KR20130055826A - Single nucleotide polymorphism marker for diagnosis of economic traits in cattle and method of diagnosing economic traits in cattle using the same marker - Google Patents

Abstract

PURPOSE: An SNP(single nucleotide polymorphism) marker for diagnosing economic traits of Hanwoo(Korean beef) is provided to improve economic traits of beef, to produce high quality beef, and to enable consumers to enjoy high quality beef. CONSTITUTION: An SNP marker for diagnosing economic traits of beef contains a polynucleotide containing 421th nucleotide of sequence number 1 or a complementary polynucleotide thereof. The economic traits are selected from a group consisting of marbling score, backfat thickness, carcass weight, and unsaturated fatty acid content. The genotype of 421th nucleotide is CC. A method for diagnosing economic traits of beef comprises a step of identifying genotype of 421th nucleotide.

Description

Single Nucleotide Polymorphism Marker for Diagnosis of Economic traits in Cattle and Method of Diagnosing Economic traits in Cattle Using the Same Marker}

The present invention relates to a polymorphic marker for diagnosing small economy and a method for diagnosing small economy using the same.

In general, the traditional approach to improving livestock genetic capacity is to use selection and mating systems repeatedly. However, the current Hanwoo breeding system based on traditional selection breeding has been pointed out as a big problem in improving the economic competitiveness of the high quality meat because of the slow speed and quality improvement of meat quality for producing high quality beef. In addition, the conventional statistical breeding method takes a very long time and requires a lot of expense and effort to obtain phenotypic information on the main economic traits through the subsequent test or ability test. In the case of large livestock like Hanwoo, the average generation interval is long and the number of livestocks is low, so the selection intensity is low. Therefore, the rate of genetic change is slow and the amount of genetic improvement is insufficient. . In particular, in the case of economic traits such as meat quality, relevant information and data can be obtained after the slaughter of the individual, and there is a clear limitation in the existing methods.

However, when searching for and discovering useful genes and DNA markers affecting the major economic traits of Hanwoo and using them in breeding and improving business, the genetic improvement is maximized and improved by improving selection accuracy, increasing selection strength and shortening generation intervals. The speed can be accelerated for more efficient and economical breeding. Recent developments in genetic engineering and genetic analysis have made it possible to access molecular breeding advanced technologies and information directly to livestock breeding, thus enabling new breeding methods.

In general, the quality of beef is determined by intramuscular fat, flesh color, fat color and texture, and these factors have been reported to be closely related to the year, juiciness, flavor, etc. (Lee et al., 1994; Monson et al. 2005; Robins et al., 2003; Vander Wal et al., 1997). In addition, the unique flavor of beef is known to affect the content of unsaturated fatty acids (Dryden and Marchello, 1970; Jeremiah, 1996; Melton et al., 1982; Studivant and Lunt et al., 1992). In particular, oleic acid (C18: 1), which is known for its high content of oleic acid (Chung et al., 2007; May et al., 1993; Oka et al., 2002), accounts for more than 80% of mono-unsaturated fatty acids. It has also been proven to be a factor in determining the flavors of (Dryden and Marchello, 1970; Tsuji, 2008; Yoshimura and Namikawa, 1983).

The present invention is to provide a polymorphism diagnostic small polymorphism (SNP) marker consisting of a polynucleotide comprising a 421 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof.

In addition, the present invention is to provide a diagnostic method and kit for diagnosis of small economy using the marker.

The present invention provides a polymorphism diagnostic polymorphism (SNP) marker consisting of a polynucleotide comprising the 421 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof.

The economic features may be one or more traits selected from the group consisting of intramuscular fatness, backfat thickness, carcass weight, and content of unsaturated fatty acids.

The cattle may be Korean cattle.

Genotype 421 of the nucleotide of SEQ ID NO: 1 may be CC.

The present invention provides a method for diagnosing small economic traits comprising the step of identifying the genotype of the 421 th nucleotide of SEQ ID NO: 1.

The economic method of diagnosis,

(1) obtaining a DNA sample from the individual; And

(2) PCR is performed using the DNA obtained from step (1) as a template, including one or more primers selected from the group consisting of SEQ ID NOs: 2 to 4, and the 421th nucleotide of SEQ ID NO: 1 from the PCR result. Identifying the genotype; may include.

