KR20160056514A - Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) composition for F1 purity test in cabbage, which includes: at least one polynucleotide selected from polynucleotides composed of base sequences represented by sequence number 1 to 12 including a base at an SNP locus; and a polynucleotide complementary thereto. The present invention further relates to a primer set for amplifying the SNP polynucleotide. The use of the SNP of the present invention enables a test of purity of F1 in cabbage in a whole genomic level. Thus, more accurate and efficient outcome can be obtained.

Description

{Single nucleotide polymorphism marker set for F1 hybrid purity checking in Cabbage and uses thereof,

The present invention relates to a single base polymorphism marker set for F1 purity assay of cabbage and its use, and more particularly to a polynucleotide comprising a polynucleotide consisting of a nucleotide sequence of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) A SNP composition for F1 purity assay of cabbage comprising at least one polynucleotide selected from the group consisting of polynucleotides or complementary polynucleotides thereof, a microarray for F1 purity assay of cabbage comprising the SNP or cDNA thereof, genomic DNA from a cabbage sample, Determining the genotype of a polymorphic site that is a SNP locus, a F1 purity assay method of cabbage, a primer set for amplifying the SNP polynucleotide, and a F1 purity of cabbage, including the primer set and a reagent for performing an amplification reaction To a kit for assay.

Cabbage is a vegetable crop with an output of about 76 million tons and an economic value of $ 15 billion (2010). It is among the world's largest cultivated crops. Cabbage is a model crop of morphological research with morphologically diverse subspecies such as cabbage, kale, broccoli, cola bean, cauliflower (cauliflower). In particular, from a nutritional point of view, cabbage contains a large amount of protein, carotenoid as well as glucosinolate with anticancer effect. To further increase the economic value of these cabbages, breeders have been endeavoring to produce cabbages that are resistant to high yields, pest and environmental stresses, or contain many useful substances.

Generally, F1 produced through superior parent crossing has a high quality in terms of yield, resistance and homogeneity compared with the parent due to hybrid stress, and seeds obtained from F1 plants can not be reused. Therefore, It is also the direction of seed development around the world. F1 is developed and mass-produced for commercialization. At this time, the purity of the parent, the pollution of other pollen during the seeding, or the contamination due to the self-synthesis of the parent may occur, and the purity test of F1 is carried out after the final mass. In the F1 purity test, grow a certain number of F1 to see the uniformity of the phenotype or use a molecular marker. The discrimination method based on phenotype not only requires a lot of time and labor, but also has a disadvantage of poor reproducibility. Morphological discrimination does not reflect a clear genetic attribute, and early identification is impossible. Although some molecular markers are used to perform purity assays, the molecular markers are not a marker for purity testing of F1, but merely randomly select markers showing differences in parental status to perform purity assays, resulting in high time and economic losses , And because purity assays are performed on specific gene wisdoms, it is impossible to perform a test at the whole genome level.

In the present invention, a marker which can be widely used for assaying the purity of cabbage F1 was developed.

Korean Patent No. 0652501 discloses a method for assaying the purity of F-1 seeds of the melon family, and Korean Patent No. 1014238 discloses a method for assaying the watermelon F1 seed purity. However, There is no description of a single base polymorphism marker set and its use for the F1 purity assay.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-described needs, and the present inventors have discovered that a nucleotide sequence of 23 lines of cabbage can be used to identify a single nucleotide polymorphism (SNP) marker of a total genome level, The analysis was performed with SNP molecular markers showing polymorphism in more than 6 out of 23 lines in this section. Then, SNPs were selected for each chromosome, and each primer set was prepared. Genomic analysis was performed to select SNPs homozygous for both parents and F1 identified as heterozygous for each chromosome The present invention has been accomplished by developing a final set of 12 markers for F1 purity assay.

In order to solve the above-mentioned problems, the present invention provides a polynucleotide comprising at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) position base or a complementary polynucleotide thereof. SNP composition for F1 purity assay of cabbage.

