index trait (Table 1).

SNP ID chromosome location MAF Genetic position
(Allele) P-value -log ₁₀ P-value %Vg (genetic dispersion effect) rs43287038 2 4758180 0.017 A/G 0.000000106 6.974694 3.4 rs136995876 2 4760585 0.017 G/T 0.000000106 6.974694 3.4 rs208621284 12 23378178 0.045 G/A 0.000000117 6.931814 3.68 rs210129449 12 23375305 0.037 T/C 0.000000364 6.438899 3.66 18:41255529 18 41255529 0.012 C/A 0.0000000282 7.549751 3.13 18:41255530 18 41255530 0.012 T/A 0.0000000282 7.549751 3.13 rs134591476 24 2300986 0.09 C/T 0.000000264 6.578396 3.13 rs209257241 24 2251894 0.029 G/A 0.000000509 6.293282 2.66

The base sequence of the Hanwoo marbling index SNP marker for preparing the selected Hanwoo marbling index SNP chip is described in SEQ ID NOs: 1 to 8 (Table 2).

SNP ID Sequence Sequence number rs43287038 ACCCCCATCTGGCGTCTCTGGCATCTCTGCATTTGGCACATAGAGCTGAGGTGTTTACGGGGCCATTTCTTCCCAGGAGCTCTGCTCTGAAGTGCGGGGC[A/G]TGAGGCCTCTGCCCGTGACCTTCTGTGAGCCAGTGAAACTAGACAAGGCACCAAGAGGGGAAAAGGCTGCTGACTTT One rs136995876 TTTGTTTTTTTTTTAATGGATTGTGCTTTTGGTATCACATCTCAGAAACCTTTGTCTAATACAAGGTCCCCCCAATTTTTTCTGATGTTTGGTTCTAGAA[C/T]TTGTATAGTATTAGCACTTACATTTAAGTCTATGATCCATCTTGAGTTAGTTTTTGATTAATGTGTAAGGTAGTGACTTTATTTA 2 rs208621284 TTCTTAGGAAAAGGATGAAGCGATGCTTTATGTCTCTAGAAGTGTGAAGGGGAAAGTTTTACCCATAATTTTAAGTGCTTCAAACTGCTACAAATGGCCC[G/A]AAGAAAAGAGGTTTGTTTAGTTTTAGCTACACTTTATAATCCTAACATACATTATCATTGTGATCTTTGTAGCACAGTGTAT 3 rs210129449 ATCCCACATGCCACAACTAAGACCCAGTGCAGTCAAATAAATACAAATAAAAAAGAAGGCAACGGCAGGGCACGTGTGCTATGCCAAGGGGTTGGAAGCT[T/C]ACCCCAGAAGTTATCCCATAACAAGTGGGTTCAGTTTCAAGAAGGGGAGGGATGTGATGAAACATGCATGTACGGGGAT 4 18:41255529 CGCGGTCACACTTTACACACCATTCCATAATGGATTTTCATGTTTGTGAATCCTAACTGGCTGTGGAAATGAAAAGCAAATGTCTCATAATCACAGATAT[C/A]TTCTGGGTTGTTTTTTTTTTTTCTAAACCCAAAGATTAAATCAACTTTACCCCTCATTTGCCAGCAAGTTCATGGTTATAGAGATGAT 5 18:41255530 GCGGTCACACTTTACACACCATTCCATAATGGATTTTCATGTTTGTGAATCCTAACTGGCTGTGGAAATGAAAAGCAAATGTCTCATAATCACAGATATC[T/A]TCTGGGTTGTTTTTTTTTTTTCTAAACCCAAAGATTAAATCAACTTTACCCCTCATTTGCCAGCAAGTTCATGGTTATAGAAGGATGATA 6 rs134591476 CAACTTACATTTTCCTTTCAGGCTGAAATTGTACTGTGGCAAGGTGAATGACAAGACACGCTGACCAAAAGCATTTTCCCTTTTGAAATAACCAAATACA[C/T]ATATTCATGTAGCCACAACCACAGTGATGAAATGCTAGAGCAATTTCAGAGAGAACATTCGATCACAAGCAGAGTAAAGGTCATGT 7 rs209257241 CACAGGTTTCACTTTTGCAGTAGACCATCTAAGGGAAGTAAGAACCTGGATGCTTTCCATGACTTCACGGTGGCATCACGGTGGCACACCCTGACAACAC[G/A]CCACAGACAGAGCGGCGCCTTCTCCTTGGGGCCTTTCCCAAGGAAAAGCACTCCACGTCCCCAGTATCCCCGTC 8