The small economic genotype can be diagnosed as a cow having excellent economic traits in the order of TT genotype <CT genotype <CC genotype, genotype 421 nucleotide of SEQ ID NO: 1.

The present invention provides a kit for diagnosing small economic traits comprising a primer capable of amplifying a polynucleotide or a complementary polynucleotide thereof comprising the 421 th nucleotide of SEQ ID NO: 1.

The primer may include one or more selected from the group consisting of SEQ ID NOs: 2 to 4.

The polynucleotide comprising the 421th nucleotide of SEQ ID NO: 1 of the present invention or its complementary polynucleotide can diagnose the economic traits of cattle, especially Korean cattle, such as intramuscular fat, backfat thickness, carcass weight, or unsaturated fatty acid content. As a polymorphic (SNP) marker, it is possible to make early selection regardless of age and gender by using MAS molecular selection sarcoma technology by label genes, which can shorten generation intervals and increase the accuracy of selection. In addition, it is possible to improve the quality of cattle and improve the economic traits of cattle because they can increase the selection strength and plan cross-border, thereby not only contributing to the production of high-quality breeders and increasing the income of small farmers, but also to provide consumers with high-quality beef.

1 is a diagram showing SEQ ID NO: 1 of the present invention comprising g.3977-325 T> C SNP.

The present invention provides a polymorphism (SNP) diagnostic polymorphism (SNP) marker consisting of a polynucleotide or a complementary polynucleotide comprising the 421th nucleotide of SEQ ID NO: 1, a diagnostic method and a diagnostic kit using the same.

Hereinafter, the present invention will be described in detail.

The present invention enables the early selection regardless of age and gender when using for the development of high-quality cattle line selection of cows to shorten the interval between generations, increase the accuracy and strength of selection, and to select the DNA markers related to the economic traits of cattle to enable the planning crossbreeding. While trying to develop, when using the polymorphism diagnostic (SNP) marker of the present invention, it is possible to find a delicious, meaty, high economic value cow with excellent intramuscular fat, backfat thickness, carcass weight or unsaturated fatty acid content early. It was confirmed that the above object can be achieved and completed the present invention.

The present invention provides a polymorphism diagnostic polymorphism (SNP) marker consisting of a polynucleotide comprising the 421 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof.

The polymorphism (single nucleotide polymorphism; SNP) may be a genetic change or variation showing one nucleotide sequence difference in a DNA sequence of an organism, which is two or more frequencies of 1% or more in one biogroup. It can refer to the location where bi-allelic occurs.

The breed of cow is not particularly limited, but may be preferably Korean cattle.

The polymorphic SNP variation in the polynucleotide comprising the 421 th nucleotide of SEQ ID NO: 1 can also be described by expressing g.3977-325 T> C or g.3977-325 Y.

SEQ ID NO: 1 is a polynucleotide containing g.3977-325 T> C, which is an SNP located in a fatty acid binding protein 4 (FABP4) gene, and unsaturated fatty acids, intramuscular fat and back fat thickness that affect taste in beef. In other words, it may have a strong relationship with the carcass weight.

As shown in Example 1, the genotype frequency of g.3977-325 T> C SNP of SEQ ID NO: 1 can be confirmed polymorphism from the estimate of the heterozygote of 0.480, the minor allele frequency is also higher than 0.100, 0.164 From the point of view, the separation is well separated from the related inequality, which increases the accuracy of the analysis.

In the present invention, the economic trait may include one or more traits selected from the group consisting of intramuscular fat value, backfat thickness, carcass weight, unsaturated fatty acid, meat color, fat color, and texture among numerous traits that livestock have. Preferably, it may include one or more traits selected from the group consisting of intramuscular fat degree, back fat thickness, carcass weight, and content of unsaturated fatty acid.

G.3977-325 T> C of SEQ ID NO: 1, the SNP marker, has the highest intramuscular fat and carcass weight, the lowest back fat thickness, and the oleic acid that affects the taste and quality of beef. The high content of unsaturated fatty acids such as C18; 1) and monounsaturated fatty acids can be regarded as cows with the best economic traits.The CC genotype is superior to other genotypes, and the TT genotype is lower than other genotypes in economic traits. can confirm.