The present invention also provides a microarray for F1 purity determination of cabbage comprising the SNP or cDNA thereof.

In addition, the present invention provides a F1 purity assay method of cabbage comprising a step of isolating genomic DNA from a cabbage sample and determining a genotype of a polymorphic site as a base of each SNP.

In addition, the present invention provides a primer set for amplifying a SNP polynucleotide comprising the nucleotide sequences of SEQ ID NOS: 1-12.

The present invention also provides a kit for F1 purity assay of cabbage comprising the primer set and a reagent for carrying out an amplification reaction.

The single nucleotide polymorphism (SNP) marker set according to the present invention is capable of screening contamination of the parent species due to self synthesis of the parent, especially the parent, as well as the F1 purity of cabbage, and the purity of F1 can be assayed at the entire genome level Therefore, it is possible to obtain more accurate and efficient results, so that it can be industrially useful.

1 is a schematic diagram of the SNP and InDel marker analysis process of the present invention.
FIG. 2 is a result of performing genotyping analysis using a set of F1 purity marker markers developed in the present invention, with 26 sets of 1 to 3 individuals, each of which developed a F1 breed and developed F1.

In order to accomplish the object of the present invention, the present invention includes at least one polynucleotide selected from polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 comprising a single nucleotide polymorphism (SNP) base or its complementary polynucleotide ≪ RTI ID = 0.0 > F1 < / RTI > purity assay for cabbage.

SEQ ID NOS: 1 to 12 are polynucleotides comprising the nucleotide sequence of each SNP site. SEQ ID NOS: 1 to 12 are polymorphic sequences comprising polymorphic sites. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a SNP in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

In the SNP composition according to an embodiment of the present invention, the SNP position base is 61st from SEQ ID NO: 1 to SEQ ID NO: 12, and the polymorphic base information is indicated by [/] in the SNP nucleotide sequence information of Table 3.

The polynucleotide of each single SNP constituting the SNP for F1 purity assay of cabbage according to the present invention is preferably at least 10 continuous bases, more preferably at least 15 continuous bases, even more preferably at least 20 consecutive bases Base, most preferably each sequence of SEQ ID NOS: 1-12.

The present invention also provides a microarray for F1 purity determination of cabbage comprising a polynucleotide of the SNP, a polypeptide encoded thereby, or cDNA thereof. Preferably, the polynucleotide may be immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde, but is not limited thereto. Preferably, the substrate may be a silicon wafer, glass, quartz, metal or plastic, but is not limited thereto. As a method for immobilizing the polynucleotide on a substrate, a micropipetting method using a piezo electric method, a method using a pin-type spotter can be used.

The microarray according to the present invention can be produced by a conventional method known to those skilled in the art using a polynucleotide according to the present invention or a complementary polynucleotide thereof, a polypeptide encoded thereby, or cDNA thereof.

The present invention also relates to

Isolating the genomic DNA from the cabbage sample; And

There is provided a F1 purity assay method of cabbage comprising the step of determining a genotype of a polymorphic site which is a base of each SNP (single nucleotide polymorphism) of a polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1 to 12 of the present invention.

In the method of the present invention, a method of isolating genomic DNA from a cabbage sample can be performed by a conventional method known in the art. For example, DNA can be directly purified from tissues or cells or amplified by specific amplification of specific regions using amplification methods such as PCR and separation thereof. In the present invention, DNA includes not only DNA but also cDNA synthesized from mRNA. For example, PCR amplification, LCR, transcription amplification, self-sustained sequence replication and nucleic acid-based sequence amplification (NASBA) can be used to obtain the nucleic acid from the subject, But is not limited to.