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for determining the marbling index of a bovine including an agent capable of detecting or amplifying SNP <130> 2018P-12-016 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #1 <400> 1 acccccatct ggcgtctctg gcatctctgc atttggcaca tagagctgag gtgtttacgg 60 ggccatttct tcccaggagc tctgctctga agtgcggggc agtgaggcct ctgcccgtga 120 ccttctgtga gccagtgaaa ctagacaagg caccaagagg ggaaaaggct cagaaatttg 180 agcccctctt attgctctgt tg 202 <210> 2 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #2 <400> 2 tttgtttttt ttttaatgga ttgtgctttt ggtatcacat ctcagaaacc tttgtctaat 60 acaaggtccc cccaattttt tctgatgttt ggttctagaa ctttgtatag tattagcact 120 tacatttaag tctatgatcc atcttgagtt agtttttgat taatgtgtaa ggtagtgact 180 ttatttttat ggcagtaata ca 202 <210> 3 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #3 <400> 3 ttcttaggaa aaggatgaag cgatgcttta tgtctctaga agtgtgaagg ggaaagtttt 60 acccataatt ttaagtgctt caaactgcta caaatggccc gaaagaaaag aggtttgttt 120 agttttagct acactttata atcctaacat acattatcat tgtgatcttt gtagcacaat 180 gtagctcgct ggttttatca aa 202 <210> 4 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #4 <400> 4 atcccacatg ccacaactaa gacccagtgc agtcaaataa atacaaataa aaaagaaggc 60 aacggcaggg cacgtgtgct atgccaaggg gttggaagct tcaccccaga agttatccca 120 taacaagtgg gttcagtttc aagaagggga gggatgtgat gaaacatgca tgtacagggt 180 ctagaggatg gatgcccatg gc 202 <210> 5 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #5 <400> 5 cgcggtcaca ctttacacac cattccataa tggattttca tgtttgtgaa tcctaactgg 60 ctgtggaaat gaaaagcaaa tgtctcataa tcacagatat cattctgggt tgtttttttt 120 ttttctaaac ccaaagatta aatcaacttt acccctcatt tgccagcaag ttcatggtta 180 tagaaggatg ataaatgatt gg 202 <210> 6 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #6 <400> 6 gcggtcacac tttacacacc attccataat ggattttcat gtttgtgaat cctaactggc 60 tgtggaaatg aaaagcaaat gtctcataat cacagatatc tatctgggtt gttttttttt 120 tttctaaacc caaagattaa atcaacttta cccctcattt gccagcaagt tcatggttat 180 agaaggatga taaatgattg gg 202 <210> 7 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #7 <400> 7 caacttacat tttcctttca ggctgaaatt gtactgtggc aaggtgaatg acaagacacg 60 ctgaccaaaa gcattttccc ttttgaaata accaaataca ctatattcat gtagccacaa 120 ccacagtgat gaaatgctag agcaatttca gagagaacat tcgatcacaa gcagagtaaa 180 gcctctgttt gggtttgatg at 202 <210> 8 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> #8 <400> 8 cacaggtttc acttttgcag tagaccatct aagggaagta agaacctgga tgctttccat 60 gacttcacgg tggcatcacg gtggcacacc ctgacaacac gaccacagac agagcggcgc 120 cttctccttg gggcctttcc caaggaaaag cactccacgt ccccagtatc ccatggacgc 180 cctcccctct ctgtcccctg at 202

Claims (8)

Single nucleotide polymorphism (SNP) in which the 101st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
SNP in which the 101st base is G or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;
SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
SNP in which the 101st base is T or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP in which the 101st base is C or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;
SNP in which the 101st base is T or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;
SNP in which the 101st base is C or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; And
A composition for discriminating bovine marbling index, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 .
The method of claim 1, wherein the cattle are Korean cattle, a composition for discrimination of cattle.
The composition of claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
A kit for determining the marbling index of a cow, comprising the composition of claim 1.
The kit according to claim 4, wherein the cattle are Korean cattle.
1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of a sample isolated from cattle, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 A polynucleotide composed of a nucleotide sequence of SEQ ID NO: 5, a polynucleotide composed of a nucleotide sequence of SEQ ID NO: 6, a polynucleotide composed of a nucleotide sequence of SEQ ID NO: 7, and a base of SEQ ID NO: 8 Amplifying a region comprising the SNP of any one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences or complementary polynucleotides thereof,
The SNP is the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 1, the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3 , Base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the sequence Step 101, which is the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, or 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; And
2) determining the base type of the SNP at the site containing the amplified SNP, the method of discriminating bovine marbling index.
The method of claim 6, wherein the cattle are Korean cattle.
The method according to claim 6, wherein the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A or G,
When the base 101, which is the SNP of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, is G or T,
When the base 101 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 is G or A,
When the base 101 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 4 is T or C,
When the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is C or A,
When the base 101, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, is T or A,
When the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T, or
A method of discriminating a cow's marbling index when the base 101, which is the SNP of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 8, is G or A.

Images