Accordingly, the present invention can provide a marker having a polymorphism (SNP) marker for diagnosing a cow having excellent economic trait, wherein the genotype of the 421th nucleotide of SEQ ID NO: 1 is CC.

Beef grades are classified into meat grades and meat grades. Meat grades are judged as 1 ++, 1+, 1, 2, and 3 grades based on intramuscular fat, meat color, fat color, texture, and maturity. It is a standard for consumers to select meat, and the meat grade can be judged as A, B, C, and D grades by combining the carcass weight, backfat thickness, and fillet cross section. However, as shown in Example 3, the economic trait has a high significance between unsaturated fatty acids such as oleic acid and monounsaturated fatty acid, and the higher the grade of meat, the higher the content of unsaturated fatty acid.

In the CC genotype group of the present invention, it can be confirmed that the higher grade ¹⁺ grade ratio is 80.10%, and thus, the marker of the present invention is appropriate for the determination of economic traits. Therefore, g.3977-325 T> C SNP can be used as a measure of economic traits such as unsaturated fatty acids and intramuscular fatty acids that determine the taste of beef.

The present invention provides a method for diagnosing small economic traits comprising the step of identifying the genotype of the 421 th nucleotide of SEQ ID NO: 1.

The method of diagnosis of economic traits can be diagnosed by confirming the genotype of the 421th nucleotide of SEQ ID NO: 1 and predicting the economic traits of cattle such as intramuscular fat, backfat thickness, carcass weight, or unsaturated fatty acid content in advance. have.

The method for diagnosing small economic traits of the present invention,

(1) obtaining a DNA sample from the individual; And

(2) PCR is performed using the DNA obtained from step (1) as a template, including one or more primers selected from the group consisting of SEQ ID NOs: 2 to 4, and the 421th nucleotide of SEQ ID NO: 1 from the PCR result. Identifying the genotype of; may include.

The breed of cow is not particularly limited, but may be preferably Korean cattle.

The site from which the DNA sample is obtained is not particularly limited, and, for example, can be obtained from muscles, epidermis, blood, bones, organs, and preferably from muscles or blood.

As an example of the invention, when the starting material is gDNA, isolation of the gDNA can be carried out according to a conventional method known in the art (Refer to Rogers & Bendich (1994)), and if the starting material is mRNA reverse transcriptase It can be synthesized into cDNA using.

Primers that can be used in the present invention is a primer capable of amplifying a polynucleotide including the 421 th nucleotide of SEQ ID NO: 1 is not particularly limited in kind, for example, SEQ ID NO: 2 (Foward sequence: TTTCCCTCCATCATTGTAATCACTT), SEQ ID NO: 3 ( Reverse sequence: CACATTCCTAGGCACAAAAGCA) and SEQ ID NO: 4 (Extension sequence: CTTGAGGCCAAGTCTTGTAT).

PCR is a reagent required for PCR amplification in a manner conventional in the art, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermisflavus , Thermococcus literalis or Pyrococcus heat stable DNA polymerase obtained from furiosus (Pfu), and / or dNTPs.

The method for identifying the genotype can be carried out by applying various methods known in the art, for example, fluorescence in situ hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand confer Analysis (SSCA, Orita et al., PNAS, USA 86: 2776 (1989)), RNase protection assay (Finkelstein et al., Genomics, 7: 167 (1990)), dot blot analysis, denaturation gradient gel electrophoresis ( DGGE, Wartell et al., Nucl. Acids Res., 18: 2699 (1990)), methods using proteins that recognize nucleotide mismatches (eg, mutS proteins of E. coli) (Modrich, Ann. Rev. Genet. 25: 229-253 (1991)), restriction fragment length polymorphism (RFLP) analysis, heteroduplex analysis, single strand conformational polymorphism (SSCP), Techman It may include a Taqman probe method or PCR, but is not limited thereto. The.

In one embodiment of the present invention, according to the method of PCR-RFLP using the SNP position, a specific nucleotide sequence including the selected SNP site, for example, a nucleotide sequence including 3 to 6 nucleotides including the SNP is specific. By processing the restriction enzyme recognized by the genotype can be determined from the result obtained at this time it may be possible to distinguish the economic traits of cattle based on this. Restriction enzymes can be used by selecting one or more types that specifically recognize a specific nucleotide sequence site, and is not limited to a specific type, and the specific types of restriction enzymes that can be used are commercially available from various companies. It is open.