Determination of the base sequence of the isolated DNA can be performed by various methods known in the art. For example, a probe comprising a sequence at the SNP site or a complementary probe thereof is hybridized with the DNA, and the degree of hybridization obtained is determined through determination of the nucleotide sequence of the direct nucleic acid by the dideoxy method, A method for determining the nucleotide sequence, and the like can be used, but the present invention is not limited thereto. The degree of hybridization can be determined, for example, by marking a detectable label on the target DNA and specifically detecting only the hybridized target DNA, and other electrical signal detection methods can be used, but the present invention is not limited thereto. The F1 purity assay method of cabbage according to the present invention is preferably a method in which a nucleic acid sample isolated from the cabbage sample is hybridized with a polynucleotide comprising the SNP according to the present invention or a complementary polynucleotide thereof or a polynucleotide hybridizing therewith And detecting the result of post-hybridization.

The present invention also provides a primer set for amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 of the present invention.

The primer set of the present invention comprises at least one set of primers selected from the group consisting of a total of 12 sets of oligonucleotide primers of SEQ ID NOS: 13 to 60, each set of ASP1, ASP2, LSP and STA SEQ ID NOS: 13 to 16 are sets of primers for amplifying the SNP polynucleotides of SEQ ID NO: 1, SEQ ID NOs: 17 to 20 are amplified by the amplification of the SNP polynucleotides of SEQ ID NO: 2, SEQ ID NOs: 53 to 56 are primer sets for amplifying the SNP polynucleotide of SEQ ID NO: 11, and SEQ ID NOs: 57 to 60 are primer sets for amplifying the SNP polynucleotide of SEQ ID NO: 12. The SNP type assay specific target amplification primer (STA) and the LSP (SNPtype assay locus specific primer) of the present invention are primer sets used for amplification of target sequence (Table 3). LSP and ASP (SNPtype assay allele specific primer) Location A primer set used to identify bases. ASP 3 of the ASP primer The final base represents the SNP locus, ASP1 of the present invention is the primer for the TO1000 reference sequence and ASP2 is the primer for the genomic sequence of the other varieties (Table 4).

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

The present invention also provides a kit for F1 purity assay of cabbage comprising a primer set of the present invention and a reagent for carrying out an amplification reaction. In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating the genomic DNA from the cabbage sample;

Amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 of the present invention by using the separated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of the present invention ; And

And detecting the amplification product. ≪ Desc / Clms Page number 2 >

In the method of the present invention, the method of isolating the genomic DNA from the cabbage sample can be performed by a conventional method known in the art, and the method is as described above. The target sequence may be amplified by performing amplification reaction using the separated cabbage genomic DNA as a template and using one or more sets of oligonucleotide primers according to one embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

In the method of the present invention, a method for F1 purity assay of cabbage comprises the step of detecting the amplification product, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, radioactivity measurement, But is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Experimental material

The names and sources of the 23 cabbages collected at home and abroad are shown in Table 1 below.

Sample number System name Provided company / source K0001 # 107-HO-154 Asian seedlings K0002 # 5-KK-146 Asian seedlings K0003 # 105-RK-P6-1 Asian seedlings K0004 # 106-HY-164 Asian seedlings K0005 # 108-EB-858-7 Asian seedlings K0006 # 10-JK-JK-2 Asian seedlings K0007 # 14-KR, 518 Asian seedlings K0008 # 15-OK, 517 Asian seedlings K0009 # 17-JK, JK-2 Asian seedlings K0010 # 103-MT-621 Asian seedlings K0011 LN-748-4 Nunem seedlings K0012 100587 Samsung seedling K0013 FA-747-1 Nunem seedlings K0014 # 701, CT-12 female Asian seedlings K0015 107140 Samsung seedling K0016 # 7, HRIGRU009386 HRI, United Kingdom K0017 102119 Samsung seedling K0018 # 111-DS-2437-51 Asian seedlings K0019 # 112-QT-DWB-25 Asian seedlings K0020 # 116-PH-347-51 Asian seedlings K0021 Badger Inbred 16 HRI, United Kingdom K0022 HRIGRU007826 HRI, United Kingdom K0023 HRIGRU009617 HRI, United Kingdom

SNP Marker  Screening and genotyping

Based on the 23 lines of cabbages collected at home and abroad, we have produced NGS leads of 10X or more. The produced leads were mapped using a Burrows-Wheeler Alignment tool (BWA) to a 446 Mb cabbage reference sequence (TO1000) after removing low quality sequences. Mapped leads can be duplicated masking using the genomic analysis tool GATK (http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit) to increase the accuracy of SNP calling, After performing the local realignment process, we used UnifiedGenotyper to predict SNP (Single Nucleotide Polymorphism) and InDel (Insertion-Deletion). The SNP / InDel matrix was generated by merging the SNP / InDel of 23 lines based on the loci of the chromosomes. Then, SNP / InDel matrix was generated, and SNPs or InDels appeared at 60 bp adjacent to the locus of each SNP Respectively. As a result, SNP markers were selected as targets for SNP markers in the vicinity of 60 bp, and Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/input.htm) Was produced. Then, considering the characteristics of the mesohexaploid genome, the generated primer was mapped again to the TO1000 region to evaluate whether the primer only amplified in a single position, and then a hyper-variable region (HVR) was extracted using only a single base left mapping region. From this, 96 SNP markers were selected in 2-5 Mb units. A set of primers capable of genotyping each SNP was constructed, and a total of 26 sets of genotypes were analyzed using a set of F1s developed from parents and their parents. Genotype analysis of each SNP was performed using the Fluidigm platform. Among these genotyping results, SNPs that are homozygous and heterogygous in F1 are selected from 1-2 sets of each chromosome, and 12 SNP loci and A primer set (Fluidigm platform) capable of genotyping was developed as a cabbage F1 purity black marker set.

Example 1. SNP statistics

Mapping of high quality read of 23 lines of cabbage has resulted in more than 82% mapping to the TO1000 reference sequence. Based on the mapped leads, the SNP results are shown in Table 2, with an average of 4,216,350 SNPs and 437,484 InDels predicted. Based on the predicted SNP / InDel, SNP / InDel matrix was constructed based on the chromosomal location. As a result, SNP or InDel mutations were found in a total of 21,587,643 loci. As a result of priming with SNP without sequence mutation in the adjacent 60 bp sequence, 121,909 SNP marker candidates were generated, and 101,639 SNP markers were predicted to be single position amplification.

Example 2. Selection of SNP markers

Two-sided hypergeometric tests were performed using the frequency of SNPs in the 100K range based on the SNP information of each lineage to select regions where the sequence variation occurs frequently in the cabbage genome. As a result, a region with a significance (p-value) of 0.001 or less was defined as a hypervariable region (HVR) in each system, and a region in which the HVR was present in seven or more systems was defined as cHVR (common HVR region). Thus, after parsing the SNP markers in the cHVR region, only SNP markers showing SNP polymorphism in more than 4 lines in 23 lines of cabbage were selected at intervals of 2-5Mb. The genotype analysis of 96 SNP markers was then confirmed by Fluidigm to create a set of SNP markers for 12 purity assays (Table 3).