In the present invention, the economic trait may include one or more traits selected from the group consisting of intramuscular fatness, backfat thickness, carcass weight, unsaturated fatty acid, meat color, fat color, and texture among numerous traits possessed by cattle. Preferably, it may include one or more traits selected from the group consisting of intramuscular fat degree, back fat thickness, carcass weight, and content of unsaturated fatty acid.

The economic trait diagnosis of the cow can be diagnosed by the method of predicting the intramuscular fat degree, the back fat thickness, the carcass weight, or the content of unsaturated fatty acid by checking the genotype.

As shown in Table 3, carcass weight, intramuscular fatty acid and unsaturated fatty acid (oleic acid, monounsaturated fatty acid) were the highest in individuals with CC genotype, and were the highest, followed by CT genotype and TT genotype. It can be seen that individuals with the CC genotype are the lowest formed and increase in the order of CT genotype and TT genotype.

Therefore, the small economy in the present invention can be diagnosed as a cow of excellent economic quality in the order of genotype 421 nucleotide of SEQ ID NO: 1 TT genotype <CT genotype <CC genotype.

The present invention provides a kit for diagnosing small economic traits comprising a primer capable of amplifying a polynucleotide or a complementary polynucleotide thereof comprising the 421 th nucleotide of SEQ ID NO: 1.

When the kit of the present invention is subjected to a PCR amplification process, the kit of the present invention may optionally contain reagents for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermisflavus , Thermococcus literalis or Pyrococcus heat stable DNA polymerase obtained from furiosus (Pfu)) and / or dNTPs.

The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

Primers that can be used in the present invention is a primer capable of amplifying a polynucleotide including the 421 th nucleotide of SEQ ID NO: 1 is not particularly limited in kind, for example, SEQ ID NO: 2 (Foward sequence: TTTCCCTCCATCATTGTAATCACTT), SEQ ID NO: 3 ( Reverse sequence: CACATTCCTAGGCACAAAAGCA) and SEQ ID NO: 4 (Extension sequence: CTTGAGGCCAAGTCTTGTAT) may include one or more selected from the group consisting of.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> In the FABP4 gene  Associated with beef flavor SNP  selection

For fatty acid analysis, about 500 g of sirloin tissues were collected from 513 cows and crushed into small pieces, and then each of 4-5 g was used for chloroform (methanol) (2: 1) by Folch method (Folch et al. 5 ml was added, pulverized and extracted for 2 to 3 minutes at 11,000 rpm using a homogenizer (Polytron PT-MR-2100, Switzerland), and filtered using a filter paper in a water bath (40 ° C.). After the filtrate was mixed with distilled water, the methanol and water layers were removed, the chloroform and lipid layers were removed using nitrogen gas, and then treated with BF3-meathanol (14%) and transmethylated at 65 ° C for analysis. Total fatty acid composition analysis was performed using gas chromatography (Per-Elmer CO, USA). In this study, ANP PRISM SNaPshot ^TM MultiplexKit (AppliedBiosystems, FosterCity, CA) using SBE (single-based extension, Vreeland et al., 2002) was used.