12 SNP nucleotide sequences for F1 purity assay SNP name Sequence information (5 '- > 3') (SEQ ID NO: S1 ATTTTTTTTTATGTTTGGTTGTTTAAAGATCTTTATGCAAACCTCGAGGCTCAAAAAAT [G / T] TCCTCTCTTTAGTTAGGATGATTGAAACTTACCTCCTCTATGGCTATTGCAACCTAATTC (1) S2 TGTTGCTGTAGATGATCTTTCTGTGTGCTGCTTATGTCAAGATAGGAATTTTAAGGTGGT [T / C] GAAAGATGATCTTACCATGTGCAGTGTTGTTTTGTTTTCAATAGGTCAGAGCATTATGCG (2) S3 AGGAGGAGAGAGATGCATTAAGATCGACTGGTGGACGACTAATGTATTTGTAATTGTGAGAA [G / C] TATAACGGATGGCTTATACGCTTTGAACATCGTGCTTCAGGTGTGTTACCTTTTGCTTTC (3) S4 AGCAGAGAAACATGTCCTAAGCTCCTTGATTTGATTCCTCAAGAAAGAAAATGGTACCAT [G / A] ATGAAGAGAAGAACAACTCAGATCAAGAAAAAAACTTGAGCTAAGGCTTGCACCACCCG (4) S5 ATTACAACCAGATTGCTCAGGTTTGTGTTGTACACTCATCTCCAAGTTGTATCAAAGGTC [G / T] CTAATACAGAACTTCCGTTTGCCAGCCTAATCTGATTGTTAACGTTGCTTCTCTAAATTT (5) S6 ATTAATTAGGAGGGATTCGTATGGAAGGTATGTCCAGATTTATTCCAGAACAGTACATTC [T / C] GATTTTTCAGTTTAGCTTCTACTTATTTTGGCAGCTTTATGCAAAACCAATAACGTAATT (6) S7 TATTTTATTCAGATTAGAACAAAACTTTATATTCGTATCCAAAAATGGCGAAGAAGATAA [T / C] ATTTTCCATCATTTTTGTCGTTGACCCGATTCTTCACACATGGTTGAACATCTTCTGTAT (7) S8 TCAACGGAAAAAGGAAGATTTAAAATAATTAAAACCGAAAAAGATACGAGGAGGAAGAGC [A / T] GAGTTTTAGTTCATTAGTGGTGGGGACTTACGGAGTAATAAGGTGCGGCGGCGACGACAC (8) S9 TAACTTTAATCCAGACCAAAATGAATATTCGTCTCTATCCAATCCGTGCTCGCCGTTCTT [T / G] TCACGCGCCAAGATAATTACCGCCGACACGCAGTTTACTTCGTTATAGCTACGCCGGCAC (9) S10 ATCCTTGCGTCCTCATCTTTGCTGGAAGTTACAAACCGACGGCACGGGTAGGTAAGGTGG [A / G] CAGGCTCCCACGAGATGCTAGTAATCCATTTCTTGTGGCCTCTAAGGGGGCTGCCATCTA (10) S11 CTGTTCAAACGGGAAACACCTAATGGTCGCACCAGTTTCCTCCTTTACCCTTTGCTCATC [T / A] GAGTCACTGGCTGACCATGGACCTCTTGCCCATTTCCCTGAAGAAATCGCAGCTTTGAGC (11) S12 AAATTATTTTGCATGTTAGAGACAATCCAAAATGCAAATCCTCTCCGTATTGGCTAAGTT [T / C] ATCATCTAATGCACCCGTTTAGTTATTTTATACCAATCAGTGTCAAGTTTGGTGTAAAAA (12)

* [TO1000 sequence / other sequence]

Primer sequence information for SNP confirmation Amplification target ASP1 (SEQ ID NO) ASP2 (SEQ ID NO) LSP (SEQ ID NO) STA (SEQ ID NO) S1 AGTTTCAATCATCCTAACTAAAGAGAGGAC (13) AAGTTTCAATCATCCTAACTAAAGAGAGGAA (14) GCAAACCCTCGAGGCTCAAA (15) AGCCATAGAGGAGGTAAGTTTCAAT (16) S2 ACTGCACATGGTAAGATCATCTTTCA (17) CTGCACATGGTAAGATCATCTTTCG (18) TGTGTGCTGCTTATGTCAAGATAGGA (19) ACCTATTGAAAACAAAACAACACTGC (20) S3 CAAAGCGTATAAGCCATCCGTTATAC (21) TCAAAGCGTATAAGCCATCCGTTATAG (22) GATCGACTGGTGGACGACTAATGT (23) ACCTGAAGCACGATGTTCAAAG (24) S4 GATTCCTCAAGAAAGAAAATGGTACCATG (25) TGATTCCTCAAGAAAGAAAATGGTACCATA (26) TCTTTTCTTGATCTGAGTTGTTCTTCTCTTCA (27) CCTAAGCTCCTTGATTTGATTCCTC (28) S5 TCATCTCCAAGTTGTATCAAAGGTCG (29) TCATCTCCAAGTTGTATCAAAGGTCT (30) GGCTGGCAAACGGAAGTTCT (31) TCAGGTTTGTGTTGTACACTCATC (32) S6 TCCAGATTTATTCCAGAACAGTACATTCT (33) CCAGATTTATTCCAGAACAGTACATTCC (34) GCTGCCAAAATAAGTAGAAGCTAAACTGAA (35) TCGTATGGAAGGTATGTCCAGATT (36) S7 GGGTCAACGACAAAAATGATGGAAAATA (37) GGTCAACGACAAAAATGATGGAAAATG (38) CTTTATATTCGTATCCAAAAATGGCGAAGAAGA (39) CATGTGTGAAGAATCGGGTCAA (40) S8 CCCCACCACTAATGAACTAAAACTCT (41) CCCCACCACTAATGAACTAAAACTCA (42) AAAACCGAAAAAGATACGAGGAGGAAGA (43) CCTTATTACTCCGTAAGTCCCCA (44) S9 GGTAATTATCTTGGCGCGTGAA (45) GGTAATTATCTTGGCGCGTGAC (46) CAATCCGTGCTCGCCGT (47) CTGCGTGTCGGCGGT (48) S10 CATCTCGTGGGAGCCTGT (49) ATCTCGTGGGAGCCTGC (50) AACCGACGGCACGGGTA (51) GAGGCCACAAGAAATGGATTACTAG (52) S11 CCTCCTTTACCCTTTGCTCATCT (53) CCTCCTTTACCCTTTGCTCATCA (54) AGAGGTCCATGGTCAGCCAG (55) CTAATGGTCGCACCAGTTTCC (56) S12 AATCCTCTCCGTATTGGCTAAGTTT (57) AATCCTCTCCGTATTGGCTAAGTTC (58) CACTGATTGGTATAAAATAACTAAACGGGTGC (59) AGAGACAATCCAAAATGCAAATCCT (60)

Example 3. Genetic analysis of F1 breed and parent species using the developed marker set

The genotypes of the 12 loci of the markers developed in the present invention were analyzed by using 26 sets of the parent species and the F1 varieties developed therefrom. As a result, all twelve marker genes were homozygously detected in 26 sets of copies. This implies that the genetic stigma of the developed marker is a stable location in fixed species (native species or parent species) used for breed development and is a useful location for purity testing in F1. In addition, as a result of 26 sets of genotype analysis, it was found that 1-12 markers were polymorphic between the parents of each set (FIG. 2, blue) and could be used for F1 purity assay. Among the sets using more than two F1s, 3, 5, and 9 sets were different in the genotypes of the F1 individuals, and this was interpreted as a result of insufficient fixation of the parents of the parent species and contamination of the pollen during the cultivation , And thus other genotypes between F1 individuals will be detected and purity can be verified.