Then, genomic DNA extraction was performed by using a vacuum syringe (Becton dickinson, USA) containing an anticoagulant (0.5M EDTA) to collect about 5 ~ 10ml of blood. The collected blood was transferred to a 50ml falcon tube and added about 40ml of 0.2% NaCl solution, hemolyzed, centrifuged at 2,000rpm for 10 minutes for leukocyte extraction, and the leukocyte precipitated in the centrifuged solution. 15 ml was removed. 1,000 μl of 0.16 M NaCl / 1 mM EDTA was added to break the cell membrane, and 15 ml of a surfactant (0.5% N-lauroylsarconsine sodium salt, 10 mM Tris-HCl pH8.0, 10 mM EDTA) was added to elute the DNA in the nucleus. Proteinase K (Proteinase K; 10mg / ml, Promega Co. USA), a protease, was removed to remove the proteins in the membrane and DNA. Incubated at 12 ° C. for 12 hours. After incubation, add the same amount of TE (Tri-EDTA): phenol (1: 1) and shake slowly at 20 minute intervals for 2 hours. The same amount of phenol (Phenol): chloroform (Chloroform): iso-amylalchol (25: 24: 1) was added and centrifuged at 3,000 rpm for 10 minutes, and the DNA aqueous solution layer was again collected. 2 volumes of ethyl ether were added and the solution was shaken until the white DNA solution layer became transparent, and then centrifuged at 3,000 rpm for 5 minutes, and ethyl ether was removed by volatilization. 3M sodium acetate (pH 5.2) was added to 1/10 times the total volume, 100% ethanol was added to condense DNA, and 70% ethanol was added to about 20ml to wash the DNA. After ethanol was completely removed, TE (10 mM Tris-HCl pH8.0, 1 mM EDTA) was added in about 1 to 2 ml to dissolve DNA and stored at 4 ° C.

ABI PRISM SNaPshot ^TM for single base extension (SBE) reactions MultiplexKit (Applied Biosystems, Foster City, CA) was used and the conditions were as follows. For 1st PCR reaction, add 20ng genomic DNA, 0.25U Taq polymerase (Solgent Co., Ltd, south korea), 1x buffer, 0.2mM dNTP, 5pmol primer (forward / reverse) to make 15µl total and mix After 1 cycle at 94 ° C. for 5 minutes, 30 cycles at 94 ° C., 30 seconds at synthesis temperature, and 3 cycles at 72 ° C. were carried out for 35 cycles and 1 cycle at 72 ° C. for 3 minutes. 1 μl of the resulting PCR product was electrophoresed to confirm the product. 5U SAP (Shrimp alkaline phosphatase) and 2U Exo I (Exonuclease I, E. coli ) were added to the PCR product, mixed well, and reacted at 37 ° C for 1 hour. After the reaction was completed, the mixture was inactivated at 75 DEG C for 15 minutes. Mix 1 ul of the prepared PCR product with 0.25 Gene of GeneScan-120 LIZ size standard (Applied Biosystems, Foster City, CA) and 9.5 Hi of Hi-Di formamide (Applied Biosystems, Foster City, CA). After 5 minutes of degeneration at ABI PRISM 3130xL Genetic Analyzer was subjected to electrophoresis. The electrophoretic PCR product was analyzed automatically by inputting data into GeneMapper v4.0 software (Applied Biosystems, Foster City, CA).

As a result of confirming the polymorphism of the three SNPs through this method, the polymorphism was confirmed only in one SNP, and the information on each SNP is shown in Table 1 below.

SNP Gene BTA Sequences TM Product you g.2213 + 1439 G> A NC_007312.4 14 F ¹ AGGAGGAAAGCCATTCCATT 60 285 R ² TGGAATAGCATCATAGGGGTTT E ³ TAGAGAACTTTTAAAAGAGT g.3318 + 334 G> C NC_007312.4 14 F TTGATGCCTAAGCCCTCTTT 60 352 R GAGAGCAGCCAGCTTCATTT E ATTATGAAAAGCCAAGAAAA g.3977-325 T> C NC_007312.4 14 F TTTCCCTCCATCATTGTAATCACTT 60 567 R CACATTCCTAGGCACAAAAGCA E CTTGAGGCCAAGTCTTGTAT

¹ forward primer sequence, ² Reverse primer sequence, ³ Extension primer sequence

The genotype frequency of g.3977-325 T> C SNP was similar to that of Mendel's theory of separation, and polymorphism was confirmed in the heterozygote of 0.480, and the minor allele frequency was 0.264, higher than 0.100. The accuracy of the analysis could be increased.