When using the marker set of the present invention, it is possible to produce economical and temporal efficiency by examining only 12 markers instead of examining hundreds of random markers for the purity test of the developed F1. It is also possible to set markers for each chromosome , Which allows genotype analysis to be performed at the level of the entire genome, thereby solving the problem of obtaining inaccurate purity results of a biased locus. The set of F1 purity marker markers developed in the present invention can select the contamination of the parent species due to the self-synthesis of the parent, especially the parent, as well as the F1 purity test. The purity of F1 can be assayed at the entire genome level, And it is possible to obtain efficient results, and not only cabbage but also broader cabbage ( Brassica oleracea ) can be applied.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Single nucleotide polymorphism marker set for F1 hybrid purity          checking in Cabbage and uses thereof <130> PN14310 <160> 60 <170> Kopatentin 2.0 <210> 1 <211> 121 <212> DNA <213> Brassica oleracea <400> 1 attttttttt atgtttggtt gtttaaagat ctttatgcaa accctcgagg ctcaaaaaat 60 ttcctctctt tagttaggat gattgaaact tacctcctct atggctattg caacctaatt 120 c 121 <210> 2 <211> 121 <212> DNA <213> Brassica oleracea <400> 2 tgttgctgta gatgatcttt ctgtgtgctg cttatgtcaa gataggaatt ttaaggtggt 60 cgaaagatga tcttaccatg tgcagtgttg ttttgttttc aataggtcag agcattatgc 120 g 121 <210> 3 <211> 121 <212> DNA <213> Brassica oleracea <400> 3 aggaggagag atgcattaag atcgactggt ggacgactaa tgtatttgta attgtgagaa 60 ctataacgga tggcttatac gctttgaaca tcgtgcttca ggtgtgttac cttttgcttt 120 c 121 <210> 4 <211> 121 <212> DNA <213> Brassica oleracea <400> 4 agcagagaaa catgtcctaa gctccttgat ttgattcctc aagaaagaaa atggtaccat 60 aatgaagaga agaacaactc agatcaagaa aagaaacttg agctaaggct tgcaccaccc 120 g 121 <210> 5 <211> 121 <212> DNA <213> Brassica oleracea <400> 5 attacaacca gattgctcag gtttgtgttg tacactcatc tccaagttgt atcaaaggtc 60 tctaatacag aacttccgtt tgccagccta atctgattgt taacgttgct tctctaaatt 120 t 121 <210> 6 <211> 121 <212> DNA <213> Brassica oleracea <400> 6 attaattagg agggattcgt atggaaggta tgtccagatt tattccagaa cagtacattc 60 cgatttttca gtttagcttc tacttatttt ggcagcttta tgcaaaacca ataacgtaat 120 t 121 <210> 7 <211> 121 <212> DNA <213> Brassica oleracea <400> 7 tattttattc agattagaac aaaactttat attcgtatcc aaaaatggcg aagaagataa 60 cattttccat catttttgtc gttgacccga ttcttcacac atggttgaac atcttctgta 120 t 121 <210> 8 <211> 121 <212> DNA <213> Brassica oleracea <400> 8 tcaacggaaa aaggaagatt taaaataatt aaaaccgaaa aagatacgag gaggaagagc 60 tgagttttag ttcattagtg gtggggactt acggagtaat aaggtgcggc ggcgacgaca 120 c 121 <210> 9 <211> 121 <212> DNA <213> Brassica oleracea <400> 9 taactttaat ccagaccaaa atgaatattc gtctctatcc aatccgtgct cgccgttctt 60 gtcacgcgcc aagataatta ccgccgacac gcagtttact tcgttatagc tacgccggca 120 c 121 <210> 10 <211> 121 <212> DNA <213> Brassica oleracea <400> 10 atccttgcgt cctcatcttt gctggaagtt acaaaccgac ggcacgggta ggtaaggtgg 60 gcaggctccc acgagatgct agtaatccat ttcttgtggc ctctaagggg gctgccatct 120 a 121 <210> 11 <211> 121 <212> DNA <213> Brassica oleracea <400> 11 ctgttcaaac gggaaacacc taatggtcgc accagtttcc tcctttaccc tttgctcatc 60 agagtcactg gctgaccatg gacctcttgc ccatttccct gaagaaatcg cagctttgag 120 c 121 <210> 12 <211> 121 <212> DNA <213> Brassica oleracea <400> 12 aaattatttt gcatgttaga gacaatccaa aatgcaaatc ctctccgtat tggctaagtt 60 catcatctaa tgcacccgtt tagttatttt ataccaatca gtgtcaagtt tggtgtaaaa 120 a 121 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agtttcaatc atcctaacta aagagaggac 30 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aagtttcaat catcctaact aaagagagga a 31 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gcaaaccctc gaggctcaaa 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 agccatagag gaggtaagtt tcaat 25 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 actgcacatg gtaagatcat ctttca 26 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ctgcacatgg taagatcatc tttcg 25 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgtgtgctgc ttatgtcaag atagga 26 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acctattgaa aacaaaacaa cactgc 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 caaagcgtat aagccatccg ttatac 26 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcaaagcgta taagccatcc gttatag 27 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gatcgactgg tggacgacta atgt 24 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 acctgaagca cgatgttcaa ag 22 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gattcctcaa gaaagaaaat ggtaccatg 29 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tgattcctca agaaagaaaa tggtaccata 30 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tcttttcttg atctgagttg ttcttctctt ca 32 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cctaagctcc ttgatttgat tcctc 25 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tcatctccaa gttgtatcaa aggtcg 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tcatctccaa gttgtatcaa aggtct 26 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ggctggcaaa cggaagttct 20 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tcaggtttgt gttgtacact catc 24 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 tccagattta ttccagaaca gtacattct 29 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ccagatttat tccagaacag tacattcc 28 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gctgccaaaa taagtagaag ctaaactgaa 30 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tcgtatggaa ggtatgtcca gatt 24 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 gggtcaacga caaaaatgat ggaaaata 28 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ggtcaacgac aaaaatgatg gaaaatg 27 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ctttatattc gtatccaaaa atggcgaaga aga 33 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 catgtgtgaa gaatcgggtc aa 22 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ccccaccact aatgaactaa aactct 26 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ccccaccact aatgaactaa aactca 26 <210> 43 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 aaaaccgaaa aagatacgag gaggaaga 28 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ccttattact ccgtaagtcc cca 23 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ggtaattatc ttggcgcgtg aa 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ggtaattatc ttggcgcgtg ac 22 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 caatccgtgc tcgccgt 17 <210> 48 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 ctgcgtgtcg gcggt 15 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 catctcgtgg gagcctgt 18 <210> 50 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 atctcgtggg agcctgc 17 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 aaccgacggc acgggta 17 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 gaggccacaa gaaatggatt actag 25 <210> 53 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 cctcctttac cctttgctca tct 23 <210> 54 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cctcctttac cctttgctca tca 23 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 agaggtccat ggtcagccag 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 ctaatggtcg caccagtttc c 21 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 aatcctctcc gtattggcta agttt 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 aatcctctcc gtattggcta agttc 25 <210> 59 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 cactgattgg tataaaataa ctaaacgggt gc 32 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 agagacaatc caaaatgcaa atcct 25