SNP Region Genotype (No. of head) H ¹ MAF ² HWE ³ Frequency g.2213 + 1439 G> A Intron AA (O) AG (0) GG (44) N ⁴ (44) 0.000 0.000 0.000 0.000 0.000 1,000 One g.3318 + 334 G> C Intron CC (44) CG (0) GG (0) N (44) 0.000 0.000 0.000 1,000 0.000 0.000 One g.3977-325 T> C Intron CC (18) CT (18) TT (9) N (44) 0.480 0.404 0.264 0.400 0.400 0.200 One

¹ Heterozygosity, ² Minor allele Frequency, ³ P value for deviation of genotype distribution from Hardy-Weinberg equilibrium, ⁴ Total number

< Example  2> FABP4  Single genotype and Hanwoo beef taste and Economic trait  Association analysis

The experimental animals used in the present invention were casters from 14 city and county units in Gyeongbuk province, and each of 513 genomic DNA samples and capability data shipped in 26 ~ 33 months according to the specification of the Hanwoo Cattle Co., Ltd. The fatty acid composition for the subject was used. In addition, the sirloin tissues of Hanwoo were incised from the longest part of thoracic vertebrae 13 and lumbar spine no. 38 and each tissue was stored at -80 ℃ after removing myocardial fat.

In order to analyze the correlation between economic traits and fatty acid composition of Korean cattle, and candidate SNPs, The traits of backfat thickness and carcass weight were analyzed. Intramuscular fat was determined by comparing the degree of fat distribution in the longest section of the abdominal muscle on the grading panel, and the back fat thickness was measured in the back fat at the point 2/3 of the abdomen along the right side of the abdominal longest section. Measured in units. In addition, the fatty acid composition was measured in the form of saturated fatty acids, myristic acid (C14: 0), palmitic acid (C16: 0), and stearic acid (C18: 0). Myoleoleic acid (C14: 1), palmitolecin (C16: 1), and oleic acid (C18: 1), a type of mono-unsaturated fatty acid that is formed, linoleic Ikic acid (C18: 2n6) and linolenic acid (C18: 3n3), one of omega-3 fatty acids, were measured.

In addition, to verify the efficiency of the SNP markers and to see how reliable they are when applied to the entire Korean cattle, using candidate SNPs, the least-squares mean value of each trait was calculated. Using SPSS v19.0, Statistical analysis was performed for covariance analysis and significance test.

Yijk = μ + Pi + SNP _j + βage _k + e _ijk

(Where, Yijl = phenotypic values (economic and fatty acid content), μ = individual population, P _i = fixed effect in Gyeongsangbuk-do region, SNP _j = fixed effect of SNP marker, βage _k = slaughter age, eijk = random error)

Then, based on the results of applying to 513 farmers managed by Chamhan Hanwoo Co., Ltd., the least squares means was determined by considering the environmental factors such as SNP type, abdomen information, age, and place for each trait. This recognized result is shown in Table 3.

Trait g.3977-325 T> C CC CT TT Total (N = 80) (N = 265) (N = 168) (N = 513) LSmean ± SE LSmean ± SE LSmean ± SE LSmean ± SE Carcass weight (kg) 432.59 ± 4.33 426.42 ± 2.62 426.01 ± 3.46 427.25 ± 1.91 ns Backfat thickness (cm) 12.06 ± 0.51 ^a 13.06 ± 0.31 ^ab 14.01 ± 0.41 ^b 13.22 + - 0.22 * MS (marbling score) 6.43 ± 0.17 ^c 5.43 ± 0.11 ^b 4.95 ± 0.15 ^a 5.43 + 0.08 *** Fatty acid composition (%) C14: 0 3.16 ± 0.08 ^a 3.70 ± 0.03 ^b 3.76 ± 0.04 ^b 3.63 ± 0.02 *** C16: 0 24.35 ± 0.23 ^a 25.87 ± 0.11 ^b 25.93 ± 0.14 ^b 25.65 + 0.08 *** C18: 0 10.21 ± 0.16 10.59 ± 0.08 10.45 ± 0.10 10.48 ± 0.06 ns C14: 1 1.29 ± 0.04 1.23 + 0.02 1.24 ± 0.03 1.24 ± 0.01 ns C16: 1 6.59 ± 0.11 6.56 ± 0.06 6.70 ± 0.07 6.61 + 0.04 ns C18: 1 47.06 ± 0.29 ^b 43.99 ± 0.14 ^a 43.47 ± 0.18 ^a 44.30 ± 0.11 *** C18: 2n6 2.59 ± 0.09 ^a 3.06 ± 0.04 ^b 3.16 ± 0.05 ^b 3.02 ± 0.03 *** C18: 3n3 0.48 ± 0.02 ^b 0.33 ± 0.01 ^a 0.32 ± 0.01 ^a 0.35 ± 0.01 *** SFA ¹ 38.33 ± 0.33 ^a 41.04 ± 0.16 ^b 41.00 ± 0.19 ^b 40.60 ± 0.12 *** MUFA ² 56.50 ± 0.34 ^b 53.09 ± 0.16 ^a 52.74 ± 0.19 ^a 53.50 + - 0.13 *** M / S ³ 1.49 ± 0.02 ^b 1.30 ± 0.01 ^a 1.29 ± 0.01 ^a 1.33 ± 0.01 *** C14 index ⁴ 29.10 ± 0.85 ^b 24.71 ± 0.36 ^a 24.64 ± 0.44 ^a 25.37 ± 0.28 *** C16 index ⁵ 21.31 ± 0.34 ^b 20.23 ± 0.16 ^a 20.52 ± 0.20 ^a 20.50 + - 0.12 ** C18 index ⁶ 82.17 ± 0.28 ^b 80.61 ± 0.14 ^a 80.63 ± 0.18 ^a 80.85 + - 0.10 ***

SFA ¹ Saturated fatty acid, MUFA ² Monounsaturated fatty acid, M / S ³ Monounsaturated fatty acid / Saturated fatty acid, C14 index ⁴ [C14: 1 / (C14: 0 + C14: 1)] * 100, C16 index ⁵ [C16: 1 / (C16: 0 + C16: 1)] * 100, C18 index ⁶ [C18: 1 / (C18: 0 + C18: 1)] * 100, MS = Marbling score (1-9), ^{a, b, c, d, e} Means with different superscripts within the same column are significantly different (P <0.05), * p <0.05, ** p <0.01, *** p <0.001. ns = non-significant.

Stearic acid (C18: 0) and myristoleic acid (C14: 1) among the fatty acids were not found to be associated with SNPs in the FABP4 gene, and myristic acid (14: 0) and pals accounted for a high proportion of saturated fatty acids. Mytic acid (C16: 0) had the highest TT genotype. The total content of saturated fatty acids was also highest in the CT and TT genotypes (41.04% and 41.00%).

On the other hand, in the case of unsaturated fatty acids oleic acid (C18: 1) and monounsaturated fatty acids, 47.06% of CC genotypes were significantly higher than those of CT and TT genotypes (p <0.05). Content, which is the opposite of the trend of saturated fatty acids. In addition, the content of oleic acid (C18: 1), which is an unsaturated fatty acid, generally occupies most of the total content of unsaturated fatty acid (over 80%), so that the SNP genotype oleic acid (C18: 1) showed the same tendency as the monounsaturated fatty acid content.

The values of M / S representing monounsaturated fatty acid ratios and the C14 index and C18 index representing unsaturated fatty acid ratios of myristic oleic acid (C14: 1) and oleic acid (C18: 1) are also high in CC genotypes. From the formed point, the same result as that of the previous oleic acid (C18: 1) and monounsaturated fatty acid was obtained.

In addition, as a result of analyzing the relationship between economic traits and genes, the results were found to have a high correlation with intramuscular fat and back fat thickness. As with the fatty acid results, individuals with the CC genotype showed significantly better intramuscular fat scores than other genotype groups, and showed low fat formation even in the backfat thickness.

< Example  3> g.3977-325 T> C SNP Distribution table at

An analysis was conducted to investigate the association between beef grade and unsaturated fatty acids in Korean cattle.

As shown in Table 4, both oleic acid (C18: 1) and monounsaturated fatty acid contents were significantly higher as the meat grade of Hanwoo was higher. Therefore, the unsaturated fatty acid content of Hanwoo beef showed a high correlation with intramuscular fat scores. .