Claims (10)

A polynucleotide consisting of a nucleotide sequence of SEQ ID NOS: 1 to 12, wherein the polynucleotide is a polynucleotide consisting of 10 or more consecutive bases including a single nucleotide polymorphism (SNP) position (each 61st position from SEQ ID NO: 1 to SEQ ID NO: 12) Wherein the SNP composition comprises at least one polynucleotide selected from SEQ ID NO: 1 or SEQ ID NO: 2, or a complementary polynucleotide thereof. A microarray for F1 purity assay of cabbage comprising polynucleotide of SNP (single nucleotide polymorphism) according to claim 1 or cDNA thereof. 3. The microarray for F1 purity determination of cabbage according to claim 2, wherein the polynucleotide is immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde. Isolating the genomic DNA from the cabbage sample; And
A method for determining purity of F1 of a cabbage comprising determining the genotype of a polymorphic site which is a single nucleotide polymorphism (SNP) locus of a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to 12 according to claim 1. A primer set for amplifying a single nucleotide polymorphism (SNP) polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 to 12 according to claim 1. 7. The primer set of claim 5, wherein the set of primers is selected from the group consisting of 12 sets of oligonucleotide primers of SEQ ID NOS: 13 to 60, &Lt; / RTI &gt; wherein the oligonucleotides comprise one primer set. A kit for F1 purity assay of cabbage, comprising the oligonucleotide primer set of claim 5 or 6 and a reagent for carrying out an amplification reaction. 8. The kit according to claim 7, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Isolating the genomic DNA from the cabbage sample;
The isolated genomic DNA is used as a template and an amplification reaction is performed using the oligonucleotide primer set of claim 5 or 6 to obtain a single nucleotide polymorphism (SNP) comprising the nucleotide sequence of SEQ ID NOS: Amplifying the polynucleotide; And
And detecting the amplification product. 10. The method according to claim 9, wherein the detection of the amplification product is performed by sequencing, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images