Beef grade Fatty acid 1 ⁺⁺ 1 ⁺ One 2 LSMEAN ± SE LSMEAN ± SE LSMEAN ± SE LSMEAN ± SE Oleic acid 45.90 ± 0.31 ^d 44.60 ± 0.17 ^c 43.89 ± 0.19 ^b 42.89 ± 0.26 ^a MUFA * 55.17 ± 0.34 ^d 53.97 ± 0.19 ^c 52.99 ± 0.22 ^b 51.82 ± 0.27 ^a

SNP Genotype Beef grade 1 ⁺⁺ 1 ⁺ One 2 1 ⁺ above g.3977-325 T> C
Genotype CC Marisu
ratio 21 43 12 4 64 26.30% 53.80% 15.00% 5.00% 80.10%

As a result of confirming the distribution according to the grades according to Tables 4 and 5, it was confirmed that the higher grade ¹⁺ grade ratio in the CC genotype group was 80.10%.

<110> Yeungnam University Industry Academic Cooperation <120> Single Nucleotide Polymorphism Marker for Diagnosis of Economic          traits in Cattle and Method of Diagnosing Economic traits in          Cattle Using the Same Marker <130> DP-2011-0661 <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 634 <212> DNA <213> g.3977-325 T> C SNP in Korean Native Cattle <400> 1 cactctattt tttttccctc catcattgta atcactttta attatcccca cagagcatcg 60 taaacttaga tgaaggtgct ctggtacaag tacaaaactg ggatggaaaa tcaaccacca 120 taaagagaaa actcgtggat gataagatgg tgctggtgag tatcttctca ctacttaatt 180 ctagatttta gtgctaggtc atcccataat tgttatccta cctagagaaa tagacaatcg 240 cccttgtaga atgaaaagtt agtctattgg gattatggtt tcactctgac aattatcctt 300 ctaagctccg tctaggtata ctgtgccccc agcagtattt tcttatccct ctcaatgtga 360 accgtattgt attgtgcatt tctaattatg tttttcactc accacataga tggtaagatt 420 ycttgaggcc aagtcttgta tcttcttgat ctttgtgtct ccctagttta ttacaatatc 480 aggtatataa gaagagccaa gagggaatat cttttgatga acattttttc ctgctcaaca 540 ttgaaggaga caataaataa ataaaacata agttgtttag tcctgaggat tttaccaata 600 ttttgctttt gtgcctagga atgtgtcatg aatg 634 <210> 2 <211> 25 <212> DNA <213> Foward primer sequence for g.3977-325 T> C SNP <400> 2 tttccctcca tcattgtaat cactt 25 <210> 3 <211> 22 <212> DNA <213> Reverse primer sequence for g.3977-325 T> C SNP <400> 3 cacattccta ggcacaaaag ca 22 <210> 4 <211> 20 <212> DNA <213> Extension primer sequence for g.3977-325 T> C SNP <400> 4 cttgaggcca agtcttgtat 20

Claims (9)

A small economic diagnostic polymorphism (SNP) marker consisting of a polynucleotide comprising the 421 nucleotide of SEQ ID NO: 1 or a complementary polynucleotide thereof. The polymorphism (SNP) marker of claim 1, wherein the economic trait is one or more traits selected from the group consisting of intramuscular fatness, backfat thickness, carcass weight, and content of unsaturated fatty acids. The polymorphism (SNP) marker of claim 1, wherein the cow is Hanwoo. The polymorphism (SNP) marker of claim 1, wherein the genotype of the 421th nucleotide of SEQ ID NO: 1 is CC. Identifying the genotype of the 421 th nucleotide of SEQ ID NO: 1; comprising a small economic trait. 6. The method of claim 5,
(1) obtaining a DNA sample from an individual; And
(2) PCR is performed using the DNA obtained from step (1) as a template, including one or more primers selected from the group consisting of SEQ ID NOs: 2 to 4, and the 421th nucleotide of SEQ ID NO: 1 from the PCR result. Identifying a genotype;
Method of diagnosis of small economic traits comprising a. The method according to claim 5 or 6,
The bovine economic morphology is a genotype of the 421th nucleotide of SEQ ID NO: 1 TT genotype <CT genotype <CC genotype in order to diagnose a bovine economic quality excellent cow, diagnostic method of bovine economic traits. A small economic diagnosis kit comprising a primer capable of amplifying a polynucleotide or a complementary polynucleotide thereof comprising the 421 th nucleotide of SEQ ID NO: 1. The method of claim 8,
The primer comprises one or more selected from the group consisting of SEQ ID NOs: 2 to 4, small economic diagnostic kit.

Images